Biomarkers and uses in the treatment of viral infection, inflammation or cancer

Abstract

To provide biomarkers and methods of using the biomarkers in the monitoring, evaluation and / or treatment of viral infections, or inflammatory diseases, disorders or conditions, or cancer.SOLUTION: To provide a splicing variant lncRNA0599 - 124 at a miR - 205 - 1 locus for use as a biomarker for inflammatory disease, disorders or conditions, or cancers, or as a biomarker for effectiveness of curative treatment of inflammatory disease, disorders or conditions, or cancers.SELECTED DRAWING: None

Description

[Background Technology]

[0001] The quinoline derivative 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinolin-2-amine (also known as "ABX464") binds to the cap-binding complex (CBC), a complex at the 5' end of pre-mRNA transcripts that facilitates early interactions with the transcription and processing machinery. The CBC recruits several factors to m7G-modified transcripts to mediate processing events and is required for efficient cellular and viral pre-mRNA splicing. Interaction of the CBC with U1 snRNP at the 5' splice site of the first intron of the transcript and its direct interaction with proteins of the U4 / U5 / U6 particle promote the formation of spliced ​​mRNA. Although the CBC is not essential for viability in either yeast or humans, its deletion results in a reduction in the recruitment of several splicing factors to nascent transcripts and inhibits cotranscriptional spliceosome assembly. The CBC complex has also been shown to affect microRNA (miRNA) biogenesis. miRNAs are transcribed by RNA pol II as primary (pri)-miRNAs that retain an m7G cap. During nuclear and cytoplasmic processing events, the pri-miRNA loses the m7G cap, and the mature 21- to 23-nucleotide-long miRNA is incorporated into the RNA-induced silencing complex (RISC) to guide RNA silencing. Because the majority of miRNA genes are located in introns, the CBC complex may be involved in the interaction between the processing of intronic pre-miRNAs and pre-mRNAs, inhibiting viral replication by affecting viral RNA biogenesis; however, cellular viral RNA biogenesis has not been analyzed in detail. ABX464 likely only affects viral replication once proviral DNA is integrated into cellular DNA.This is important because once integrated into infected cells, the viral genome requires both activation and inhibition of precursor mRNA splicing. Successful infection and production of new infectious HIV particles require balanced expression of seven viral proteins (Rev, Tat, Nef, Vif, Vpr, Vpu, and Env) produced by splicing of the 9-kilobase (kb) HIV-1 primary transcript; among these, Tat and Rev factors are essential for viral gene expression at the transcriptional and posttranscriptional levels in infected cells. The HIV-1 primary transcript functions not only as the genomic RNA for progeny viruses but also as the mRNA encoding the viral Gag and Gag-Pol proteins. While most unspliced ​​cellular RNAs are retained in the nucleus, where they are degraded, nuclear export of unspliced ​​viral RNAs is facilitated by the Rev protein through binding to the Rev-responsive element (RRE) and interaction with the CRM1-dependent export machinery. Therefore, inefficient alternative splicing is required to maintain the balance between HIV gene expression and virus production. This balance is thought to be mediated by the presence of suboptimal viral 5' and 3' splice sites (5' and 3' ss), which are positively regulated by HIV long terminal repeats (LTRs) and their recognition by regulatory sequences and cognate trans-acting cellular factors. ABX464 has been shown to prevent Rev-mediated export of unspliced ​​RNA by binding to the CBC complex. However, the underlying mechanisms behind the modulation of viral and cellular splicing and / or miRNA biogenesis by ABX464 binding to the CBC are currently unknown.

[0002] ABX464 has demonstrated potent anti-inflammatory effects in the DSS model of inflammatory bowel disease (IBD) and is effective in preventing HIV viral replication. ABX464 has also demonstrated safety and efficacy in a phase 2a proof-of-concept clinical trial in patients with ulcerative colitis. However, the effects of ABX464 on viral and cellular RNA biogenesis have not been quantified. Summary of the Invention [Problem to be solved by the invention]

[0003] It has now been found that ABX464 alters viral RNA splicing, but not cellular splicing, and induces splicing of long non-coding RNA at the miR-124 locus, resulting in upregulation of the anti-inflammatory miR124. "miR-124 locus" refers to any one of the miR-124 loci, including the miR-124-1 locus, the miR-124-2 locus, and the miR-124-3 locus. Thus, the methods and uses disclosed herein involving miR-124 or one of its loci as a biomarker can also be or be applied to any one of the specific loci known to those skilled in the art. [Means for solving the problem]

[0004] Thus, in one aspect, the present invention provides in vitro or ex vivo methods of using spliced ​​viral RNA variants as biomarkers for viral infection or for therapeutic treatment of such viral infection. In some embodiments, the present invention provides methods of using spliced ​​viral RNA variants as biomarkers for viral infection or for therapeutic treatment of such viral infection, comprising measuring the presence or expression level of the spliced ​​viral RNA variant in a biological sample. In some embodiments, treating a viral infection comprises administering a compound described herein or a pharmaceutically acceptable salt thereof.

[0005] In another aspect, the present invention provides in vitro or ex vivo uses of long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for an inflammatory disease, disorder, or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for the inflammatory disease, disorder, or condition, or cancer. In some embodiments, the present invention provides methods for using long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for an inflammatory disease, disorder, or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for the inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of long non-coding RNA spliced ​​at the miR-124 locus in a biological sample. In some embodiments, treating an inflammatory disease, disorder, or condition, or cancer comprises administering a compound or a pharmaceutically acceptable salt thereof, as described herein.

[0006] In one aspect, the present invention relates to the in vitro or ex vivo use of the HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection or as a biomarker for the effectiveness of therapeutic treatment of HIV infection.

[0007] In one aspect, the present invention relates to the in vitro or ex vivo use of the HIV splice variant of SEQ. ID. No. 1 as a biomarker for assessing the biological effect of compounds for the treatment of HIV infection.

[0008] In one aspect, the present invention relates to the in vitro or ex vivo use of the HIV splice variant of SEQ. ID. No. 1 as a biomarker for screening compounds or vaccines in preventing and / or treating HIV infection.

[0009] In one aspect, the present invention relates to the in vitro or ex vivo use of splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

[0010] In one aspect, the present invention relates to the in vitro or ex vivo use of splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for assessing the biological efficacy of compounds or medical devices in treating inflammatory diseases, disorders or conditions, or cancer.

[0011] In one aspect, the present invention relates to the in vitro or ex vivo use of splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for selecting patients for therapeutic treatment of inflammatory diseases, disorders or conditions, or cancer.

[0012] In one aspect, the invention relates to the in vitro or ex vivo use of miR-124 as a biomarker for an inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment.

[0013] In one aspect, the present invention relates to the in vitro or ex vivo use of miR-124 as a biomarker for selecting patients for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

[0014] In one aspect of the in vitro or ex vivo uses defined above, the therapeutic treatment comprises the administration of a compound of Formula I, Formula Ia, Formula Ib, Formula Ib', Formula Ic, Formula Id, or Formula IV, Formula IVa, Formula IVb, Formula IVb', Formula IVc, Formula IVd, Formula IV, e.g., ABX464, or a pharmaceutically acceptable salt thereof.

[0015] In one aspect of the in vitro or ex vivo uses defined above, the compound is a compound of Formula I, Formula Ia, Formula Ib, Formula Ib', Formula Ic, Formula Id, or IV, Formula IVa, Formula IVb, Formula IVb', Formula IVc, Formula IV, e.g., ABX464, or a pharmaceutically acceptable salt thereof.

[0016] In one aspect of the in vitro or ex vivo uses defined above, the measured level of expression in a biological sample of the HIV splice variant of SEQ.ID.No.1, the splice variant lncRNA 0599-205 at the miR-124-1 locus, or the miR-124 is compared to a control reference value. [Brief explanation of the drawings]

[0017] [Figure 1A] Figure 1 shows the analysis of HIV splicing after ABX464 treatment. Figure 1A. The HIV-1 genome and the composition of various mRNA splicing products. The 5's (D1-D4) and 3's (A1-A7) sequences are shown. The ORFs of the coding exons of each mRNA product are shown with different color codes, indicating the corresponding encoded protein in the HIV genome. Non-coding exons are outlined in gray. [Figure 1B]Figure 1 shows analysis of HIV splicing after ABX464 treatment. Figure 1B. Inhibition of HIV-1 replication measured by p24 production in PBMCs from six donors. [Figure 1C] Figure 1 shows an analysis of HIV splicing after ABX464 treatment. Figure 1C. Quantification of HIV splice events using RNA CaptureSeq in PBMCs from six different donors that were infected and either untreated (DMSO) or treated with ABX464 for 6 days (464). The numbers of spliced ​​and unspliced ​​contigs are displayed. The various splicing products are colored as in Figure 1A. [Figure 1D] Figure 1 shows the analysis of HIV splicing after ABX464 treatment. Figure 1D. Sequence of new viral RNA generated by splicing. [Figure 2A] Figure 2 shows that ABX464 has no global effect on cellular splicing. Figure 2A. The effect of ABX464 on infected and uninfected CD4+ T cells was examined using a high-throughput RNA-seq approach. Sixteen libraries were constructed using four conditions: uninfected (DMSO_NI), uninfected treated with ABX464 (ABX464_NI), infected (DMSO_I), and infected treated with ABX464 (464_I), corresponding to four donors. Approximately 38 million reads (more than 50% of the total raw reads) were aligned to exons of the human genome sequence for each sample. [Figure 2B] Figure 2 shows that ABX464 has no global effect on cellular splicing. Figure 2B. Multidimensional scaling analysis (MDS) was used to interpret major trends in the data. [Figure 2C]Figure 2 shows that ABX464 has no global effect on cellular splicing. Figure 2C. Alternative splicing events in cellular genes were classified into five major groups (left panel): alternative 5' splice sites (A5SS, orange), alternative 3' splice sites (A3SS, blue), skipped exons (SE, gray), mutually exclusive exons (MXE, gray), and retained exons (RI, yellow). AS event counts comparing infected vs. uninfected samples (DMSO_I vs. DMSO_NI), uninfected vs. uninfected samples treated with ABX464 (DMSO_NI vs. 464_NI), infected vs. infected samples treated with ABX464 (DMSO_I vs. 464_I), and after 50% depletion of CBCs in the IPS (IPS depletion of 50% of CBCs) (right panel). [Figure 2D] Figure 2 shows that ABX464 has no global effect on cellular splicing (Figure 2D). By comparing exon coverage reads of a common highly expressed gene (B2M) between ABX464 and DMSO conditions in four donors, we confirmed that ABX464 did not increase splicing events in B2M. [Figure 2E]Figure 2 shows that ABX464 has no overall effect on cellular splicing. Figure 2E. Volcano plots of DMSO_I vs. DMSO_NI (top panel), DMSO_NI vs. 464_NI (middle panel), and DMSO_I vs. 464_I (bottom panel). The variation in gene expression produced by ABX464 treatment was very low in infected (6 downregulated genes) and uninfected (6 upregulated genes) samples. [Figure 3A] Figure 3 shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. Figure 3A. Microarray analysis of small RNAs from PBMCs from six donors. PBMCs were infected with YU-2 strain (I) or not (NI) and treated with or without ABX464 (DMSO). Volcano plots show that infection leads to large variations in small noncoding RNAs (left panel), whereas ABX464 induced reproducible upregulation of a single microRNA, miR-124, in infected and uninfected cells (right and center panels, respectively). [Figure 3B] Figure 3 shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. Figure 3B. Quantification of miR-124 expression using TaqMan Low Density Array technology in CD4+ T cells under the same conditions as in Figure 3A. [Figure 3C] Figure 3 shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. Figure 3C. Expression of miR-124 measured by qPCR in PBMCs, purified CD4+ and CD8 T cells, and macrophages treated with ABX464 compared to untreated cells (DMSO, fold change). [Figure 3D]Figure 3 shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. Figure 3D. Expression of miR-124 in PBMCs treated with the antiretroviral drugs ABX464, ABX530, maraviroc, efavirenz, darunavir, and AZT compared to untreated cells (DMSO, fold change). [Figure 3E] Figure 3 shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. Figure 3E. Quantification of miR-124 in rectal biopsies from healthy participants (n=10) and HIV patients (n=9) receiving ART on days 1 and 28 of treatment with ABX464. Individual graphs show the results for each patient compared to the results for healthy participants. [Figure 4A] Figure 4 shows that upregulation of miR-124 by ABX464 occurs through splicing of a long non-coding RNA at the miR-124-1 locus. Figure 4A. There are three genes encoding miR-124, miR-124-1, miR-124-2, and miR-124-3, located on chromosomes 8 and 20 of the human genome. [Figure 4B] Figure 4 shows that upregulation of miR-124 by ABX464 occurs through splicing of a long non-coding RNA at the miR-124-1 locus (Figure 4B). We employed a targeted RNA capture and sequencing strategy to determine which genes were induced by ABX464. In both infected and uninfected cells, treatment with ABX464 resulted in upregulation of miR-124 from the miR-124-1 locus, while the control locus, miR-429, was unaffected. [Figure 4C] Figure 4 shows that upregulation of miR-124 by ABX464 occurs through splicing of a long non-coding RNA at the miR-124-1 locus (Figure 4C). The miR-124-1 locus contains a long non-coding RNA (lncRNA 0599-205), the splicing of which is stimulated by ABX464. [Figure 4D] Figure 4 shows that upregulation of miR-124 by ABX464 results from splicing of long non-coding RNAs at the miR-124-1 locus. Figure 4D. Read counts at splice junctions (J1, J2, J3, and J4), exon-exon (J5 and J6), and the miR-124 75-bp region (miR-124) quantified by RNA CaptureSeq in PBMCs treated with ABX464. [Figure 5A] Figure 5 shows that splicing of lncRNA 0599-205 is required for the production of miR-124. Figure 5A. Schematic diagram of lncRNA 0599-205 precursor and primers used to amplify various derived RNAs. [Figure 5B] Figure 5 shows that splicing of lncRNA 0599-205 is required for the production of miR-124. Figure 5B. Quantification of spliced ​​and unspliced ​​lncRNA 0599-205 in the presence or absence of ABX464. [Figure 5C] Figure 5 shows that splicing of lncRNA 0599-205 is required for the production of miR-124. Figure 5C. Quantification of miR-124 expression after transfection of wild-type and splice variants of lncRNA 0599-205 plasmid in HeLa cells in the presence or absence of ABX464. [Figure 5D] Figure 5 shows that splicing of lncRNA 0599-205 is required for the production of miR-124. Figure 5D. Quantification of total wild-type and splice variant lncRNA 0599-205 in the presence or absence of ABX464. [Figure 6A] Figure 6 shows the following: Figure 6A. Processing steps. [Figure 6B] Figure 6 shows the following: Figure 6B. RNA-seq processing pipeline. [Figure 7]Figure 7 shows a representation of assembled contigs from two untreated samples (D5_DMSO and D8_DMSO) and three ABX464-treated samples (D4_464, D5_464, and D8_464). [Figure 8] Figure 8 shows FACS analysis using CD45, CCR7, CCR3 and CCR6 surface markers on PBMCs (2 donors) and CD4 (4 donors) both untreated (red) and treated with ABX464 (blue). [Figure 9A] Figure 9 shows an analysis of the effect of ABX464 treatment on miRNA expression. Figure 9A. miRNA expression profiling of PBMCs from six donors using TaqMan Low Density Arrays (TLDA). Volcano plots show differential miRNA expression in PBMCs treated with ABX464 vs. untreated (left panel) and infected vs. uninfected (right panel). [Figure 9B] Figure 9 shows an analysis of the effect of ABX464 treatment on miRNA expression. Figure 9B. Comparison of miR-124 expression in macrophages from six donors using TaqMan PCR. [Figure 9C] Figure 9 shows an analysis of the effect of ABX464 treatment on miRNA expression. Figure 9C. Quantification of miR-124 in biopsies of healthy volunteers (normal tissue), HIV-infected patients receiving ART at day 28 and 28 days after ABX464 treatment (HIV+day 1) and 28 days after (HIV+day 28). [Figure 9D] Figure 9 shows an analysis of the effect of ABX464 treatment on miRNA expression. Figure 9D. Quantification of miR-124 in biopsies of HIV patients on ART on days 1 (D1) and 28 (D28) of treatment and 28 days after stopping treatment (D56). DETAILED DESCRIPTION OF THE INVENTION

[0018] 1. Exemplary embodiments of biomarkers and their uses:

[0019] The effects of ABX464 in treating HIV infection and IBD have now been found to be mediated through the same mechanism: enhanced pre-mRNA splicing. ABX464 not only blocks HIV replication by enhancing pre-mRNA splicing of HIV viral RNA, but also triggers splicing of a long non-coding RNA harboring one of the gene loci for the anti-inflammatory microRNA miR-124, thereby increasing the expression of the anti-inflammatory microRNA miR-124. Additionally, ABX464 has been shown not to affect pre-mRNA splicing of cellular genes. While ABX464 does not affect pre-mRNA splicing of cellular genes, depletion of the CBC complex by RNAi leads to the accumulation of intron-retaining transcripts. These results suggest that ABX464 did not inhibit the function of the CBC in splicing but enhanced it under pathological conditions such as inflammation and HIV infection.

[0020] Viral infection

[0021] In some embodiments, the present invention provides methods of using a spliced ​​viral RNA variant as a biomarker for a viral infection or for the therapeutic treatment of said viral infection, the method comprising determining the presence or expression level of the spliced ​​viral RNA variant in a biological sample.

[0022] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound on treating a viral infection, the method comprising measuring the presence or expression level of a spliced ​​viral RNA variant as a biomarker of the viral infection.

[0023] In some embodiments, the present invention provides a method for screening compounds or vaccines in preventing and / or treating viral infection, the method comprising measuring the presence or expression level of a spliced ​​viral RNA variant as a biomarker of the viral infection.

[0024] In some embodiments, the present invention provides methods of treating a viral infection comprising measuring and / or monitoring the presence or expression level of a spliced ​​viral RNA variant as a biomarker of the viral infection.

[0025] In some embodiments, the viral infection is a viral infection that requires RNA splicing. In some embodiments, the viral infection that requires RNA splicing is a retroviral infection. In some embodiments, the retroviral infection is an oncovirus, lentivirus, and / or spumavirus infection.

[0026] As used herein, "oncovirus" refers to cancer and malignant infections. In some embodiments, the oncovirus is selected from leukemia viruses (e.g., avian leukemia virus (ALV), murine leukemia virus (MULV), also called Moloney virus, feline leukemia virus (FELV), human leukemia viruses such as HTLV1 and HTLV2, simian leukemia virus (STLV), bovine leukemia virus (BLV), primate oncovirus D, oncovirus B, which is an inducer of mammary tumors, and oncoviruses that cause rapid breast cancer (e.g., Rous sarcoma virus, or RSV).

[0027] As used herein, "spumaviruses" show fairly low specificity for a given cell type or a given species, and they are sometimes associated with immunosuppressive phenomena. In some embodiments, the spumavirus is a simian foamy virus (i.e., SFV).

[0028] As used herein, "lentiviruses" are responsible for slowly progressing pathological conditions that are very frequently associated with immunosuppressive phenomena, including, for example, AIDS.

[0029] In some embodiments, the retroviral infection is a condition associated with HIV and AIDS. In some embodiments, the HIV and AIDS-related condition is an inflammatory disorder or condition associated with or coexisting with AIDS.

[0030] In some embodiments, the presence or expression level of spliced ​​viral RNA variants is measured using RNA and / or DNA amplification, sequencing, isotopes, fluorescence, chromogenic enzymes, spectroscopy, spectrometry, immunoassays, or immunoenzymatic assays.

[0031] As described herein, ABX464 has been found to generate novel HIV splice variants in HIV-infected cells (Figure 1D): GGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAA GGAAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAG CGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGAAGAAGCGGAG ACAGCGACGAAGACCTCCTCAGGACAGTCAGACTCATCAAAGTTCTC TATCAAAGCA (SEQ.ID.No.1).

[0032] Thus, in some embodiments, the spliced ​​viral RNA variant is an HIV splice variant as a biomarker for HIV infection. In some embodiments, the HIV splice variant is that of SEQ. ID. No. 1.

[0033] In some embodiments, the present invention provides a method for using an HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection or as a biomarker for the effectiveness of a therapeutic treatment for HIV infection, the method comprising determining the presence or expression level of the HIV splice variant of SEQ. ID. No. 1 in a biological sample.

[0034] In some embodiments, the presence of the HIV splice variant of SEQ. ID. No. 1 in the isolated biological material indicates efficacy of a therapeutic treatment of HIV infection.

[0035] In some embodiments, the measured expression level of the HIV splice variant of SEQ.ID.No.1 in an isolated biological sample is compared to the measured expression level of the HIV splice variant of SEQ.ID.No.1 in a previously isolated biological sample, wherein an increase in the expression level of the HIV splice variant of SEQ.ID.No.1 indicates the effectiveness of a therapeutic treatment of HIV infection.

[0036] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound for treating HIV infection, the method comprising measuring the presence or expression level of an HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection.

[0037] In some embodiments, the present invention provides a method for screening compounds or vaccines in preventing and / or treating HIV infection, the method comprising measuring the presence or expression level of an HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection.

[0038] In some embodiments, the present invention provides an HIV splice variant comprising SEQ.ID.No. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant, said composition comprising SEQ.ID.No. 1.

[0039] In some embodiments, the present invention provides an HIV splice variant that is an HIV splice variant of SEQ.ID.No. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant of SEQ.ID.No. 1. In some embodiments, the present invention provides a biological sample comprising an HIV splice variant of SEQ.ID.No. 1.

[0040] In some embodiments, the present invention provides methods for treating HIV infection, comprising measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ. ID. No. 1 in a patient. In some embodiments, the presence and / or expression level of an HIV splice variant of SEQ. ID. No. 1 is measured in a patient's biological sample. In some embodiments, the patient's biological sample is a blood sample. In some embodiments, the patient's biological sample is a tissue sample. In some embodiments, the methods of the present invention for treating HIV infection further comprise measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ. ID. No. 1 in a patient prior to administering a compound or pharmaceutically acceptable salt thereof or composition thereof described herein. In some embodiments, the methods of the present invention for treating HIV infection further comprise measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ. ID. No. 1 in a patient during the course of treatment with a compound or pharmaceutically acceptable salt thereof or composition thereof described herein. In some embodiments, the methods of the invention for treating HIV infection further comprise selecting a patient for treatment with a compound or pharmaceutically acceptable salt thereof described herein, or a composition thereof, by measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ.ID.No. 1 in the patient. In some embodiments, the methods of the invention for treating HIV infection further comprise excluding a patient from treatment with a compound or pharmaceutically acceptable salt thereof described herein, or a composition thereof, by measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ.ID.No. 1 in the patient.In some embodiments, the methods of the invention for treating HIV infection further include adjusting (e.g., increasing or decreasing) the dosing regimen (e.g., dosage and / or dosing schedule) of a compound or pharmaceutically acceptable salt thereof described herein, or composition thereof, to be administered to a patient by measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ.ID.No. 1 in the patient. In some embodiments, the methods of the invention for treating HIV infection further include suspending and / or ceasing administration of a compound or pharmaceutically acceptable salt thereof described herein, or composition thereof, after the measured presence and / or expression level of an HIV splice variant of SEQ.ID.No.1 reaches a level at which treatment can be suspended and / or discontinued (e.g., the expression level of the HIV splice variant plateaus).

[0041] In some embodiments, the present invention provides a method for treating HIV infection, comprising comparing the measured expression level of the HIV splice variant of SEQ. ID. No. 1 in a patient with a previously measured expression level of the HIV splice variant of SEQ. ID. No. 1 in the patient.

[0042] In some embodiments, the methods of the present invention for treating HIV infection include measuring and / or monitoring the presence and / or expression level of the HIV splice variant of SEQ. ID. No. 1 in a patient to guide dosage or monitor response to treatment.

[0043] In some embodiments, the methods of the present invention for treating HIV infection involve measuring and / or monitoring the HIV splice variant of SEQ. ID. No. 1 in a patient to guide treatment.

[0044] In some embodiments, the methods of the present invention further include measuring pre-mRNA splicing of a cellular gene in a patient or biological sample, wherein the pre-mRNA splicing of the cellular gene is not altered compared to the control sample. The control sample can be obtained from a variety of sources. In some embodiments, the control sample is taken from the patient before treatment or before the presence of disease (e.g., a stored blood sample or tissue sample). In some embodiments, the control sample is taken from a set of normal, non-diseased members of a population. In some embodiments, the control sample is taken from the patient before treatment with a compound or pharmaceutically acceptable salt or composition thereof described herein. In some embodiments, a cellular assay can be performed on the biological sample.

[0045] Inflammatory diseases, disorders and conditions, and cancer

[0046] In some embodiments, the present invention provides methods of using the miR-124 locus as a biomarker for an inflammatory disease, disorder, or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for said inflammatory disease, disorder, or condition, or said cancer, comprising determining the presence or expression level of miR-124 in a biological sample.

[0047] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound or medical device in treating an inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of miR-124 as a biomarker for the inflammatory disease, disorder, or condition, or the cancer.

[0048] In some embodiments, the present invention provides a method for screening compounds or medical devices in treating an inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of miR-124 as a biomarker for the inflammatory disease, disorder, or condition, or the cancer.

[0049] In some embodiments, the present invention provides methods of treating an inflammatory disease, disorder or condition, or cancer, comprising measuring and / or monitoring the presence and / or expression level of miR-124 as a biomarker for said inflammatory disease, disorder or condition, or said cancer.

[0050] In some embodiments, the present invention provides methods for the use of a long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for an inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for said inflammatory disease, disorder or condition, or said cancer, comprising measuring the presence or expression level of a long non-coding RNA spliced ​​at the miR-124 locus in a biological sample.

[0051] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound or medical device in treating an inflammatory disease, disorder or condition, or cancer, comprising measuring the presence or expression level of a spliced ​​long non-coding RNA at the miR-124 locus as a biomarker for the inflammatory disease, disorder or condition, or the cancer.

[0052] In some embodiments, the present invention provides a method for screening a compound or medical device in treating an inflammatory disease, disorder or condition, or cancer, comprising measuring the presence or expression level of a spliced ​​long non-coding RNA at the miR-124 locus as a biomarker for the inflammatory disease, disorder or condition, or the cancer.

[0053] In some embodiments, the present invention provides methods of treating an inflammatory disease, disorder or condition, or cancer, comprising measuring and / or monitoring the presence or expression level of a spliced ​​long non-coding RNA at the miR-124 locus as a biomarker for said inflammatory disease, disorder or condition, or said cancer.

[0054] In some embodiments, the spliced ​​long non-coding RNA at the miR-124 locus is at the miR-124-1 locus. In some embodiments, the spliced ​​long non-coding RNA at the miR-124 locus is at the miR-124-2 locus. In some embodiments, the spliced ​​long non-coding RNA at the miR-124 locus is at the miR-124-3 locus.

[0055] In some embodiments, the presence or expression level of spliced ​​long non-coding RNA at the miR-124 locus is measured using RNA and / or DNA amplification, sequencing, isotopes, fluorescence, chromogenic enzymes, spectroscopy, spectrometry, immunoassays, or immunoenzymatic assays.

[0056] As described herein, ABX464 has been found to induce long non-coding RNA (lncRNA 0599-205) at the miR-124-1 locus (FIGS. 4A and 4C). The long non-coding RNA referred to herein and throughout as "lncRNA 0599-205" or "LINC00599-205" is derived from the region of the miR-124-1 locus ranging from position 9903000 to position 9904500 on chromosome 8, specifically from position 9903107 to position 9904210, which includes the miR-124-1 locus (FIGS. 4A and 4C). For reference, the region of the sequence containing the transcript lncRNA 0599-205 is further referred to herein as SEQ. ID. No. 15. The sequences of the three exons from 5' to 3' corresponding to the lncRNA 0599-205 transcript are further referenced herein as SEQ.ID.No. 16, SEQ.ID.No. 17, and SEQ.ID.No. 18, respectively. The sequence of the lncRNA 0599-205 transcript has further been deposited in the ENSEMBL database as ENST00000521863.1.

[0057] Thus, in some embodiments, the spliced ​​long non-coding RNA at the miR-124 locus is lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder or condition, or cancer.

[0058] In some embodiments, the present invention provides a method of using lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder, or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for an inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus in a biological sample.

[0059] In some embodiments, the presence of lncRNA 0599-205 at the miR-124-1 locus in the isolated biological material indicates efficacy of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

[0060] In some embodiments, the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in the isolated biological sample is compared to the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in a previously isolated biological sample, wherein an increase in the expression level of lncRNA 0599-205 at the miR-124-1 locus indicates the efficacy of the therapeutic treatment of the inflammatory disease, disorder or condition, or cancer.

[0061] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound in treating an inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder, or condition, or cancer.

[0062] In some embodiments, the present invention provides a method for screening a compound in treating an inflammatory disease, disorder, or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder, or condition, or cancer.

[0063] In some embodiments, the methods of the present invention for treating an inflammatory disease, disorder, or condition, or cancer further comprise measuring and / or monitoring the presence and / or level of lncRNA 0599-205 at the miR-124-1 locus in the patient. In some embodiments, the presence and / or level of lncRNA 0599-205 at the miR-124-1 locus is measured in a biological sample from the patient. In some embodiments, the patient biological sample is a blood sample. In some embodiments, the patient biological sample is a tissue sample. In some embodiments, the methods of the present invention for treating an inflammatory disease, disorder, or condition, or cancer further comprise measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient prior to administration of a compound or pharmaceutically acceptable salt thereof, or a composition thereof, as described herein. In some embodiments, the methods of the invention for treating an inflammatory disease, disorder, or condition, or cancer further comprise measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient during the course of treatment with a compound or pharmaceutically acceptable salt thereof, or composition thereof, described herein. In some embodiments, the methods of the invention for treating an inflammatory disease, disorder, or condition, or cancer further comprise selecting a patient for treatment with a compound or pharmaceutically acceptable salt thereof, or composition thereof, described herein, by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient. In some embodiments, the methods of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprise excluding the patient from treatment with a compound or pharmaceutically acceptable salt or composition thereof described herein by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.In some embodiments, the methods of the present invention for treating an inflammatory disease, disorder, or condition, or cancer further comprise adjusting (e.g., increasing or decreasing) the administration regimen (e.g., dosage and / or administration schedule) of a compound or pharmaceutically acceptable salt thereof described herein, or a composition thereof, to be administered to a patient by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

[0064] In some embodiments, the methods of the present invention for treating an inflammatory disease, disorder, or condition, or cancer, comprise comparing the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient to a control reference value. The control reference value to be used to compare the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient is obtained from a control sample. Control samples can be obtained from a variety of sources. In some embodiments, the control sample is collected from a patient prior to treatment or the presence of disease (e.g., a stored blood sample or tissue sample). In some embodiments, the control sample is collected from a set of normal, non-diseased members of a population. In some embodiments, the control sample is collected from a patient prior to treatment with a compound or pharmaceutically acceptable salt or composition thereof described herein. In some embodiments, a cellular assay can be performed on the biological sample.

[0065] In some embodiments, a modulated presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient relative to a control reference value is indicative of an inflammatory disease, disorder, or condition, or cancer. In some embodiments, a modulated presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient relative to a control reference value is indicative of the effectiveness of treatment with a compound or pharmaceutically acceptable salt thereof described herein or a composition thereof administered to the patient. The term "modulation" or "modulated presence and / or expression level" means that the presence or expression level of a biomarker is either induced or increased, or alternatively, suppressed or decreased.

[0066] In some embodiments, the measured, decreased, or suppressed presence or decreased expression level of lncRNA 0599-205 at the miR-124-1 locus relative to a control reference value is indicative of an inflammatory disease, disorder, or condition, or cancer. In some embodiments, the measured, decreased, or suppressed presence or decreased expression level of lncRNA 0599-205 at the miR-124-1 locus relative to a control reference value is indicative of the efficacy of a compound, or pharmaceutically acceptable salt, or composition thereof described herein. In some embodiments, the measured expression level of lncRNA 0599-205 at the miR-124-1 locus in patients treated with a compound, or pharmaceutically acceptable salt, or composition thereof described herein is a 2-fold, 4-fold, 6-fold, 8-fold, or 10-fold increase relative to the control reference value.

