Method for testing pancreatic cancer, marker, test kit, and method for screening agent for preventing or ameliorating pancreatic cancer

Abstract

To provide a technique capable of contributing to the diagnosis of pancreatic cancer, reducing a physical burden, and inexpensively and quickly examining the possibility of suffering from pancreatic cancer.SOLUTION: The method for examining pancreatic cancer includes detecting the amount of N-acetylneuraminic acid lyase gene derived from bacteria in a sample from a subject. Advantageous Effects of Invention According to the present invention, pancreatic cancer can be tested using a biological sample obtained noninvasively, such as feces, saliva, blood, or body fluid, without imposing a hospital visit burden or a physical burden related to the test on a subject. Since the amount of the nanA gene derived from bacteria can be measured by PCR and the comprehensive analysis of intestinal bacterial flora is unnecessary in the present invention, pancreatic cancer can be rapidly and inexpensively examined.SELECTED DRAWING: Figure 4

Description

[Technical Field]

[0001] The present invention relates to a method, a marker and a test kit for detecting pancreatic cancer, and a method for screening for an agent for preventing or improving pancreatic cancer. [Background technology]

[0002] Pancreatic cancer (pancreatic cancer) is one of the most lethal malignant tumors, and the number of patients has been increasing in recent years. One of the reasons for the high mortality rate is the difficulty of early detection of the cancer. Most pancreatic cancers are adenocarcinomas of the exocrine pancreas, but adenocarcinomas of the pancreatic body or tail generally do not show symptoms until the cancer has grown large. For this reason, by the time symptoms appear and a diagnosis is made, the tumor has often already metastasized to sites other than the pancreas, making a complete cure difficult (Non-Patent Document 1).

[0003] Therefore, research and development of technologies that contribute to the early detection of pancreatic cancer has been conducted. For example, Patent Document 1 discloses that LOC100507412 RNA, a long non-coding RNA in human extracellular vesicles, can be used as a biomarker for pancreatic cancer. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Publication No. 2021-114934 [Non-patent literature]

[0005] [Non-Patent Document 1] Merck & Co., Inc., Kenilworth, NJ, USA, MSD Manual Home Edition / 03. Digestive System Diseases / Digestive System Tumors / Pancreatic Cancer, Author: Minhhuyen Nguyen, MD, Fox Chase Cancer Center, Temple University, Review / Revised March 2021, [Retrieved June 11, 2024], Internet <URL: https: / / www.msdmanuals.com / ja-jp / home / 03-%E6%B6%88%E5%8C%96%E5%99%A8%E7%B3%BB%E3%81%AE%E7%97%85%E6%B0%97 / %E6%B6%88%E5%8C%96%E5%99%A8%E7%B3%BB%E3%81%AE%E8%85%AB%E7%98%8D / %E8%86%B5%E8%87%93%E3%81%8C%E3%82%93> Summary of the Invention [Problem to be solved by the invention]

[0006] However, even in light of these patent documents, it cannot be said that there is a sufficient supply of technologies that contribute to the early detection of pancreatic cancer. The present invention has been made to solve this problem, and aims to provide a technology that can contribute to the diagnosis of pancreatic cancer and that can quickly and inexpensively test the possibility of developing pancreatic cancer with little physical burden. [Means for solving the problem]

[0007] As a result of extensive research, the present inventors have found that the amount of bacterial N-acetylneuraminic acid lyase (NanA) gene or the amount of bacteria carrying the nanA gene in their genomic DNA (nanA-carrying bacteria) is significantly higher in pancreatic cancer patients than in healthy individuals. Based on this finding, the present inventors have completed the following inventions.

[0008] (1) A first embodiment of the method for testing pancreatic cancer according to the present invention comprises detecting the amount of the bacterial nanA gene in a sample from a subject.

[0009] (2) A second embodiment of the method for testing pancreatic cancer according to the present invention comprises detecting the amount of nanA-carrying bacteria in a sample from a subject.

[0010] (3) In the present invention, the nanA gene may comprise the following DNA sequence (a) or (b): (A) a DNA sequence having a sequence identity of 66.7% or more with SEQ ID NO: 9; (i) A DNA sequence having 70% or more sequence identity with SEQ ID NO: 38.

[0011] (4) In the present invention, the nanA-carrying bacteria may consist of two or more species. Furthermore, in the present invention, it may be considered that there is a positive correlation between the amount of nanA-carrying bacteria and the possibility of developing pancreatic cancer.

[0012] (5) The testing method according to the present invention may further comprise detecting the amount of Blautia wexlerae in a sample from the subject.

[0013] (6) A first embodiment of the diagnostic marker for pancreatic cancer according to the present invention comprises the nanA gene derived from bacteria.

[0014] (7) A second embodiment of the diagnostic marker for pancreatic cancer according to the present invention includes nanA-carrying bacteria.

[0015] (8) A first embodiment of the test kit for pancreatic cancer according to the present invention comprises a PCR primer set capable of amplifying the nanA gene.

[0016] (9) A second embodiment of the pancreatic cancer test kit according to the present invention comprises a PCR primer set capable of detecting nanA-carrying bacteria.

[0017] (10) A first embodiment of the method of the present invention for screening a preventive or ameliorating agent for pancreatic cancer comprises detecting the amount of the bacterial nanA gene in a sample.

[0018] (11) A second embodiment of the method of screening for a preventive or ameliorating agent for pancreatic cancer according to the present invention comprises detecting the amount of nanA-carrying bacteria in a sample.

[0019] (12) The diagnostic marker for pancreatic cancer according to the present invention may further comprise Blautia wexcellellae.

[0020] (13) The test kit for pancreatic cancer according to the present invention may further include a PCR primer set capable of detecting Blautia wexellellae.

[0021] (14) The screening method according to the present invention may further comprise detecting the amount of Blautia wexellellae in the sample.

[0022] The method of the present invention may exclude medical intervention. [Effects of the Invention]

[0023] According to the present invention, it is possible to examine the possibility of suffering from pancreatic cancer.

[0024] According to the present invention, pancreatic cancer can be tested using non-invasively obtained biological samples such as feces, saliva, blood, and body fluids, without imposing the burden of visiting a hospital or the physical burden associated with the test on the subject.

[0025] The amount of the bacterial nanA gene can be measured by PCR, and since the present invention does not require comprehensive analysis of the intestinal bacterial flora, pancreatic cancer can be tested quickly and inexpensively.

[0026] It is known that even enterobacteria that have the same 16S rRNA gene and are identified as the same species may possess different functions (enzyme genes). For example, the butyrate-producing bacterium Faecalibacterium prausnitzii has been shown to have high genomic diversity, suggesting the existence of strains with different functions, such as sugar metabolism (BMC Genomics. 2018 Dec 14;19(1):931. DOI: 10.1186 / s12864-018-5313-6). In addition, two different clades (phylogenetic groups) of Ruminococcus gnavus, which is believed to be the causative bacterium of inflammatory bowel disease, have been identified, and it has been reported that only Clade 2 was prevalent in patients with inflammatory bowel disease (Genome Med. 2017 Nov 28;9(1):103. DOI: 10.1186 / s13073-017-0490-5). In other words, when targeting specific bacterial species classified by the 16S rRNA gene, strains with specific functions and strains without those functions will be counted together, which may raise concerns about the validity of the analysis. In contrast, the present invention targets the nanA gene carried by a bacterial group consisting of multiple species and genera (or a nanA-carrying bacterial group consisting of multiple species and genera), thereby alleviating concerns about the effectiveness of such tests. In other words, the present invention can provide a highly sensitive pancreatic cancer testing technology.

[0027] According to the present invention, pancreatic cancer can be examined, which can contribute to the diagnosis of the disease, and in turn contribute to the prompt initiation of treatment, the reduction of mortality rates, and the improvement of the quality of life of patients.

[0028] According to the present invention, it is possible to screen for substances that reduce the risk of developing pancreatic cancer or improve the condition of the disease, i.e., agents for preventing or improving pancreatic cancer. The agents extracted thereby can be expected to prevent or improve pancreatic cancer or maintain health. [Brief explanation of the drawings]

[0029] [Figure 1]1 is a table showing the sequence results of the PP region detected by PCR using primer set I for amplifying nanA gene homologs, and the bacterial species and strains identified based on the results. [Figure 2] This is a phylogenetic tree showing the bacteria from which the PP region of the nanA gene detected by PCR using primer set I for amplifying nanA gene homologs is derived, and a bar graph showing the amount of the sequence (bacteria) detected. [Figure 3] 1 is a table showing bacteria having partial sequences that perfectly match with primer set II for amplifying nanA gene homologs. [Figure 4] 1 is a bar graph showing the nanA gene abundance in feces from a group of healthy individuals and a group of patients. (a) shows the results detected by PCR using primer set I, and (b) shows the results detected by PCR using primer set II. In the figure, the plots indicate the measured values ​​for each sample. [Figure 5] 1 is a bar graph showing the amount of Blautia wexellellae in the feces of healthy subjects and patients, with the plots indicating the measured values ​​for each sample. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention will be described in detail below. The present invention may be practiced outside of medical practice.

[0031] Pancreatic cancer refers to a disease in which malignant tumors develop in the pancreas, and includes pancreatic exocrine tumors, pancreatic endocrine tumors, pancreatic ductal carcinoma, pancreatic neuroendocrine tumors (malignant), and neoplastic pancreatic cysts (malignant), which arise from pancreatic ductal cells and acinar cells.

[0032] In the present invention, "pancreatic cancer testing" includes testing to determine whether a subject is likely to have pancreatic cancer, and testing to make a definitive diagnosis if the subject already has pancreatic cancer.

[0033] In the present invention, the amount of the nanA gene derived from bacteria or the amount of bacteria carrying the nanA gene in their genomic DNA is detected. Here, the bacteria may be microorganisms that inhabit (form colonies of) specific parts of the human or animal body (living body), such as the skin, nose, mouth, throat, large intestine, or vagina. Alternatively, the bacteria may be those cultured outside the body, those that inhabit plants, or those that inhabit environments such as water or soil. Furthermore, the bacteria may consist of one species or genus, or two or more species or genera.

[0034] In the present invention, examples of samples include those that reflect the bacterial flora in a living body, such as feces, intestinal contents, washings and body fluids (saliva, mucus, lymph, etc.) collected during examinations such as endoscopic examinations, mucous membranes of the gastrointestinal lumen, tissues or cells collected or excised by surgery, blood, skin, and cultured human intestinal models.

[0035] N-acetylneuraminic acid lyase (NanA) is an enzyme that decomposes N-acetylneuraminic acid, a type of sialic acid, into N-acetylmannosamine and pyruvate. The nanA gene encodes NanA.

[0036] Since many of the sugar chain terminals of mucins contain N-acetylneuraminic acid, several species of bacteria that degrade and utilize mucins possess the nanA gene. Examples of bacteria carrying the nanA gene in their genomic DNA (nanA-carrying bacteria) include the genus Blautia (Blautia luti, Blautia coccoides, Blautia hansenii, Blautia pseudococcoides, Blautia producta, etc.), the genus Dorea (Dorea longicatena, Dorea formicigenerans, etc.), the genus Ruminococcus (Ruminococcus gnavus, etc.), the genus Streptococcus (Streptococcus pneumoniae, Streptococcus parasanguinis, Sreptococcus anginosus, Sreptococcus sanguinis, etc.), the genus Clostridium (Clostridium difficile, Clostridium perfringens, etc.), the genus Bacteroides (Bacteroides acidifaciens, Bacteroides caccae, etc.), the genus Fusobacterium (Fusobacterium Examples include the genus Akkermansia (e.g., Akkermansia muciniphila), etc. The nanA-carrying bacteria may consist of one species or genus, or two or more species or genera.