[0067] In some embodiments, the methods of the invention for treating an inflammatory disease, disorder or condition, or cancer include measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in a patient to guide dosage or monitor response to treatment.

[0068] In some embodiments, the methods of the invention for treating an inflammatory disease, disorder or condition, or cancer include measuring and / or monitoring lncRNA 0599-205 at the miR-124-1 locus in a patient to guide treatment.

[0069] In some embodiments, the present invention provides algorithms that link levels of lncRNA 0599-205 at the miR-124-1 locus with levels of cytokines or other biomarkers to monitor the severity of an inflammatory disease, disorder, or condition, or cancer, and / or to monitor the effectiveness of a treatment, including, but not limited to, the treatments described herein. In some embodiments, the treatment methods described herein comprise monitoring the severity of an inflammatory disease, disorder, or condition, or cancer and / or monitoring the effectiveness of a treatment using an algorithm that links levels of lncRNA 0599-205 at the miR-124-1 locus with levels of cytokines or other biomarkers.

[0070] 2.Definition:

[0071] The compounds of the present invention can exist in the form of a free base or in the form of an addition salt with a pharmaceutically acceptable acid. Suitable physiologically acceptable acid addition salts of the compounds of the present invention include sulfate, hydrobromide, citrate, trifluoroacetate, ascorbate, hydrochloride, tartrate, triflate, maleate, mesylate, formate, acetate, fumarate and sulfonate, particularly alkylsulfonate or arylsulfonate, more particularly mesylate, triflate, edisylate, besylate and tosylate.

[0072] The compounds of the present invention and / or their salts may form solvates or hydrates, and the present invention encompasses all such solvates and hydrates. The terms "hydrate" and "solvate" simply mean that the compounds according to the present invention may be in the form of a hydrate or solvate, i.e., in the form of a hydrate or solvate combined or associated with one or more water or solvent molecules. This is merely a chemical property of such compounds, which can be applied to all organic compounds of this type.

[0073] The compounds of the present invention may contain one or more asymmetric carbon atoms. They may therefore exist in the form of enantiomers or diastereoisomers. These enantiomers, diastereoisomers and mixtures thereof, including racemic mixtures, are encompassed within the scope of the present invention.

[0074] In the context of the present invention, the following terms are defined as follows: "halogen atom" is understood to mean a chlorine, fluorine, bromine or iodine atom, and in particular to denote a chlorine, fluorine or bromine atom; - "(C1-C5) alkyl" as used herein refers to a C1-C5 straight chain, secondary or tertiary saturated hydrocarbon, respectively. Examples include, but are not limited to, methyl, ethyl, 1-propyl, 2-propyl, butyl, pentyl. - "(C3-C6)cycloalkyl" as used herein refers to a cyclic saturated hydrocarbon. Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl. - "(C1-C4)alkoxy" as used herein refers to an O-(C1-C4)alkyl residue, where alkyl is as defined above. Examples include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, butoxy. - "fluoroalkyl group" and "fluoroalkoxy group" refer to alkyl and alkoxy groups, respectively, as defined above, wherein the group is substituted with at least one fluorine atom. Examples are perfluoroalkyl groups, such as trifluoromethyl or perfluoropropyl. "Saturated 5- or 6-membered heterocycle," as used herein, refers to a saturated ring containing at least one heteroatom. Examples include, but are not limited to, morpholine, piperazine, thiomorpholine, piperidine, and pyrrolidine.

[0075] As used herein, the term "pharmaceutically acceptable salt" refers to a salt that is suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and that is commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases.

[0076] Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate Salts include, but are not limited to, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like.

[0077] Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N + (C 1~4 Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Additionally, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.

[0078] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure, such as the R and S configurations of each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Thus, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the compounds of the invention are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of a hydrogen atom by deuterium or tritium, or the replacement of a carbon by a C- or C-enriched carbon are within the scope of the invention. Such compounds are useful, for example, as analytical tools, probes in biological assays, or as therapeutic agents according to the invention.

[0079] 3. Exemplary embodiments of the treatment method:

[0080] In one aspect, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (I) below or a pharmaceutically acceptable salt thereof: [ka] where: Z is C or N; V is C or N; [ka] means an aromatic ring, wherein V is C or N, and when V is N, V ​​is in the ortho, meta or para position relative to Z; Each R is independently a hydrogen atom, a halogen atom, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -O-P(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, where the alkyl is optionally a hydroxyl group, or a group of formula (IIa) [ka] Or a group of the following formula (IIIa) [ka] optionally mono- or disubstituted by Q is N or O, provided that when Q is O, R″ is absent; R1 and R2 each independently represent a hydrogen atom or a (C1-C3) alkyl; R3 and R4 each independently represent a hydrogen atom, Li + , Na + , K. + , N + (Ra)4 or benzyl, n is 1, 2 or 3; n' is 1, 2 or 3; Each R' is independently a hydrogen atom, (C1-C3) alkyl, hydroxyl, a halogen atom, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3) fluoroalkyl, (C1-C4) alkoxy, -OP(=O)-(OR3)(OR4), -CN, or a group of formula (IIa) below. [ka] Or a group of the following formula (IIIa) [ka] and A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb independently represents a hydrogen atom, a (C1-C5) alkyl, or a (C3-C6) cycloalkyl; R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocyclic ring, which may be optionally substituted with one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 or 3 only if the other R a group is different from said (IIa) or (IIIa) group; and R″ is a hydrogen atom, a (C1-C4) alkyl or a group of formula (IIa) as defined above.

[0081] Z is C or N as generally defined above.

[0082] In some embodiments, Z is C. In some embodiments, Z is N.

[0083] In some embodiments, Z is selected from those set forth in Tables 1-3 below.

[0084] V is C or N as generally defined above.

[0085] In some embodiments, V is C. In some embodiments, V is N.

[0086] In some embodiments, V is selected from those set forth in Tables 1-3 below.

[0087] As generally defined above, [ka] means an aromatic ring, where V is C or N, and when V is N, V ​​is in the ortho, meta, or para position relative to Z.

[0088] In some embodiments, [ka] means an aromatic ring, where V is C.

[0089] In some embodiments, [ka] means an aromatic ring, where V is N and V is in the ortho, meta, or para position relative to Z. In some embodiments, V is N and V is in the ortho position relative to Z. In some embodiments, V is N and V is in the meta position relative to Z. In some embodiments, V is N and V is in the para position relative to Z.

[0090] In some embodiments, [ka] is phenyl.

[0091] In some embodiments, [ka] is pyridine.

[0092] In some embodiments, [ka] is a pyridazine.

[0093] In some embodiments, [ka] is a pyrimidine.

[0094] In some embodiments, [ka] is a pyrazine.

[0095] In some embodiments, [ka] is selected from those listed in Tables 1 to 3 below.

[0096] As generally described above, each R is independently a hydrogen atom, a halogen atom, —CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, —NO2, —NR1R2, (C1-C4)alkoxy, phenoxy, —NR1-SO2-NR1R2, —NR1-SO2-R1, —NR1-C(═O)-R1, —NR1-C(═O)-NR1R2, —SO2-NR1R2, —SO3H, —O-SO2-OR3, —O-P(═O)-(OR3)(OR4), —O-CH2-COOR3, or (C1-C3)alkyl, wherein the alkyl is optionally mono- or di-substituted with hydroxyl groups.

[0097] In some embodiments, R is a hydrogen atom. In some embodiments, R is a halogen atom. In some embodiments, R is -CN. In some embodiments, R is hydroxyl. In some embodiments, R is (C1-C3)fluoroalkyl, wherein the alkyl is optionally mono- or di-substituted with hydroxyl. In some embodiments, R is (C1-C3)fluoroalkoxy. In some embodiments, R is (C3-C6)cycloalkyl. In some embodiments, R is -NO2. In some embodiments, R is -NR1R2. In some embodiments, R is (C1-C4)alkoxy. In some embodiments, R is phenoxy. In some embodiments, R is -NR1-SO2-NR1R2. In some embodiments, R is -NR1-SO2-R1. In some embodiments, R is -NR1-C(=O)-R1. In some embodiments, R is -NR1-C(=O)-NR1R2. In some embodiments, R is -SO2-NR1R2. In some embodiments, R is -SO3H. In some embodiments, R is -O-SO2-OR3. In some embodiments, R is -OP(=O)-(OR3)(OR4). In some embodiments, R is -O-CH2-COOR3. In some embodiments, R is (C1-C3) alkyl, wherein the alkyl is optionally mono- or di-substituted with hydroxyl.

[0098] In some embodiments, each R is independently a halogen atom, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, -NR1R2, (C1-C4)alkoxy, or (C1-C3)alkyl.

[0099] In some embodiments, each R is independently a hydrogen atom, methyl, methoxy, trifluoromethyl, trifluoromethoxy, amino, a halogen atom, or -OP(=O)-(OR3)(OR4). In some embodiments, R is methyl. In some embodiments, R is methoxy. In some embodiments, R is trifluoromethyl. In some embodiments, R is trifluoromethoxy. In some embodiments, R is amino. In some embodiments, R is -OP(=O)-(OR3)(OR4).

[0100] In some embodiments, each R is independently methyl, methoxy, trifluoromethyl, a halogen atom, trifluoromethoxy, or amino.

[0101] In some embodiments, R is selected from those set forth in Tables 1-3 below.

[0102] As generally described above, Q is N or O, with the proviso that when Q is O, R" is absent.

[0103] In some embodiments, Q is N. In some embodiments, Q is O and R″ is absent.

[0104] In some embodiments, Q is selected from those set forth in Tables 1-3 below.

[0105] As generally described above, each of R1 and R2 is independently a hydrogen atom or a (C1-C3) alkyl.

[0106] In some embodiments, R1 is a hydrogen atom. In some embodiments, R1 is (C1-C3) alkyl. In some embodiments, R2 is a hydrogen atom. In some embodiments, R2 is (C1-C3) alkyl.

[0107] In some embodiments, each of R1 and R2 is independently selected from those set forth in Tables 1-3 below.

[0108] As generally described above, each of R3 and R4 is independently a hydrogen atom, Li+, Na+, K+, N+(Ra)4, or benzyl.

[0109] In some embodiments, R3 is a hydrogen atom. In some embodiments, R3 is Li + In some embodiments, R3 is Na + In some embodiments, R3 is K + In some embodiments, R3 is N + (Ra)4. In some embodiments, R3 is benzyl. In some embodiments, R4 is a hydrogen atom. In some embodiments, R4 is Li + In some embodiments, R4 is Na + In some embodiments, R4 is K + In some embodiments, R4 is N + (Ra)4. In some embodiments, R4 is benzyl.

[0110] In some embodiments, each of R3 and R4 is independently selected from those set forth in Tables 1-3 below.

[0111] As generally described above, n is 1, 2, or 3.

[0112] In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[0113] In some embodiments, n is selected from those set forth in Tables 1-3 below.

[0114] As generally described above, n' is 1, 2 or 3.

[0115] In some embodiments, n' is 1 or 2. In some embodiments, n' is 1. In some embodiments, n' is 2. In some embodiments, n' is 3.

[0116] In some embodiments, n' is selected from those set forth in Tables 1-3 below.

[0117] As generally described above, each R' is independently a hydrogen atom, (C1-C3) alkyl, hydroxyl, a halogen atom, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3) fluoroalkyl, (C1-C4) alkoxy, -OP(=O)-(OR3)(OR4), -CN, a group of formula (IIa) below: [ka] Or a group of the following formula (IIIa) [ka] is.

[0118] In some embodiments, R' is a hydrogen atom. In some embodiments, R' is (C1-C3) alkyl. In some embodiments, R' is hydroxyl. In some embodiments, R' is a halogen atom. In some embodiments, R' is -NO2. In some embodiments, R' is -NR1R2. In some embodiments, R' is morpholinyl. In some embodiments, R' is morpholino. In some embodiments, R' is N-methylpiperazinyl. In some embodiments, R' is (C1-C3) fluoroalkyl. In some embodiments, R' is (C1-C4) alkoxy. In some embodiments, R' is -OP(=O)-(OR3)(OR4). In some embodiments, R' is -CN. In some embodiments, R' is a group of formula (IIa): [ka] is.

[0119] In some embodiments, R' is a group of formula (IIIa): [ka]

[0120] In some embodiments, R' is amino. In some embodiments, R' is methyl. In some embodiments, R' is a group of the formula: [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other R' groups are different from the above groups.

[0121] In some embodiments, R' is a group of the formula: [ka] wherein A is O or NH, m is 2, and X1 is O, CH2, or N-CH3, provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other R' groups are different from the above groups.

[0122] In some embodiments, R' is a group of the formula: [ka] wherein A is O or NH, m is 3, and X1 is O, CH2, or N-CH3, provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other R' groups are different from the above groups.

[0123] In some embodiments, each R' is independently a hydrogen atom, a halogen atom, amino, methyl, -OP(=O)-(OR3)(OR4), or a group of the formula: [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other R' groups are different from the above groups.

[0124] In some embodiments, each R' is independently a hydrogen atom, a halogen atom, methyl, or a group of the formula: [ka] wherein A is O or NH, m is 2, and X1 is O, CH2, or N-CH3, provided that when R' is such a group, n' is 1 or 2, and when n' is 2, the other R' groups are different from the above groups.

[0125] In some embodiments, each R' is independently a halogen atom, (C1-C3) alkyl, hydroxyl, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3) fluoroalkyl, (C1-C4) alkoxy, or a group of Formula (IIa) or Formula (IIIa) described herein.

[0126] In some embodiments, R' is a halogen atom or methyl.

[0127] In some embodiments, each R' is independently selected from those set forth in Tables 1-3 below.

[0128] As generally described above, A is a covalent bond, an oxygen atom, or NH.

[0129] In some embodiments, A is a covalent bond. In some embodiments, A is an oxygen atom. In some embodiments, A is NH.

[0130] In some embodiments, A is selected from those set forth in Tables 1-3 below.

[0131] As generally described above, B is a covalent bond or NH.

[0132] In some embodiments, B is a covalent bond. In some embodiments, B is NH.

[0133] In some embodiments, B is selected from those set forth in Tables 1-3 below.

[0134] As generally described above, m is 1, 2, 3, 4 or 5.

[0135] In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5.

[0136] In some embodiments, m is selected from those set forth in Tables 1-3 below.

[0137] As generally described above, p is 1, 2, or 3.

[0138] In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5.

[0139] In some embodiments, p is selected from those set forth in Tables 1-3 below.

[0140] As generally described above, each of Ra and Rb is independently a hydrogen atom, a (C1-C5) alkyl, or a (C3-C6) cycloalkyl, or Ra and Rb together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocycle, which may optionally be substituted with one or more Ra, provided that when R' is a (IIa) or (IIIa) group, n' may be 2 or 3 only if the other R' group is different from said (IIa) or (IIIa) group.

[0141] In some embodiments, Ra is a hydrogen atom. In some embodiments, Ra is (C1-C5) alkyl. In some embodiments, Ra is (C3-C6) cycloalkyl. In some embodiments, Rb is a hydrogen atom. In some embodiments, Rb is (C1-C5) alkyl. In some embodiments, Rb is (C3-C6) cycloalkyl.

[0142] In some embodiments, R and R, together with the nitrogen atom to which they are attached, form a saturated 5- or 6-membered heterocyclic ring, which may optionally be substituted with one or more R, provided that when R is a group of Formula (IIa) or Formula (IIIa), n' can be 2 or 3 only if the other R' group is different from the Formula (IIa) or Formula (IIIa) group. In some embodiments, as described above, the saturated 5- or 6-membered heterocyclic ring formed by R and R, together with the nitrogen atom to which they are attached, may optionally have an additional heteroatom selected from N, O, and S.

[0143] In some embodiments, R and R together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle having an additional heteroatom selected from N, O, and S, which heterocycle is optionally substituted with one or more R, provided that when R is a group of Formula (IIa) or Formula (IIIa), n can be 2 or 3 only if the other R group is different from the group of Formula (IIa) or Formula (IIIa).

[0144] In some embodiments, Ra and Rb together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle, provided that when R' is a group of Formula (IIa) or Formula (IIIa), n' can be 2 or 3 only if the other R' group is different from the group of Formula (IIa) or Formula (IIIa).

[0145] In some embodiments, R and R together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle having an additional heteroatom selected from N, O, and S, with the proviso that when R′ is a group of formula (IIa) or (IIIa), n′ can be 2 or 3 only if the other R′ group is different from the group of formula (IIa) or formula (IIIa).

[0146] In some embodiments, R and R together with the nitrogen atom to which they are attached form a saturated 5- or 6-membered heterocycle having an additional heteroatom selected from N, O, and S, which heterocycle is optionally substituted with one or more R, provided that when R is a (IIa) or (IIIa) group, n can be 2 only if the other R group is different from the (IIa) or (IIIa) group.

[0147] In some embodiments, each of Ra and Rb is independently selected from those set forth in Tables 1-3 below.

[0148] As generally described above, R″ is a hydrogen atom, a (C1-C4) alkyl, or a group of formula (IIa) as defined above.

[0149] In some embodiments, R" is a hydrogen atom or a (C1-C4) alkyl. In some embodiments, R" is a hydrogen atom. In some embodiments, R" is a (C1-C4) alkyl. In some embodiments, R" is a group of formula (IIa) defined above.

[0150] In some embodiments, R″ is a group of the formula: [ka] wherein m is 2 or 3, and X1 is O, CH2, or N-CH3.

[0151] In some embodiments, R″ is selected from those set forth in Tables 1-3 below.

[0152] In some embodiments, n is 1, n' is 1 or 2, R" is H, R is selected from methyl, methoxy, trifluoromethyl, a halogen atom, trifluoromethoxy, and amino, and each R' is independently a halogen atom, methyl, or a group described below. [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3, provided that when n' is 2, the other R' groups are different from the above groups.

[0153] In some embodiments, n is 1, n' is 1, R" is H, R is selected from methyl, methoxy, trifluoromethyl, a halogen atom, and trifluoromethoxy, and R' is a halogen atom or methyl.

[0154] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ia) below, or a pharmaceutically acceptable salt thereof: [ka] wherein the variables R, R', R", n, and n' are independently as defined above and as described in the embodiments herein, both alone and in combination.

[0155] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ib) below, or a pharmaceutically acceptable salt thereof: [ka] wherein the variables R, R', R", n, and n' are independently as defined above and as described in the embodiments herein, both alone and in combination.

[0156] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ic) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', R", n, and n' is independently as defined above and as described herein, both alone and in combination, in the embodiments herein.

[0157] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (Ib') below or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', R", and n' is independently as defined above and as described herein, both alone and in combination, in the embodiments herein.

[0158] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ib) or a pharmaceutically acceptable salt thereof. where: each R is independently a halogen atom, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, -NR1R2, (C1-C4)alkoxy, or (C1-C3)alkyl, wherein the alkyl is optionally mono- or di-substituted with hydroxyl groups; n is 1 or 2, n' is 1 or 2; R1 and R2 each independently represent a hydrogen atom or a (C1-C3) alkyl; each R' is independently a halogen atom, (C1-C3) alkyl, hydroxyl, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3) fluoroalkyl, (C1-C4) alkoxy, or a group of formula (IIa) or formula (IIIa) as described herein; A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb independently represents a hydrogen atom, a (C1-C5) alkyl, or a (C3-C6) cycloalkyl; R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocycle having an additional heteroatom selected from N, O and S, which heterocycle may be substituted with one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 only if the other R a group is different from said (IIa) or (IIIa) group; and R″ is a hydrogen atom or a (C1-C4) alkyl.

[0159] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ib) or a pharmaceutically acceptable salt thereof. where: Each R' is independently a hydrogen atom, a halogen atom, a (C1-C3) alkyl, or a (C1-C4) alkoxy group, where the alkyl is optionally mono- or di-substituted with a hydroxyl group; R" is a hydrogen atom or a (C1-C4) alkyl; n is 1 or 2; n' is 1 or 2; when n is 1, R is a (C1-C3) fluoroalkoxy, NRR, or phenoxy, where each of R and R is independently a (C1-C3) alkyl; and when n is 2, one of the two R groups is a (C1-C3) fluoroalkoxy, and the other R group is a (C1-C3) alkyl.

[0160] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ib) or a pharmaceutically acceptable salt thereof. where: Each R is independently (C1-C3)fluoroalkoxy; each R' is independently a hydrogen atom, a halogen atom, a (C1-C3)alkyl, or a (C1-C4)alkoxy; R" is a hydrogen atom or a (C1-C4)alkyl; n is 1; and n' is 1 or 2.

[0161] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Ib') or a pharmaceutically acceptable salt thereof. where: each R is independently a hydrogen atom, a halogen atom, a (C1-C3) alkyl, -NR1R2, a (C1-C3) fluoroalkoxy, -NO2, phenoxy, or a (C1-C4) alkoxy, wherein the alkyl is optionally mono- or di-substituted with a hydroxyl group; each of R1 and R2 is independently a hydrogen atom or a (C1-C3) alkyl; R' is a hydrogen atom, a halogen atom, a (C1-C3) alkyl, or a (C1-C4) alkoxy, with the proviso that R' is different from the methyl group at the 4-position of the quinoline group; R" is a hydrogen atom or a (C1-C4) alkyl; n is 1, 2, or 3; and n' is 1 or 2.

[0162] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Id) or a pharmaceutically acceptable salt thereof. [ka] wherein R and R' are independently as defined above and in embodiments herein, both alone and in combination, and R''' is a hydrogen atom or the group described below. [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0163] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (Id) or a pharmaceutically acceptable salt thereof. Here, R is methyl, methoxy, trifluoromethyl, a halogen atom, trifluoromethoxy, or amino, R' is a halogen atom or methyl, and R''' is a hydrogen atom or the following group: [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0164] In some embodiments, R''' is a hydrogen atom.

[0165] In some embodiments, R''' is the following group: [ka] wherein A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0166] In some embodiments, R''' is the following group: [ka] wherein A is O, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0167] In some embodiments, R''' is the following group: [ka] wherein A is NH, m is 2 or 3; and X1 is O, CH2, or N-CH3.

[0168] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of the following formula (ABX464) or a pharmaceutically acceptable salt thereof: [ka] 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinolin-2-amine

[0169] In some embodiments, the compound ABX464 or a pharmaceutically acceptable salt thereof is in an amorphous form. In some embodiments, the compound ABX464 or a pharmaceutically acceptable salt thereof is in a crystalline form. In some embodiments, the crystalline form of the compound ABX464 or a pharmaceutically acceptable salt thereof has a melting point of 120.5°C (± 2°C).

[0170] In some embodiments, the crystalline form of the compound ABX464 or a pharmaceutically acceptable salt thereof exhibits peaks in an x-ray powder diffractogram (XRPD) at angles 7.3, 14.6, 18.4, and 24.9. In some embodiments, the crystalline form of the compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRD peaks at angles selected from 18.0, 24.2, 28.3, and 29.5. In some embodiments, the crystalline form of the compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRD peaks at angles selected from 18.6, 22.3, 23.0, and 23.5.

[0171] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 1 below, or a pharmaceutically acceptable salt thereof.

[0172] [Table 1] JPEG2026009991000039.jpg255145JPEG2026009991000040.jpg255147JPEG2026009991000041.jpg255146JPEG2026009991000042.jpg25514 0JPEG2026009991000043.jpg255152JPEG2026009991000044.jpg255154JPEG2026009991000045.jpg255144JPEG2026009991000046.jpg71170

[0173] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 2 below, or a pharmaceutically acceptable salt thereof.

[0174] [Table 2] JPEG2026009991000048.jpg255143JPEG2026009991000049.jpg255148JPEG2026009991000050.jpg255144JPEG20260099910 00051.jpg255143JPEG2026009991000052.jpg255157JPEG2026009991000053.jpg255157JPEG2026009991000054.jpg255146 JPEG2026009991000055.jpg255147JPEG2026009991000056.jpg255143JPEG2026009991000057.jpg255148JPEG20260099910 00058.jpg255142JPEG2026009991000059.jpg255150JPEG2026009991000060.jpg255160JPEG2026009991000061.jpg255164

[0175] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound selected from Table 3 below, or a pharmaceutically acceptable salt thereof.

[0176] [Table 3] JPEG2026009991000063.jpg230170

[0177] In some embodiments, the compounds described herein are in the form of a salt selected from sulfate, hydrobromide, citrate, trifluoroacetate, ascorbate, hydrochloride, tartrate, triflate, maleate, mesylate, formate, acetate, fumarate, and sulfonate. In some embodiments, the compounds described herein are in the form of a salt as an alkylsulfonate or arylsulfonate. In some embodiments, the compounds described herein are in the form of a salt as a mesylate, triflate, edisylate, besylate, and tosylate.

[0178] In one aspect, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a metabolite of a compound described herein. In some embodiments, the metabolite of a compound described herein is an N-glucuronide metabolite.

[0179] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IV) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables V, Z, R, R', n, and n' is independently as defined above and as described in the embodiments herein, both alone and in combination.

[0180] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (IVa) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', n, and n' is independently as defined above and as described in the embodiments herein, both alone and in combination.

[0181] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of Formula (IVb) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', n, and n' is independently as defined above and as described in the embodiments herein, both alone and in combination.

[0182] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVc) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', n, and n' is independently as defined above and as described in the embodiments herein, both alone and in combination.

[0183] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVb') below or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', and n is independently as defined above and as described in the embodiments herein, both alone and in combination.

[0184] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of formula (IVd) below, or a pharmaceutically acceptable salt thereof: [ka] wherein each of the variables R, R', and R" is independently as defined above and as described herein, both alone and in combination, in the embodiments herein.

[0185] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound of the following formula, or a pharmaceutically acceptable salt thereof: [ka]

[0186] In some embodiments, the methods of the present invention comprise measuring the level of a compound described herein or a pharmaceutically acceptable salt thereof, or a metabolite thereof, in a patient. In some embodiments, the level of a compound described herein or a pharmaceutically acceptable salt thereof, or a metabolite thereof, is measured in a biological sample from the patient. In some embodiments, the patient's biological sample is a blood, plasma, tissue, saliva, and / or serum sample. In some embodiments, the methods of the present invention comprise measuring the level of a compound of Formula (I), Formula (Ia), Formula (Ib), Formula (Ib'), Formula (Ic), and Formula (Id) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the level of a compound of Formula (IV), Formula (IVa), Formula (IVb), Formula (IVb'), Formula (IVc), and Formula (IVd) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of a compound of Formula (I) and Formula (IV) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (I) and Formula (IV) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (Ia) and Formula (IVa) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (Ib) and Formula (IVb) or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (Ib') and Formula (IVb') or a pharmaceutically acceptable salt thereof in a patient. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (Ic) and Formula (IVc) or a pharmaceutically acceptable salt thereof. In some embodiments, the methods of the present invention comprise measuring the total level of the compounds of Formula (Id) and Formula (IVd) or a pharmaceutically acceptable salt thereof.

[0187] 4. Use, Prescription and Administration

[0188] Pharmaceutically Acceptable Compositions

[0189] According to another embodiment, the present invention provides compositions comprising a compound of the present invention or a pharmaceutically acceptable derivative thereof and a pharmaceutically acceptable carrier, adjuvant, or vehicle. In some embodiments, the compositions of the present invention are formulated for administration to a patient in need of such a composition. In some embodiments, the compositions of the present invention are formulated for oral administration to a patient.

[0190] The term "patient", as used herein, means an animal, preferably a mammal, and most preferably a human.

[0191] The term "pharmaceutically acceptable carrier, adjuvant, or vehicle" refers to a non-toxic carrier, adjuvant, or vehicle that does not destroy the pharmacological activity of the compound being formulated. Pharmaceutically acceptable carriers, adjuvants, or vehicles that can be used in the compositions of the present invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.

[0192] "Pharmaceutically acceptable derivative" means any non-toxic salt, ester, salt of an ester, or other derivative of a compound of the invention which, upon administration to a recipient, is capable of providing, either directly or indirectly, a compound of the invention or an active metabolite or residue thereof.

[0193] A "biological sample" suitable for the present invention can be a biological fluid, such as a blood, plasma or serum, saliva, interstitial fluid, or urine sample; a cell sample, such as a cell culture, cell line, or PBMC sample; a tissue biopsy, such as a sample of oral tissue, gastrointestinal tissue, skin, oral mucosa, or multiple samples from a clinical trial.

[0194] The biological sample can be a crude sample or can be purified to various degrees before storage, processing, or measurement. In some embodiments, the biological sample is selected from the group consisting of a biological tissue sample, a whole blood sample, a swab sample, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, a sperm sample, a throat fluid sample, a bronchial fluid sample, a fecal fluid sample, a cerebrospinal fluid sample, a tear sample, and a tissue culture supernatant sample.

[0195] The compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, intravaginally, or via an implanted reservoir. The term "parenteral," as used herein, includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally, or intravenously. Sterile injectable forms of the compositions of the present invention may be aqueous or oily suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be used are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.

[0196] For this purpose, any bland, fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids, such as oleic acid, and its glyceride derivatives, especially in their polyoxyethylated versions, are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants, such as carboxymethylcellulose or similar dispersants, commonly used in the formulation of pharmaceutically acceptable dosage forms, including emulsions and suspensions. Commonly used surfactants, such as Tweens, Spans, and other emulsifiers, or bioavailability enhancers commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms, can also be used for formulation purposes.

[0197] The pharmaceutically acceptable compositions of the present invention can be orally administered in any orally acceptable dosage form, including, but not limited to, capsules, tablets, aqueous suspensions, or solutions. For tablets for oral use, commonly used carriers include lactose and cornstarch. Lubricants, such as magnesium stearate, are also typically added. For oral administration in capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If necessary, certain sweeteners, flavorings, or coloring agents can also be added.

[0198] Alternatively, the pharmaceutically acceptable compositions of the present invention can be administered in the form of suppositories for rectal administration. These can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and therefore melts in the rectum to release the drug. Such materials include cocoa butter, beeswax, and polyethylene glycol.

[0199] Pharmaceutically acceptable compositions of this invention may also be administered topically, particularly when the target of treatment includes areas or organs readily accessible by topical application, including disorders of the eye, skin, or lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[0200] Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically-transdermal patches may also be used.

[0201] For topical application, the prepared pharmaceutically acceptable composition can be formulated into a suitable ointment containing the active ingredient suspended or dissolved in one or more carriers.Carriers for topical application of the compounds of the present invention include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax and water.Alternatively, the prepared pharmaceutically acceptable composition can be formulated into a suitable lotion or cream containing the active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers.

[0202] Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

[0203] For ophthalmic use, the pharmaceutically acceptable composition may be formulated as a micronized suspension in isotonic, pH-adjusted, sterile saline, or preferably as a solution in isotonic, pH-adjusted, sterile saline, either with or without a preservative, such as benzylalkonium chloride. Alternatively, for ophthalmic use, the pharmaceutically acceptable composition may be formulated in an ointment, such as petrolatum.

[0204] The pharmaceutically acceptable compositions of this invention may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the art of pharmaceutical formulation and may be prepared as a solution in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other conventional solubilizing or dispersing agents.

[0205] Most preferably, pharmaceutically acceptable compositions of the present invention are formulated for oral administration. Such formulations can be administered with or without food. In some embodiments, pharmaceutically acceptable compositions of the present invention are administered without food. In other embodiments, pharmaceutically acceptable compositions of the present invention are administered with food.

[0206] The amount of the compounds of the present invention that can be combined with the carrier materials to produce a composition in a single dosage form will vary depending upon the host treated, the particular mode of administration, etc. Preferably, the compositions provided should be formulated so that a dosage of 0.01 to 100 mg / kg body weight / day of the inhibitor can be administered to a patient receiving these compositions.

[0207] It should also be understood that the specific dosage and treatment regimen for any patient will depend upon a variety of factors, including, for example, the activity of the particular compound used, age, body weight, general health, sex, diet, time of administration, excretion rate, drug combination, and the judgment of the treating physician, as well as the severity of the particular disease being treated. The amount of a compound of the invention in the composition will also depend upon the particular compound in the composition.