[0037] As shown in the Examples below, the amount of nanA gene in feces or the amount (abundance ratio) of nanA-carrying bacteria is correlated with a higher amount in individuals with pancreatic cancer than in individuals without the disease. In other words, there is a positive correlation between the amount of nanA gene or the amount of nanA-carrying bacteria and the likelihood of developing pancreatic cancer. Therefore, bacterial nanA genes or nanA-carrying bacteria can be used as diagnostic markers for pancreatic cancer. In other words, the likelihood of developing pancreatic cancer can be examined by detecting the amount of bacterial nanA gene or the amount of nanA-carrying bacteria.

[0038] Furthermore, as shown in the examples below, Blautia weexcellae exhibits a correlation in that the amount of this bacterial species in feces is lower in individuals with pancreatic cancer than in individuals without the disease. In other words, there is a negative correlation between the amount of Blautia weexcellae and the likelihood of developing pancreatic cancer. Therefore, Blautia weexcellae can be used as a diagnostic marker for pancreatic cancer, and the likelihood of developing pancreatic cancer can be examined by detecting the amount of this bacteria.

[0039] By detecting the amount of Blautia weexcellellae in addition to the amount of bacterial nanA gene or the amount of nanA-carrying bacteria, the accuracy and sensitivity of pancreatic cancer testing can be improved. In other words, a diagnostic marker for pancreatic cancer may contain Blautia weexcellellae in addition to the nanA gene or nanA-carrying bacteria.

[0040] Furthermore, based on the above correlation, it can be said that "substances that reduce the amount of bacterial nanA gene or the amount of nanA-carrying bacteria" and "substances that increase the amount of Blautia wexellellae" reduce the possibility of developing pancreatic cancer, or do not worsen the condition, or even improve it.

[0041] Therefore, the amount of the "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae" can be used as an indicator to screen for preventive or ameliorative agents for pancreatic cancer. In this screening method, for example, a test substance is added to a cultured human intestinal model or administered to a subject, and the amount of the "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae" is detected after a certain period of time has passed. If a substance that reduces the amount of the nanA gene or nanA-carrying bacteria or increases the amount of Blautia wexcellae is extracted using this test system, it can be said to be a substance that reduces the risk of developing pancreatic cancer or improves the condition, i.e., a preventive or ameliorative agent for pancreatic cancer.

[0042] More specifically, the screening method may comprise, for example, the steps of measuring the amount of "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae" in a sample before administration of a test substance; measuring the amount of "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae" in a sample after administration of the test substance; and selecting a test substance useful as a preventive or ameliorative agent for pancreatic cancer based on the results of measuring the amount of the "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae" from the pre-administration sample and the post-administration sample.

[0043] Examples of the DNA sequence of the nanA gene include the DNA sequences of SEQ ID NOs: 3 to 6 and 37 contained in the above bacteria, or sequences that have a relatively high sequence identity with SEQ ID NOs: 3 to 6 and 37. [SEQ ID NO: 3] nanA gene (length 948 residues) from Ruminococcus gnavus ATCC 29149, Accession No.: AAYG02000020.1 (Genome): 136203-137150 (nanA corresponding part) ATGGCTTTTATGAAGCAAAGGAGCAAAACTATGAGAAATCTTGAGAAGTATAAAGGTGTG ATTCCGGCATTTTATGC TTGCTATGACAAAGAAGGAAACATTAGTCCAGAAGGTGTACAGGGACTGACAAAATATTTTGTAAAAAAAGGG GTAAAAGGTGTCTATGTAAACGGTTCTTCCGGAGAATGTATTTATCAGAGTGTGGAGGACCGTAAGATTGTACTTGAGAATGTTATGAAAGTAGCGGAAGGTAAACTTACAGTTATTGCCCATGTGGCCTGCAATAACACGAAGGACAGTCAGGAGCTTGCCAGACATGCAGAAGGGCTGGGGGTAGATGCAATCGCTGCAATTCCTCCCATCTAT TTTCACTTACCGGAATATGCTATTGCGCAGTATTGGAATGCCATTAGTGCAGCGGCACCGAACACAGACTTTGTAATTTATAACATACCTCAGCTTGCTGGTGTTGCACTTACACAGAATTTATTTGTAGAGATGAGGAAAAATCCCAACGTCATTGGTGTCAAGAATTCCTCTATGCCGGTACAGGATATCCA AATGTTTAAGCAGGCTGCAGGAGCTGAGTACATTATCTTTAATGGTCCTGATGAGCAGTTTATGAGCGGACGTGTTATCGGGGCAGAGGGTGCAATTGGGGGAACCTATGGTGCTATGCCTGAATTATACTTAAAGTTGGATGAGTGTATAAATGCAGGAAAGATGACAGAGGCAAGAAAAATCCAGTATGCTT GTAATGAGATAATTTACAAAATGTGTTCAGCGCATGGAAATATGTATGCAGTTATTAAAGCAATTCTAAAGATTAATGAAGGACTGGAACTTGGTGCAGTAAGAGAGCCTCTTCCAGCATTGGTAGATGAGGACATGGAGATTGTAAAAGAAGCTGCACAGATGATCTGTGATGCGAAGAAGAAATTTCTATAA

[0044] [SEQ ID NO: 4] nanA gene from Blautia genus (length 918 bases), Accession No.: WQPZ01000016.1 (genome): 32239-33156 (corresponding part of nanA) ATGAGAAATCTTGAGAAATATAAAGGTGTGATTCCGGCATTTTATGCTTGCTATGACAAAGAAGGAAACATTAGTCCAGAAAGTGTACAGGAACTGACAAAATATTTTGTAAAAAAAGGGGTAAAAGGTGTCTATGTAAACGGTTCTTCCGGAGAGTGTATTTATCAGAGTGTGGAAGATCGTAAGATCGTACTTGAGAATGTTATGAAAGCAGCGGAAGGTAAACTTACAGTTATCGCCCATGTCGCCTGCAATAACACGAAGGACAGTCAGGAACTTGCCAGACATGCAGAAGAGCTGGGGGTAGATGCAATCGCTGCAATTCCTCCCATCTATTTTCACTTACCGGAATACGCTATTGCACAGTATTGGAATGCCATTAGTGCAGCGGCACCGAACACAGACTTTGTAATTTATAACATACCTCAGCTTGCTGGCGTTGCACTTACACAGAATTTA TTTGCAGAGATGAGGAAGAATCCAAACGTCATTGGTGTCAAGAATTCCTCTATGCCGGTACAGGATATCCAAATGTTTAAGCAGGCTGCAGGAGATGAGTACATTATCTTTAATGGTCCTGATGAGCAGTTTATGAGCGGACGTGTTATCGGGGCAGAGGGTGCAATTGGGGGAACCTATGGTGCTATGCCTGAATTATACTTAAAGTTGGATGAGTGTGTAAATGCAGGAAAGATGACAGAGGCAAGAAAAATCCAGTATGCTTGTAATGAGATAATTTATAAAATGTGTTCAGCACACGGAAACATGTATGCAGTTATTAAAGCAATTCTAAAGATCAATGAGGGACTGGAACTTGGCGGAGTAAGAGAGCCTCTTCCAGCACTGGTAGATGAGGACATGGAAATCGTAAAAAAAGCTGCTCAGATGATCTGTGATGCGAAGAAAAAATATTTGTAA

[0045] [SEQ ID NO: 5] nanA gene from Blautia genus (length 918 bases), Accession No.: CABHNW010000134.1 (genome): 10299-11216 (nanA corresponding part) ATGAGAAATCTGGAAAAGTACAAAGGAGTCATTCCGGCATTTTATGCATGCTACGATGAAAAAGGAAATGTAAGTCCAGAAGGGGTACAGGCACTGACAAAATATTTTGTGAAAAAGGGAGTAAAGGGTGTCTATGTAAACGGATCTTCAGGGGAATGTATTTACCAGAGTGTGGAGGATCGAAAGATCATTCTCGAGAATGTTATGAAAGCCGCAGAGGGTAAACTTACTGTTATTGCACATGTTGCATGTAATAATACAAAAGATAGCCAGGAACTGGCAAGACATGCAGAGAGCCTTGGCGTAGATGCAATCGCAGCTATTCCGCCAATTTATTTCCATTTACCAGAATATGCAATTGCACAATATTGGAATGATATCAGTGCAGCAGCACCACATACAGATTTTGTAATTTACAACATTCCTCAGCTTGCAGGTGTTGCTTTAACACAGAAGCTT TTTGCAGAAATGAGAAAGAATCCAAATGTAATCGGGGTTAAGAACTCCTCTATGCCGGTTCAGGATATTCAGATGTTCAAGCAGGCAGCTGGCCCAGATTACATTATCTTTAATGGCCCAGATGAGCAGTTTATGAGTGGACGTGTAATTGGTGCAGAAGGTGCTATTGGTGGAACATATGGTGCTATGCCAGAACTGTATCTGAAACTGGATGAATATGTAAAGGCAGGCGAGATGGAAAAAGCAAGAGAGCTCCAGTATGCTTGTGATGAAATTATTTATAAGATGTGTTCCGCACATGGAAATATGTATGCAGTAATCAAAGCAATTCTTAAGATTAATGAAGGTCTTGAACTGGGCGGCGTAAGAGAACCTCTTCCTGCTTTAATTGAAGATGATATGGATATCGTGAAAGAAGCAGCACAGATGATCTGTGATGCAAAGAAGAAATATTTATAA

[0046] [SEQ ID NO: 6] nanA gene from Blautia genus (length 930 bases), Accession No.: JANFXL010000022.1 (genome): 24794-25723 (corresponding part of nanA) ATGAGTAAATTAGATAAGTACAGAGGTATTATCCCGGCATTTTATGCATGTTATGATGAGGAAGGAAATGTGAGCGGAGAGCGTGTACAGGCCCTCACACGTCACTTCATCGAAAAAGGCGTAAAGGGTGTCTACGTAAATGGTTCTTCAGGAGAATGTATTTACCAGAGCGTAGAAGAGAGAAAGCTTATCATTGAAAACGTAATGGCAGCAGCAAAGGGTAAACTGACTGTCATCAATCATGTGGCATGTAATAACACAAAGGACAGTGTGGAGCTGGCAAAACACTCTGAGAGTGTAGGCGTAGATGCAATCGCATCCATTCCTCCTATTTACTTCCGTCTGCCGGAGTATTCTATTGCAGCTTACTGGAATGCAATCAGTGAAGCAGCGCCAAACACAGATTTCGTGATTTACAATATACCGCAGCTTGCTGGCACAGCTCTGACTATGAGCCTGTTTGCAGAGATGATGAAAAACCCAAGAGTTATCGCTGTAAAGAACTCTTCCATGCCTGCCCAGGATATTCAGATGTTCAAAACAGCAGGTCTTGCGGCAAAAGACGACTTTGTAGTGTTCAACGGCCCGGATGAGCAGTTTGTAGCAGGACGCGCGATCGGTGCTGACGGTGGGATCGGCGGAACCTATGGTGTTATGCCGGAGCTGTTCCTGAAACTGAATGAGCTGGTCGAGGCAGGGGAAAAGAAAAAAGCCTGTGAATTACAGTATGCGATCAATGAGATCATCTACAAAATGTGCTCCAGCCATGCGAATATGTATGCGGTAGCAAAAGAAATCCTGCGCACAAACGACAGCGTAAATATCGGAGGTGTCCGTGAACCGCTGGAAAATATGCAGGAAGCAGACAAAGTGATCGCTCATGAGGCTGCCGCTATGGTTAAAGCTGCCATGGAAAGATATCTGGTATAA