[0208] Uses of the Compounds and Pharmaceutically Acceptable Compositions

[0209] The compounds and compositions described herein are generally useful for the treatment of viral infections, or inflammatory diseases, disorders or conditions, or cancer.

[0210] As used herein, the terms "treatment," "treat," and "treating" refer to reversing, alleviating, delaying the onset of, or arresting the progression of a disease or disorder described herein or one or more symptoms thereof. In some embodiments, treatment can be administered after one or more symptoms have developed. In other embodiments, treatment can be administered in the absence of symptoms. For example, treatment can be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment can also be continued after symptoms have resolved, e.g., to prevent or delay their recurrence.

[0211] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder or condition, or cancer, comprising administering to a patient in need thereof a compound or composition described herein.

[0212] The compounds and compositions according to the methods of the present invention may be administered using any amount and any route of administration effective for treating or reducing the severity of a disease, disorder, or one or more symptoms described herein. The exact amount required will vary from subject to subject, depending on the subject's species, age, and general condition, the severity of the disease or condition, the particular agent, its mode of administration, and the like. The compounds described herein are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression "dosage unit form," as used herein, refers to a physically discrete unit of agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be determined by the attending physician within the scope of sound medical judgment. The specific effective dosage level for any particular patient or organism will depend upon a variety of factors, including, for example, the disorder to be treated and the severity of the disorder; the activity of the particular compound to be used; the particular composition used; the age, weight, general health, sex, and diet of the patient; the time of administration, route of administration, and excretion rate of the particular compound used; the duration of treatment; drugs used in combination with or concomitantly with the particular compound used; and similar factors well known in the medical arts. The term "patient", as used herein, means an animal, preferably a mammal, and most preferably a human.

[0213] The pharmaceutically acceptable compositions of the present invention can be administered to humans and other animals orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (such as powders, ointments, or drops), bucally, as an oral or nasal spray, etc., depending on the severity of the infection being treated. In certain embodiments, the compounds of the present invention can be administered orally or parenterally, one or more times daily, at a dosage level of about 0.01 mg / kg to about 50 mg / kg, preferably about 1 mg / kg to about 25 mg / kg, of the subject's body weight per day to achieve the desired therapeutic effect.

[0214] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, germ, olive, castor oil, and sesame oil), glycerol, tetrafurfuryl alcohol, polyethylene glycol, fatty acid esters of sorbitan, etc., and mixtures thereof. In addition to inert diluents, the oral compositions may also contain auxiliary agents, such as wetting agents, emulsifying and suspending agents, sweeteners, flavorings, and aromatics.

[0215] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations can also be sterile injectable solutions, suspensions, or emulsions in non-toxic parenterally acceptable diluents or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, United States Pharmacopoeia (USP), and isotonic sodium chloride solution. Additionally, sterile, fixed oils are conventionally used as solvents or suspending media. For this purpose, any bland, fixed oil, including synthetic monoglycerides or diglycerides, can be used. Additionally, fatty acids, such as oleic acid, are used for the preparation of injectables.

[0216] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0217] To prolong the effect of a compound of the present invention, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material with poor water solubility. Furthermore, the rate of absorption of a compound depends on its rate of dissolution, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form can be accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers, such as polylactide-polyglycolide. Depending on the ratio of compound to polymer and the nature of the particular polymer used, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0218] Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds described herein with a suitable non-irritating excipient or carrier such as cocoa butter, polyethylene glycol or a suppository wax which is solid at ambient temperature but liquid at body temperature and therefore melts in the rectum or vaginal cavity to release the active agent.

[0219] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier, such as sodium citrate or dicalcium phosphate, and / or a) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia; c) hygroscopic agents, such as glycerol; d) disintegrants, such as agar, calcium carbonate, potato starch, or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retardants. agents such as paraffin, f) absorption enhancers such as quaternary ammonium compounds, g) wetting agents such as cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also contain buffering agents.

[0220] Solid compositions of a similar type can also be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycols. Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They can optionally contain opacifying agents and can be of a composition that they release one or more active ingredients only, preferably in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type can also be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycols.

[0221] The active compound can also be in the form of microencapsulation with one or more excipients as described above.Solid dosage forms such as tablets, sugar-coated tablets, capsules, pills and granules can be prepared with coatings and shells, such as enteric coatings, release-controlling coatings and other coatings well known in the pharmaceutical formulation field.In such solid dosage forms, the active compound can be mixed with at least one inert diluent, such as sucrose, lactose or starch.

[0222] Such dosage forms may also contain, as is common practice, additional substances other than inert diluents, such as tableting lubricants and other tableting aids, such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may also contain buffering agents. They may optionally contain opacifying agents and may be of a composition that they release one or more active ingredients only, preferably in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0223] Dosage forms for topical or transdermal administration of a compound of this invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches.

[0224] The active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and, if necessary, any necessary preservatives or buffers. Ophthalmic formulations, ear drops, and eye drops are also contemplated within the scope of the present invention. In addition, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of the compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in a suitable medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled either by providing a rate-controlling membrane or by dispersing the compound in a polymer matrix or gel.

[0225] Inflammatory diseases, disorders or conditions

[0226] The compounds described herein are useful in the treatment of inflammatory or obstructive airway diseases, resulting in, for example, a reduction in tissue damage, airway inflammation, bronchial hyperresponsiveness, remodeling, or disease progression. In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory or obstructive airway disease, such as asthma of any type or origin, including both intrinsic (non-allergic) asthma and extrinsic (allergic) asthma, including mild asthma, moderate asthma, severe asthma, bronchial asthma, exercise-induced asthma, occupational asthma, and asthma induced after bacterial infection. Treatment of asthma should also be understood to include treatment of subjects, e.g., subjects under the age of 4 or 5, who exhibit wheezing symptoms and have been diagnosed or are diagnosable as "wheezing infants" (an established patient category of major medical concern and currently often identified as an early or early-stage asthma patient).

[0227] The compounds described herein are useful in treating heteroimmune diseases. In some embodiments, the inflammatory disease, disorder or condition is a heteroimmune disease, including but not limited to graft-versus-host disease, transplant, blood transfusion, anaphylaxis, allergy (e.g., allergy to plant pollen, latex, drugs, food, insect venom, animal hair, animal dander, mite dust or cockroach calyx), type I hypersensitivity, allergic conjunctivitis, allergic rhinitis, and atopic dermatitis.

[0228] A prophylactic effect in the treatment of asthma may be evidenced by a reduced frequency or severity of symptomatic attacks, e.g., a reduced frequency or severity of attacks of acute asthma or bronchoconstrictors, an improvement in lung function, or improved airway hyperresponsiveness. It may also be evidenced by a reduced need for other symptomatic therapies, such as anti-inflammatory drugs or bronchodilators, to limit or terminate symptomatic attacks or treatments intended to limit or terminate symptomatic attacks if they occur. A prophylactic effect in asthma may be particularly observed in subjects prone to "morning dipping." "Morning dipping" is a recognized asthma syndrome common to a significant proportion of asthmatics and characterized by an asthma attack between about 4:00 AM and about 6:00 AM, i.e., a time usually substantially removed from previously administered symptomatic asthma therapy.

[0229] In some embodiments, the inflammatory disease, disorder, or condition is selected from acute lung injury (ALI), adult / acute respiratory distress syndrome (ARDS), chronic obstructive pulmonary disease (COPD), chronic obstructive airways disease (COAD), or chronic obstructive lung disease (COLD), including chronic bronchitis or the breathing difficulties associated therewith, emphysema, and airway hyperresponsiveness due to other medications, particularly other inhaled medications. In some embodiments, the inflammatory disease, disorder, or condition is bronchitis, wherein the bronchitis is bronchitis of any type or genesis, including, but not limited to, acute bronchitis, arachidic bronchitis, catarrhal bronchitis, croupus bronchitis, chronic bronchitis, or tuberculous bronchitis. In some embodiments, the inflammatory disease, disorder, or condition is pneumoconiosis of any type or origin (an inflammatory, generally occupational, lung disease, whether chronic or acute, frequently associated with airway obstruction and caused by repeated inhalation of dust), such as pneumoconiosis, including aluminosis, anthracosis, asbestosis, chalicosis, ptilosis, siderosis, silicosis, tobacco poisoning, and byssinosis.

[0230] In some embodiments, the inflammatory disease, disorder, or condition is an eosinophil-associated disorder, e.g., eosinophilia. In some embodiments, the eosinophil-associated disorder is an eosinophil-associated disorder of the respiratory tract (e.g., including pathological eosinophil infiltration of lung tissue), e.g., including hypereosinophilia affecting the airways and / or lungs, and eosinophil-associated disorders of the respiratory tract caused by, e.g., Löffler's syndrome, eosinophilic pneumonia, parasitic (particularly metazoan) infestation (including tropical eosinophilia), bronchopulmonary aspergillosis, polyarteritis nodosa (including Churg-Strauss syndrome), eosinophilic granuloma, and eosinophil-associated disorders affecting the airways caused by drug reactions.

[0231] The compounds described herein are also useful in treating inflammatory or allergic skin conditions, such as psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity vasculitis, urticaria, bullous pemphigoid, lupus erythematosus, systemic lupus erythematosus, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, acne vulgaris, and other inflammatory or allergic skin conditions.

[0232] In some embodiments, the inflammatory disease, disorder, or condition is a disease or condition having an inflammatory component, for example, diseases and conditions of the eye, such as ocular allergies, conjunctivitis, keratoconjunctivitis sicca, uveitis, and vernal conjunctivitis, diseases and conditions affecting the nose (including allergic rhinitis), inflammatory diseases involving an autoimmune response or having an autoimmune component or etiology (including autoimmune blood disorders (e.g., hemolytic anemia, aplastic anemia, true erythrocytic anemia, and idiopathic thrombocytopenia)), systemic lupus erythematosus, rheumatoid arthritis, polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic hepatitis, myasthenia gravis, Stevens-Johnson syndrome, idiopathic sprue, sprue), autoimmune inflammatory bowel disease (e.g., ulcerative colitis and Crohn's disease), irritable bowel syndrome, celiac disease, periodontitis, pulmonary hyaline membrane disease, kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine ophthalmopathy, Graves' disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), Sjogren's syndrome, keratoconjunctivitis sicca, uveitis, and vernal conjunctivitis keratoconjunctivitis), interstitial pulmonary fibrosis, psoriatic arthritis, systemic juvenile idiopathic arthritis, cryopyrin-associated periodic syndrome, Muckle-Wells syndrome, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (with or without nephrotic syndrome, including idiopathic nephrotic syndrome or minor change nephropathy), chronic granulomatous disease, endometriosis, leptospirosis kidney disease, glaucoma, retinopathy, aging, headache, pain, complex regional pain syndrome, cardiac hypertrophy, muscle fatigue wasting, dysphagia, obesity, fetal growth retardation, intestinal failure, hypercholesterolemia, heart disease, chronic heart failure, mesothelioma, anhidrotic ectodermal dysplasia, Behçet's disease, incontinentia pigmenti, Paget's disease, acute or chronic pancreatitis, hereditary periodic fever syndromes, asthma (allergic and non-allergic, mild, moderate, severe, bronchitis, and exercise-induced), acute lung injury, acute respiratory distress syndrome, eosinophilia, hypersensitivity, anaphylaxis, nasal sinusitis, ocular allergies, silica-induced diseasediseases), COPD (reduction of damage, airway inflammation, bronchial hyperresponsiveness, remodeling, or disease progression), lung disease, cystic fibrosis, acid-induced lung injury, pulmonary hypertension, polyneuropathy, cataracts, muscle inflammation associated with systemic sclerosis, inclusion body myositis, myasthenia gravis, thyroiditis, Addison's disease, lichen planus, type 1 or type 2 diabetes, appendicitis, atopic dermatitis, asthma, allergies, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic transplant rejection, colitis, conjunctivitis, Crohn's disease, cystitis, dacryoadenitis, dermatitis, dermatomyositis, cerebral inflammation, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, connective tissue inflammation, gastritis, gastroenteritis, Henoch-Schönlein purpura, hepatitis, hidradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis, myocarditis, myositis, nephritis, oophoritis, orchitis, osteitis, otitis, pancreatitis, parotitis, pericarditis, peritonitis, pharyngitis, pleuritis, phlebitis, interstitial pneumonia, pneumonia, polymyositis, proctitis, prostatitis, pyelonephritis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, tendonitis, tonsillitis, ulcerative colitis, uveitis, vaginitis, vasculitis, or vulvitis.

[0233] In some embodiments, the inflammatory disease, disorder, or condition is acute or chronic transplant rejection in kidney, liver, heart, or lung transplants, or graft-versus-host disease in bone marrow transplants.

[0234] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disease, disorder, or condition of the skin, hi some embodiments, the inflammatory disease, disorder, or condition of the skin is selected from contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity vasculitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, and other inflammatory or allergic conditions of the skin.

[0235] In some embodiments, the inflammatory disease, disorder, or condition is selected from acute and chronic gout, chronic gouty arthritis, psoriasis, psoriatic arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, systemic jubenile idiopathic arthritis (SJIA), cryopyrin associated periodic syndrome (CAPS), Muckle-Wells syndrome, and osteoarthritis.

[0236] In some embodiments, the inflammatory disease, disorder, or condition is a TH17-mediated disease. In some embodiments, the TH17-mediated disease is selected from systemic lupus erythematosus, multiple sclerosis, and inflammatory bowel disease (including Crohn's disease or ulcerative colitis).

[0237] In some embodiments, the inflammatory disease, disorder or condition is selected from Sjogren's syndrome, allergic disorders, osteoarthritis, eye conditions such as ocular allergies, conjunctivitis, keratoconjunctivitis sicca and vernal conjunctivitis, and diseases affecting the nose such as allergic rhinitis.

[0238] In some embodiments, the inflammatory disease, disorder, or condition is associated with transplantation. In some embodiments, the inflammatory disease, disorder, or condition is associated with organ transplantation, organ transplant rejection, and / or graft-versus-host disease.

[0239] In some embodiments, the inflammatory disease, disorder, or condition is an autoimmune disorder, ie, type 1 diabetes, systemic lupus erythematosus, multiple sclerosis, psoriasis, Behcet's disease, POEMS syndrome, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondyloarthritis, primary biliary cirrhosis, autoimmune hepatitis, or inflammatory bowel disease.

[0240] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disorder, ie, rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, psoriasis, hepatomegaly, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondyloarthritis, primary biliary cirrhosis, polymyalgia rheumatica, giant cell arteritis, or inflammatory bowel disease.

[0241] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the pancreas, in some embodiments, the inflammatory disease, disorder, or condition of the pancreas is selected from type 1 diabetes, type 2 diabetes, acute pancreatitis, and chronic pancreatitis.

[0242] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the kidney, hi some embodiments, the inflammatory disease, disorder, or condition of the kidney is selected from glomerulosclerosis, glomerulonephritis, nephritis, acute kidney injury, Berger's disease, Goodpasture's syndrome, Wegener's granulomatosis, and acute or chronic rejection of a kidney transplant.

[0243] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition in the liver, hi some embodiments, the inflammatory disease, disorder, or condition is selected from nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, and acute or chronic rejection of a liver transplant.

[0244] In some embodiments, the present invention provides a method for treating a pulmonary inflammatory disease, disorder, or condition, in some embodiments, the pulmonary inflammatory disease, disorder, or condition is selected from chronic obstructive pulmonary disease (COPD), asthma, pulmonary fibrosis, pulmonary hypertension, sarcoidosis, and acute or chronic lung transplant rejection.

[0245] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the skin, in some embodiments, the inflammatory disease, disorder, or condition of the skin is selected from contact dermatitis, atopic dermatitis, psoriasis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity vasculitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, acne, keloid scars, and other inflammatory or allergic conditions of the skin.

[0246] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the blood vessels / blood, in some embodiments, the inflammatory disease, disorder, or condition of the blood vessels / blood is selected from Behcet's disease, vasculitis, sepsis, tumor angiogenesis, atherosclerosis, proliferative vascular disease, and restenosis.

[0247] In some embodiments, the present invention provides a method for treating an ophthalmic inflammatory disease, disorder, or condition, in which the ophthalmic inflammatory disease, disorder, or condition is selected from conjunctivitis, scleritis, episcleritis, panuveitis, choroiditis, chorioretinitis, neuroretinitis, uveitis, orbital inflammatory disease, and optic neuritis.

[0248] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the central or peripheral nervous system, in which the inflammatory disease, disorder, or condition is selected from non-viral and viral encephalitis and meningitis, depression, neuropathic pain including chronic pain, traumatic brain injury including stroke, Alzheimer's disease, Parkinson's disease, myelitis, Charcot-Marie-Tooth type 1 disease (including CMT1A and CMT1B), multiple sclerosis, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, demyelinating polyneuropathy, and peripheral neuropathy.

[0249] In some embodiments, the present invention provides a method for treating an autoimmune disease, disorder, or condition, in some embodiments, the autoimmune disease, disorder, or condition is selected from lupus, including lupus of the skin and kidney, Guillain-Barré syndrome, myasthenia gravis, Hashimoto's thyroiditis, idiopathic purpura, aplastic anemia, Leve's disease, and myocarditis.

[0250] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the intestine, hi some embodiments, the inflammatory disease, disorder, or condition of the intestine is selected from intestinal failure, ulcerative colitis, and Crohn's disease.

[0251] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the reproductive system, hi some embodiments, the inflammatory disease, disorder, or condition of the reproductive system is selected from endometriosis, uterine fibroids, prostate dysplasia or growth, and cervical dysplasia.

[0252] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of bone and / or joints, hi some embodiments, the inflammatory disease, disorder, or condition of bone and / or joints is selected from juvenile idiopathic arthritis, psoriatic arthritis, periodontitis, and arthritis and / or demineralization of the hands, feet, ankles, knees, hips, shoulders, elbows, or spine.

[0253] In some embodiments, the present invention provides methods for treating inflammatory disorders or conditions associated with or coexisting with AIDS.

[0254] Combination Therapy for Inflammatory Diseases, Disorders, or Conditions

[0255] Depending on the particular condition, or disease, to be treated, additional therapeutic agents that are normally administered to treat that condition may be administered in combination with the compounds and compositions described herein. As used herein, additional therapeutic agents that are normally administered to treat a particular disease or condition are known as "appropriate for the disease, or condition, being treated."

[0256] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition, comprising administering to a patient in need thereof a compound or composition described herein in combination with other therapeutic agents.

[0257] These additional agents can be administered separately from the combined therapy provided as part of a multiple dose regimen. Alternatively, these agents can be part of a single dosage form and mixed together with the compound of the present invention in a single composition. When administered as part of a multiple dose regimen, the two active agents can be given simultaneously, sequentially, or within a period of each other, usually within 5 hours of each other.

[0258] As used herein, the terms "combination," "combined," and related terms refer to simultaneous or sequential administration of agents according to the invention. For example, the combination of the invention may be administered with another therapeutic agent simultaneously or sequentially in individual unit dosage forms, or together in a single unit dosage form.

[0259] The amount of additional therapeutic agent present in the compositions of the invention will not exceed the amount that would normally be administered in a composition comprising that therapeutic agent as the only active agent. Preferably, the amount of additional therapeutic agent in the presently disclosed compositions will range from about 50% to about 100% of the amount that would normally be present in a composition comprising that agent as the only therapeutically active agent.

[0260] The combination may result in an additive or synergistic effect, where lower doses of one or both of the compounds may be used to obtain similar efficacy, or the same doses may result in significantly improved efficacy.

[0261] In some embodiments, the present invention provides compositions comprising a compound described herein and one or more additional therapeutic agents. The therapeutic agents can be administered together with the compounds described herein, or can be administered before or after the administration of the compounds described herein. Suitable therapeutic agents are described in more detail below. In some embodiments, the compounds described herein can be administered up to 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, or 18 hours before the therapeutic agent. In some embodiments, the compounds described herein may be administered up to 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, or 18 hours after the therapeutic agent.

[0262] In some embodiments, the present invention provides methods for treating an inflammatory disease, disorder, or condition by administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents. Such additional therapeutic agents may be small molecules or recombinant biological agents, and may include, for example, acetaminophen, non-steroidal anti-inflammatory drugs (NSAIDS), or other therapeutic agents. drugs such as aspirin, ibuprofen, naproxen, etodolac (Lodine™) and celecoxib, colchicine (Colcrys™), corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, etc., probenecid, allopurinol, febuxostat (Uloric™), sulfasalazine (Azulfidine™), antimalarials such as hydroxychloroquine (Plaquenil™) and chloroquine (Aralen™), methotrexate (Rheumatrex™), gold salts such as aurothioglucose (Solganal™), aurothiomalate (Myochrysine™) and auranofin (Ridaura™), D-penicillamine (Depen™ or Cuprimine™), azathioprine (Imuran™), cyclophosphamide (Cytoxan™), chlorambucil (Leukeran™), cyclosporine (Sandimmune™, Neoral™), tacrolimus, sirolimus, mycophenolate, leflunomide (Arava™), and "anti-TNF" agents such as etanercept (Enbrel™), infliximab (Remicade™), golimumab (Simponi™), certolizumab pegol (Cimzia™) and adalimumab (Humira™), "anti-IL-1" agents such as anakinra (Kineret™) and rilonacept (Arcalyst™), anti-T cell antibodies such as thymoglobulin, IV immunoglobulin (IVIg: IV Immunoglobulins), canakinumab (Ilaris™), anti-Jak inhibitors,Antibodies such as tofacitinib, antibodies such as rituximab (Rituxan™), "anti-T-cell" agents such as abatacept (Orencia™), "anti-IL-6" agents such as tocilizumab (Actemra™), diclofenac, cortisone, hyaluronic acid (Synvisc™ or Hyalgan™), monoclonal antibodies such as tanezumab, anticoagulants such as heparin (Calcinparine™ or Liquaemin™) and warfarin (Coumadin™), antidiarrheals such as diphenoxylate (Lomotil™), ) and loperamide (Imodium™), bile acid binders such as cholestyramine, alosetron (Lotronex™), lubiprostone (Amitiza™), laxatives such as milk of magnesia, polyethylene glycol (MiraLax™), Dulcolax™, Correctol™ and Senokot™, anticholinergics or antispasmodics such as dicyclomine (Bentyl™), Singulair™, beta2 agonists such as albuterol (Ventolin™), HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergics agents), such as ipratropium bromide (Atrovent™) and tiotropium (Spiriva™), inhaled corticosteroids, such as beclomethasone dipropionate (Beclovent™, Qvar™ and Vanceril™), triamcinolone acetonide (Azmacort™), mometasone (Asthmanex™), budesonide (Pulmocort™) and flunisolide (Aerobid™, Afviar™, Symbicort™, Dulera™), sodium cromoglycate (Intal™), methylxanthines,for example theophylline (Theo-Dur™, ​​Theolair™, Slo-bid™, Uniphyl™, Theo-24™), and aminophylline, IgE antibodies such as omalizumab (Xolair™), nucleoside reverse transcriptase inhibitors such as zidovudine (Retrovir™), abacavir (Ziagen™), abacavir / lamivudine (Epzicom™), abacavir / lamivudine / zidovudine (Trizivir™), didanosine (Videx™), Emtri citabine (Emtriva™), lamivudine (Epivir™), lamivudine / zidovudine (Combivir™), stavudine (Zerit™) and zalcitabine (Hivid™), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor™), efavirenz (Sustiva™), nevirapine (Viramune™) and etravirine (Intelence™), nucleotide reverse transcriptase inhibitors such as tenofovir (Virevir™), ad™), protease inhibitors such as amprenavir (Agenerase™), atazanavir (Reyataz™), darunavir (Prezista™), fosamprenavir (Lexiva™), indinavir (Crixivan™), lopinavir and ritonavir (Kaletra™), nelfinavir (Viracept™), ritonavir (Norvir™), saquinavir (Fortovase™ or Invirase™) and tipranavir (Aptivus™). )), entry inhibitors such as enfuvirtide (Fuzeon™) and maraviroc (Selzentry™), integrase inhibitors such as raltegravir (Isentress™), doxorubicin (Hydrodaunorubicin™), vincristine (Oncovin™), dexamethasone (Decadron™) in combination with bortezomib (Velcade™) and lenalidomide (Revlimid™), anti-IL36 agents such as BI655130,Dihydroorotate dehydrogenase inhibitors, e.g., IMU-838, anti-OX40 agents, e.g., KHK-4083, microbiome agents, e.g., RBX2660, SER-287, narrow-spectrum kinase inhibitors, e.g., TOP-1288, anti-CD40 agents, e.g., BI-655064 and FFP-104, guanylate cyclase agonists, e.g., dolcatide, sphingosine kinase inhibitors, e.g., opaganib, anti-IL-12 / IL-23 agents, e.g., AK-101, ubiquitin protein ligases enzyme inhibitors, for example BBT-401, sphingosine receptor modulators, for example BMS-986166, P38MAPK / PDE4 inhibitors, for example CBS-3595, CCR9 antagonists, for example CCX-507, FimH antagonists, for example EB-8018, HIF-PH inhibitors, for example FG-6874, HIF-1α stabilizers, for example GB-004, MAP3K8 protein inhibitors, for example GS-4875, LAG-3 antibodies, for example GSK-2831781, RIP2 kinase inhibitors such as GSK-2983559, farnesoid X receptor agonists such as MET-409, CCK2 antagonists such as PNB-001, IL-23 receptor antagonists such as PTG-200, purinergic P2X7 receptor antagonists such as SGM-1019, PDE4 inhibitors such as apremilast, ICAM-1 inhibitors such as alicaforsen sodium, anti-IL23 agents such as guselkumab, brazikumab and mirquizumab, anti-IL-15 agents such as A MG-714, TYK-2 inhibitors such as BMS-986165, NK cell activators such as CNDO-201, RIP-1 kinase inhibitors such as GSK-2982772, anti-NKGD2 agents such as JNJ-4500, CXCL-10 antibodies such as JT-02, IL-22 receptor agonists such as RG-7880, GATA-3 antagonists such as SB-012, and colony-stimulating factor-1 receptor inhibitors such as edicotinib, or any one or more combinations thereof.

[0263] In another embodiment, the present invention provides a method of treating gout, comprising administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents selected from nonsteroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine™), and celecoxib, colchicine (Colcrys™), corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, and the like, probenecid, allopurinol, and febuxostat (Uloric™).

[0264] In another embodiment, the present invention provides a method of treating rheumatoid arthritis, comprising administering to a patient in need thereof a compound described herein and nonsteroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine™), and celecoxib, corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, and the like, sulfasalazine (Azulfidine™), antimalarials such as hydroxychloroquine (Plaquenil™) and chloroquine (Aralen™), methotrexate (Rheumatrex™), gold salts such as aurothioglucose (Solganal™), aurothiomalate (Myochrysine™), and auranofin (Ridaura™), D-penicillamine (Depen™ or Cuprimine™), azathioprine, or the like. (Imuran™), cyclophosphamide (Cytoxan™), chlorambucil (Leukeran™), cyclosporine (Sandimmune™), leflunomide (Arava™), and "anti-TNF" agents such as etanercept (Enbrel™), infliximab (Remicade™), golimumab (Simponi™), certolizumab pegol (Cimzia™), and amphetamines. and one or more additional therapeutic agents selected from dalimumab (Humira™), "anti-IL-1" agents such as anakinra (Kineret™) and rilonacept (Arcalyst™), antibodies such as rituximab (Rituxan™), "anti-T-cell" agents such as abatacept (Orencia™), and "anti-IL-6" agents such as tocilizumab (Actemra™).

[0265] In some embodiments, the present invention provides a method of treating osteoarthritis, comprising administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents selected from acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine™), and celecoxib, diclofenac, cortisone, hyaluronic acid (Synvisc™ or Hyalgan™), and monoclonal antibodies, such as tanezumab.

[0266] In some embodiments, the present invention provides a method of treating lupus, comprising administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents selected from acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine™), and celecoxib, corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, and the like, antimalarials such as hydroxychloroquine (Plaquenil™) and chloroquine (Aralen™), cyclophosphamide (Cytoxan™), methotrexate (Rheumatrex™), azathioprine (Imuran™), and anticoagulants such as heparin (Calcinparine™ or Liquaemin™) and warfarin (Coumadin™).

[0267] In some embodiments, the present invention provides a method of treating Crohn's disease, ulcerative colitis, or inflammatory bowel disease, comprising administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents selected from mesalamine (Asacol™), sulfasalazine (Azulfidine™), antidiarrheals such as diphenoxylate (Lomotil™) and loperamide (Imodium™), bile acid binders such as cholestyramine, alosetron (Lotronex™), lubiprostone (Amitiza™), laxatives such as milk of magnesia, polyethylene glycol (MiraLax™, Dulcolax™, Correctol™, and Senokot™), and anticholinergics or antispasmodics such as dicyclomine (Bentyl™), anti-TNF therapy, steroids, and antibiotics such as Flagyl or ciprofloxacin.

[0268] In some embodiments, the present invention provides a method of treating asthma, comprising administering to a patient in need thereof a compound described herein and one or more of the following: Singulair™; beta-2 agonists such as albuterol (Ventolin™ HFA, Proventil™ HFA), levalbuterol (Xopenex™), metaproterenol (Alupent™), pirbuterol acetate (Maxair™), terbutaline sulfate (Brethaire™), salmeterol xinafoate (Serevent™), and formoterol (Foradil™); anticholinergics such as ipratropium bromide (Atrovent™) and tiotropium (Spiriva™); inhaled corticosteroids such as prednisone, prednisolone, beclomethasone dipropionate (Beclovent™, Qvar™, and Vanceril™); triamcinolone acetonide; and one or more additional therapeutic agents selected from: methadone (Azmacort™), mometasone (Asthmanex™), budesonide (Pulmocort™), flunisolide (Aerobid™), Afviar™, Symbicort™, and Dulera™, sodium cromoglycate (Intal™), methylxanthines such as theophylline (Theo-Dur™, ​​Theolair™, Slo-bid™, Uniphyl™, Theo-24™), and aminophylline, and IgE antibodies such as omalizumab (Xolair™).

[0269] In some embodiments, the present invention provides a method of treating COPD, comprising administering to a patient in need thereof a compound described herein and a β2 agonist, such as albuterol (Ventolin™ HFA, Proventil™ HFA), levalbuterol (Xopenex™), metaproterenol (Alupent™), pirbuterol acetate (Maxair™), terbutaline sulfate (Brethaire™), salmeterol xinafoate (Serevent™) and formoterol (Foradil™), an anticholinergic, such as ipratropium bromide (Atrovent™) and tiotropium (Spiriva™), a methylxanthine, such as theophylline (Theo-Dur™, ​​Theolair™, Slo-bid™, Uniphyl™), or a combination of these. and one or more additional therapeutic agents selected from the group consisting of benzodiazepines (e.g., benzodiazepines), ...

[0270] In some embodiments, the present invention provides a method of treating HIV, comprising administering to a patient in need thereof a compound described herein and a nucleoside reverse transcriptase inhibitor, such as zidovudine (Retrovir™), abacavir (Ziagen™), abacavir / lamivudine (Epzicom™), abacavir / lamivudine / zidovudine (Trizivir™), didanosine (Videx™), emtricitabine (Emtriva™), or a combination of these two. (trademark), lamivudine (Epivir™), lamivudine / zidovudine (Combivir™), stavudine (Zerit™) and zalcitabine (Hivid™), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor™), efavirenz (Sustiva™), nevirapine (Viramune™) and etravirine (Intelence™), nucleoside and one or more additional therapeutic agents selected from a protease inhibitor such as a leutidine reverse transcriptase inhibitor, e.g., tenofovir (Viread™), a protease inhibitor such as amprenavir (Agenerase™), atazanavir (Reyataz™), darunavir (Prezista™), fosamprenavir (Lexiva™), indinavir (Crixivan™), lopinavir and ritonavir (Kaletra™), nelfinavir (Viracept™), ritonavir (Norvir™), saquinavir (Fortovase™ or Invirase™), and tipranavir (Aptivus™), an entry inhibitor such as enfuvirtide (Fuzeon™) and maraviroc (Selzentry™), an integrase inhibitor such as raltegravir (Isentress™), and combinations thereof.

[0271] In some embodiments, the present invention provides a method of treating organ transplant rejection or graft-versus-host disease, comprising administering to a patient in need thereof a compound described herein and one or more additional therapeutic agents selected from a steroid, cyclosporine, FK506, rapamycin, a hedgehog signaling inhibitor, a BTK inhibitor, a JAK / pan-JAK inhibitor, a TYK2 inhibitor, a PI3K inhibitor, and a SYK inhibitor.

[0272] The compounds of the present invention are also useful as combination therapeutic compounds for use in combination with other active ingredients, particularly anti-inflammatory active ingredients, bronchodilatory active ingredients, or antihistamine active ingredients, such as those described hereinabove, in the treatment of obstructive or inflammatory airway diseases, for example, as enhancers of the therapeutic activity of such drugs or as a means of reducing the required dosage or potential side effects of such drugs. The compounds of the present invention can be mixed with the other active ingredients in a fixed pharmaceutical composition, or can be administered separately before, simultaneously with, or after the other active ingredients. Thus, the present invention encompasses combinations of the compounds of the present invention described hereinabove with anti-inflammatory active ingredients, bronchodilatory active ingredients, antihistamine active ingredients, or antitussive active ingredients, wherein the compounds of the present invention and the active ingredients are in the same or different pharmaceutical compositions.

[0273] Suitable anti-inflammatory drugs include steroids, in particular glucocorticosteroids, such as budesonide, beclomethasone dipropionate, fluticasone propionate, ciclesonide furoate or mometasone furoate; non-steroidal glucocorticoid receptor agonists; LTB antagonists, such as LY293111, CGS025019C, CP-195543, SC-53228, BIIL 284, ONO 4057, SB 209247; LTD antagonists, such as montelukast and zafirlukast; PDE inhibitors, such as cilomilast (Ariflo™ GlaxoSmithKline), roflumilast (Byk Gulden), V-11294A (Napp), BAY19-8004 (Bayer), SCH-5 351591 (Schering-Plough), Arofylline (Almirall Prodesfarma), PD189659 / PD168787 (ParkeDavis), AWD-12-281 (Asta Medica), CDC-801 (Celgene), SeICID™ CC-10004 (Celgene), VM554 / UM565 (Vernalis), T-440 (Tanabe), KW-4490 (Kyowa Hakko Kogyo); A2a agonists; A2b antagonists; and beta-2 adrenoceptor agonists such as albuterol (salbutamol), metaproterenol, terbutaline, salmeterol, fenoterol, procaterol, especially formoterol, and pharmaceutically acceptable salts thereof. Suitable bronchodilators include anticholinergic or antimuscarinic compounds, particularly ipratropium bromide, oxitropium bromide, tiotropium salts and CHF 422 (Chiesi), and glycopyrrolate.

[0274] Suitable antihistamine substances include cetirizine hydrochloride, acetaminophen, clemastine fumarate, promethazine, loratidine, desloratidine, diphenhydramine and fexofenadine hydrochloride, activastine, astemizole, azelastine, ebastine, epinastine, mizolastine and terfenadine.

[0275] Other useful combinations of compounds of the invention with anti-inflammatory agents include antagonists of chemokine receptors, such as CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR-8, CCR-9 and CCR10, CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, particularly CCR-5 antagonists, such as Schering-Plough antagonists. and combinations with SC-351125, SCH-55700 and SCH-D, and Takeda antagonists such as N-[[4-[[[6,7-dihydro-2-(4-methylphenyl)-5H-benzo-cyclohepten-8-yl]carbonyl]amino]phenyl]-methyl]tetrahydro-N,N-dimethyl-2H-pyran-4-ammonium chloride (TAK-770).

[0276] The structures of active compounds identified by code numbers, generic names or trade names can be obtained from the working edition of the standard compendium "The Merck Index" or from databases such as Patents International (eg IMS World Publications).

[0277] The compounds of the present invention may be administered alone or in combination with one or more other therapeutic compounds, where possible combination therapy takes the form of a fixed combination, or the administration of the compound of the present invention and one or more other therapeutic compounds is staggered or given independently of each other, or a fixed combination and combined administration of one or more other therapeutic compounds.

[0278] These additional agents may be administered separately from the compound-containing composition of the present invention as part of a multiple dose regimen. Alternatively, the agents may be part of a single dosage form and mixed together with the compound of the present invention in a single composition. When administered as part of a multiple dose regimen, the two active agents may be given simultaneously, sequentially, or within a period of each other, usually within 5 hours of each other.

[0279] As used herein, the terms "combination," "combined," and related terms refer to simultaneous or sequential administration of therapeutic agents according to the present invention. For example, a combination of the present invention may be administered with another therapeutic agent simultaneously or sequentially in individual unit dosage forms, or together in a single unit dosage form. Thus, the present invention provides a single unit dosage form comprising a compound of the present invention, an additional therapeutic agent, and a pharmaceutically acceptable carrier, adjuvant, or vehicle.

[0280] The amount of both the compounds described herein and the additional therapeutic agent (in those compositions containing additional therapeutic agents as described above) that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. Preferably, the compositions of this invention should be formulated so that a dosage of 0.01 to 100 mg / kg body weight / day of the compound of this invention can be administered.

[0281] In these compositions containing an additional therapeutic agent, the additional therapeutic agent and the compound of the present invention may act synergistically. Therefore, the amount of the additional therapeutic agent in such compositions will be less than the amount required in a monotherapy utilizing only that therapeutic agent. In such compositions, a dosage of 0.01 to 1,000 μg / kg body weight / day of the additional therapeutic agent can be administered.

[0282] The amount of additional therapeutic agent present in the compositions of the invention will not exceed the amount that would normally be administered in a composition comprising that therapeutic agent as the only active agent. Preferably, the amount of additional therapeutic agent in the presently disclosed compositions will range from about 50% to about 100% of the amount that would normally be present in a composition comprising that agent as the only therapeutically active agent.

[0283] The compounds of the present invention, or pharmaceutical compositions thereof, can also be incorporated into compositions for coating implantable medical devices, artificial prostheses, artificial valves, vascular grafts, stents, and catheters. Vascular stents, for example, have been used to overcome restenosis (re-narrowing of the blood vessel wall after injury). However, patients using stents or other implantable devices are at risk of blood clot formation or platelet activation. These undesirable effects can be prevented or mitigated by pre-coating the device with a pharmaceutically acceptable composition containing a kinase inhibitor. An implantable device coated with the compounds of the present invention is another embodiment of the present invention.

[0284] cancer

[0285] The cancer, in one embodiment, is selected from the group consisting of leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease or non-Hodgkin's disease), Waldenstrom's hypergammaglobulinemia, multiple myeloma, heavy chain disease, and solid tumors, such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial tumor, lymphangiosarcoma, lymphangioendothelial tumor, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, and the like). Cancers include, but are not limited to, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung carcinoma, bladder cancer, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neuroblastoma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0286] In some embodiments, the cancer is a glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neuroblastoma, meningioma, melanoma, neuroblastoma, or retinoblastoma.

[0287] In some embodiments, the cancer is an acoustic neuroma, an astrocytoma (e.g., grade I - pilocytic astrocytoma, grade II - low-grade astrocytoma, grade III - malignant astrocytoma, or grade IV - glioblastoma (GBM)), chordoma, CNS lymphoma, craniopharyngioma, brain stem glioma, ependymoma, mixed glioma, optic glioma, subependymoma, medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumor, primitive neuroectodermal tumor (PNET), or schwannoma. In some embodiments, the cancer is a type that is more common in children than adults, such as brainstem glioma, craniopharyngioma, ependymoma, juvenile pilocytic astrocytoma (JPA), medulloblastoma, optic nerve glioma, pineal tumor, primitive neuroectodermal tumors (PNET), or rhabdoid tumor. In some embodiments, the patient is an adult human. In some embodiments, the patient is a child or pediatric patient.

[0288] The cancer may, in other embodiments, be mesothelioma, hepatobiliary (liver duct and bile duct) cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, or the like. Cancers include, but are not limited to, gastrointestinal (stomach, colorectum, and duodenum), uterine cancer, cancer of the fallopian tubes, cancer of the endometrium, cancer of the cervix, cancer of the vagina, cancer of the vulva, Hodgkin's disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, cancer of the renal pelvis, non-Hodgkin's lymphoma, spinal axis tumor, brain stem glioma, pituitary adenoma, adrenocortical carcinoma, gallbladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, or a combination of one or more of the foregoing cancers.

[0289] In some embodiments, the cancer is selected from hepatocellular carcinoma, ovarian cancer, ovarian epithelial cancer, or fallopian tube cancer; uterine papillary serous carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; soft tissue and osteosarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing's sarcoma; anaplastic thyroid cancer; adrenocortical adenoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal / stomach (GIST) cancer; lymphoma; squamous cell carcinoma of the head and neck (SCCHN); salivary gland cancer; glioma, or brain cancer; neurofibromatosis-1 associated malignant peripheral nerve sheath tumors (MPNST); Waldenstrom's hypergammaglobulinemia; or medulloblastoma.

[0290] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, fallopian tube cancer, cranial serous cystadenocarcinoma, uterine serous papillary carcinoma (UPSC), hepatic cholangiocarcinoma, soft tissue sarcoma and osteosarcoma, rhabdomyosarcoma, osteosarcoma, histoplastic thyroid carcinoma, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, malignant peripheral nerve sheath tumor (MPNST) associated with neurofibromatosis-1, Waldenstrom's hypergammaglobulinemia, or medulloblastoma.

[0291] In some embodiments, the cancer is a solid tumor, such as a sarcoma; solid tumors generally comprise a mass of abnormal tissue that typically does not contain cysts or liquid areas. In some embodiments, the cancer is renal cell carcinoma, or kidney cancer; hepatocellular carcinoma (HCC), or hepatoblastoma, or liver cancer; melanoma; breast cancer; colorectal cancer, or colorectal cancer; colon cancer; rectal cancer; anal cancer; lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC); ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, or fallopian tube cancer; cranial serous cystadenocarcinoma or uterine serous papillary carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; soft tissue sarcoma and osteosarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing's sarcoma; histoplastic thyroid cancer; adrenocortical carcinoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal / gastric (GIST) cancer; lymphoma; squamous cell carcinoma of the head and neck (SCCHN). head and neck); salivary gland cancer; glioma or brain cancer; malignant peripheral nerve sheath tumor (MPNST) associated with neurofibromatosis-1; Waldenstrom's hypergammaglobulinemia; or medulloblastoma.

[0292] In some embodiments, the cancer is selected from renal cell carcinoma, hepatocellular carcinoma (HCC), hepatoblastoma, colorectal cancer, colon cancer, rectal cancer, anal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, cranial serous cystadenocarcinoma, uterine serous papillary carcinoma (UPSC), hepatic cholangiocarcinoma, soft tissue sarcoma and osteosarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, histoplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, brain cancer, malignant peripheral nerve sheath tumor (MPNST) associated with neurofibromatosis-1, Waldenstrom's hypergammaglobulinemia, or medulloblastoma.

[0293] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, cranial serous cystadenocarcinoma, uterine serous papillary carcinoma (UPSC), hepatic cholangiocarcinoma, soft tissue sarcoma and osteosarcoma, rhabdomyosarcoma, osteosarcoma, histoplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis-1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom's hypergammaglobulinemia, or medulloblastoma.

[0294] In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer or ovarian carcinoma. In some embodiments, the cancer is ovarian epithelial cancer. In some embodiments, the cancer is fallopian tube cancer. In some embodiments, the cancer is caput serous cystadenocarcinoma. In some embodiments, the cancer is uterine serous papillary carcinoma (UPSC). In some embodiments, the cancer is hepatocholangiocarcinoma. In some embodiments, the cancer is soft tissue sarcoma and osteosarcoma. In some embodiments, the cancer is rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is histogenic thyroid carcinoma. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is glioma. In some embodiments, the cancer is malignant peripheral nerve sheath tumors (MPNST). In some embodiments, the cancer is MPNST-associated neurofibromatosis-1. In some embodiments, the cancer is Waldenstrom's hypergammaglobulinemia. In some embodiments, the cancer is medulloblastoma.

[0295] The present invention further relates to cancers associated with viruses, including human immunodeficiency virus (HIV)-associated solid tumors, human papillomavirus (HPV)-16-positive incurable solid tumors, and adult T-cell leukemia, which is a highly aggressive form of CD4+ T-cell leukemia caused by human T-cell leukemia virus type I (HTLV-I) and characterized by clonal integration of HTLV-I into leukemic cells (see https: / / clinicaltrials.gov / ct2 / show / study / NCT02631746), as well as gastric cancer. The present invention further features methods and compositions for the diagnosis, prognosis, and treatment of virus-associated tumors in human ovarian cancer, nasopharyngeal cancer, cervical cancer, vaginal cancer, vulvar cancer, squamous cell carcinoma of the head and neck, and Merkel cell carcinoma (see https: / / clinicaltrials.gov / ct2 / show / study / NCT02488759; see also https: / / clinicaltrials.gov / ct2 / show / study / NCT0240886; https: / / clinicaltrials.gov / ct2 / show / NCT02426892).

[0296] In some embodiments, the cancer is melanoma cancer. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is small cell lung cancer (SCLC). In some embodiments, the cancer is non-small cell lung cancer (NSCLC).

[0297] In some embodiments, cancer is treated by preventing further growth of tumors. In some embodiments, the tumor is treated by reducing the size (e.g., volume or mass) of the tumor by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% compared to the size of the tumor before treatment. In some embodiments, the tumor is treated by reducing the tumor mass in the patient by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% compared to the tumor mass before treatment.

[0298] Combination cancer therapy

[0299] In some embodiments, the present invention provides a method for treating a disclosed disease or condition, comprising administering to a patient in need thereof an effective amount of a compound disclosed herein or a pharmaceutically acceptable salt thereof, and simultaneously or sequentially co-administering an effective amount of one or more additional therapeutic agents, such as the additional therapeutic agents described herein. In some embodiments, the method comprises co-administering one additional therapeutic agent. In some embodiments, the method comprises co-administering two additional therapeutic agents. In some embodiments, the combination of a disclosed compound and one or more additional therapeutic agents acts synergistically.

[0300] The compounds of the present invention can also be used in combination with known therapeutic processes, such as the administration of hormones or radiation. In some embodiments, the provided compounds are used as radiosensitizers, particularly for the treatment of tumors that exhibit poor sensitivity to radiation therapy.

[0301] The compounds of the present invention can be administered alone or in combination with one or more other therapeutic compounds, where possible combination therapy takes the form of a fixed combination, or the administration of the compounds of the present invention and one or more other therapeutic compounds is staggered or administered independently of each other, or a fixed combination administered in combination with one or more other therapeutic compounds. Alternatively or additionally, the compounds of the present invention can be administered for tumor treatment, particularly in combination with chemotherapy, radiotherapy, immunotherapy, phototherapy, surgical intervention, or a combination thereof. Long-term therapy is equally possible, as is adjuvant therapy in the context of other therapeutic strategies, as described above. Other possible treatments include treatment to maintain the patient's condition after tumor regression, or even chemopreventive therapy, for example, in at-risk patients.

[0302] One or more other therapeutic agents may be administered separately from the compounds or compositions of the invention as part of a multiple dose regimen. Alternatively, one or more other therapeutic agents may be part of a single dosage form and mixed together with the compounds of the invention in a single composition. When administered as part of a multiple dose regimen, the one or more other therapeutic agents and the compounds or compositions of the invention may be administered simultaneously, sequentially, or within a period of time, typically within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23, or 24 hours of each other. In some embodiments, the one or more other therapeutic agents and the compounds or compositions of the invention are administered as a multiple dose regimen within a range of more than 24 hours apart.

[0303] As used herein, the terms "combination," "combined," and related terms refer to simultaneous or sequential administration of therapeutic agents according to the invention. For example, a combination of the invention may be administered with one or more other therapeutic agents simultaneously or sequentially in individual unit dosage forms, or together in a single unit dosage form. Thus, the invention provides a single unit dosage form comprising a compound of the invention, one or more other therapeutic agents, and a pharmaceutically acceptable carrier, adjuvant, or vehicle.

[0304] The amount of a compound of the present invention and one or more other therapeutic agents (in those compositions containing additional therapeutic agents as described above) that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. Preferably, compositions of the present invention should be formulated so that a dosage of 0.01 to 100 mg / kg body weight / day of a compound of the present invention can be administered.

[0305] In these compositions containing one or more other therapeutic agents, the one or more other therapeutic agents and the compound of the present invention may act synergistically. Therefore, the amount of the one or more other therapeutic agents in such compositions will be less than the amount required in a monotherapy utilizing only that therapeutic agent. In such compositions, a dosage of 0.01 to 1,000 μg / kg body weight / day of the additional therapeutic agent can be administered.

[0306] The amount of one or more other therapeutic agents present in the compositions of the invention will not exceed the amount normally administered in a composition comprising that therapeutic agent as the only active agent. Preferably, the amount of one or more other therapeutic agents in the presently disclosed compositions will range from about 50% to about 100% of the amount normally present in a composition comprising that agent as the only therapeutic active agent. In some embodiments, the one or more other therapeutic agents are administered at a dosage of about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% of the amount normally administered for that agent. As used herein, the phrase "normally administered" means the amount of the therapeutic agent approved by the FDA for administration per the FDA label insert.

[0307] The compounds of the present invention, or pharmaceutical compositions thereof, can also be incorporated into compositions for coating implantable medical devices, artificial prostheses, artificial valves, vascular grafts, stents, and catheters. Vascular stents, for example, have been used to overcome restenosis (re-narrowing of the blood vessel wall after injury). However, patients using stents or other implantable devices are at risk of blood clot formation or platelet activation. These undesirable effects can be prevented or mitigated by pre-coating the device with a pharmaceutically acceptable composition containing a kinase inhibitor. An implantable device coated with the compounds of the present invention is another embodiment of the present invention.

[0308] Examples of other therapeutic agents

[0309] In some embodiments, the one or more other therapeutic agents is a poly ADP ribose polymerase (PARP) inhibitor. In some embodiments, the PARP inhibitor is selected from olaparib (Lynparza™, AstraZeneca); rucaparib (Rubraca™, Clovis Oncology); niraparib (Zejula™, Tesaro); talazoparib (MDV3800 / BMN 673 / LT00673, Medivation / Pfizer / Biomarin); veliparib (ABT-888, AbbVie); and BGB-290 (BeiGene Inc.).

[0310] In some embodiments, the one or more other therapeutic agents is a histone deacetylase (HDAC) inhibitor. In some embodiments, the HDAC inhibitor is selected from vorinostat (Zolinza™, Merck); romidepsin (Istodax™, Celgene); panobinostat (Farydak™, Novartis); belinostat (Beleodaq™, Spectrum Pharmaceuticals); entinostat (SNDX-275, Syndax Pharmaceuticals) (NCT00866333); and chidamide (Epidaza™, HBI-8000, Chipscreen Biosciences, China).

[0311] In some embodiments, the one or more other therapeutic agents is a CDK inhibitor, e.g., a CDK4 / CDK6 inhibitor. In some embodiments, the CDK4 / 6 inhibitor is selected from palbociclib (Ibrance™, Pfizer); ribociclib (Kisqali™, Novartis); abemaciclib (Ly2835219, Eli Lilly); and trilaciclib (G1T28, G1 Therapeutics).

[0312] In some embodiments, the one or more other therapeutic agents is a phosphatidylinositol 3 kinase (PI3K) inhibitor. In some embodiments, the PI3K inhibitor is selected from idelalisib (Zydelig™, Gilead), alpelisib (BYL719, Novartis), taselisib (GDC-0032, Genentech / Roche); pictilisib (GDC-0941, Genentech / Roche); copanlisib (BAY806946, Bayer); duvelisib (formerly IPI-145, Infinity Pharmaceuticals); PQR309 (Piqur Therapeutics, Switzerland); and TGR1202 (formerly RP5230, TG Therapeutics).

[0313] In some embodiments, the one or more other therapeutic agents are platinum-based therapeutic agents, also called platins. Platinums cause DNA cross-linking, thus inhibiting DNA repair and / or DNA synthesis, primarily in rapidly reproducing cells, such as cancer cells. In some embodiments, the platinum-based therapeutic agent is selected from cisplatin (Platinol™, Bristol-Myers Squibb); carboplatin (Paraplatin™, Bristol-Myers Squibb; also Teva; Pfizer); oxaliplatin (Eloxitin™, Sanofi-Aventis); nedaplatin (Aqupla™, Shionogi), picoplatin (Poniard Pharmaceuticals); and satraplatin (JM-216, Agennix).

[0314] In some embodiments, the one or more other therapeutic agents is a taxane compound, which causes disruption of microtubules, which are essential for cell division. In some embodiments, the taxane compound is selected from paclitaxel (Taxol™, Bristol-Myers Squibb), docetaxel (Taxotere™, Sanofi-Aventis; Docefrez™, Sun Pharmaceutical), albumin-bound paclitaxel (Abraxane™; Abraxis / Celgene), cabazitaxel (Jevtana™, Sanofi-Aventis), and SID530 (SK Chemicals Co.) (NCT00931008).

[0315] In some embodiments, the one or more other therapeutic agents are nucleoside inhibitors or therapeutic agents that interfere with normal DNA synthesis, protein synthesis, cell replication, or that would otherwise inhibit rapidly proliferating cells.

[0316] In some embodiments, the nucleoside inhibitor is trabectedin (a guanidine alkylator, Yondelis™, Janssen Oncology), mechlorethamine (an alkylator, Valchlor™, Aktelion Pharmaceuticals); vincristine (Oncovin™, Eli Lilly; Vincasar™, Teva Pharmaceuticals; Marqibo™, Talon Therapeutics); temozolomide (a prodrug for the alkylator 5-(3-methyltriazen-1-yl)-imidazole-4-carboxamide (MTIC), Temodar™, Merck); cytarabine injection (ara-C, an antimetabolite cytidine analog, Pfizer); lomustine (an alkylator, CeeNU™, Bristol-Myers Squibb; Gleostine™, NextSource) Biotechnology); azacitidine (an analogue of the pyrimidine nucleoside cytidine, Vidaza™, Celgene); omacetaxine mepesuccinate (cephalotaxine ester) (a protein synthesis inhibitor, Synribo™; Teva Pharmaceuticals); asparaginase Erwinia chrysanthemi (an enzyme for asparagine depletion, Elspar™, Lundbeck; Erwinaze™, EUSA) Pharma); eribulin mesylate (microtubule inhibitor, tubulin-based mitosis inhibitor, Halaven™, Eisai); cabazitaxel (microtubule inhibitor, tubulin-based mitosis inhibitor, Jevtana™, Sanofi-Aventis); capacetrin (thymidylate synthase inhibitor, Xeloda™, Genentech); bendamustine (bifunctional mechlorethamine derivative, thought to form interstrand DNA crosslinks, Treanda™, Cephalon / Teva); ixabepilone (semisynthetic analog of epothilone B, microtubule inhibitor, tubulin-based mitosis inhibitor, Ixempra™, Bristol-Myers Squibb);Selected from nelarabine (prodrug of a deoxyguanosine analog, a nucleoside metabolism inhibitor, Arranon™, Novartis); chlorafavine (prodrug of a ribonucleotide reductase inhibitor, a competitive inhibitor of deoxycytidine, Clolar™, Sanofi-Aventis); and trifluridine and tipiracil (thymidine-based nucleoside analog and thymidine phosphorylase inhibitor, Lonsurf™, Taiho Oncology);

[0317] In some embodiments, the one or more other therapeutic agents is a kinase inhibitor or a VEGF-R antagonist. Approved VEGF inhibitors and kinase inhibitors useful in the present invention include: bevacizumab (Avastin™, Genentech / Roche), an anti-VEGF monoclonal antibody; ramucirumab (Cyramza™, Eli Lilly), an anti-VEGFR-2 antibody and ziv-aflibercept, also known as VEGF Trap (Zaltrap™; Regeneron / Sanofi), VEGFR inhibitors such as regorafenib (Stivarga™, Bayer); vandetanib (Caprelsa™, AstraZeneca); axitinib (Inlyta™, Pfizer); and lenvatinib (Lenvima™, Eisai); Raf inhibitors such as sorafenib (Nexavar™, Bayer AG and Onyx; dabrafenib (Tafinlar™, Novartis); and vemurafenib (Zelboraf™, Genentech / Roche); MEK inhibitors such as cobimetanib (Cotellic™, Exelexis / Genentech / Roche); trametinib (Mekinist™, Novartis); Bcr-Abl tyrosine kinase inhibitors such as imatinib (Gleevec™, Novartis); nilotinib (Tasigna™, Novartis); dasatinib (Sprycel™, Bristol-Myers Squibb); bosutinib (Bosulif™, Pfizer); and ponatinib (Inclusig™, Ariad Pharmaceuticals; Her2 and EGFR inhibitors such as gefitinib (Iressa™, AstraZeneca); erlotinib (Tarceeva™, Genentech / Roche / Astellas); lapatinib (Tykerb™, Novartis); afatinib (Gilotrif™, Boehringer Ingelheim); osimertinib (targets activated EGFR, Tagrisso™, AstraZeneca);and brigitinib (Alunbrig™, Ariad Pharmaceuticals); c-Met and VEGFR2 inhibitors, such as cabozantinib (Cometriq™, Exelexis); and multikinase inhibitors, such as sunitinib (Sutent™, Pfizer); pazopanib (Votrient™, Novartis); ALK inhibitors, such as crizotinib (Xalkori™, Pfizer); ceritinib (Zykadia™, Novartis); and alectinib (Alecenza™, Genentech / Roche); Bruton's tyrosine kinase inhibitors, such as ibrutinib (Imbruvica™, Pharmacyclics / Janssen); and Flt3 receptor inhibitors, such as midostaurin (Rydapt™, Novartis).

[0318] Other kinase inhibitors and VEGF-R antagonists that have been developed and can be used in the present invention include tivozanib (Aveo Pharmaceuticals); vatalanib (Bayer / Novartis); lusitanib (Clovis Oncology); dovitinib (TKI258, Novartis); chiauanib (Chipscreen Biosciences); CEP-11981 (Cephalon); linifanib (Abbott Laboratories); neratinib (HKI-272, Puma Biotechnology); radotinib (Supect™, IY5511, Il-Yang Pharmaceuticals, Republic of Korea); ruxolitinib (Jakafi™, Incyte Corporation); PTC299 (PTC Therapeutics); CP-547,632 (Pfizer); foretinib (Exelexis, GlaxoSmithKline); quizartinib (Daiichi Sankyo) and motesanib (Amgen / Takeda).

[0319] In some embodiments, the one or more other therapeutic agents is an mTOR inhibitor, which inhibits cell proliferation, angiogenesis, and glucose uptake. In some embodiments, the mTOR inhibitor is everolimus (Afinitor™, Novartis); temsirolimus (Torisel™, Pfizer); and sirolimus (Rapamune™, Pfizer).

[0320] In some embodiments, the one or more other therapeutic agents is a proteasome inhibitor. Approved proteasome inhibitors useful in the present invention include bortezomib (Velcade™, Takeda); carfilzomib (Kyprolis™, Amgen); and ixazomib (Ninlaro™, Takeda).

[0321] In some embodiments, the one or more other therapeutic agents is a growth factor antagonist, such as an antagonist of platelet-derived growth factor (PDGF) or epidermal growth factor (EGF) or its receptor (EGFR). Approved PDGF antagonists that can be used in the present invention include olaratumab (Lartruvo(olaratumab)™; Eli Lilly). Approved EGFR antagonists that can be used in the present invention include cetuximab (Erbitux™, Eli Lilly); necitumumab (Portrazza™, Eli Lilly), panitumumab (Vectibix™, Amgen); and osimertinib (targeting activated EGFR, Tagrisso™, AstraZeneca).

[0322] In some embodiments, the one or more other therapeutic agents is an aromatase inhibitor. In some embodiments, the aromatase inhibitor is selected from exemestane (Aromasin™, Pfizer); anastrozole (Arimidex™, AstraZeneca); and letrozole (Femara™, Novartis).

[0323] In some embodiments, the one or more other therapeutic agents are hedgehog pathway antagonists. Approved hedgehog pathway inhibitors that can be used in the present invention include sonidegib (Odomzo™, Sun Pharmaceuticals); and vismodegib (Erivedge™, Genentech), both for the treatment of basal cell carcinoma.

[0324] In some embodiments, the one or more other therapeutic agents is a folate inhibitor. Approved folate inhibitors useful in the present invention include pemetrexed (Alimta™, Eli Lilly).

[0325] In some embodiments, the one or more other therapeutic agents is a CC chemokine receptor 4 (CCR4) inhibitor. Tested CCR4 inhibitors that may be useful in the present invention include mogamulizumab (Poteligeo™, Kyowa Hakko Kirin, Japan).

[0326] In some embodiments, the one or more other therapeutic agents is an isocitrate dehydrogenase (IDH) inhibitor. Tested IDH inhibitors that can be used in the present invention include AG120 (Celgene; NCT02677922); AG221 (Celgene, NCT02677922; NCT02577406); BAY1436032 (Bayer, NCT02746081); and IDH305 (Novartis, NCT02987010).

[0327] In some embodiments, the one or more other therapeutic agents are arginase inhibitors. Arginase inhibitors that can be used in the present invention and tested include AEB1102 (pegylated recombinant arginase, Aeglea Biotherapeutics), which is being studied in Phase 1 clinical trials for acute myeloid leukemia and myelodysplastic syndromes (NCT02732184) and solid tumors (NCT02561234); and CB-1158 (Calithera Biosciences).

[0328] In some embodiments, the one or more other therapeutic agents is a glutaminase inhibitor. Tested glutaminase inhibitors that can be used in the present invention include CB-839 (Calithera Biosciences).

[0329] In some embodiments, the one or more other therapeutic agents are antibodies that bind to tumor antigens, i.e., proteins expressed on the cell surface of tumor cells. Approved antibodies that bind to tumor antigens that can be used in the present invention include rituximab (Rituxan™, Genentech / Biogen Idec); ofatumumab (anti-CD20, Arzerra™, GlaxoSmithKline); obinutuzumab (anti-CD20, Gazyva™, Genentech); ibritumomab (anti-CD20 and Yttrium-90, Zevalin™, Spectrum Pharmaceuticals); daratumumab (anti-CD38, Darzalex™, Janssen Biotech); dinutuximab (anti-glycolipid GD2, Unituxin™, United Therapeutics); trastuzumab (anti-HER2, Herceptin™, Genentech); ado-trastuzumab emtansine (anti-HER2, fused to emtansine, Kadcyla™, Genentech); and pertuzumab (anti-HER2, Perjeta™, Genentech); and brentuximab vedotin (anti-CD30-drug conjugate, Adcetris™, Seattle Genetics).

[0330] In some embodiments, the one or more other therapeutic agents are topoisomerase inhibitors. Approved topoisomerase inhibitors useful in the present invention include irinotecan (Onivyde™, Merrimack Pharmaceuticals); topotecan (Hycamtin™, GlaxoSmithKline). Tested topoisomerase inhibitors that can be used in the present invention include pixantrone (Pixuvri™, CTI Biopharma).

[0331] In some embodiments, the one or more other therapeutic agents are inhibitors of anti-apoptotic proteins, such as BCL-2. Approved anti-apoptotic drugs that can be used in the present invention include venetoclax (Venclexta™, AbbVie / Genentech); and blinatumomab (Blincyto™, Amgen). Other therapeutic agents that target apoptotic proteins undergoing clinical trials and that can be used in the present invention include navitoclax (ABT-263, Abbott), a BCL-2 inhibitor (NCT02079740).