[0047] [SEQ ID NO: 37] nanA gene (length 918 bases) from Streptococcus constellatus subsp. pharyngis C232, Accession No.: GenBank: CP003800.1 (genome): 81999-82916 (corresponding portion of nanA) ATGAGAGATTTAAAAAAATATGAAGGGGTCATTCCGGCCTTTTATGCTTG CTATGATGATCAAGGCGAGATTAGTCCAGAGCGCGTGCGAGCTTTGGTAG AATATTTTCTTGAAAAAAGGAGTTCAAGGCTTGTATGTTAATGGCTCATCTGGTGAATGTATCTACCAAAGTGTGCTGATAGAAAATTGATTTTAGAAGAAGTAATGGCAGTGGCAAAAGGGAAATTAACTATTATTGCTCACGTCGCTTGCAACAACACCA AGGATAGTATGGAGTTAGCGCGCCATGCAGAAAGCTTGGGAGTGGACGCTATTGCGACCATACCACCGATTTATTTTCGTTTGCCAGAATACTCGATTGCTCAATATTGGAACGATATTAGCGCAGCTGCCCCACATACAGACTTTGTGATCTACAATATTC CGCAGTTGGCAGGTGTAGCTCT GACGCCAAGTTTATATAAAGAAATGCTCAAAAATGAACGTGTGATTGGCGTGAAGAATTCTTCCATGCCTGTCCAAGAC ATTCAAACCTTTGCAGCACTTGGTGGGGAAGACCACCTCGTCTTTAATGGGCCAGATGAGCAATTTTTAGGTGGTCGCCTGATGGGAGCAAGAGCAGGTATCGGTGGAACATATGGGGCGATGCCAGAGCTTTTCTTGAAGCTCAATCAATTGATTGCCGACAAAGAATTGGAGAGCAAAAGAATTACAATTTACCATCAACACTATTATCGGAAAATTAACT GCTGCTCATGGAAAATATGTATTCTGTTATCAAGGAAGTCTTGAAAATCAA TGAAAATCTAAACGTTGGTTCTGTTCGTGCTCCGTTAACACCAGTGACAG GCACAGATCGTCCGATTGTAGAAGAAGCAGCTCGCTTGATTCGTGCAGCTAAGGAAACGT TCTTGTAA

[0048] Furthermore, the nanA gene may be (A) a gene containing the DNA sequence of SEQ ID NO: 9, or a DNA sequence that has relatively high sequence identity with SEQ ID NO: 9. Here, SEQ ID NO: 9 is the sequence from positions 78 to 151 of SEQ ID NO: 3. [SEQ ID NO: 9] (73 residues in length) TTGCTATGACAAAGAAGGAAACATTAGTCCAGAAGGTGTACAGGGACTGACAAAATATTTTGTAAAAAAAGGG

[0049] The nanA gene may be (i) a gene containing the DNA sequence of SEQ ID NO: 38, or a DNA sequence that has relatively high sequence identity with SEQ ID NO: 38. SEQ ID NO: 38 is the sequence from bases 447 to 525 of SEQ ID NO: 37. [SEQ ID NO: 38] (length 79 residues) GACGCCAAGTTTATATAAAGAAATGCTCAAAAATGAACGTGTGATTGGCGTGAAGAATTCTTCCATGCCTGTCCAAGAC

[0050] Here, when referring to a "DNA sequence having a high sequence identity to SEQ ID NO: 3 to 6, 9, 37, or 38," examples of the sequence identity include 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, 90% or more, 95% or more, and the like, including 100%. Note that "sequence identity" refers to sequence consistency and is used interchangeably with "identity."

[0051] A "DNA sequence with high sequence identity" can also be referred to as "a DNA sequence in which one or more nucleotides are deleted, substituted, inserted or added in SEQ ID NO: 3 to 6, 9, 37 or 38." In this case, the number of nucleotides to be deleted, substituted, inserted or added can be, for example, 1 to 231, 1 to 223, 1 to 215, 1 to 208, 1 to 200, 1 to 192, 1 to 185, 1 to 177, 1 to 169, 1 to 161, 1 to 154, 1 to 115, 1 to 77, 1 to 38, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 11, 1 to 7, or 1 to 3.

[0052] Sequence identity with a given DNA sequence can be confirmed using standard methods, such as FASTA (http: / / www.genome.JP / tools / fasta / ), Basic local alignment search tool (BLAST; http: / / www.ncbi.nlm.nih.gov.), Position-Specific Iterated BLAST (PSI-BLAST; http: / / www.ncbi.nlm.nih.gov.), CLUSTALW (http: / / www.genome.jp / ja / ), and MAFFT (http: / / www.genome.jp / ja / ).

[0053] The amount of the nanA gene can be detected by known conventional methods. For example, when the sample is feces, an example of such a detection method is the "shotgun sequencing method" of the total genomic DNA of bacteria extracted from the fecal sample. In this method, the genomic DNA is first cleaved with a restriction enzyme or the like, and the sequence of the cleaved short DNA strands is determined. At this time, the fragments are cleaved so that they overlap, and then sequenced. Finally, the overlapping portions of the DNA fragment sequences are connected on a computer to determine the long sequence. While this method requires relatively high costs in terms of money and time, it allows for accurate determination of the type and amount of genes.