[0332] In some embodiments, the one or more other therapeutic agents are androgen receptor inhibitors. Approved androgen receptor inhibitors useful in the present invention include enzalutamide (Xtandi™, Astellas / Medivation); approved inhibitors of androgen synthesis include abiraterone (Zytiga™, Centocor / Ortho); and approved gonadotropin-releasing hormone (GnRH) receptor antagonists (degaralix, Firmagon™, Ferring Pharmaceuticals).

[0333] In some embodiments, the one or more other therapeutic agents is a selective estrogen receptor modulator (SERM), which interferes with the synthesis or activity of estrogen. Approved SERMs useful in the present invention include raloxifene (Evista™, Eli Lilly).

[0334] In some embodiments, the one or more other therapeutic agents are inhibitors of bone resorption. An approved therapeutic agent that inhibits bone resorption is denosumab (Xgeva™, Amgen), an antibody that binds to RANKL, preventing it from binding to its receptor RANK, found on the surface of osteoclasts, their precursor cells, and osteoclast-like giant cells, which mediates bone lesions in solid tumors with bone metastasis. Other approved therapeutic agents that inhibit bone resorption include bisphosphonates, such as zoledronic acid (Zometa™, Novartis).

[0335] In some embodiments, the one or more other therapeutic agents are inhibitors of the interaction between MDMX and MDM2, two major p53 inhibitory proteins. Tested inhibitors of p53 inhibitory proteins that can be used in the present invention include ALRN-6924 (Aileron), a stapled peptide that binds to and disrupts the interaction of MDMX and MDM2 with p53 with equal potency. ALRN-6924 is currently being evaluated in clinical trials for the treatment of AML, advanced myelodysplastic syndrome (MDS), and peripheral T-cell lymphoma (PTCL) (NCT02909972; NCT02264613).

[0336] In some embodiments, the one or more other therapeutic agents are inhibitors of transforming growth factor-beta (TGF-beta, or TGFβ). Tested inhibitors of TGF-beta protein that can be used in the present invention include NIS793 (Novartis), an anti-TGF-beta antibody clinically tested for the treatment of various cancers, including breast cancer, lung cancer, hepatocellular carcinoma, colorectal cancer, pancreatic cancer, prostate cancer, and renal cancer (NCT 02947165). In some embodiments, the inhibitor of TGF-beta protein is fresolimumab (GC1008; Sanofi-Genzyme), which is being tested for melanoma (NCT00923169); renal cell carcinoma (NCT00356460); and non-small cell lung cancer (NCT02581787). Additionally, in some embodiments, the additional therapeutic agent is a TGF-beta trap, e.g., as described in Connolly et al. (2012) Int'l J. Biological Sciences 8:964-978. One therapeutic compound currently in clinical trials for the treatment of solid tumors is M7824 (Merck KgaA, formerly MSB0011459X), which is a bispecific anti-PD-L1 / TGFβ trap compound (NCT02699515); and (NCT02517398). M7824 consists of a fully human IgG1 antibody against PD-L1 fused to the extracellular domain of human TGF-receptor II, which functions as a "trap" for TGFβ.

[0337] In some embodiments, the one or more other therapeutic agents are selected from glembatumumab vedotin-monomethyl auristatin E (MMAE) (Celldex), glembatumumab vedotin-monomethyl auristatin E, and an anti-glycoprotein NMB (gpNMB) antibody conjugated to MMAE (CR011). gpNMB is a protein overexpressed by multiple tumor types that is associated with the ability of cancer cells to metastasize.

[0338] In some embodiments, the one or more other therapeutic agents are antiproliferative compounds. Such antiproliferative compounds include aromatase inhibitors; antiestrogens; topoisomerase I inhibitors; topoisomerase II inhibitors; microtubule active compounds; alkylating compounds; histone deacetylase inhibitors; compounds that induce cell differentiation processes; cyclooxygenase inhibitors; MMP inhibitors; mTOR inhibitors; anti-neoplastic antimetabolites; platinum compounds; compounds that target / reduce the activity of protein or lipid kinases, as well as anti-angiogenic compounds; compounds that target, reduce or inhibit the activity of protein or lipid phosphatases; gonadorelin agonists; antiandrogens; methionine aminopeptidase inhibitors; matrix metalloproteinase inhibitors; bisphosphonates; biological response modifiers; antiproliferative compounds. antibodies; heparanase inhibitors; inhibitors of Ras oncogenic isoforms; telomerase inhibitors; proteasome inhibitors; compounds used in the treatment of hematological malignancies; compounds that target, decrease or inhibit the activity of Flt-3; Hsp90 inhibitors, such as 17-AAG (17-allylaminogeldanamycin, NSC330507), 17-DMAG (17-dimethylaminoethylamino-17-demethoxy-geldanamycin, NSC707545), IPI-504, CNF1010, CNF2024, CNF1010 (Conforma Therapeutics); temozolomide (Temodal™); kinesin spindle protein inhibitors, such as SB715992 or SB743921 from GlaxoSmithKline, or pentamidine / chlorpromazine from CombinatoRx; MEK inhibitors, such as ARRY142886 from Array BioPharma, AZd6244 from AstraZeneca, PD181461 from Pfizer, and leucovorin.

[0339] The term "aromatase inhibitors," as used herein, refers to compounds that inhibit estrogen production, such as the conversion of the radicals androstenedione and testosterone to estrone and estradiol, respectively. The term includes, but is not limited to, steroids, particularly atamestane, exemestane, and formestane, and nonsteroids, particularly aminoglutethimide, rogletimide, pyridoglutethimide, trilostane, testolactone, ketoconazole, vorozole, fadrozole, anastrozole, and letrozole. Exemestane is sold under the trade name Aromasin™. Formestane is sold under the trade name Lentaron™. Fadrozole is sold under the trade name Afema™. Anastrozole is sold under the trade name Arimidex™. Letrozole is sold under the trade name Femara™ or Femar™. Aminoglutethimide is sold under the trade name Orimeten™. Combinations of the present invention which include a chemotherapeutic agent that is an aromatase inhibitor are particularly useful for the treatment of hormone receptor positive tumors, such as breast tumors.

[0340] The term "antiestrogen," as used herein, refers to a compound that antagonizes the effects of estrogen at the estrogen receptor level. The term includes, but is not limited to, tamoxifen, fulvestrant, raloxifene, and raloxifene hydrochloride. Tamoxifen is sold under the trade name Nolvadex™. Raloxifene hydrochloride is sold under the trade name Evista™. Fulvestrant is sold under the trade name Faslodex™. The combinations of the present invention, which include a chemotherapeutic agent that is an anti-estrogen, are particularly useful for treating estrogen receptor-positive tumors, such as breast tumors.

[0341] The term "antiandrogen" as used herein refers to any substance capable of inhibiting the biological effects of androgen hormones and includes, but is not limited to, bicalutamide (Casodex™). The term "gonadorelin agonist" as used herein includes, but is not limited to, abarelix, goserelin, and goserelin acetate. Goserelin can be administered under the trade name Zoladex™.

[0342] The term "topoisomerase I inhibitors" as used herein includes, but is not limited to, topotecan, gimatecan, irinotecan, camptothecin and its analog 9-nitrocamptothecin, and the polymeric camptothecin conjugate PNU-166148. Irinotecan can be administered, for example, in the form in which it is marketed, for example, under the trademark Camptosar™. Topotecan is marketed under the trade name Hycamptin™.

[0343] The term "topoisomerase II inhibitors," as used herein, includes, but is not limited to, anthracyclines such as doxorubicin (including liposomal formulations, e.g., Caelyx™), daunorubicin, epirubicin, idarubicin, and nemorubicin, anoraquinone, mitoxantrone, and losoxantrone, and the podophyllotoxins etoposide and teniposide. Etoposide is commercially available under the trade name Etopophos™. Teniposide is commercially available under the trade name VM 26-Bristol. Doxorubicin is commercially available under the trade name Acriblastin™ or Adriamycin™. Epirubicin is commercially available under the trade name Farmorubicin™. Idarubicin is commercially available under the trade name Zavedos™. Mitoxantrone is commercially available under the trade name Novantron.

[0344] The term "microtubule active agent" refers to microtubule-stabilizing compounds, microtubule-destabilizing compounds, and microtubule polymerization inhibitors, including, but not limited to, taxanes such as paclitaxel and docetaxel; vinca alkaloids such as vinblastine or vinblastine sulfate, vincristine or vincristine sulfate, and vinorelbine; discodermolide; colchicine and epothilones and their derivatives. Paclitaxel is sold under the trade name Taxol™. Docetaxel is sold under the trade name Taxotere™. Vinblastine sulfate is sold under the trade name Vinblastin RP™. Vincristine sulfate is sold under the trade name Farmistin™.

[0345] The term "alkylating agent" as used herein includes, but is not limited to, cyclophosphamide, ifosfamide, melphalan, or nitrosourea (BCNU or Gliadel). Cyclophosphamide is sold under the trade name Cyclostin™. Ifosfamide is sold under the trade name Holoxan™.

[0346] The term "histone deacetylase inhibitors" or "HDAC inhibitors" relates to compounds which inhibit histone deacetylase and have antiproliferative activity, including, but not limited to, suberoylanilide hydroxamic acid (SAHA).

[0347] The term "antineoplastic antimetabolite" includes, but is not limited to, 5-fluorouracil, i.e., 5-FU, capecitabine, gemcitabine, DNA demethylating compounds such as 5-azacytidine and decitabine, methotrexate and edatrexate, and folate antagonists such as pemetrexed. Capecitabine is sold under the trade name Xeloda™. Gemcitabine is sold under the trade name Gemzar™.

[0348] The term "platin compound" as used herein includes, but is not limited to, carboplatin, suplatin, cisplatinum and oxaliplatin. Carboplatin can be administered, e.g., in the form as it is marketed, e.g., under the trademark Carboplat™. Oxaliplatin can be administered, e.g., in the form as it is marketed, e.g., under the trademark Eloxatin™.

[0349] The term "compounds which target / reduce protein or lipid kinase activity; or compounds which target / reduce protein or lipid phosphatase activity; or compounds which further target / reduce anti-angiogenic compounds", as used herein, includes, but is not limited to, protein tyrosine kinase and / or serine and / or threonine kinase inhibitors or lipid kinase inhibitors, such as: a) compounds which target, reduce or inhibit the activity of platelet-derived growth factor receptors (PDGFR), for example compounds which target, reduce or inhibit the activity of PDGFR, in particular compounds which inhibit PDGF receptors, for example N-phenyl-2-pyrimidine-amine derivatives, such as imatinib, SU101, SU6668 and GFB-111; b) compounds which target, reduce or inhibit the activity of fibroblast growth factor receptors (FGFR); Compounds which target, reduce or inhibit the activity of insulin-like growth factor receptor I (IGF-IR); for example compounds which target, reduce or inhibit the activity of IGF-IR, in particular compounds which inhibit the kinase activity of the IGF-I receptor, i.e. antibodies which target the extracellular domain of the IGF-I receptor or its growth factors; d) compounds which target, reduce or inhibit the activity of the Trk receptor tyrosine kinase family, i.e. ephrin B4 inhibitors; e) compounds which target, reduce or inhibit the activity of the AxI receptor tyrosine kinase family; f) compounds which target, reduce or inhibit the activity of the Ret receptor tyrosine kinase; g) compounds which target, reduce or inhibit the activity of the Kit / SCFR receptor tyrosine kinase, for example imatinib;h) compounds which target, decrease or inhibit the activity of the C-kit receptor tyrosine kinase, which is part of the PDGFR family, for example compounds which target, decrease or inhibit the activity of the c-Kit receptor tyrosine kinase family, in particular compounds which inhibit the c-Kit receptor, such as imatinib; i) compounds which target, decrease or inhibit the activity of members of the c-Abl family, their gene fusion products (e.g. BCR-Abl kinase) and their mutants, for example compounds which target, decrease or inhibit the activity of c-Abl family members and their gene fusion products, for example N-phenyl-2-pyrimidine-amine derivatives, such as imatinib or nilotinib (AMN107); PD180970; AG957; NSC 680410; PD173955 from ParkeDavis; or dasatinib (BMS-354825); j) protein kinase C (PKC) C) and members of the Raf family of serine / threonine kinases, members of the MEK, SRC, JAK / pan-JAK, FAK, PDK1, PKB / Akt, Ras / MAPK, PI3K, SYK, TYK2, BTK and TEC families, cyclin-dependent kinase family (CDK) including staurosporine derivatives such as midostaurin, further exemplary compounds are UCN-01, safingol, BAY 43-9006, Bryostatin 1, perifosine; llmofosine; RO 318220 and RO 320432; GO 6976; 3521; LY333531 / LY379196; isoquinoline compounds; FTIs; PD184352 or QAN697 (P13K inhibitor) or AT7519 (CDK inhibitor);k) Compounds which target, decrease or inhibit the activity of protein tyrosine kinase inhibitors, for example compounds which target, decrease or inhibit the activity of protein tyrosine kinase inhibitors include compounds which target, decrease or inhibit the activity of imatinib mesylate (Gleevec™) or tyrphostins, for example Tyrphostin A23 / RG-50810; AG 99; Tyrphostin AG 213; Tyrphostin AG 1748; Tyrphostin AG 490; Tyrphostin B44; Tyrphostin B44 (+) enantiomer; Tyrphostin AG 555; AG 494; Tyrphostin AG 556, AG957 and Adafostine (4-{[(2,5-dihydroxyphenyl)methyl]amino}-benzoic acid adamantyl ester; NSC 680410, Adafostin; l) compounds which target, decrease or inhibit the activity of the epidermal growth factor family of receptor tyrosine kinases (EGFR1, ErbB2, ErbB3, ErbB4 as homodimers or heterodimers) and their variants, e.g. compounds which target, decrease or inhibit the activity of the epidermal growth factor receptor family are in particular compounds, proteins or antibodies which inhibit members of the EGF receptor tyrosine kinase family, e.g. binding to EGF receptor, ErbB2, ErbB3 and ErbB4 or to EGF or EGF-related ligands, CP 358774, ZD 1839, ZM 105180; trastuzumab (Herceptin™), cetuximab (Erbitux™), Iressa, Tarceva, OSI-774, Cl-1033, EKB-569, GW-2016, E1.1, E2.4, E2.5, E6.2, E6.4, E2.11, E6.3 or E7.6.3, and 7H-pyrrolo-[2,3-d]pyrimidine derivatives; m) compounds that target, decrease or inhibit the activity of the c-Met receptor, for example compounds that target, decrease or inhibit the activity of c-Met, in particular compounds that inhibit the kinase activity of the c-Met receptor, i.e., antibodies that target the extracellular domain of c-Met or antibodies that bind to HGF;n) compounds that target, decrease or inhibit the kinase activity of one or more JAK family members (JAK1 / JAK2 / JAK3 / TYK2 and / or pan-JAK), such as, but not limited to, PRT-062070, SB-1578, baricitinib, pacritinib, momelotinib, VX-509, AZD-1480, TG-101348, tofacitinib and ruxolitinib; o) PI3 kinase (PI3K:PI3 and q) compounds that target, decrease or inhibit the kinase activity of hedgehog protein (Hh) or smoothened receptor (SMO), such as, but not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparlisib, pictrelisib, PF-4691502, BYL-719, dactolisib, XL-147, XL-765 and idelalisib; and q) compounds that target, decrease or inhibit the kinase activity of hedgehog protein (Hh) or smoothened receptor (SMO), such as, but not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparlisib, pictrelisib, PF-4691502, BYL-719, dactolisib, XL-147, XL-765 and idelalisib. Compounds that target, decrease, or inhibit the signaling effects of the IL-1 receptor pathway, including, but not limited to, cyclopamine, vismodegib, itraconazole, erismodegib, and IPI-926 (saridegib);

[0350] The term "PI3K inhibitor," as used herein, includes, but is not limited to, compounds having activity against one or more enzymes of the phosphatidylinositol-3-kinase family, such as, but not limited to, PI3Kα, PI3Kγ, PI3Kδ, PI3Kβ, PI3K-C2α, PI3K-C2β, PI3K-C2γ, Vps34, p110-α, p110-β, p110-γ, p110-δ, p85-α, p85-β, p55-γ, p150, p101, and p87. Examples of PI3K inhibitors useful in the present invention include, but are not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparlisib, pictrelisib, PF-4691502, BYL-719, dactolisib, XL-147, XL-765, and idelalisib.

[0351] The term "Bcl-2 inhibitor", as used herein, refers to a compound having inhibitory activity against B-cell lymphoma 2 protein (Bcl-2), such as ABT-199, ABT-731, ABT-737, apogossypol, Ascenta's pan-Bcl-2 inhibitor, curcumin (and analogs thereof), dual Bcl-2 / Bcl-xL inhibitor (Infinity Pharmaceuticals / Novartis Pharmaceuticals), Genasense (G3139), HA14-1 (and analogs thereof, see WO 2008118802), navitoclax (and analogs thereof, see U.S. Pat. No. 7,390,799), NH-1 (Shenayng Pharmaceutical In some embodiments, the Bcl-2 inhibitor is a small molecule therapeutic agent. In some embodiments, the Bcl-2 inhibitor is a peptidomimetic.

[0352] The term "BTK inhibitor," as used herein, includes, but is not limited to, compounds that have inhibitory activity against Bruton's tyrosine kinase (BTK), such as, but not limited to, AVL-292 and ibrutinib.

[0353] The term "SYK inhibitor," as used herein, includes, but is not limited to, compounds that have inhibitory activity against spleen tyrosine kinase (SYK), such as, but not limited to, PRT-062070, R-343, R-333, Excellair, PRT-062607, and fostamatinib.

[0354] Further examples of BTK inhibitor compounds, and conditions treatable by such compounds in combination with the compounds of the invention, can be found in WO2008039218 and WO2011090760, the entire contents of which are incorporated herein by reference.

[0355] Further examples of SYK inhibitor compounds, and conditions treatable by such compounds in combination with the compounds of the present invention, can be found in WO2003063794, WO2005007623 and WO2006078846, the entire contents of which are incorporated herein by reference.

[0356] Further examples of PI3K inhibitor compounds, and conditions treatable by such compounds in combination with the compounds of the invention, can be found in WO2004019973, WO2004089925, WO2007016176, U.S. Pat. No. 8,138,347, WO2002088112, WO2007084786, WO2007129161, WO2006122806, WO2005113554, and WO2007044729, the entire contents of which are incorporated herein by reference.

[0357] Further examples of JAK inhibitor compounds, and conditions treatable by such compounds in combination with compounds of the invention, can be found in WO2009114512, WO2008109943, WO2007053452, WO2000142246 and WO2007070514, the entire contents of which are incorporated herein by reference.

[0358] Further anti-angiogenic compounds include compounds that have another mechanism for their activity, such as those unrelated to protein or lipid kinase inhibition, such as thalidomide (Thalomid™) and TNP-470.

[0359] Examples of proteasome inhibitors that are useful in combination with the compounds of the invention include, but are not limited to, bortezomib, disulfiram, epigallocatechin-3-gallate (EGCG), salinosporamide A, carfilzomib, ONX-0912, CEP-18770, and MLN9708.

[0360] Compounds which target, decrease or inhibit the activity of a protein or lipid phosphatase are eg inhibitors of phosphatase 1, phosphatase 2A or CDC25, such as okadaic acid or a derivative thereof.

[0361] Compounds that induce cell differentiation processes include, but are not limited to, retinoic acid, α-γ- or δ-tocopherol, or α-γ- or δ-tocotrienol.

[0362] The term "cyclooxygenase inhibitors" as used herein includes, but is not limited to, Cox-2 inhibitors, 5-alkyl substituted 2-arylaminophenylacetic acids and derivatives thereof, such as celecoxib (Celebrex™), rofecoxib (Vioxx™), etoricoxib, valdecoxib, or 5-alkyl-2-arylaminophenylacetic acids, such as 5-methyl-2-(2'-chloro-6'-fluoroanilino)phenylacetic acid, lumiracoxib.

[0363] The term "bisphosphonate" as used herein includes, but is not limited to, etidronic acid, clodronic acid, tiludronic acid, pamidronic acid, alendronic acid, ibandronic acid, risedronic acid, and zoledronic acid. Etidronic acid is sold under the trade name Didronel™. Clodronic acid is sold under the trade name Bonefos™. Tiludronic acid is sold under the trade name Skelid™. Pamidronic acid is sold under the trade name Aredia™. Alendronic acid is sold under the trade name Fosamax™. Ibandronic acid is sold under the trade name Bondranat™. Risedronic acid is sold under the trade name Actonel™. Zoledronic acid is sold under the trade name Zometa™. The term "mTOR inhibitors" relates to compounds which inhibit the mammalian target of rapamycin (mTOR) and have antiproliferative activity, such as sirolimus (Rapamune™), everolimus (Certican™), CCI-779 and ABT578.

[0364] The term "heparanase inhibitor" as used herein refers to a compound that targets, decreases, or inhibits the degradation of heparin sulfate. The term includes, but is not limited to, PI-88. The term "biological response modifier" as used herein refers to a lymphokine or interferon.

[0365] The term "inhibitors of Ras oncogenic isoforms," ​​e.g., H-Ras, K-Ras, or N-Ras, as used herein, refers to compounds that target, reduce, or inhibit the oncogenic activity of Ras; "farnesyltransferase inhibitors," e.g., L-744832, DK8G557, or R115777 (Zarnestra™). The term "telomerase inhibitors," as used herein, refers to compounds that target, reduce, or inhibit the activity of telomerase. Compounds that target, reduce, or inhibit the activity of telomerase are particularly compounds that inhibit the telomerase receptor, e.g., telomestatin.

[0366] The term "methionine aminopeptidase inhibitor" as used herein refers to a compound which targets, decreases or inhibits the activity of methionine aminopeptidase. Compounds which target, decrease or inhibit the activity of methionine aminopeptidase include, but are not limited to, bengamide or a derivative thereof.

[0367] The term "proteasome inhibitor," as used herein, refers to a compound that targets, decreases, or inhibits the activity of the proteasome. Compounds that target, decrease, or inhibit the activity of the proteasome include, but are not limited to, bortezomib (Velcade™) and MLN 341.

[0368] The term "matrix metalloproteinase inhibitor" or ("MMP" inhibitor), as used herein, includes, but is not limited to, collagen peptidomimetic inhibitors and non-peptidomimetic inhibitors, tetracycline derivatives, such as the hydroxamate peptidomimetic inhibitor batimastat and its orally bioavailable analogue marimastat (BB-2516), prinomastat (AG3340), metastat (NSC 683551), BMS-279251, BAY 12-9566, TAA211, MMI270B, or AAJ996.

[0369] The term "compounds used in the treatment of hematological malignancies" as used herein includes, but is not limited to, FMS-like tyrosine kinase inhibitors, which are compounds that target, decrease or inhibit the activity of FMS-like tyrosine kinase receptor (Flt-3R); interferon, 1-β-D-arabinofuransylcytosine (ara-c) and bisulfan; and ALK inhibitors, which are compounds that target, decrease or inhibit anaplastic lymphoma kinase.

[0370] Compounds which target, decrease or inhibit the activity of FMS-like tyrosine kinase receptors (Flt-3R) are in particular compounds, proteins or antibodies which inhibit members of the Flt-3R receptor kinase family, such as PKC412, midostaurin, staurosporine derivatives, SU11248 and MLN518.

[0371] The term "HSP90 inhibitor," as used herein, includes, but is not limited to, compounds that target, decrease, or inhibit the intrinsic ATPase activity of HSP90; compounds that degrade, target, decrease, or inhibit HSP90 client proteins via the ubiquitin proteosome pathway. Compounds that target, decrease, or inhibit the intrinsic ATPase activity of HSP90 are, in particular, compounds, proteins, or antibodies that inhibit the ATPase activity of HSP90, such as 17-allylamino-17-demethoxygeldanamycin (17AAG), geldanamycin derivatives, other geldanamycin-related compounds; radicicol, and HDAC inhibitors.

[0372] The term "antiproliferative antibody" as used herein includes, but is not limited to, trastuzumab (Herceptin™), trastuzumab-DM1, erbitux, bevacizumab (Avastin™), rituximab (Rituxan™), PRO64553 (anti-CD40), and 2C4 antibodies. By antibody is meant intact monoclonal antibodies, multispecific antibodies formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity.

[0373] For the treatment of acute myeloid leukemia (AML), the compounds of the present invention can be used in combination with standard leukemia therapies, particularly in combination with therapies used for the treatment of AML. In particular, the compounds of the present invention can be administered in combination with, for example, farnesyltransferase inhibitors and / or other drugs useful for the treatment of AML, such as daunorubicin, adriamycin, Ara-C, VP-16, teniposide, mitoxantrone, idarubicin, carboplatinum, and PKC412.

[0374] Other anti-leukemic compounds include, for example, Ara-C, a pyrimidine analogue, which is a dimer of deoxycytidine. ' α-alpha-hydroxyribose (arabinoside) derivatives. Also included are the purine analogs of hypoxanthine, 6-mercaptopurine (6-MP) and fludarabine phosphate. Compounds that target, decrease, or inhibit the activity of histone deacetylase (HDAC) inhibitors, such as sodium butyrate and suberoylanilide hydroxamic acid (SAHA), inhibit the activity of enzymes known as histone deacetylases. Specific HDAC inhibitors include, but are not limited to, MS275, SAHA, FK228 (formerly FR901228), trichostatin A, and compounds described in U.S. Pat. No. 6,552,065, such as N-hydroxy-3-[4-[[[2-(2-methyl-1H-indol-3-yl)-ethyl]-amino]methyl]phenyl]-2E-2-propenamide or a pharmaceutically acceptable salt thereof, and N-hydroxy-3-[4-[(2-hydroxyethyl){2-(1H-indol-3-yl)ethyl]-amino]methyl]phenyl]-2E-2-propenamide or a pharmaceutically acceptable salt thereof, particularly the lactate salt. As used herein, somatostatin receptor antagonist refers to a compound that targets, treats, or inhibits somatostatin receptors, such as octreotide and SOM230. Approaches that damage tumor cells are referred to as approaches such as ionizing radiation. The term "ionizing radiation," as referred to above and below, means ionizing radiation that occurs either as electromagnetic waves (e.g., X-rays and gamma rays) or particles (e.g., alpha particles and beta particles). Ionizing radiation is provided in, but is not limited to, radiation therapy and is known in the art. Hellman, Principles of Radiation Therapy, Cancer, in Principles and Practice of Oncology, Devita et al., Eds., 4 th Edition, Vol. 1, pp. 248-275 (1993).

[0375] Also included are EDG binders and ribonucleotide reductase inhibitors. The term "EDG binders" as used herein refers to a class of immunosuppressants that modulate lymphocyte recirculation, such as FTY720. The term "ribonucleotide reductase inhibitors" refers to pyrimidine or purine nucleoside analogs, including, but not limited to, fludarabine and / or cytosine arabinoside (ara-C), 6-thioguanine, 5-fluorouracil, cladribine, 6-mercaptopurine (especially in combination with ara-C for ALL), and / or pentostatin. Ribonucleotide reductase inhibitors are particularly hydroxyurea or 2-hydroxy-1H-isoindole-1,3-dione derivatives.

[0376] In particular, VEGF compounds, proteins or monoclonal antibodies, such as 1-(4-chloroanilino)-4-(4-pyridylmethyl)phthalazine or a pharmaceutically acceptable salt thereof, 1-(4-chloroanilino)-4-(4-pyridylmethyl)phthalazine succinate; Angiostatin™; Endostatin™; anthranilic acid amide; ZD4190; Zd6474; SU5416; SU6668; bevacizumab; or anti-VEGF antibodies or anti-VEGF receptor antibodies, such as rhuMAb and RHUFab, VEGF aptamers, such as Macugon; FLT-4 inhibitors, FLT-3 inhibitors, VEGFR-2 IgGI antibodies, Angiozyme (RPI 4610) and bevacizumab (Avastin™), are also included.

[0377] Photodynamic therapy, as used herein, refers to a therapeutic method for treating or preventing cancer using certain chemicals known as photosensitizing compounds. Examples of photodynamic therapy include treatment with compounds such as Visudyne™ and porfimer sodium.

[0378] Antiangiogenic steroids, as used herein, refer to compounds that block or inhibit angiogenesis, such as anecoltabe, triamcinolone, hydrocortisone, 11-α-epihydrocortisol, cortexolone, 17α-hydroxyprogesterone, corticosterone, desoxycorticosterone, testosterone, estrone, and dexamethasone.

[0379] Implants containing corticosteroids refer to compounds such as fluocinolone and dexamethasone.

[0380] Other chemotherapeutic compounds include, but are not limited to, plant alkaloids, hormonal compounds, and antagonists; biological response modifiers, preferably lymphokines or interferons; antisense nucleotide or oligonucleotide derivatives; shRNA or siRNA; or other compounds or compounds with other or unknown mechanisms of action.

[0381] The structures of active compounds identified by code numbers, generic names or trade names can be obtained from the working edition of the standard compendium "The Merck Index" or from databases such as Patents International (eg IMS World Publications).

[0382] Exemplary Immuno-Oncology Agents

[0383] In some embodiments, the one or more other therapeutic agents are immuno-oncology agents. As used herein, the term "immuno-oncology agent" refers to an agent that is effective for enhancing, stimulating, and / or upregulating the immune response in a subject. In some embodiments, administration of the compound of the present invention with an immuno-oncology agent has a synergistic effect in treating cancer.

[0384] The immuno-oncology agent can be, for example, a small molecule drug, an antibody, or a biological molecule or small molecule. Examples of biological immuno-oncology agents include, but are not limited to, cancer vaccines, antibodies, and cytokines. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the monoclonal antibody is humanized or human.

[0385] In some embodiments, the immuno-oncology agent is (i) an agonist of a stimulatory (including costimulatory) receptor, or (ii) an antagonist of an inhibitory (including co-inhibitory) signal in T cells, both of which result in amplification of the antigen-specific T cell response.

[0386] Some stimulatory and inhibitory molecules are members of the immunoglobulin superfamily (IgSF). One important family of membrane-bound ligands that bind to costimulatory or costimulatory receptors is the B7 family, which includes B7-1, B7-2, B7-H1 (PD-L1), B7-DC (PD-L2), B7-H2 (ICOS-L), B7-H3, B7-H4, B7-H5 (VISTA), and B7-H6. Another family of membrane-bound ligands that bind to costimulatory or co-inhibitory receptors is the TNF family of molecules that bind to cognate TNF receptor family members, which include CD40 and CD40L, OX-40, OX-40L, CD70, CD27L, CD30, CD30L, 4-1BBL, CD137 (4-1BB), TRAIL / Apo2-L, TRAILR1 / DR4, TRAILR2 / DR5, TRAILR3, TRAILR4, OPG, RANK, RANKL, TWEAKR / Fn14, TWEAK, BAFFR, EDAR, XEDAR, TACI, APRIL, BCMA, LTβR, LIGHT, DcR3, HVEM, VEGI / TL1A, TRAMP / DR3 , EDAR, EDA1, XEDAR, EDA2, TNFR1, lymphotoxin α / TNFβ, TNFR2, TNFα, LTβR, lymphotoxin α1β2, FAS, FASL, RELT, DR6, TROY, NGFR.

[0387] In some embodiments, the immuno-oncology agent is a cytokine that inhibits T cell activation (e.g., IL-6, IL-10, TGF-β, VEGF, and other immunosuppressive cytokines) or a cytokine that stimulates T cell activation to stimulate an immune response.

[0388] In some embodiments, the combination of a compound of the present invention with an immuno-oncology agent can stimulate a T cell response. In some embodiments, the immuno-oncology agent is (i) an antagonist of a protein that inhibits T cell activation (e.g., an immune checkpoint inhibitor), such as CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, TIM-3, Galectin-9, CEACAM-1, BTLA, CD69, Galectin-1, TIGIT, CD113, GPR56, VISTA, 2B4, CD48, GARP, PD1H, LAIR1, TIM-1, and TIM-4; or (ii) an agonist of a protein that stimulates T cell activation, such as B7-1, B7-2, CD28, 4-1BB (CD137), 4-1BBL, ICOS, ICOS-L, OX40, OX40L, GITR, GITRL, CD70, CD27, CD40, DR3, and CD28H.

[0389] In some embodiments, the immuno-oncology agent is an antagonist of inhibitory receptors on NK cells or an antagonist of activating receptors on NK cells, hi some embodiments, the immuno-oncology agent is an antagonist of KIR, e.g., lirilumab.

[0390] In some embodiments, immuno-oncology agents include, but are not limited to, agents that inhibit or deplete macrophages or monocytes, such as CSF-1R antagonists, e.g., CSF-1R antagonist antibodies, e.g., CSF-1R antagonists including RG7155 (WO 11 / 70024, WO 11 / 107553, WO 11 / 131407, WO 13 / 87699, WO 13 / 119716, WO 13 / 132044), or FPA-008 (WO 11 / 140249; WO 13169264; WO 14 / 036357).

[0391] In some embodiments, the immuno-oncology agent is selected from agonist agents that ligate co-stimulatory receptors, blocking agents that attenuate signaling through inhibitory co-receptors, antagonists, and one or more agents that generally increase the frequency of anti-tumor T cells, agents that overcome distinct immunosuppressive pathways within the tumor microenvironment (e.g., block inhibitory receptor engagement (e.g., PD-L1 / PD-1 interactions)), agents that deplete or inhibit Tregs (e.g., using anti-CD25 monoclonal antibodies (e.g., daclizumab) or by ex vivo anti-CD25 bead depletion), agents that inhibit metabolic enzymes, such as IDO, i.e., agents that reverse / prevent T cell energy or exhaustion), and agents that activate innate immunity and / or trigger inflammation at primary sites.

[0392] In some embodiments, the immuno-oncology agent is a CTLA-4 antagonist. In some embodiments, the CTLA-4 antagonist is an antagonistic CTLA-4 antibody. In some embodiments, the antagonistic CTLA-4 antibody is Yervoy (ipilimumab) or tremelimumab.

[0393] In some embodiments, the immuno-oncology agent is a PD-1 antagonist. In some embodiments, the PD-1 antagonist is administered by infusion. In some embodiments, the immuno-oncology agent is an antibody, or antigen-binding portion thereof, that specifically binds to the Programmed Death-1 (PD-1) receptor and inhibits PD-1 activity. In some embodiments, the PD-1 antagonist is an antagonistic PD-1 antibody. In some embodiments, the antagonistic PD-1 antibody is Opdivo (nivolumab), KEYTRUDA (pembrolizumab), or MEDI-0680 (AMP-514; WO 2012 / 145493). In some embodiments, the immuno-oncology agent can be pidilizumab (CT-011). In some embodiments, the immuno-oncology agent is a recombinant protein composed of the extracellular domain of PD-L2 (B7-DC) fused to the Fc portion of IgG1, called AMP-224.

[0394] In some embodiments, the immuno-oncology agent is a PD-L1 antagonist. In some embodiments, the PD-L1 antagonist is an antagonistic PD-L1 antibody. In some embodiments, the PD-L1 antibody is MPDL3280A (RG7446; WO 2010 / 077634), durvalumab (MEDI4736), BMS-936559 (WO 2007 / 005874), and MSB0010718C (WO 2013 / 79174).

[0395] In some embodiments, the immuno-oncology agent is a LAG-3 antagonist. In some embodiments, the LAG-3 antagonist is an antagonistic LAG-3 antibody. In some embodiments, the LAG-3 antibody is BMS-986016 (WO 10 / 19570, WO 14 / 08218), or IMP-731 or IMP-321 (WO 8 / 132601, WO 009 / 44273).

[0396] In some embodiments, the immuno-oncology agent is a CD137 (4-1BB) agonist. In some embodiments, the CD137 (4-1BB) agonist is an agonistic CD137 antibody. In some embodiments, the CD137 antibody is urelumab or PF-05082566 (WO 12 / 32433).

[0397] In some embodiments, the immuno-oncology agent is a GITR agonist. In some embodiments, the GITR agonist is an agonistic GITR antibody. In some embodiments, the GITR antibody is BMS-986153, BMS-986156, TRX-518 (WO 006 / 105021, WO 009 / 009116), or MK-4166 (WO 11 / 028683).

[0398] In some embodiments, the immuno-oncology agent is an indoleamine (2,3)-dioxygenase (IDO) antagonist. In some embodiments, the IDO antagonist is selected from the group consisting of epacadostat (INCB024360, Incyte); indoximod (NLG-8189, NewLink Genetics Corporation); capmanitib (INC280, Novartis); GDC-0919 (Genentech / Roche); PF-06840003 (Pfizer); BMS:F001287 (Bristol-Myers Squibb); Phy906 / KD108 (Phytoceutica); and kynurenine degrading enzymes (Kynase, Kyn). Therapeutics); and NLG-919 (WO 09 / 73620, WO 09 / 1156652, WO 11 / 56652, WO 12 / 142237).

[0399] In some embodiments, the immuno-oncology agent is an OX40 agonist. In some embodiments, the OX40 agonist is an agonistic OX40 antibody. In some embodiments, the OX40 antibody is MEDI-6383 or MEDI-6469.

[0400] In some embodiments, the immuno-oncology agent is an OX40L antagonist. In some embodiments, the OX40L antagonist is an antagonistic OX40 antibody. In some embodiments, the OX40L antagonist is RG-7888 (WO 06 / 029879).

[0401] In some embodiments, the immuno-oncology agent is a CD40 agonist. In some embodiments, the CD40 agonist is an agonistic CD40 antibody. In some embodiments, the immuno-oncology agent is a CD40 antagonist. In some embodiments, the CD40 antagonist is an antagonistic CD40 antibody. In some embodiments, the CD40 antibody is lucatumumab or dacetuzumab.

[0402] In some embodiments, the immuno-oncology agent is a CD27 agonist. In some embodiments, the CD27 agonist is an agonistic CD27 antibody. In some embodiments, the CD27 antibody is varlilumab.

[0403] In some embodiments, the immuno-oncology agent is MGA271 (directed against B7H3) (WO 11 / 109400).

[0404] In some embodiments, the immuno-oncology agent is abagovomab, adecatumumab, aftuzumab, alemtuzumab, anatumomab mafenatox, apolizumab, atezolizumab, avelumab, blinatumomab, BMS-936559, catumaxomab, durvalumab, epacadostat, epratuzumab, indoximod, inotuzumab ozogamicin, or rituximab. ozogamicin, intelumumab, ipilimumab, isatuximab, lambrolizumab, MED14736, MPDL3280A, nivolumab, obinutuzumab, ocaratuzumab, ofatumumab, olatatumumab, pembrolizumab, pidilizumab, rituximab, ticilimumab, samalizumab, or tremelimumab.

[0405] In some embodiments, the immuno-oncology agent is an immunostimulatory agent. For example, antibodies that block the PD-1 and PD-L1 inhibitory axis can unleash activated tumor-reactive T cells and have been shown in clinical trials to induce durable anti-tumor responses in an increasing number of tumor tissues, including several tumor types not traditionally considered sensitive to immunotherapy (e.g., Okazaki, T. et al. (2013) Nat. Immunol. 14, 1212-1218; Zou et al. (2016) Sci. Transl. Med. 8). The anti-PD-1 antibody nivolumab (Opdivo™, Bristol-Myers Squibb, also known as ONO-4538, MDX1106, and BMS-936558) has shown the potential to improve overall survival in patients with RCC who have experienced disease progression during or after previous antiangiogenic therapy.

[0406] In some embodiments, the immunomodulator specifically induces apoptosis of tumor cells. Approved immunomodulators that may be used in the present invention include pomalidomide (Pomalyst™, Celgene); lenalidomide (Revimid™, Celgene); and ingenol mebutate (Picato™, LEO Pharma).

[0407] In some embodiments, the immuno-oncology agent is a cancer vaccine. In some embodiments, the cancer vaccine is selected from sipuleucel-T (Provenge™, Dendreon / Valeant Pharmaceuticals), which is approved for the treatment of asymptomatic or minimally symptomatic metastatic castration-resistant (hormone-refractory) prostate cancer; and talimogene laherparepvec (Imlygic™, BioVex / Amgen, formerly known as T-VEC), which is a recombinant oncolytic virus agent approved for the treatment of unresectable cutaneous, subcutaneous, and nodal lesions of melanoma. In some embodiments, the immuno-oncology agent is an oncolytic viral agent, such as pexastimogene devacirepvec (PexaVec / JX-594, SillaJen / formerly Jennerex Biotherapeutics), a thymidine kinase- (TK-) deficient vaccinia virus engineered to express GM-CSF for hepatocellular carcinoma (NCT02562755) and melanoma (NCT00429312); pelareorep (Reolysin™, Oncolytics Biotech), a cancer treatment for many cancers, such as colorectal cancer (NCT01622543); prostate cancer (NCT01619813); head and neck squamous cell carcinoma (NCT01166542); pancreatic adenocarcinoma (NCT00998322); and non-small cell lung cancer (NSCLC). a mutant of respiratory enteric orphan virus (reovirus) that does not replicate in RAS-inactivated cells in cancers, including ovarian cancer (NCT00861627); enadenotucirev (NG-348, PsiOxus, formerly known as ColoAd1), an adenovirus engineered to express full-length CD80 and an antibody fragment specific for the T-cell receptor CD3 protein in ovarian cancer (NCT02028117);For example, metastatic or advanced epithelial tumors in colorectal cancer, bladder cancer, head and neck squamous cell carcinoma, and salivary gland cancer (NCT02636036); ONCOS-102 (Targovax / formerly Oncos), an adenovirus engineered to express GM-CSF in melanoma (NCT03003676); and peritoneal disease, colorectal cancer, or ovarian cancer (NCT02963831); GL-ONC1 (GLV-1h68 / GLV-1h153, Genelux GmbH), a vaccinia virus engineered to express beta-galactosidase (beta-gal) / beta-glucoronidase, or beta-gal / human sodium iodide symporter (hNIS), respectively, have been used to treat peritonitis carcinomatosis (NCT01443260); fallopian tube cancer, ovarian cancer or an adenovirus engineered to express GM-CSF in bladder cancer (NCT02365818), studied in CG0070 (Cold Genesys);

[0408] In some embodiments, the immuno-oncology agent is selected from the group consisting of JX-929 (SillaJen / formerly Jennerex Biotherapeutics), a TK- and vaccinia growth factor-deficient vaccinia virus engineered to express cytosine deaminase, which can convert the prodrug 5-fluorocytosine to the cytotoxic drug 5-fluorouracil; TG01 and TG02 (Targovax / formerly Oncos), peptide-based immunotherapeutics targeting difficult-to-treat RAS mutations; and TILT-123 (TILT Biotherapeutics), an engineered adenovirus designated: Ad5 / 3-E2F-delta24-hTNFα-IRES-hIL20; and VSV-GP (ViraTherapeutics), a vesicular stomatitis virus (VSV) engineered to express the glycoprotein (GP) of lymphocytic choriomeningitis virus (LCMV). virus), which is antigen-specific CD8 + which may be further engineered to express engineered antigens to enhance T cell responses.

[0409] In some embodiments, the immuno-oncology agent is a T cell engineered to express a chimeric antigen receptor, or CAR (chimeric antigen receptor). T cells engineered to express such a chimeric antigen receptor are called CAR-T cells.

[0410] CARs consist of a binding domain, which can be derived from a natural ligand, a single-chain variable fragment (scFv) derived from a monoclonal antibody specific for a cell surface antigen, fused to a functional end-domain of a T-cell receptor (TCR), such as the CD3-zeta signaling domain from the TCR, which can generate an activation signal in T lymphocytes. Upon antigen binding, such CARs link to endogenous signaling pathways within the effector cell and generate activation signals similar to those initiated by the TCR complex.

[0411] For example, in some embodiments, the CAR-T cells are one of those described in U.S. Patent No. 8,906,682 (June; incorporated herein by reference in its entirety), which discloses a CAR-T designed to include an extracellular domain having an antigen-binding domain (e.g., a domain that binds to CD19) fused to the intracellular signaling domain of the T cell antigen receptor complex zeta chain (e.g., CD3 zeta). When expressed in T cells, the CAR can redirect antigen recognition based on antigen-binding specificity. In the case of CD19, the antigen is expressed on malignant B cells. More than 200 clinical trials are currently underway using CAR-T for a wide range of indications [https: / / clinicaltrials.gov / ct2 / results?term=chimeric+antigen+receptors&pg=1].

[0412] In some embodiments, the immunostimulatory agent is an activator of retinoic acid receptor-related orphan receptor g (RORgt). RORgt is a transcription factor that plays an important role in the differentiation and maintenance of type 17 effector subsets of CD4+ (Th17) and CD8+ (Tc17) T cells, as well as the differentiation of innate immune cell subpopulations that express IL-17, such as NK cells. In some embodiments, the activator of RORgt is LYC-55716 (Lycera), which is currently being evaluated in clinical trials for the treatment of solid tumors (NCT02929862).

[0413] In some embodiments, the immunostimulatory agent is a toll-like receptor (TLR) agonist or activator. Suitable activators of TLRs include TLR9 agonists or activators, such as SD-101 (Dynavax). SD-101 is an immunostimulatory CpG that is being studied in B-cell, follicular, and other lymphomas (NCT02254772). TLR8 agonists or activators that can be used in the present invention include motolimod (VTX-2337, VentiRx Pharmaceuticals), which is being studied in squamous cell carcinoma of the head and neck (NCT02124850) and ovarian cancer (NCT02431559).

[0414] Other immuno-oncology agents that may be used in the present invention include urelumab (BMS-663513, Bristol-Myers Squibb), an anti-CD137 monoclonal antibody; varlilumab (CDX-1127, Celldex Therapeutics), an anti-CD27 monoclonal antibody; BMS-986178 (Bristol-Myers Squibb), an anti-OX40 monoclonal antibody; lirilumab (IPH2102 / BMS-986015, Innate Pharma, Bristol-Myers Squibb), an anti-KIR monoclonal antibody; monalizumab (IPH2201, Innate Pharma, AstraZeneca), an anti-NKG2A monoclonal antibody; andecaliximab (GS-5745, Gilead Sciences, Inc., New York, NY, USA) Sciences), an anti-MMP9 antibody; MK-4166 (Merck & Co.), an anti-GITR monoclonal antibody.

[0415] In some embodiments, the immunostimulatory agent is selected from elotuzumab, mifamurtide, agonists or activators of Toll-like receptors, and activators of RORgt.

[0416] In some embodiments, the Immunostimulatory Therapeutic Agent is recombinant human interleukin 15 (rhIL-15). rhIL-15 is being clinically tested as a treatment for melanoma and renal cell carcinoma (NCT01021059 and NCT01369888) and leukemia (NCT02689453). In some embodiments, the Immunostimulatory Agent is recombinant human interleukin 12 (rhIL-12). In some embodiments, the IL-15-based immunotherapeutic is heterodimeric IL-15 (hetIL-15, Novartis / Admune), a fusion complex composed of a synthetic form of endogenous IL-15 complexed with the soluble IL-15 binding protein IL-15 receptor alpha chain (IL15:sIL-15RA), which is being tested in Phase 1 clinical trials for melanoma, renal cell carcinoma, non-small cell lung cancer, and head and neck squamous cell carcinoma (NCT02452268). In some embodiments, the recombinant human interleukin-12 (rhIL-12) is NM-IL-12 (Neumedicines Inc.), NCT02544724, or NCT02542124.

[0417] In some embodiments, the immuno-oncology agent is selected from those listed in Table 1 of Jerry L. Adams et al., "Big opportunities for small molecules in immuno-oncology," Cancer Therapy 2015, Vol. 14, pages 603-622, the entire contents of which are incorporated herein by reference. In some embodiments, the immuno-oncology agent is a small molecule that targets an immune tumor target selected from those listed in Table 2 of Jerry L. Adams et al., supra. In some embodiments, the immuno-oncology agent is a small molecule agent selected from those listed in Table 2 of Jerry L. Adams et al., supra.

[0418] In some embodiments, the immuno-oncology agent is selected from the small molecule immuno-oncology agents described in Peter L. Toogood, "Small molecule immuno-oncology therapeutic agents," Bioorganic & Medicinal Chemistry Letters 2018, Vol. 28, pages 319-329, the entire contents of which are incorporated herein by reference. In some embodiments, the immuno-oncology agent is an agent that targets a pathway described in Peter L. Toogood, supra.

[0419] In some embodiments, the immuno-oncology agent is selected from those described in Sandra L. Ross et al., "Bispecific T cell engager (BiTE™) antibody constructs can mediate bystander tumor cell killing," PLoS ONE 12(8):e0183390, the entire contents of which are incorporated herein by reference. In some embodiments, the immuno-oncology agent is a bispecific T cell engager (BiTE™) antibody construct. In some embodiments, the bispecific T cell engager (BiTE™) antibody construct is a CD19 / CD3 bispecific antibody construct. In some embodiments, the bispecific T cell engager (BiTE™) antibody construct is an EGFR / CD3 bispecific antibody construct. In some embodiments, the bispecific T cell engager (BiTE™) antibody construct activates T cells. In some embodiments, the bispecific T cell engager (BiTE™) antibody construct activates T cells, which release cytokines that induce upregulation of intercellular adhesion molecule 1 (ICAM-1) and FAS in bystander cells. In some embodiments, the bispecific T cell engager (BiTE™) antibody construct activates T cells, which results in induced bystander cell lysis. In some embodiments, the bystander cells are in a solid tumor. In some embodiments, the lysed bystander cells are in the vicinity of BiTE™-activated T cells. In some embodiments, the bystander cells comprise tumor-associated antigen (TAA)-negative cancer cells. In some embodiments, the bystander cells comprise EGFR-negative cancer cells. In some embodiments, the immuno-oncology agent is an antibody that blocks the PD-L1 / PD1 axis and / or CTLA4.In some embodiments, the immuno-oncology agent is an ex vivo expanded tumor-infiltrating T cell. In some embodiments, the immuno-oncology agent is a bispecific antibody construct or chimeric antigen receptors (CARs) that directly connect T cells to tumor-associated surface antigens (TAAs).

[0420] Exemplary Immune Checkpoint Inhibitors

[0421] In some embodiments, the immuno-oncology agent is an immune checkpoint inhibitor described herein.

[0422] The term "checkpoint inhibitors," as used herein, refers to agents useful for preventing cancer cells from evading a patient's immune system. One of the major mechanisms of anti-tumor immunity subversion is known as "T cell depletion," which results from chronic exposure to antigens that causes the upregulation of inhibitory receptors. These inhibitory receptors function as immune checkpoints to prevent uncontrolled immune responses.

[0423] PD-1 and its coinhibitory receptors, such as cytotoxic T-lymphocyte antigen 4 (CTLA-4), B and T lymphocyte attenuator (BTLA; CD272), T cell immunoglobulin and mucin domain-3 (Tim-3), lymphocyte activation gene-3 (Lag-3; CD223), and others, are often referred to as checkpoint regulators. They function as molecular “gatekeepers” that allow extracellular signals to determine whether cell cycle progression and other intracellular signaling processes proceed.

[0424] In some embodiments, the immune checkpoint inhibitor is an antibody against PD-1, which binds to the programmed cell death 1 receptor (PD-1) and prevents the receptor from binding to the inhibitory ligand PDL-1, thus abolishing the tumor's ability to suppress the host's anti-tumor immune response.

[0425] In one aspect, the checkpoint inhibitor is a biotherapeutic agent or a small molecule. In another aspect, the checkpoint inhibitor is a monoclonal antibody, a humanized antibody, a fully human antibody, a fusion protein, or a combination thereof. In a further aspect, the checkpoint inhibitor inhibits a checkpoint protein selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, B-7 family ligand, or a combination thereof. In an additional aspect, the checkpoint inhibitor interacts with a ligand of a checkpoint protein selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, a B-7 family ligand, or a combination thereof. In one aspect, the checkpoint inhibitor is an immunostimulant, a T cell growth factor, an interleukin, an antibody, a vaccine, or a combination thereof. In a further aspect, the interleukin is IL-7 or IL-15. In a particular aspect, the interleukin is glycosylated IL-7. In an additional aspect, the vaccine is a dendritic cell (DC) vaccine.

[0426] Checkpoint inhibitors include any agent that blocks or inhibits a suppressive pathway of the immune system in a statistically significant manner. Such inhibitors may include small molecule inhibitors or may include antigen-binding fragments thereof that bind to and block or inhibit immune checkpoint receptors, or antibodies that bind to and block or inhibit immune checkpoint receptor ligands. Exemplary checkpoint molecules that can be targeted for blocking or inhibition include CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, GAL9, LAG3, TIM3, VISTA, KIR, 2B4 (belonging to the CD2 family of molecules, and all NK, gamma delta, and memory CD8 +(expressed on αβ)T cells), CD160 (also called BY55), CGEN-15049, CHK1 and CHK2 kinases, A2aR, and various B-7 family ligands. B-7 family ligands include, but are not limited to, B7-1, B7-2, B7-DC, B7-H1, B7-H2, B7-H3, B7-H4, B7-H5, B7-H6, and B7-H7. Checkpoint inhibitors include antibodies, or antigen-binding fragments thereof, other binding proteins, biotherapeutics, or small molecules that block or inhibit the activity of one or more of CTLA-4, PDL1, PDL2, PD1, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, and CGEN-15049. Exemplary immune checkpoint inhibitors include tremelimumab (a CTLA-4 blocking antibody), anti-OX40, PD-L1 monoclonal antibody (anti-B7-H1; MEDI4736), MK-3475 (a PD-1 blocker), nivolumab (an anti-PD1 antibody), CT-011 (an anti-PD1 antibody), BY55 monoclonal antibody, AMP224 (an anti-PDL1 antibody), BMS-936559 (an anti-PDL1 antibody), MPLDL3280A (an anti-PDL1 antibody), MSB0010718C (an anti-PDL1 antibody), and ipilimumab (an anti-CTLA-4 checkpoint inhibitor). Checkpoint protein ligands include, but are not limited to, PD-L1, PD-L2, B7-H3, B7-H4, CD28, CD86, and TIM-3.

[0427] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antagonist, a PD-L1 antagonist, and a CTLA-4 antagonist. In some embodiments, the checkpoint inhibitor is selected from the group consisting of nivolumab (Opdivo™), ipilimumab (Yervoy™), and pembrolizumab (Keytruda™). In some embodiments, the checkpoint inhibitor is selected from the group consisting of nivolumab (anti-PD-1 antibody, Opdivo™, Bristol-Myers Squibb); pembrolizumab (anti-PD-1 antibody, Keytruda™, Merck); ipilimumab (anti-CTLA-4 antibody, Yervoy™, Bristol-Myers Squibb); durvalumab (anti-PD-L1 antibody, Imfinzi™, AstraZeneca); and atezolizumab (anti-PD-L1 antibody, Tecentriq™, Genentech).

[0428] In some embodiments, the checkpoint inhibitor is selected from the group consisting of lambrolizumab (MK-3475), nivolumab (BMS-936558), pidilizumab (CT-011), AMP-224, MDX-1105, MEDI4736, MPDL3280A, BMS-936559, ipilimumab, lirlumab, IPH2101, pembrolizumab (Keytruda™), and tremelimumab.

[0429] In some embodiments, the immune checkpoint inhibitor is REGN2810 (Regeneron), an anti-PD-1 antibody tested in patients with basal cell carcinoma (NCT03132636); NSCLC (NCT03088540); squamous cell carcinoma (NCT02760498); lymphoma (NCT02651662); and melanoma (NCT03002376); pidilizumab (CureTech), also known as CT-011, an antibody that binds to PD-1 in clinical trials for diffuse large B-cell lymphoma and multiple myeloma; avelumab (Bavencio™, Pfizer / Merck KGaA), also known as MSB0010718C, an antibody that binds to PD-1 in clinical trials for non-small cell lung cancer, Merkel cell carcinoma, mesothelioma, solid tumors, renal cancer, ovarian cancer, and ovarian cancer. or PDR001 (Novartis), a blocking antibody that binds to PD-1 in clinical trials for non-small cell lung cancer, melanoma, triple-negative breast cancer, and advanced or metastatic solid tumors. Tremelimumab (CP-675,206; Astrazeneca) is a fully human monoclonal antibody against CTLA-4 that has been studied in clinical trials for many indications, including mesothelioma, colorectal cancer, kidney cancer, breast cancer, lung cancer and non-small cell lung cancer, pancreatic ductal adenocarcinoma, pancreatic cancer, germ cell cancer, squamous cell carcinoma of the head and neck, hepatocellular carcinoma, prostate cancer, endometrial cancer, metastatic cancer in the liver, liver cancer, large B-cell lymphoma, ovarian cancer, cervical cancer, metastatic non-histoplastic thyroid cancer, urothelial carcinoma, fallopian tube cancer, multiple myeloma, bladder cancer, soft tissue sarcoma, and melanoma. AGEN-1884 (Agenus) is an anti-CTLA4 antibody being studied in a Phase 1 clinical trial for advanced solid tumors (NCT02694822).

[0430] In some embodiments, the checkpoint inhibitor is an inhibitor of T-cell immunoglobulin mucin-containing protein-3 (TIM-3). TIM-3 inhibitors that can be used in the present invention include TSR-022, LY3321367, and MBG453. TSR-022 (Tesaro) is an anti-TIM-3 antibody being studied in solid tumors (NCT02817633). LY3321367 (Eli Lilly) is an anti-TIM-3 antibody being studied in solid tumors (NCT03099109). MBG453 (Novartis) is an anti-TIM-3 antibody being studied in advanced malignancies (NCT02608268).

[0431] In some embodiments, the checkpoint inhibitor is an inhibitor of a T cell immunoreceptor having Ig and ITIM domains or TIGIT, an immunoreceptor in certain T cells and NK cells. TIGIT inhibitors that can be used in the present invention include BMS-986207 (Bristol-Myers Squibb), anti-TIGIT monoclonal antibody (NCT02913313); OMP-313M32 (Oncomed); and anti-TIGIT monoclonal antibody (NCT03119428).

[0432] In some embodiments, the checkpoint inhibitor is an inhibitor of lymphocyte activation gene-3 (LAG-3). LAG-3 inhibitors that can be used in the present invention include BMS-986016, REGN3767, and IMP321. BMS-986016 (Bristol-Myers Squibb), an anti-LAG-3 antibody, is being studied in glioblastoma and gliosarcoma (NCT02658981). REGN3767 (Regeneron) is also an anti-LAG-3 antibody and is being studied in gliosarcoma (NCT03005782). IMP321 (Immutep SA) is a LAG-3-Ig fusion protein that has been studied in melanoma (NCT02676869); adenocarcinoma (NCT02614833); and metastatic breast cancer (NCT00349934).

[0433] Checkpoint inhibitors that can be used in the present invention include OX40 agonists. OX40 agonists being tested in clinical trials include PF-04518600 / PF-8600 (Pfizer), an agonistic anti-OX40 antibody for metastatic kidney cancer (NCT03092856) and advanced and neoplastic cancers (NCT02554812; NCT05082566); GSK3174998 (Merck), an agonistic anti-OX40 antibody in a Phase 1 cancer trial (NCT02528357); MEDI0562 (Medimmune / AstraZeneca), an agonistic anti-OX40 antibody for advanced solid tumors (NCT02318394 and NCT02318396). CT02705482); MEDI6469, an agonistic anti-OX40 antibody (Medimmune / AstraZeneca) in patients with colorectal cancer (NCT02559024), breast cancer (NCT01862900), head and neck cancer (NCT02274155), and metastatic prostate cancer (NCT01303705); and BMS-986178 (Bristol-Myers Squibb), an agonistic anti-OX40 antibody in advanced cancers (NCT02737475).

[0434] Checkpoint inhibitors that can be used in the present invention include CD137 (also known as 4-1BB) agonists. CD137 agonists being investigated in clinical trials include utomilumab (PF-05082566, Pfizer), an agonistic anti-CD137 antibody in diffuse large B-cell lymphoma (NCT02951156) and advanced and neoplastic cancers (NCT02554812 and NCT05082566); urelumab (BMS-663513, Bristol-Myers Squibb), an agonistic anti-CD137 antibody in melanoma and skin cancer (NCT02652455) and glioblastoma and gliosarcoma (NCT02658981).

[0435] Checkpoint inhibitors that can be used in the present invention include CD27 agonists. CD27 agonists being investigated in clinical trials include varlilumab (CDX-1127, Celldex Therapeutics), an agonistic anti-CD27 antibody in squamous cell head and neck cancer, ovarian carcinoma, colorectal cancer, renal cell carcinoma, and glioblastoma (NCT02335918); lymphoma (NCT01460134); and glioma and astrocytoma (NCT02924038).

[0436] Checkpoint inhibitors that can be used in the present invention include glucocorticoid-induced tumor necrosis factor receptor (GITR) agonists. GITR agonists being investigated in clinical trials include TRX518 (Leap Therapeutics), an agonistic anti-GITR antibody in melanoma and other malignant solid tumors (NCT01239134 and NCT02628574); GWN323 (Novartis), an agonistic anti-GITR antibody in solid tumors and lymphomas (NCT02740270); INCAGN01876 (Incyte / Agenus), an agonistic anti-GITR antibody in advanced cancers (NCT02697591 and NCT03126110); MK-4166 (Merck), an agonistic anti-GITR antibody in solid tumors (NCT02132754) and MEDI1873 (Medimmune / AstraZeneca), a human IgG1 in advanced solid tumors (NCT02583165). agonistic hexameric GITR-ligand molecules having an Fc domain.

[0437] Checkpoint inhibitors that can be used in the present invention include inducible T-cell co-stimulator (ICOS, also known as CD278) agonists. ICOS agonists being investigated in clinical trials include MEDI-570 (Medimmune), an agonistic anti-ICOS antibody in lymphoma (NCT02520791); GSK3359609 (Merck), an agonistic anti-ICOS antibody in Phase 1 (NCT02723955); and JTX-2011 (Jounce Therapeutics), an agonistic anti-ICOS antibody in Phase 1 (NCT02904226).

[0438] Checkpoint inhibitors that can be used in the present invention include killer IgG-like receptor (KIR) inhibitors. KIR inhibitors being investigated in clinical trials include lirilumab (IPH2102 / BMS-986015, Innate Pharma / Bristol-Myers Squibb), an anti-KIR antibody in leukemia (NCT01687387, NCT02399917, NCT02481297, NCT02599649), multiple myeloma (NCT02252263), and lymphoma (NCT01592370); IPH2101 (1-7F9, Innate Pharma), an anti-KIR antibody that binds to the three domains of the long cytoplasmic tail (KIR3DL2), in myeloma (NCT01222286 and NCT01217203); and IPH4102 (Innate Pharma), an anti-KIR antibody that binds to the three domains of the long cytoplasmic tail (KIR3DL2), in lymphoma (NCT02593045).

[0439] Checkpoint inhibitors that can be used in the present invention include CD47 inhibitors of the interaction between CD47 and signal regulatory protein alpha (SIRPa). CD47 / SIRPa inhibitors being investigated in clinical trials include ALX-148 (Alexo Therapeutics), an antagonistic variant of SIRPa that binds to CD47 and prevents CD47 / SIRPa-mediated signaling (SIRPa) in Phase 1 (NCT03013218); TTI-621 (SIRPa-Fc, Trillium Therapeutics), an antagonistic variant of SIRPa that binds to human CD47 and prevents macrophages from "eating" SIRPa; Soluble recombinant fusion proteins being investigated in clinical trials, created by combining the N-terminal CD47-binding domain of SIRPa with the Fc domain of human IgG1, act by preventing the transmission of CD47 signaling; CC-90002 (Celgene), an anti-CD47 antibody in leukemia (NCT02641002); and Hu5F9-G4 (Forty Seven, Inc.), in colorectal neoplasia and solid tumors (NCT02953782), acute myeloid leukemia (NCT02678338), and lymphoma (NCT02953509).

[0440] Checkpoint inhibitors that can be used in the present invention include CD73 inhibitors. CD73 inhibitors being studied in clinical trials include MEDI9447 (Medimmune), an anti-CD73 antibody in solid tumors (NCT02503774); and BMS-986179 (Bristol-Myers Squibb), an anti-CD73 antibody in solid tumors (NCT02754141).