[0054] Another example is a method of performing PCR using specific primers on the total genomic DNA of bacteria extracted from a sample. This method allows for more rapid and inexpensive detection of the amount of the nanA gene. The specific primers for amplifying the nanA gene used in this method can be designed based on the known DNA sequence of part or all of the nanA gene (e.g., SEQ ID NOS: 3-6, 9, 37, and 38). PCR reaction conditions can also be appropriately set depending on the type and preparation method of the sample, the sequence and length of the primers, and the type and properties of the enzyme used in the reaction. More specifically, examples of specific primers include Primer Set I (SEQ ID NOS: 7 and 8) and Primer Set II (SEQ ID NOS: 35 and 36) described in the Examples below. In SEQ ID NOS: 3, the sequences corresponding to SEQ ID NOS: 7 and 8 are underlined. In SEQ ID NOS: 37, the sequences corresponding to SEQ ID NOS: 35 and 36 are underlined.

[0055] The amount of nanA-carrying bacteria can also be detected by known standard methods. For example, the abundance ratio of nanA-carrying bacteria can be detected by the above-mentioned "shotgun sequencing method." Alternatively, a partial sequence of genomic DNA that is specifically shared by nanA-carrying bacteria from multiple species and genera (a conserved sequence specific to nanA-carrying bacteria) can be identified, specific primers can be designed to amplify the conserved sequence, and the amount of nanA-carrying bacteria can be quantified by the above-mentioned "method of performing PCR using specific primers."

[0056] The amount of Blautia wexcellellae can also be detected by known standard methods. For example, the abundance ratio of Blautia wexcellellae may be detected by the above-mentioned "shotgun sequencing method." Alternatively, a partial sequence of genomic DNA specifically contained in Blautia wexcellellae can be identified, specific primers for amplifying the partial sequence can be designed, and quantification can be performed by the above-mentioned "method of PCR using specific primers." More specifically, examples of specific primers include SEQ ID NOs: 41 and 42 (Blautia wexcellellae-specific partial sequences of the xanthine dehydrogenase gene) described in the Examples below.

[0057] That is, the present invention provides a test kit for pancreatic cancer and a screening kit for agents for preventing or ameliorating pancreatic cancer, which comprises a "PCR primer set capable of amplifying part or all of the bacterial nanA gene" or a "PCR primer set capable of detecting nanA-carrying bacteria." An example of a PCR primer set capable of detecting nanA-carrying bacteria is a PCR primer set capable of amplifying part or all of the above-mentioned conserved sequence specific to nanA-carrying bacteria.

[0058] The kit may further include a "PCR primer set capable of detecting Blautia wexcellellae." Examples of PCR primer sets capable of detecting Blautia wexcellellae include the above-mentioned SEQ ID NOS: 41 and 42 (Blautia wexcellellae-specific partial sequences of the xanthine dehydrogenase gene). The kit may also include enzymes necessary for PCR reactions, such as dNTPs and DNA polymerase, specimen collection equipment, labeling substances, reaction buffers, washing buffers, positive controls, negative controls, and instructions regarding the criteria for diagnosing pancreatic cancer and operating procedures.

[0059] If the amount of "bacterial nanA gene" or "nanA-carrying bacteria" in a sample is low, it is presumed that the possibility of developing pancreatic cancer is low, or that the test substance has a preventive or ameliorative effect against pancreatic cancer. Furthermore, if the amount of "Blautia wexcellae" is high, it is presumed that the possibility of developing pancreatic cancer is low, or that the test substance has a preventive or ameliorative effect against pancreatic cancer. However, since the amount of genes and bacteria purified from samples such as feces (purification efficiency) is not constant, it is preferable to calculate the percentage of the total number of bacteria and make a judgment based on that percentage.

[0060] Based on the results of detecting the amount of "bacterial nanA gene," "nanA-carrying bacteria," or "Blautia wexcellae," the reference value for determining the likelihood of developing pancreatic cancer and the presence or absence of a preventive or improvement effect can be set appropriately, and may vary depending on various factors such as the method for measuring the gene amount or bacterial amount, the method for calculating the reference value, the sex and age of the subject group, clinical findings, area of ​​residence, and test data accumulated up to that point.

[0061] For example, if the amount of the nanA gene is detected by PCR, and the "DNA copy number of the gene" is divided by the "DNA copy number of the 16S rRNA gene" to calculate the "nanA level," and the ratio is 0.01 or more, 0.02 or more, 0.03 or more, 0.04 or more, 0.05 or more, 0.06 or more, 0.07 or more, 0.08 or more, 0.09 or more, or 0.1 or more, it can be determined that there is a high possibility of the patient being affected by pancreatic cancer.

[0062] The present invention will be described below based on examples, but the technical scope of the present invention is not limited to the features shown in these examples. [Example]

[0063] <Example 1> Comprehensive bacterial flora analysis (1) Recovery of bacterial genomic DNA from feces The subjects were 38 untreated patients diagnosed with unresectable pancreatic ductal adenocarcinoma (patient group) and 85 healthy individuals (healthy control group). The subject demographics are shown in Table 1. The patient group consisted of individuals who met all of the criteria 1 to 4 listed on the left. 1. Patients who received sufficient information and provided voluntary written informed consent to participate in this study. 2. Patients aged 20 to 80 years at the time of informed consent. 3. Cases in which PDAC was strongly suspected on contrast-enhanced CT scan and in which adenocarcinoma was detected by tissue examination using endoscopic ultrasound-guided fine needle biopsy (EUS-FNB). 4. Patients with an ECOG performance status (PS) of 0 to 1.5, who were not receiving antibiotics, prebiotics, or probiotics, and whose treatment had not changed in the 4 weeks prior to the study. [Table 1]

[0064] Feces were collected from subjects using the fecal collection kit "FS-0017" (Techno Suruga Lab Co., Ltd.). The types and numbers of bacteria contained in feces are generally considered to reflect the individual's bacterial flora. DNA was extracted from the fecal samples using the QIAamp PowerFecal Pro DNA Kit (QIAGEN) according to the attached instructions, and this was used as total fecal DNA. The DNA concentration was measured using a spectrophotometer ND-1000 (NanDrop Technologies) and adjusted to 10 ng / μL.

[0065] (2) 16S rRNA metagenomic analysis We performed a comprehensive analysis of the types and abundance of bacteria in feces as previously reported (Shunsuke Takahashi, PLosONE, No. 9, Vol. 8, e105592, August 2014). First, we used total fecal DNA as a template and performed polymerase chain reaction (PCR) using the universal primers SEQ ID NOs: 1 and 2 below by the Dual-index method (Hisada Takayoshi et al., Arch Microbiol, Vol. 197, No. 7, pp. 919-34, June 2015) to amplify the V3-V4 region of bacterial 16S rDNA. Forward primer (341f): CCTACGGGAGGCAGCAG (SEQ ID NO: 1) Reverse primer (R806): GGACTACHVGGGTWTCTAAT (SEQ ID NO: 2)

[0066] The PCR amplification products were then sequenced using a next-generation sequencer, MiSeq (Illumina), using the paired-end method. The sequences were analyzed using the EzBioCloud 16S database and the 16S Microbiome Pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify the classification at the genus or species level and determine their abundance. The abundance ratio was calculated as the percentage of the total number of reads for each bacterial species (genus). The mean abundance ratio was calculated for each patient group and healthy control group, and p values ​​were calculated for comparisons between groups using a one-sided parametric test.

[0067] As a result, the beta diversity between the patient group and the healthy control group was significantly different (P = 0.001), and it was confirmed that the presence ratio (occupancy rate) of multiple bacterial species was increased in the patient group compared to the healthy control group, and the presence ratio of Blautia wexlerae was decreased.

[0068] According to a previous report (Shunda Wang et al., Mucins in pancreatic cancer: A well-established but promising family for diagnosis, prognosis and therapy, J Cell Mol Med. 2020;24:10279-10289. DOI: 10.1111 / jcmm.15684), mucins (MUC1, MUC3, MUC4, MUC5AC, MUC5B, MUC6, MUC13, and MUC16) are highly expressed in the pancreatic tissues of patients with pancreatic ductal carcinoma compared to healthy individuals. Based on this and the results of the 16S rRNA metagenomic analysis in Example 1(2), the present inventors speculated that bacteria that degrade or assimilate mucins may be increased in patients with pancreatic cancer.

[0069] <Example 2> Design of primers for amplifying the nanA gene (primer set I) If the number of bacteria that decompose or utilize mucin is increased in pancreatic cancer patients, it is likely that the proportion of mucin-degrading enzymes is also increased. Therefore, based on the considerations in Example 1, we decided to quantitatively analyze the gene encoding N-acetylneuraminic acid lyase (NanA), one of the mucin-degrading enzymes.

[0070] (1) Primer design Ruminococcus gnavus is a bacterium that has been reported to possess NanA and grow using sialic acid from mucin as a nutrient source. It is found in the oral cavity and intestinal tract. Therefore, a Protein BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) search was performed based on the amino acid sequence of NanA from Ruminococcus gnavus ATCC 29149 (JCM 6515). Four NanA variants from Ruminococcus gnavus and three NanA variants from Blautia species were identified as highly identical amino acid sequences. These DNA sequences were then searched and identified in GenBank (https: / / www.ncbi.nlm.nih.gov / genbank / ). The DNA sequences of the nanA genes from Ruminococcus gnavus ATCC 29149 and the three Blautia species are shown in SEQ ID NOs: 3 to 6, respectively. Subsequently, DNA sequences were aligned to identify highly conserved regions, and the following specific primers capable of amplifying a partial sequence of the nanA gene were designed. <Primer set I for nanA gene amplification> Forward primer: 5'-ATYCCGGCATTTTATGC-3' (SEQ ID NO: 7) Reverse primer: 5'-CCRTTTACRTAGACACCYTTTAC-3' (SEQ ID NO: 8)

[0071] Here, SEQ ID NO: 7 corresponds to positions 61 to 77 in SEQ ID NO: 3, and SEQ ID NO: 8 corresponds to positions 152 to 173 in SEQ ID NO: 3. That is, with the above primer set I, a portion corresponding to 113 nucleotides from positions 61 to 173 in SEQ ID NO: 3 is amplified. In the present invention, the portion of the nanA gene corresponding to positions 61 to 173 (113 nucleotides) in SEQ ID NO: 3 may be referred to as "region P." Furthermore, the portion of region P corresponding to positions 78 to 151 (73 nucleotides, SEQ ID NO: 9) in SEQ ID NO: 3, excluding the primer portions of SEQ ID NOs: 7 and 8, may be referred to as "region PP."

[0072] (2) Primer evaluation Water used for intestinal lavage during intestinal endoscopy was collected from four adults diagnosed with ulcerative colitis. The types and numbers of bacteria contained in intestinal lavage fluid are generally considered to reflect the individual's bacterial flora. Total DNA derived from bacterial genomes was extracted from 1 mL of each intestinal lavage fluid using the QIAamp DNA Stool Mini Kit (QIAGEN). Total DNA was also extracted from the feces of ovalbumin-sensitized food allergy model mice and highly aggressive dogs in the same manner.