[0441] Checkpoint inhibitors that can be used in the present invention include agonists of the stimulator of interferon genes protein (STING, also known as transmembrane protein 173, i.e., TMEM173). STING agonists being investigated in clinical trials include MK-1454 (Merck), an agonistic synthetic cyclic dinucleotide in lymphoma (NCT03010176); and ADU-S100 (MIW815, Aduro Biotech / Novartis), an agonistic synthetic cyclic dinucleotide in Phase 1 trials (NCT02675439 and NCT03172936).

[0442] Checkpoint inhibitors that can be used in the present invention include CSF1R inhibitors. CSF1R inhibitors being investigated in clinical trials include pexidartinib (PLX3397, Plexxikon), a treatment for colorectal cancer, pancreatic cancer, metastatic and advanced cancers (NCT02777710), as well as melanoma, non-small cell lung cancer, squamous cell head and neck cancer, gastrointestinal stromal tumor (GIST), and ovarian cancer. and IMC-CS4 (LY3022855, Lilly), an anti-CSF-1R antibody in pancreatic cancer (NCT03153410), melanoma (NCT03101254), and solid tumors (NCT02718911); and BLZ945 (4-[2((1R,2R)-2-hydroxycyclohexylamino)-benzothiazol-6-yloxy]-pyridine-2-carboxylic acid methylamide, Novartis), an orally available inhibitor of CSF1R in advanced solid tumors (NCT02829723).

[0443] Checkpoint inhibitors that can be used in the present invention include NKG2A receptor inhibitors. An NKG2A receptor inhibitor being studied in clinical trials is monalizumab (IPH2201, Innate Pharma), an anti-NKG2A antibody in head and neck neoplasms (NCT02643550) and chronic lymphocytic leukemia (NCT02557516).

[0444] In some embodiments, the immune checkpoint inhibitor is selected from nivolumab, pembrolizumab, ipilimumab, avelumab, durvalumab, atezolizumab, or pidilizumab.

[0445] In addition to the above-described methods of prevention and / or treatment, the present invention also provides corresponding methods of use for preventing and / or treating the diseases, disorders, or conditions described herein. In some embodiments, the present invention provides methods of use of the compounds described herein, or pharmaceutically acceptable salts thereof, for preventing and / or treating a viral infection, or an inflammatory disease, disorder, or condition, or cancer described herein. In some embodiments, the methods of use provided by the present invention for preventing and / or treating HIV infection are intended for patients in whom the presence and / or expression level of HIV splice variants as biomarkers is measured and / or monitored by the methods described herein. In some embodiments, the methods of use for preventing and / or treating an inflammatory disease, disorder, or condition, or cancer are intended for patients in whom the presence and / or expression level of spliced ​​long non-coding RNA at the miR-124 locus as a biomarker is measured and / or monitored by the methods described herein.

[0446] Further provided herein is a compound of Formula I, Formula Ia, Formula Ib, Formula Ib', Formula Ic, Formula Id, Formula IV, Formula IVa, Formula IVb, Formula IVb', Formula IVc, or Formula IVd, or a pharmaceutically acceptable salt thereof, as defined above, for use in treating or preventing an inflammatory disease, disorder, or condition, or cancer, in a patient in need thereof. In some embodiments, the compound of Formula Ia, Formula Ib, Formula Ib', Formula Ic, Formula Id, Formula IV, Formula IVa, Formula IVb, Formula IVb', Formula IVc, or Formula IVd, or a pharmaceutically acceptable salt thereof, as defined above, for use as an anti-inflammatory agent is intended for patients in which the presence and / or expression level of spliced ​​long non-coding RNA at the miR-124 locus is monitored in blood and / or tissue samples from the patient prior to said treatment and / or during the course of said use.

[0447] Further provided herein are pharmaceutically acceptable salts of compounds of Formula I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc, or IVd, as defined above, for use in treating HIV infection in a patient in need thereof. In some embodiments, compounds of Formula I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc, or IVd, as defined above, for use as an HIV treatment are intended for the patient, wherein the pharmaceutically acceptable salts are monitored in blood and / or tissue samples from the patient during the course of said use.

[0448] Further exemplary embodiments:

[0449] 1. A method for using the HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection or as a biomarker for the effectiveness of therapeutic treatment of HIV infection, said method comprising measuring the presence or expression level of the HIV splice variant of SEQ. ID. No. 1 in a biological sample.

[0450] 2. A method for assessing the biological effect of a compound for the treatment of HIV infection, comprising measuring the presence or expression level of the HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection.

[0451] 3. A method for screening compounds or vaccines in preventing and / or treating HIV infection, comprising measuring the presence or expression level of the HIV splice variant of SEQ. ID. No. 1 as a biomarker for HIV infection.

[0452] 4. A method for treating HIV infection, comprising administering a therapeutic treatment to a patient and determining and / or monitoring the presence and / or expression level of the HIV splice variant of SEQ. ID. No. 1 in the patient.

[0453] 5. A method of using lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder or condition, or as a biomarker for the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus in a biological sample.

[0454] 6. A method for evaluating the biological effect of a compound or medical device in treating an inflammatory disease, disorder or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder or condition, or cancer.

[0455] 7. A method for screening compounds or medical devices in treating an inflammatory disease, disorder or condition, or cancer, comprising measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder or condition, or cancer.

[0456] 8. A method of treating an inflammatory disease, disorder or condition, or cancer, comprising administering a therapeutic treatment to a patient and measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

[0457] 9. A method of treating an inflammatory disease, disorder or condition, or cancer, comprising administering a therapeutic treatment to a patient and measuring and / or monitoring the presence and / or expression level of miR-124 in said patient.

[0458] 10. A method for selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer, comprising measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the miR-124-1 locus in the patient.

[0459] 11. A method for selecting a patient for therapeutic treatment, comprising measuring and / or monitoring the presence and / or expression level of miR-124 in the patient.

[0460] 12. The method of embodiments 4 and 8-11, wherein said therapeutic treatment is a compound of formula I below or a pharmaceutically acceptable salt thereof. [ka] where: Z is C or N; V is C or N; [ka] means an aromatic ring, wherein V is C or N, and when V is N, V ​​is in the ortho, meta or para position relative to Z; Each R is independently a hydrogen atom, a halogen atom, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -O-P(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, where the alkyl is optionally a hydroxyl group, or a group of formula (IIa) [ka] Or a group of the following formula (IIIa) [ka] optionally mono- or disubstituted by Q is N or O, provided that when Q is O, R″ is absent; R1 and R2 each independently represent a hydrogen atom or a (C1-C3) alkyl; R3 and R4 each independently represent a hydrogen atom, Li + , Na + , K. + , N + (Ra)4 or benzyl, n is 1, 2 or 3; n' is 1, 2 or 3; Each R' is independently a hydrogen atom, (C1-C3) alkyl, hydroxyl, a halogen atom, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3) fluoroalkyl, (C1-C4) alkoxy, -OP(=O)-(OR3)(OR4), -CN, or a group of formula (IIa) below. [ka] Or a group of the following formula (IIIa) [ka] A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb is independently a hydrogen atom, a (C1-C5) alkyl, or a (C3-C6) cycloalkyl; or R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocyclic ring, which may be optionally substituted with one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 or 3 only if the other R a group is different from said (IIa) or (IIIa) group; and R″ is a hydrogen atom, a (C1-C4) alkyl or a group of formula (IIa) as defined above.

[0461] 13. The method of embodiment 12, wherein the compound is selected from the group consisting of Formulae Ia to Id below, or a pharmaceutically acceptable salt thereof. [ka]

[0462] 14. The method of embodiment 12 or 13, wherein said compound is ABX464 or a pharmaceutically acceptable salt thereof.

[0463] 15. The method of any one of embodiments 1, 4, or 8-11, wherein said therapeutic treatment is a compound of formula IV: [ka] wherein V, Z, R, R', n, and n' are each as described in embodiment 8.

[0464] 16. The method of embodiment 15, wherein the compound is selected from the group consisting of Formulas IVa-IVd below or a pharmaceutically acceptable salt thereof. [ka]

[0465] Example

[0466] Human samples

[0467] All experiments on human biopsies were performed in accordance with the relevant guidelines and regulations and were approved by AEMPS (Spanish Agency). AEMPS number: 16-0728 under contract number EudraCT: 2016-002797-1titulo ESTUDIOABIERTODE LA SEGURIDAD,FARMACOCINETICA Y FARMACODINAMICA DE ABX464EN ADULTOS SERONEGATIVOS Y SEROPOSITIVOS PARA ELVIH-1. Informed consent was obtained from all subjects.

[0468] Cell culture, infection, and transduction

[0469] Buffy coats from HIV-negative individuals were obtained from the local blood donation center at the Centre de transfusion sanguine Montpellier. Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll (Histopaque, Sigma) gradient centrifugation. CD4+ and CD8+ T cells were purified from PBMCs after Ficoll gradient centrifugation by human CD4+ and CD8+ bead-positive selection, respectively (Miltenyi). PBMCs, CD4+ cells, and CD8+ T cells were cultured at 1.5 × 10 in RPMI GlutaMAX medium (Life Technologies) supplemented with 10% fetal calf serum (FCS) (Thermo Fisher), 40 U / ml IL2 (PeproTech), and 5 μg / ml PHA (Roche) at 37°C and 5% CO2. 6 After 3 days, cells were cultured at a density of 1.5 x 10 cells / ml in RPMI supplemented with 10% FCS and 40 U / ml IL-2. 6 The cells were resuspended at 1000 cells / ml and divided into two portions (infected and uninfected cells). 6 Cells were infected with 80 ng of HO for 4-6 h and then rinsed with PBS before refreshing the medium.

[0470] Both infected and uninfected cells were then centrifuged according to the manufacturer's instructions and plated at 1.5 × 10 in medium supplemented with diluted drug solubilized in DMSO (Sigma). 6 Cells were resuspended to a density of 1000 cells / ml and adjusted to a final 0.05% DMSO concentration or antiretroviral compound. Cells were treated for 6 days, with medium refreshed on day 3. HIV p24 titration was performed by ELISA from cell culture supernatants using the Innotest kit (Ingen) according to the manufacturer's instructions.

[0471] To generate monocyte-derived macrophages, monocytes were isolated using CD14+ microbeads (Miltenyi) and cultured in X-VIVO 10 medium (Lonza) supplemented with 10 mM HEPES, 1 mM sodium pyruvate, 1% non-essential amino acids, 10% FBS, 10 ng / ml GM-CSF, and 100 ng / ml M-CSF for 7 days, with a medium change on day 3. After 7 days of differentiation, the cells were washed, placed in 6-well plates, and cultured for 24 hours in medium without cytokines. Cells were treated for 6 days, with a partial medium change on day 3.

[0472] HeLa cells (ATCC) were cultured in DMEM GlutaMAX medium (Life Technologies) supplemented with 10% FCS (Thermo Fisher) at 37°C and 5% CO2. The region corresponding to lncRNA 0599-205 was synthesized by IDT (Integratde DNA Technologies) and cloned into pcDNA3.1 to generate the pc-lncRNA 0599-205 plasmid. pc-lncRNA 0599-205 (2 μg per 400,000 cells) was transiently transfected into HeLa cells using jetPEI reagent (Polyplus) according to the manufacturer's instructions.

[0473] miRNA (RT-q)-PCR analysis

[0474] miRNA was extracted from PBMCs, CD4+, or CD8+ T cells using the NucleoSpin miRNeasy kit (Macherey-Nagel) according to the manufacturer's instructions. miRNA reverse transcription (RT) was performed using the miScript II RT kit (Qiagen). The resulting cDNA was used as a template for real-time qPCR using the miScript SYBR Green PCR kit (Qiagen) with appropriate primers (Qiagen). Relative qPCR was performed using a specific miR-124 primer (Hs_miR-124a), a control-specific primer (Ce_miR-39), and two housekeeping gene (miR-26 and miR-191)-specific primers (Hs_miR-26a and Hs_miR-191). PCR analysis was performed using a LightCycler 480 Instrument II (Roche Molecular Systems, Inc.). All reactions were performed in triplicate. The relative levels of miR-124 were -ΔΔCt was calculated using the method.

[0475] Total RNA was extracted from macrophages using the Macherey-Nagel NucleoSpin miRNeasy kit. miRNA reverse transcription (RT) was performed on 2 μl of total RNA according to the Applied Biosystems TaqMan Advanced miRNA Assay protocol for TaqMan qPCR. Relative qPCR was performed using a specific miR-124 primer (Hs_miR-124a), a spike-in control-specific primer (Ce_miR-39), and a housekeeping gene (miR-191)-specific primer (Hs_miR-191). PCR runs were analyzed using Applied Biosystems ViiA7 software.

[0476] Quantification of miR-124 in human biopsies

[0477] Quantification of miR-124 was performed on rectal biopsy samples from patients collected in PAXgene Tissue Containers (PreAnalytiX). RNA extraction was performed using the PAXgene Tissue miRNA Kit (PreAnalytiX) according to the manufacturer's protocol. Briefly, samples were placed in 250 μl of Buffer™1 in a 2 ml Safe-Lock microcentrifuge tube containing one 5 mm stainless steel bead. The samples were disrupted and homogenized twice for 2 minutes at 20 Hz using a Qiagen TissueLyser instrument. The remaining steps were performed according to the manufacturer's protocol. At the end of the procedure, each RNA was eluted in 32 μl of TM4 buffer. RNA concentration and purity were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). RNA integrity was assessed using an Agilent 2200 TapeStation with RNAScreenTape. cDNA templates were prepared starting from 10 ng of total RNA matrix using the TaqMan Advanced miRNA cDNA Synthesis Kit (Applied Biosystems) according to the manufacturer's protocol. qPCR was performed using two TaqMan Advanced miRNA Assays (Applied Biosystems), one targeting miR-124-1 miRNA (Assay ID: 477879_mir) and the other targeting the endogenous miRNA miR16 (Assay ID: 477860_mir), which was used as a reference for normalizing expression data, according to the manufacturer's protocol. qPCR was performed using two TaqMan Advanced miRNA Assays (Applied Biosystems), one targeting miR-124-1 miRNA (Assay ID: 477879_mir) and the other targeting the endogenous miRNA miR16 (Assay ID: 477860_mir), which was used as a reference for normalizing expression data. All assays were performed on a LightCycler 480 Instrument II (Roche Molecular Systems Inc.) All assays were labeled using FAM-MGB chemistry.

[0478] Statistical Data Analysis

[0479] All statistical analyses and plots were performed using R software v3.5. For normalization and processing, we used edgeR v3.22.1, EDASeq v2.14, and DESeq2 v1.20. We decided to primarily use counts per million (CPM) rather than transcripts per million (TPM) because TPM discards much information about the original count size and would therefore generate too much noise for differential testing. The first step was to filter the data. We considered a gene to be expressed at a reasonable level in a sample if it had at least 5 counts per million mapped reads in the sample. For marker selection, we used type 11, which was set at 5%. (*)An error α threshold was used, which allows a very flexible approach to differential analysis despite the lack of replication. For the same reason, the log2 fold change cutoff was set to 1.5 for both positive and negative values, and the cutoff P value was typically ≤0.05. These appropriate cutoffs allowed for the identification of differentially expressed genes. False discovery rate (FDR) values ​​were calculated for illustrative purposes but were not considered in the determination due to the lack of replication. The initial methodological choice was Benjamini and Hochberg. This procedure provided less stringent control of type 1 errors compared to familywise error rate (FWER) procedures (e.g., Bonferroni correction). We added MDS plots for the data using R and the edgeR package. The MDS plot generates a plot in which the distance between samples corresponds to the principal biological coefficient of variation (BCV) between those samples. In this plot, no separation was observed between the DMSO-NI, 464-NI, DMSOI, and 464-I conditions. We also generated several Volcano plots using R and the EDASeq package. These plots were good representations of the differential expression (DE) studies in RNA-Seq experiments. These plots show the log2 fold-change (FC) and -log fold-change (FC) for all genes investigated in the DE studies. 10 The P-values ​​of the markers are shown. Highlighted green dots are markers that met the selection criteria (significant by both P-value and log2FC). Highlighted yellow dots are genes that met the log2FC criteria but did not meet the P-value criteria. We did not consider these dots to be of definitive value, but retained them for further investigation.

[0480] Sequencing and bioinformatics analysis

[0481] RNA CaptureSeq of HIV RNA and cellular microRNAs

[0482] Total RNA was extracted from infected and uninfected PBMC samples using TRIzol Reagent (Invitrogen) according to the manufacturer's protocol. RNA concentration and purity were determined using an RNA 6000 Bioanalyzer kit (Agilent). For cDNA synthesis, 1 μg of total RNA was treated with DNase I (Invitrogen) according to the manufacturer's instructions and then used as a template for reverse transcription using the Verso cDNA kit with a blend of random hexamers and anchored oligo-dT (Thermo Scientific). After preparing a KAPA Hyper Prep (ROCHE) library from 1 μg of total RNA, we proceeded with SeqCap EZ Capture (ROCHE) according to the manufacturer's recommendations. Hybrid selection was performed using a custom SeqCap EZ Choice Library (Roche NimbleGen) containing the following regions: chromosome 8 (9,760,617 to 9,761,780 and 65,285,285 to 65,296,944), chromosome 20 (61,797,549 to 61,812,855), chromosome 1 (1,102,000 to 1,106,000), chromosome 13 (92,000,074 to 92,006,833), chromosome 15 (22,512,831 to 2,513,641), and the genome of the HIV Ada8 strain. This library was designed through the NimbleDesign portal (v1.2.R1) using genome build hg19 NCBI build 37.1 / GRCh37. Sequencing was performed on a NextSeq 500 (Illumina) with 18 samples (2x400 million reads of 75 bases each) on a HighOutput cartridge.

[0483] CD4+ T cell sequencing

[0484] A full detailed report describing the complete analysis has been submitted to Gene Expression Omnibus (GEO, https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE116073). Total RNA extraction was performed according to the Qiagen miRNeasy kit. RNA concentration was determined using Qubit fluorimetric quantitation and purity with the RNA 6000 Bioanalyzer kit (Agilent). RNA-Seq libraries were constructed using the Illumina TruSeq Stranded mRNA Sample Preparation (Low-Throughput Protocol) kit according to the manufacturer's instructions. Aliquots of 1.2 μg of total RNA were used for library construction. The final cDNA libraries were verified using a fragment analyzer (Advanced Analytical, Ankeny, IA) and quantified using the KAPA qPCR kit (Kapa Biosystems, Wilmington, MA). In the eight sequencing lanes of a flow cell V4, 32 libraries were pooled in equal proportions, with sets of four libraries per lane, denatured with NaOH, and diluted to 16 pM before clustering. Cluster generation, primer hybridization, and 50-cycle sequencing of single-end reads were performed on a cBot and a HiSeq 2500 (Illumina, San Diego, CA), respectively. Image analysis and base calling were performed using HiSeq Control Software with the Real-Time Analysis component. Demultiplexing was performed using Illumina's sequence analysis software. Data quality was verified using the Babraham Institute's FastQC and Illumina software SAV (Sequence Analysis Software). The results were evaluated using the NI Viewer.Potential contaminants were screened using Babraham Institute's FastQ Screen software.

[0485] To investigate splicing activity, we used SUPPA v2.0.0, a tool developed in Python 3.4 and specifically designed for this approach. To study splicing across conditions, we performed three modular operations, which were run separately. The first step was to generate events from annotation files, commonly called GTF files (general transfer format). The second step was to quantify event inclusion levels (PSIs) from our samples. Finally, differential splicing across conditions was calculated for all replicates.

[0486] To generate various alternative splicing events from the input annotation file (GTF format), this method reads transcript and gene information only from the "exon" line in the GTF. Then, it generates events and outputs an "ioe" file, which contains the relationship between each event and the transcripts that share this particular event. Specifically, it provides the transcripts that contribute to the numerator (one form of event) and denominator (both forms of event) of the PSI calculation. To generate PSI values, SUPPA reads the ioe file generated in the first step and a transcript expression file with transcript abundances.

[0487] SUPPA calculates the magnitude (ΔPSI) of splicing changes across biological conditions and their significance, using four replicates per condition. Conditions are analyzed in the order specified as input. Statistical significance is calculated by comparing the observed ΔPSI across conditions to the distribution of ΔPSI across replicates as a function of gene expression (measured as the expression of the transcript defining the event). Using the output from differential splicing analysis, we classified events into four major groups: alternative 5' splice sites (A5), alternative 3' splice sites (A3), alternative first and last exons (altexons), and retained introns (RI). Using this classification, we classified differential splicing encountered across various comparisons of samples using a very stringent cutoff for psi score difference (ΔPSI) fixed at >0.4 and a P value <0.05. We used a simple Perl script to establish a raw count table from the SUPPA output.

[0488] MicroRNA array analysis

[0489] Total RNA was extracted from infected and uninfected PBMC samples using the miRNeasy kit (Qiagen) according to the manufacturer's protocol. RNA concentration was determined using a Nanodrop spectrophotometer (ThermoFisher). Quality control was performed using Expression Console metrics. A full detailed report describing the complete analysis was submitted to GEO (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE116148). All miRNA arrays were normalized using the "RMA+DABG" normalization method within the Affymetrix Expression Console with dedicated annotation files downloaded from the Affymetrix web server. A probe was considered expressed if its DABG P value was less than 0.05; otherwise, it was considered not expressed. A miRNA was considered expressed in a condition if the probe was expressed in more than three-quarters of the replicates. Finally, a miRNA was considered differentially expressed between condition A and condition B if 1) it was expressed in A or B, 2) its fold change was 1.5 or greater, and 3) its paired t -test P value was 0.05 or less.

[0490] Volcano plots were generated using R. They show the M values ​​(log2 (fold change)) and -log10 (P value) of all miRNAs for comparisons of 464_I vs. DMSO_I, 464_NI vs. DMSO_NI, and DMSO_I vs. DMSO_NI. Significantly (FC≧1.5 and P value≦0.05) upregulated miRNAs were highlighted in red, and downregulated miRNAs were highlighted in green.

[0491] TaqMan Low Density Array (TLDA)

[0492] MicroRNA profiling of the samples was performed using TaqMan Array Human MicroRNA Panels A and B (Life Technologies). Each TLDA card detects 384 functions, including 377 human miRNAs, three endogenous small RNA controls (one of which has four), and a negative control. In total, 754 human miRNAs were quantified. Reverse transcription and preamplification were performed according to the manufacturer's instructions (Megaplex™ RT Primers and Megaplex™ PreAmp Primers, Life Technologies). Nine microliters of diluted preamplification product added to a total mixture of 900 μL was used per TLDA card. Real-time quantitative PCR was performed using a ViiA7 Real-Time PCR System, and data were collected using the manufacturer's ViiA™ software. Gene Expression Suite software (Applied Biosystems) was further used to process the array data. The automatic thresholds were individually checked and corrected as necessary.

[0493] In the data preprocessing step, the HiSeq control and real-time analysis software automatically generated image analysis, base calling, and base call quality in real time. "Dirty" raw reads were defined as reads containing high content of adapter sequences or unknown bases and low-quality reads. These reads were filtered out before downstream analysis to reduce data noise. The filtering procedure is as follows:

[0494] The quality of the RNA-seq library was first assessed using FastQC v0.11.5 software. We use the FastQ Screen Contaminant finder to test the alignment of a large dataset to various genomes that represent potential sources of contamination. The software generates a graph showing the percentage of reads aligned to the various genomes tested. FastQ Screen uses the Bowtie2 aligner. Alignment is performed on a subset of sequences from each sample.

[0495] The reads were then subjected to standard quality control (QC) and filtering criteria according to the following parameters: (1) trimming and cleaning of reads aligned to primers and / or adapters, (2) reads with more than 50% low-quality bases (quality value ≦15) in a single read, and (3) reads with more than 10% unknown bases (N bases). We used a program called Trimmomatic to remove primers and low-quality reads. After filtering, we removed short reads (<36 bp); the remaining reads were called "clean reads" and saved in FASTQ format.

[0496] Once we were confident in the quality of the sequencing data, we proceeded to align the clean reads in the FASTQ files to a reference sequence. Alignment was performed using the TopHat2 v2.0.8b tool against the human GRCh38 reference genome.

[0497] TopHat2 is a splice-aware aligner that aligns data using the Bowtie2 aligner before counting the reads mapped to each gene. Bowtie2's behavior was adjusted to support local alignments by setting it to sensitive. TopHat2 output was saved to a BAM file (typically named accepted_hits.bam) containing all alignments. TopHat2 output also reported alignment statistics. Next, because the SAM file format is required for counting reads, the BAM files were sorted by name and converted to SAM format using SAMtools-1.3.1 software. To calculate gene-level raw counts from the mapped reads in each library, we used the tool htseq-countv0.6.1p1 from the Python package HTSeq using the default union count mode. The HTSeq package generated a raw count table for each library, which was required to determine the expression level of each gene. DEG (differentially expressed gene) screening aims to find genes that are differentially expressed between samples and perform further functional analysis on them. Gene expression levels and DEGs were calculated using R software and a series of R packages. To outline and better understand the effects of ABX464, we chose to focus and limit our statistical analysis to specific libraries. In our work, we decided to compare the DMSO vs. DMSOi library, the ABX464 vs. DMSO library, and the 464i vs. DMSOi library. In addition, to obtain meaningful results, in our statistical design, we considered four donors as biological replicates.

[0498] Flow cytometry

[0499] PBMCs or CD4+ T cells from various donors in suspension were labeled with appropriate anti-human monoclonal antibodies (mAbs) (all from BioLegend). Washing and dilution of reagents were performed using FACS buffer (PBS with 2% fetal bovine serum and 0.05% sodium azide [NaN3]). All acquisitions were performed on a Cyan ADP (Beckman Coulter) flow cytometer. Data were analyzed using FlowJo software (Ashland, OR). Cell debris and dead cells were excluded based on their light scattering properties.

[0500] Measurement of unspliced ​​and spliced ​​lncRNA 599-205

[0501] Retrotranscription (RT) reactions were performed on 1 μg of total RNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific). Genomic DNA removal was performed before amplification, but an RT negative control was nevertheless performed without enzymes to confirm the absence of DNA contamination. qPCR was performed using LightCycler™ 480 SYBR Green I Master Mix (Roche) and the following primers: total lncRNA 599-205 Fwd (CCCTCCACCACTTGGGAC) and total lncRNA 599-205 Rev (GACCTGGGGATTCAGCCTTC), unspliced ​​lncRNA 599-205 Fwd (GAACAAAGAGCCTTTGGAAGAC) and unspliced ​​lncRNA 599-205 Rev (GGAAGGGACCACAGCATC), spliced ​​lncRNA 599-205 Fwd (CACTCAGCGATGGAGGAAA) and spliced ​​lncRNA 599-205 Rev (CCAATCACACAGACAATGAGATAAC), internal control β-actin Fwd (GTGAAGGTGACAGCAGTCGGTT), and β-actin Rev (GAAGTGGGGTGGCTTTTAGGA). The amplification run conditions were as follows: 40 cycles of 95°C (10 seconds), 58°C (30 seconds), and 72°C (30 seconds).

[0502] result

[0503] 1. ABX464 generates spliced ​​HIV RNA variants

[0504] To profile viral transcriptional events modulated by ABX464 and thereby assess the full depth of the HIV transcriptome, we employed a recently described targeted RNA capture and sequencing strategy (RNA CaptureSeq). This strategy involves the construction of tiling arrays spanning the HIV genome, to which cDNA is hybridized, eluted, and sequenced. RNA CaptureSeq is similar to previous in-solution capture methods and exome sequencing approaches, but when combined with deep-sequencing technology, it provides saturating coverage and allows for the robust assembly of rare and unannotated HIV transcripts.

[0505] PBMCs from six HIV-negative donors were infected with the YU-2 strain and treated with ABX464. Our protocol resulted in a mild infection that did not cause cell death at 8 days postinfection (dpi), and viral replication was inhibited by more than 70% with 5 μM ABX464 (Figure 1B). After capturing cDNA from infected cells that were untreated or treated with ABX464, libraries were prepared and sequenced using Illumina sequencing. To highlight potential novel splicing events induced by ABX464, we used a custom bioinformatics pipeline, in which the main step involves the assembly of putative transcripts from targeted RNA-seq reads (Illumina paired-end 2 × 75 bp) to construct contigs (Figures 6A and 6B). The HIV profiling dataset used in our analysis, which then mapped putative transcripts (contigs) to the HIV genome, provided high sequence coverage (2-30 million reads for a 9 kb genome), allowing detailed quantification of HIV splice variants. We demonstrated that we could reliably quantify each HIV alternative splice variant across a wide range of transcript abundance, and that although ABX464 treatment resulted in enhanced splicing, ABX464 did not favor the generation of one splice variant over another (Figure 1C, Table III).

[0506] To test whether enhanced splicing by ABX464 generates new viral RNA variants, splicing events were filtered and analyzed. After mapping the contigs to the YU-2 strain genome, the YU-2 strain was used as an anchor for additional clustering and assembly of new HIV transcripts. Partial gene structures generated by spliced ​​alignments were merged whenever they shared consecutive splice sites spanning intronic viral sequences. The superstructures thus formed correspond to all possible HIV gene structures in which each complete exon is supported by at least one alignment. At the HIV transcript level, this resulted in the formation of superassemblies, each a merger of initial contigs matching the predicted superstructure. Notably, the linking of contigs to the HIV-1 genome sequence and the requirement that all splice sites within the merged contigs match prevented the formation of spurious superassemblies. Figure 1C and Table III show the distribution of the number of contigs merged to form one superassembly for each donor. In contrast, in all ABX464-treated samples, most of the assembled contigs (90%) corresponded to spliced ​​RNAs (Fig. 1C, Table IV, and Fig. 7) or to small RNAs containing gag-pol sequences that could be released from introns. In untreated samples, spliced ​​RNAs accounted for a small proportion (less than 24%), and the majority of contigs corresponded to full-length unspliced ​​viral RNAs (more than 74%) (Fig. 1C, Table IV, and Fig. 7). These results indicated that ABX464 preferentially generates spliced ​​HIV RNA variants in infected PBMCs, which impair the subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles, resulting in the inhibition of viral replication.

[0507] Interestingly, one of the splice variants generated by ABX464 treatment (Figures 1A and 1D) was present in cells infected with both the YU-2 and Ada-M strains, and polymorphisms in its sequence were not detected in HIV-1 subtypes B and C, which were strongly inhibited by ABX464. Furthermore, this new splice variant was detected using long-read sequencing, demonstrating the additional precision this method brings to delineating complex and rare splice isoforms and estimating their relative abundance. This new RNA variant could generate immunogenic peptides or be toxic to cells containing proviral DNA. This is consistent with the reduced viral load and reduced viral DNA levels observed in HIV patients treated with ABX464 (ABIVAX, data on file). Thus, ABX464 not only enhanced HIV RNA splicing but also generated new HIV splice variants.

[0508] Table III shows the read assembly and contig counts from PBMCs infected with the YU2 strain and either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

[0509] Table IV shows the contig counts of full mRNA or spliced ​​RNA transcripts of Gag, Pol, vif, vpr, tat, rev, vpu, and env from PBMCs infected with the YU2 strain and either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

[0510] [Table 4]

[0511] [Table 5]

[0512] 2. ABX464 does not affect cellular splicing

[0513] To confirm that ABX464 acted specifically on HIV splicing and did not significantly or globally affect splicing events in human genes, we used a high-throughput RNA sequencing approach. Many genome-wide expression studies of HIV infection are based on the analysis of total peripheral blood mononuclear cells (PBMCs), which consist of more than 12 cell subsets, including T cells, B cells, NK cells, and monocytes. To prevent specific gene expression signals from specific cell subsets from being diluted by signals from other cells, thus reducing the specificity of this approach, we used purified CD4+ T cells from the PBMCs of four donors. CD4+ T cells were either uninfected or infected with the YU-2 strain and either untreated or treated with ABX464 for 6 days, after which they were subjected to high-throughput RNA sequencing. Each raw dataset for a sample contained between 44 and 105 million single-end reads (50 bp), with an average of approximately 60 million raw reads per sample (Figure 2A). Over 97% of bases had a quality score of Q20 or higher. Approximately 98% of all raw reads were mapped to the human genome sequence (GRCh38), providing an average of 60 million human reads per sample for further analysis. Subsequently, reads (approximately 98% of total input reads) that correctly mapped to gene and transcript locations (GTF annotation files) (Figure 2A) were analyzed using an in-house package suite for transcript abundance normalization and evaluation. Multidimensional scaling (MDS) is an unsupervised global analysis approach and is useful for reducing the dimensionality of gene expression data (Figure 2B). MDS minimizes dimensionality, preserves distances between data points, and allows multidimensional genetic data to be projected into two or three new dimensions that explain most of its variance. As a result, major trends in the data can be visually interpreted, for example, in terms of similarities between various data points.MDS of our gene expression data showed that the different donors were well separated and distributed among infected and uninfected DMSO (untreated) and ABX464 treatments, with no outliers. The displayed variance was donor-dependent (clustered by donor) but treatment-independent (no data structure associated with the different treatments), suggesting that the ABX464 molecule did not induce significant differences in CD4+ T cell gene expression (Figure 2B).

[0514] To estimate the overall extent of alternative splicing events regulated by ABX464 in infected and uninfected CD4+ T cells, we compared junction read counts derived from exon-exon boundaries across samples (Figure 2C). Although alignment of reads to exon junctions was entirely by chance, we observed no significant differences in the total number of reads corresponding to exon-exon boundaries between treated and untreated CD4+ T cells, regardless of whether they were infected or not, in any sample (Figure 2C). For a more statistically relevant assessment of alternative splicing in these CD4+ T cells, we followed a method for differential splicing analysis across multiple conditions, named the super-fast pipeline for alternative splicing analysis. Alternative splicing events were classified into five major groups: alternative 5' splice sites (A5SS), alternative 3' splice sites (A3SS), alternative first and last exons (Alt exons), and retained exons (RI) (Figure 2C). A "percent splicing index" (psi) score (ψ-score) was calculated for each transcript variant for each sample. Using a stringent cutoff, a difference in psi-score from the untreated sample was fixed at 0.4, and a P-value was fixed at 0.05, for differential splicing events induced in response to ABX464 treatment to be considered significant. The number of significant events for each of the five possible AS events is shown in Figure 2C and Table I. No switch-like events with a difference in psi-score of exactly 1 or -1 were detected.Next, we calculated the ψ-scores of transcripts in uninfected versus infected CD4+ T cells (Figure 2C). No switch-like events were detected in infected or uninfected T CD4+ samples when compared with ABX464-treated samples (Figure 2C). The exact number of common and differential splicing events between ABX464-treated infected and ABX464-treated uninfected CD4+ T cells was very low (less than 10 events, Table I). However, NCBP1 (Nuclear Cap Binding protein subunit 1), a component of the CBC, was only 50% abundant in stem cells, causing a large variation with 81 Alternative Exons, 12 Altered 5' Second Splice (ASS), 10 Altered 3' Second Splice (ASS), and 206 Altered IR events (Figure 2C). The IR levels indicated that the CBC complex is a key component preventing the accumulation of unspliced ​​RNA, since most unspliced ​​transcripts would be degraded by nonsense-mediated decay (NMD). Comparison of exon coverage reads of the commonly highly expressed gene B2M between ABX464 and DMSO conditions in four donors revealed that ABX464 did not increase splicing events of B2M (Figure 2D). In summary, ABX464 treatment did not induce alternative splicing of transcripts. Therefore, ABX464 did not have the potential to dramatically alter gene expression in activated CD4+ T cells. Consistent with this result, FACS analysis of purified activated CD4+ T cells or PBMCs from seven donors after 6 days of ABX464 treatment revealed no changes in CCR6 / CXCR3 or CD45 / CCR7 (Th17 / Th1 and effector memory cell) subpopulations (Figure 8).

[0515] Table I below lists splicing events in CD4 T cells: infected vs. uninfected (DMSO_I vs. DMSO), uninfected treated with ABX464 vs. uninfected and untreated (464 vs. DMSO), and infected treated with ABX464 vs. infected and untreated (464_I vs. DMSO_I).

[0516] [Table 6]

[0517] [Table 7]

[0518] [Table 8]

[0519] 3. ABX464 does not alter cellular gene expression

[0520] To determine whether ABX464 induced quantitative changes in the transcriptome of infected cells, we measured transcription levels (see Figure 6 for the pipeline) from RNA-seq data. Over 60,000 different transcripts were detected across all samples. After counts per million normalization (CPM), transcripts in each sample were filtered out at a coverage cutoff of CPM > 5; that is, a gene was considered expressed in a sample if it had at least 5 counts per million mapped reads in that sample. Because this experiment used four donors, four replicates were available for each condition (infected / uninfected, with or without ABX464 treatment), and a gene was considered expressed if it was expressed in at least 5 counts per million mapped reads in all replicates. Following these selection criteria, we generated a list of transcripts common to all samples, encompassing 11,700 different transcripts with an average raw count of approximately 3,000 per transcript. Using the CPM values ​​of the modified genes, global expression plots were generated for each donor. Under the mild infection conditions used in our study, we did not detect strong changes in gene expression, with only 15 genes downregulated in response to infection in untreated samples (Figure 2E, top panel; Table II). ABX464 treatment resulted in the upregulation of nine genes in infected samples and six downregulated and seven upregulated genes in uninfected samples (Figure 2E, middle and bottom panels, respectively; Table II), indicating a mild effect of ABX464 treatment on gene expression. Six genes that were upregulated following ABX464 treatment were shared between infected and uninfected samples, suggesting that this upregulation was mediated by ABX464 treatment and independent of infection.Three of the six genes, namely TOR1AIP2, SCML1 and PPP1R2, had a P value of 10. -5 had a fold change of more than 3. Interestingly, TOR1AIP2, a protein thought to regulate protein folding and intracellular trafficking, was recently shown to restrict late stages of HIV replication and may therefore be an effector of the ABX464-induced changes.

[0521] Table II below lists genes regulated in T CD4 cells: infected vs. uninfected (DMSO_I vs. DMSO), uninfected treated with ABX464 vs. uninfected and untreated (464 vs. DMSO), and infected treated with ABX464 vs. infected and untreated (464_I vs. DMSO_I). Upregulated genes are in bold and downregulated genes are in italics. Upregulated genes are in bold and downregulated genes are in italics.

[0522] [Table 9]

[0523] [Table 10]

[0524] [Table 11]

[0525] 4.ABX464 upregulates miR-124

[0526] Because the CBC complex targeted by ABX464 is involved in the biogenesis of small noncoding RNAs, and previous global analyses have not included these, we decided to evaluate if miRNAs or nucleolar RNAs (snoRNAs) were differentially regulated by ABX464. We performed microarray analysis of these RNAs from PBMCs of six donors. Cells infected with the YU-2 strain and subsequently treated with ABX464 were compared with uninfected and untreated controls. A total of 104 human miRNAs and 40 snoRNAs were significantly differentially expressed in infected PBMCs compared with uninfected PBMCs (data not provided), with a false discovery rate of less than 0.05 and a fold change of more than 1.5. Cluster analysis revealed complete separation between infected and uninfected samples based on the expression profiles of differentially expressed miRNAs (Figure 3A). Although infection resulted in substantial variation in the expression of small noncoding RNAs (Figure 3A, left panel), ABX464 treatment induced reproducible upregulation of a single microRNA, miR-124, in infected and uninfected cells (Figure 3A, middle and right panels, respectively). To confirm this result, we used another method for microRNA profiling, the TaqMan Low Density Array (TLDA), which is based on reverse transcription real-time PCR and has the capacity to screen 760 miRNAs (Figure 9A). Again, we observed that only miR-124 was upregulated by ABX464. Furthermore, quantitative PCR of total RNA isolated from infected and uninfected PBMCs of five donors showed that infection resulted in a slight decrease in miR-124 expression (Fig. 3B, also visible in the total analysis of P3A), whereas treatment with ABX464 resulted in a significant upregulation of miR-124 in both infected and uninfected cells (Fig. 3B).Next, we determined whether the miR-124 response to ABX464 treatment observed in PBMCs could be attributed to a specific cell type. Using purified CD4+, CD8, and macrophage cells, we found that ABX464 treatment resulted in the upregulation of miR-124 in lymphoid cells (Figure 3C), but not in monocyte-derived macrophages, where miR-124 expression was undetectable (Figures 3C, 9B). Finally, whereas other antiretroviral drugs, such as maraviroc, efavirenz, darunavir, and AZT, did not upregulate miR-124 expression in PBMCs, ABX530, a molecule with the same properties as ABX464, induced miR-124 upregulation to a similar extent as ABX464 (Figure 3D). Therefore, we demonstrated that miR-124 upregulation is specific to the ABX class of small molecules.

[0527] In recent years, miR-124 has emerged as a key regulator of immunity and inflammation. miR-124 is known both as a key regulator of microglial quiescence in the central nervous system and as a regulator of monocyte and macrophage activation. miR-124 also plays an important role in both innate and adaptive immune responses. In particular, miR-124 has been shown to be a key mediator of cholinergic anti-inflammatory effects by reducing the production of IL-6, TNF-α, and MCP-1. Interestingly, IL-6, TNF-α, and MCP-1 were upregulated in a commonly used DSS-induced experimental mouse model of colitis, while ABX464 reduced the expression of these pro-inflammatory cytokines. Persistent immune activation and systemic inflammation also play a central role in the pathogenesis of HIV disease. Many HIV-infected individuals treated with antiretroviral therapy (ART) exhibit residual inflammation, which is associated with non-AIDS-related morbidity and mortality. Based on the observed downregulation of miR-124 expression in response to HIV infection of PBMCs or CD4+ T cells, and subsequent upregulation with ABX464 treatment, we decided to investigate whether similar modulation of miR-124 expression is observed in HIV patients receiving antiretroviral therapy (ART). Because the chronic inflammatory state in patients receiving combination ART is primarily related to the extent of lymphoid tissue associated with damaged intestinal tract, miR-124 expression was monitored in rectal biopsies from HIV-infected patients receiving ART and treated with ABX464 (N=9). miR-124 expression was downregulated in HIV patients treated with ART compared with its expression in colon biopsies from healthy donors (N=10). Treatment with ABX464 for 28 days restored miR-124 expression to the level of healthy donors (Figure 3E). When ABX464 treatment was stopped for 28 days, miR-124 expression was reduced, reaching levels seen before treatment (Figures 9C and 9D), indicating that the observed changes in expression were due specifically to ABX464.Thus, ABX464 regulates miR-124 expression both in vitro and in HIV patients.

[0528] 5. ABX464-induced splicing of long non-coding RNA at the miR-124-1 locus results in upregulation of miR-124

[0529] miR-124 is encoded by three independent genes, miR-124-1, miR-124-2, and miR-124-3, located on human chromosomes 8 and 20 (Figure 4A). To determine which of these genes are induced by ABX464, we employed targeted RNA CaptureSeq to assess the full depth of the transcriptome. The increased sequencing depth of RNA CaptureSeq, along with ab initio transcript assembly, was used to determine which gene loci were affected by ABX464 treatment (Figures 4A and 4B). We reconstructed all transcripts assembled in the pre-capture RNA-Seq data with similar uniformity of transcript coverage (100% of reconstructed transcript chains; Figures 4A and 4B). The total number of reads for untreated and ABX464-treated samples varied between 2 and 30 million in infected and uninfected PBMCs (Table V). The number of reads from the three loci encoding miR-124 in treated samples was 4 to 12 times higher than in untreated samples (Figure 4B, Table V), confirming that ABX464 resulted in a significant increase in miR-124 expression. In contrast, ABX464 did not affect the expression of miR-429, which is located outside the miR-124 region (Figure 4B), again demonstrating the specificity of ABX464 in targeting miR-124.

[0530] Most of the aligned reads from the 10-kb region of each locus were derived from miR-124-1 and miR-124-3, whereas the number of aligned reads from miR-124-2 was very low even after ABX464 treatment (Figure 4B). The effect of ABX464 on miR-124 expression was most pronounced from the miR-124-1 locus (Figure 4B). All mapped reads from the miR-124-1 locus in the treated samples aligned to miR-124 and the surrounding 2-kb region. Inspection of this region revealed that the miR-124 sequence was embedded within a long noncoding RNA (lncRNA 0599-205) at the miR-124-1 locus (Figures 4A and 4C).

[0531] The sequencing depth of RNA CaptureSeq allowed us to assemble ab initio transcripts that displayed a complex array of splicing patterns. This approach revealed that splicing of lncRNA 0599-205 was activated by ABX464 and was absent in untreated samples (Figures 4C and 4D). Most of the contigs in the untreated samples aligned with the unspliced ​​lncRNA 0599-205. Mapping reads at splice junctions (J1, J2, J3, and J4) and exon-exon junctions (J5 and J6) of this lncRNA allowed us to quantify spliced ​​and unspliced ​​RNA in treated samples (Figure 4D). After 8 days of treatment with ABX464, which we assumed would be sufficient time for the transcript to reach steady-state levels, the level of unspliced ​​RNA was 9-fold higher than that of spliced ​​RNA. Because spliced ​​RNA is more stable than unspliced ​​RNA, we must consider that spliced ​​lncRNA 0599-205 is responsible for the upregulation of miR-124 and therefore its reduced stability. Consistent with this prediction, we found that the production of miR-124 (reads mapping only to the 85-bp miR-124 region) compensated for the absence of spliced ​​lncRNA 0599-205 (Figure 4D).

[0532] Table V shows the read counts for the three genes encoding miR-124; mir124.1, mir124.2, and mir124.3 in PBMCs either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

[0533] [Table 12]

[0534] 6. Splicing of lncRNA 0599-205 is required for the production of miR-124

[0535] To directly assess the contribution of lncRNA 0599-205 to miR-124 production, we cloned the genomic sequence of lncRNA 0599-205 from 9903167 to 9904210 on chromosome 8 into a plasmid vector (Figure 5A). Both spliced ​​and unspliced ​​transcripts of lncRNA 0599-205 were readily detected in transfected HeLa cells (Figure 5B). However, we failed to detect upregulation of miR-124 in transfected HeLa cells in response to ABX464 treatment because splicing is maximized in HeLa cells and the CBC complex influences the transcription site (Figure 5B). However, transient transfection of the plasmid into HeLa cells dramatically increased miR-124 levels (1250-fold) (Figure 5C, left panel). In contrast, when the splice site of lncRNA 0599-205 was mutated, only traces of miR-124 were detected (Figure 5C, left panel). Consistent with the fact that unspliced ​​lncRNA 0599-205 is less stable, the amount of mutated lncRNA 0599-205 was lower than that of the wild-type (Figure 5C, right panel). Together, these results indicate that splicing of lncRNA 0599-205 is a prerequisite for the production of mir-124.

[0536] Discussion

[0537] Our research provides new insights into the mechanism of action of ABX464 in upregulating anti-inflammatory miR-124 in treated UC patients and inhibiting viral replication in HIV patients. ABX464 binds to the CBC (ABIVAX, data in file), a complex that stimulates capped RNA processing, including splicing, 3′-end formation, degradation, and transport. The CBC is thought to bind to all classes of m7G-capped RNA, including precursor and mature mRNAs, stable long non-coding RNAs (lncRNAs), non-adenylated histone RNAs, and precursors of spliceosomal small nuclear RNAs (snRNAs). Understanding how ABX464 binds to the CBC complex is important. Both HIV RNA and lncRNA 0599-205 splicing variants are potently induced by ABX464. We do not know the reason for this. The weak splice sites that characterize both transcripts may be responsible for the induction of these splicing events by the ABX464-CBC complex. Most human protein-coding genes are spliced ​​before being exported to the cytoplasm; otherwise, they are degraded in the nucleus, where the pioneer round of translation is important for mRNA quality control. Like any RNA in the cell, lncRNA0599-205 may be degraded, or, as in the case of many long noncoding RNAs, it may remain at its transcription site. The miR-124 sequence is located in the third exon of lncRNA0599-205, which is also a unique situation because most microRNAs are generally classified as "intergenic" or "intronic" based on their genomic location.Intergenic miRNAs are known to be transcribed as independent transcription units, whereas intronic miRNAs are processed from the introns of their host transcription units and are therefore thought to share common regulatory mechanisms and expression patterns with their host genes. Because ABX464 treatment did not induce any changes in microRNAs other than miR-124 and there was little change in the expression of genes that could host microRNAs, we believe that the ABX464-CBC interaction induces specific effects on viral RNA and miR-124 biogenesis. This latter point is also supported by the fact that although miR-124 is transcribed by three loci, only the miR-124-1 locus was affected by ABX464 treatment, and that splicing of lncRNA 0599-205 is required for the production of miR-124 (Figure 5).

[0538] Nuclear cap function is mediated by the CBP80 and CBP20 proteins, which co-transcriptionally associate with nascent RNA. CBP20 interacts directly with the m7G cap via its classical RNA recognition motif (RRM), while CBP80 ensures high-affinity binding of the intact CBC and provides a platform for interaction with other factors. We demonstrated that ABX464, by binding to the CBC, prevents the production of unspliced ​​viral RNA required for viral replication and induces the production of miR-124 from lncRNA 0599-205. However, ABX464 had little effect on cellular splicing. Therefore, ABX464 functions as a viral enhancer but not a cellular splicing enhancer. ABX464 binding alters the conformation of the CBC, allowing efficient interaction of CBP80 with splicing factors, thereby providing more efficient recognition of viral splice sites. HIV RNA is known to have suboptimal splicing sites that allow inhibition of splicing of the 9-kb primary transcript during the late stages of infection. In contrast, most cellular genes require splicing for expression, and transcripts containing unspliced ​​introns are retained in the nucleus, where they are degraded. Depletion of NCBP1 by 50% resulted in upregulation of unspliced ​​IR transcripts, confirming the influence of the CBC on NMD. ABX464 confirms that viral HIV RNA is spliced ​​(because it is transcribed from integrated proviral DNA similar to any gene in the cell) and exported, and that unspliced ​​viral RNA is degraded (presumably by NMD). ABX464 does not alter any of the CBC functions, and therefore, by binding to the CBC complex, ABX464 is not expected to alter general RNA biogenesis in cells. However, little is known about the CBC complex during HIV infection or immune cell activation.The findings that ABX464 binds to CBC and induces specific changes in immune cells; overexpression of miR-124 by regulating splicing 0599-205 long non-coding RNA and enhancing HIV RNA splicing, will be of great help to understand the involvement of CBC in HIV infection and inflammation.

[0539] Prediction of splice site strength using maximum entropy (MaxEnt) revealed that the 5' splice site between exon 2 and intron 2 of lncRNA 0599-205 is very weak compared to other splice sites (Table VI). Because unspliced ​​lncRNA 0599-205 cannot exit the nucleus due to regulation via quality control mechanisms and CBC, spliced ​​lncRNA 0599-205 likely constitutes a miRNA storage form, in addition to other functional properties of the intact spliced ​​transcript. This storage may be maintained through the low transcriptional and degradative activity of unspliced ​​lncRNA 0599-205, which generates only low levels of mature miR-124 release under normal conditions. In fact, if lncRNA 0599-205 is unspliced, its fate is similar to that of other short-lived transcripts and it becomes susceptible to the CBC complex called CBC-NEXT, which promotes RNA degradation via the nuclear RNA exosome. Consistently, lncRNA 0599-205 splicing is a prerequisite for the production of miR-124. Splicing of lncRNA 0599-205 is important for stabilizing the mature transcript for recognition by the microRNA processing machinery, thereby generating miR-124. Therefore, ABX464 treatment may enable the rapid release of large amounts of miR-124 through lncRNA 0599-205 splicing without requiring transcriptional activation of the lncRNA 0599-205 locus. This may be the mechanism by which miR-124 is upregulated after ABX464 treatment in HIV patients (Figure 3E).

[0540] HeLa cells containing a large excess of splicing factors efficiently produce HIV viral RNA splice products and large amounts of miR-124 from transfected HIV and lncRNA 0599-205 constructs, respectively. Thus, ABX464 does not interfere with the normal function of the CBC in splicing but makes it more efficient. Because cellular, but not viral, genes require an unspliced ​​state for viral replication, and splicing of lncRNA 0599-205 can affect miR-124 expression, ABX464 inhibits viral replication and induces the expression of anti-inflammatory miR-124. Numerous studies in various cells and systems have shown that miR-124 is an important modulator of inflammation and immune responses. The discovery that ABX464 upregulates miR-124 expre...

Claims

1. Splice variant lncRNA 0599-205 at the miR-124-1 locus for use as a biomarker for an inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

2. Splice variant lncRNA 0599-205 at the miR-124-1 locus for use as a biomarker for assessing the biological effect of a compound or medical device for the treatment of an inflammatory disease, disorder or condition, or cancer.

3. Splice variant lncRNA 0599-205 at the miR-124-1 locus for use as a biomarker for screening compounds or medical devices in treating inflammatory diseases, disorders or conditions, or cancer.

4. An agent for use in treating an inflammatory disease, disorder or condition, or cancer, comprising a splicing variant lncRNA 0599-205, wherein the splicing variant lncRNA 0599-205 at the miR-124-1 locus is used as a biomarker for the inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of therapeutic treatment of the inflammatory disease, disorder or condition, or cancer biomarker.

5. An agent used to treat an inflammatory disease, disorder or condition, or cancer, comprising miR-124, wherein the miR-124 is used as a biomarker for the inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of therapeutic treatment of a biomarker for the inflammatory disease, disorder or condition, or cancer.

6. Splice variant lncRNA 0599-205 at the miR-124-1 locus for use as a biomarker for selecting patients for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

7. miR-124 for use as a biomarker for selecting patients for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

8. The agent according to any one of claims 4 to 5, wherein the therapeutic treatment is carried out with a compound of the following formula I or a pharmaceutically acceptable salt thereof: 【Chemistry 1】 where: Z is C or N; V is C or N; 【Chemistry 2】 means an aromatic ring, wherein V is C or N, and when V is N, V ​​is in the ortho, meta or para position relative to Z; Each R is independently a hydrogen atom, a halogen atom, -CN, hydroxyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 3 ) fluoroalkoxy, (C 3 ~C 6 ) cycloalkyl, -NO 2 , -NR 1 R 2 , (C 1 ~C 4 )Alkoxy, Phenoxy, -NR 1 -SO 2 -NR 1 R 2 , -NR 1 -SO 2 -R 1 , -NR 1 -C(=O)-R 1 , -NR 1 -C(=O)-NR 1 R 2 , -SO 2 -NR 1 R 2 , -SO 3 H, -O-SO 2 -OR 3 ,-OP(=O)-(OR 3 )(OR 4 ), -O-CH 2 -COOR 3 , or (C 1 ~C 3 ) alkyl, wherein the alkyl optionally contains a hydroxyl group, a group of formula (IIa) 【Transformation 3】 or a group of formula (IIIa) 【Chemistry 4】 optionally mono- or disubstituted by Q is N or O, provided that when Q is O, R″ is absent; R 1 and R 2 Each of the groups independently represents a hydrogen atom or (C 1 ~C 3 ) alkyl, R 3 and R 4 each independently represents a hydrogen atom, Li + , Na + , K. + , N + (Ra) 4 or benzyl, n is 1, 2 or 3; n' is 1, 2 or 3; Each R' is independently a hydrogen atom, (C 1 ~C 3 ) Alkyl, hydroxyl, halogen atom, -NO 2 , -NR 1 R 2 , morpholinyl, morpholino, N-methylpiperazinyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 4 )alkoxy, -OP(=O)-(OR 3 )(OR 4 ), —CN, a group of the following formula (IIa): 【Transformation 5】 or a group of the following formula (IIIa) 【Transformation 6】 and A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb independently represents a hydrogen atom, (C 1 ~C 5 ) alkyl or (C 3 ~C 6 ) cycloalkyl, or R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocycle, which may optionally be substituted by one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 or 3 only if the other R a group is different from said (IIa) or (IIIa) group; and R" is a hydrogen atom, (C 1 ~C 4 ) alkyl or a group of formula (IIa) as defined above.

9. The agent according to claim 8, wherein the compound is selected from the compounds having the following formulae Ia to Id or pharmaceutically acceptable salts thereof: 【Transformation 7】

10. The agent according to claim 8 or 9, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof.

11. The agent according to any one of claims 4 to 5, wherein the therapeutic treatment is carried out with a compound of the following formula IV or a pharmaceutically acceptable salt thereof: 【Transformation 8】 wherein V, Z, R, R', n and n' are as defined in claim 8.

12. The agent according to claim 11, wherein the compound is selected from the compounds of the following formulae IVa to IVd or pharmaceutically acceptable salts thereof: 【Chemistry 9】 13. The mutant of claim 6, wherein the therapeutic treatment is with a compound of formula I: 【Chemistry 10】 where: Z is C or N; V is C or N; 【Chemistry 11】 means an aromatic ring, wherein V is C or N, and when V is N, V ​​is in the ortho, meta or para position relative to Z; Each R is independently a hydrogen atom, a halogen atom, -CN, hydroxyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 3 ) fluoroalkoxy, (C 3 ~C 6 ) cycloalkyl, -NO 2 , -NR 1 R 2 , (C 1 ~C 4 )Alkoxy, Phenoxy, -NR 1 -SO 2 -NR 1 R 2 , -NR 1 -SO 2 -R 1 , -NR 1 -C(=O)-R 1 , -NR 1 -C(=O)-NR 1 R 2 , -SO 2 -NR 1 R 2 , -SO 3 H, -O-SO 2 -OR 3 ,-OP(=O)-(OR 3 )(OR 4 ), -O-CH 2 -COOR 3 , or (C 1 ~C 3 ) alkyl, wherein the alkyl optionally contains a hydroxyl group, a group of formula (IIa) 【Chemistry 12】 or a group of formula (IIIa) 【Chemistry 13】 optionally mono- or disubstituted by Q is N or O, provided that when Q is O, R″ is absent; R 1 and R 2 Each of the groups independently represents a hydrogen atom or (C 1 ~C 3 ) alkyl, R 3 and R 4 each independently represents a hydrogen atom, Li + , Na + , K. + , N + (Ra) 4 or benzyl, n is 1, 2 or 3; n' is 1, 2 or 3; Each R' is independently a hydrogen atom, (C 1 ~C 3 ) Alkyl, hydroxyl, halogen atom, -NO 2 , -NR 1 R 2 , morpholinyl, morpholino, N-methylpiperazinyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 4 )alkoxy, -OP(=O)-(OR 3 )(OR 4 ), —CN, a group of the following formula (IIa): 【Chemistry 14】 or a group of the following formula (IIIa) 【Chemistry 15】 and A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb independently represents a hydrogen atom, (C 1 ~C 5 ) alkyl or (C 3 ~C 6 ) cycloalkyl, or R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocycle, which may optionally be substituted by one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 or 3 only if the other R a group is different from said (IIa) or (IIIa) group; and R" is a hydrogen atom, (C 1 ~C 4 ) alkyl or a group of formula (IIa) as defined above.

14. 14. The mutant of claim 13, wherein the compound is selected from compounds having formulas Ia to Id below or a pharmaceutically acceptable salt thereof. 【Chemistry 16】

15. 15. The mutant of claim 13 or 14, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof.

16. The mutant of claim 6, wherein the therapeutic treatment is with a compound of formula IV: 【Chemistry 17】 wherein V, Z, R, R', n and n' are as defined in claim 8.

17. 17. The variant of claim 16, wherein the compound is selected from compounds having the following formulae IVa to IVd, or pharmaceutically acceptable salts thereof: [Chemistry 18] 18. The miR-124 of claim 7, wherein the therapeutic treatment is performed with a compound of formula I: 【Chemistry 19】 where: Z is C or N; V is C or N; 【Chemistry 20】 means an aromatic ring, wherein V is C or N, and when V is N, V ​​is in the ortho, meta or para position relative to Z; Each R is independently a hydrogen atom, a halogen atom, -CN, hydroxyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 3 ) fluoroalkoxy, (C 3 ~C 6 ) cycloalkyl, -NO 2 , -NR 1 R 2 , (C 1 ~C 4 )Alkoxy, Phenoxy, -NR 1 -SO 2 -NR 1 R 2 , -NR 1 -SO 2 -R 1 , -NR 1 -C(=O)-R 1 , -NR 1 -C(=O)-NR 1 R 2 , -SO 2 -NR 1 R 2 , -SO 3 H, -O-SO 2 -OR 3 ,-OP(=O)-(OR 3 )(OR 4 ), -O-CH 2 -COOR 3 , or (C 1 ~C 3 ) alkyl, wherein the alkyl optionally contains a hydroxyl group, a group of formula (IIa) 【Chemistry 21】 or a group of formula (IIIa) 【Chemistry 22】 optionally mono- or disubstituted by Q is N or O, provided that when Q is O, R″ is absent; R 1 and R 2 Each of the groups independently represents a hydrogen atom or (C 1 ~C 3 ) alkyl, R 3 and R 4 each independently represents a hydrogen atom, Li + , Na + , K. + , N + (Ra) 4 or benzyl, n is 1, 2 or 3; n' is 1, 2 or 3; Each R' is independently a hydrogen atom, (C 1 ~C 3 ) Alkyl, hydroxyl, halogen atom, -NO 2 , -NR 1 R 2 , morpholinyl, morpholino, N-methylpiperazinyl, (C 1 ~C 3 ) fluoroalkyl, (C 1 ~C 4 )alkoxy, -OP(=O)-(OR 3 )(OR 4 ), —CN, a group of the following formula (IIa): 【Chemistry 23】 or a group of the following formula (IIIa) 【Chemistry 24】 and A is a covalent bond, an oxygen atom, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4 or 5; p is 1, 2 or 3; Each of Ra and Rb independently represents a hydrogen atom, (C 1 ~C 5 ) alkyl or (C 3 ~C 6 ) cycloalkyl, or R a and R b together with the nitrogen atom to which they are attached may form a saturated 5- or 6-membered heterocycle, which may optionally be substituted by one or more R a , provided that when R a is a (IIa) or (IIIa) group, n a may be 2 or 3 only if the other R a group is different from said (IIa) or (IIIa) group; and R" is a hydrogen atom, (C 1 ~C 4 ) alkyl or a group of formula (IIa) as defined above.

19. The miR-124 of claim 18, wherein the compound is selected from the compounds having the following formulae Ia to Id, or pharmaceutically acceptable salts thereof: 【Chemistry 25】

20. 20. The miR-124 of claim 19, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof.

21. The miR-124 of claim 7, wherein the therapeutic treatment is performed with a compound of formula IV: 【Chemistry 26】 wherein V, Z, R, R', n and n' are as defined in claim 8.

22. The miR-124 of claim 21, wherein the compound is selected from the compounds having the following formulae IVa to IVd or pharmaceutically acceptable salts thereof: 【Chemistry 27】

23. In vitro or ex vivo methods for using splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for an inflammatory disease, disorder or condition, or cancer, or as a biomarker for the effectiveness of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

24. An in vitro or ex vivo method for using splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for assessing the biological effect of a compound or medical device for the treatment of an inflammatory disease, disorder or condition, or cancer.

25. In vitro or ex vivo methods of using splice variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for selecting patients for therapeutic treatment of inflammatory diseases, disorders or conditions, or cancer.

26. In vitro or ex vivo methods of using miR-124 as a biomarker for inflammatory diseases, disorders or conditions, or cancer, or the effectiveness of therapeutic treatments.

27. In vitro or ex vivo methods of using miR-124 as a biomarker for selecting patients for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer.

28. 28. The in vitro or ex vivo method of use of any one of claims 23, 25, 26, or 27, wherein the therapeutic treatment comprises administration of a compound of formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IVd, IV, such as ABX464, or a pharmaceutically acceptable salt thereof.

29. 25. The in vitro or ex vivo method of claim 24, wherein the compound is a compound of formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IV, such as ABX464, or a pharmaceutically acceptable salt thereof.

30. An in vitro or ex vivo method for use described in any one of claims 23 to 29, wherein the measured level of expression of the splice variant lncRNA 0599-205 or the miR-124 at the miR-124-1 locus in an isolated biological sample is compared to a control reference value.

Images