[0073] Using these total DNAs as templates, first-stage PCR was performed using primers of SEQ ID NO: 7 and SEQ ID NO: 8. The PCR reagent was "Quick Taq® HS DyeMix" (Toyobo), and the reaction cycle consisted of 40 cycles of 95°C for 5 seconds, 50°C for 15 seconds, and 72°C for 15 seconds, with a final extension reaction of 72°C for 1 minute. After confirming that the PCR product was a single band by electrophoresis, the PCR product was purified and extracted. Using the first-stage PCR product as a template, second-stage PCR was performed under the same conditions (except for 22 reaction cycles) using primers of SEQ ID NO: 10 and 11 below. The underlined portions in SEQ ID NO: 10 and 11 are the same as those in SEQ ID NO: 7 and 8, respectively. <Second-stage PCR primers> Forward primer: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT ATYCCGGCATTTTATGC -3' (SEQ ID NO: 10) Reverse primer: 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CCRTTTACRTAGACACCYTTTAC -3' (SEQ ID NO: 11)

[0074] The product of the second PCR step was purified and its base sequence was decoded using the paired-end method with the next-generation sequencer MiSeq (Illumina). The decoded base sequence was analyzed using the bacterial flora analysis software Qiime2, and bacteria containing the sequence (region PP of the nanA gene) were identified at the species level. The results of sequencing the region PP and the identification of the bacterial species and strains are shown in Figure 1. In addition, the abundance was determined and a phylogenetic tree was created. The results are shown in Figure 2.

[0075] As shown in Figures 1 and 2(a), the PP region of Dorea longicatena, Ruminococcus gnavus, Blautia hansenii, and Blautia argi was detected in total DNA from feces of ovalbumin-sensitized food allergy model mice. Furthermore, as shown in Figures 1 and 2(b), the PP region of Dorea longicatena, Dorea formicigenerans, and Ruminococcus gnavus was detected in total DNA from highly aggressive dog feces. Furthermore, as shown in Figures 1 and 2(c), the PP region of Ruminococcus gnavus, Dorea formicigenerans, Dorea longicatena, Clostridiales sp., Blautia hansenii, Streptococcus pneumoniae, Blautia pseudococcoides, and Blautia producta was detected in total DNA from human intestinal lavage fluid.

[0076] That is, the nanA genes possessed by the genera Dorea, Ruminococcus, Blautia, Streptococcus, and Clostridiales were amplified in PCR using bacterial genome-derived total DNA as a template and primers of SEQ ID NOs: 7 and 8. These results demonstrate that PCR using primers of SEQ ID NOs: 7 and 8 can detect the nanA genes possessed by bacteria of multiple species and genera.

[0077] The sequence identity between SEQ ID NOs: 12 to 34 was 66.7 to 100% (the lowest identity was with the region PP (SEQ ID NO: 28) of Streptococcus pneumoniae ATCC 700669) when the region PP (SEQ ID NO: 9; positions 78 to 151 of SEQ ID NO: 3) of Ruminococcus gnavus ATCC 29149 was used as the standard. These results demonstrate that PCR using primers of SEQ ID NOs: 7 and 8 (primer set I) can detect nanA gene homologs with region PP identities in the range of 66.7 to 100%.

[0078] <Example 3> Design of primers for amplifying the nanA gene (primer set II) Next, the following primers were designed according to the method described in Example 2 as primers capable of amplifying the nanA gene possessed by the genus Streptococcus. <Primer set II for amplifying the nanA gene> Forward primer: 5'-CGCAGTTGGCAGGTGTAGCTCT-3' (SEQ ID NO: 35) Reverse primer: 5'-CCAAGTGCTGCAAAGGTTTGAAT-3' (SEQ ID NO: 36)

[0079] Enterobacteriaceae with partial sequences that perfectly match SEQ ID NOs: 35 and 36 were identified using Protein BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and the results are shown in Figure 3. Figure 3 shows a list of bacteria that were confirmed to also perfectly match the reverse primer (SEQ ID NO: 36) from a list of bacteria with partial sequences that perfectly match the forward primer (SEQ ID NO: 35).

[0080] As shown in Figure 3, at least Streptococcus anginosus, Streptococcus periodonticum, Streptococcus milleri, Streptococcus intermedius, and Streptococcus constellatus have partial sequences that perfectly match those of Primer Set II. Therefore, it can be said that PCR using total DNA derived from bacterial genomes as a template and Primer Set II can detect the nanA genes contained in multiple species of Streptococcus.

[0081] Here, for example, using the DNA sequence of the nanA gene of Streptococcus constellatus subsp. pharyngis C232 (SEQ ID NO: 37) as a reference, SEQ ID NO: 35 corresponds to positions 425 to 446 in SEQ ID NO: 37, and SEQ ID NO: 36 corresponds to positions 526 to 548 in SEQ ID NO: 37. That is, with the above-mentioned primer set II, a portion corresponding to 124 nucleotides from positions 425 to 548 in SEQ ID NO: 37 is amplified. In the present invention, the portion of the nanA gene corresponding to positions 425 to 548 (124 nucleotides) in SEQ ID NO: 37 may be referred to as "region Q." Furthermore, the portion of region Q corresponding to positions 447 to 525 (79 nucleotides, SEQ ID NO: 38) in SEQ ID NO: 37, excluding the primer portions of SEQ ID NOs: 35 and 36, may be referred to as "region QQ."

[0082] <Example 4> Quantitation of nanA gene in pancreatic cancer patients (1) Specific primers Primer set I (SEQ ID NOs: 7 and 8) and primer set II (SEQ ID NOs: 35 and 36) were prepared. In addition, the following universal primers were prepared that can amplify the V3-V4 region of the 16S ribosomal RNA gene of all bacteria. <For amplifying the 16S ribosomal RNA (V3-V4 region) gene of all bacteria> Forward primer: 5'-CGGTGAATACGTTCCCGG-3' (SEQ ID NO: 39) Reverse primer: 5'-TACGGCTACCTTGTTACGACTT-3' (SEQ ID NO: 40)

[0083] (2) Quantitative PCR Quantitative PCR was performed using the total fecal DNA from the patient group and healthy control group in Example 1(1) as a template, the quantitative PCR reagent "PowerTrack SYBR Green Master Mix" (Thermo Fisher Scientific) and primer set I or primer set II, and the DNA copy number of the nanA gene partial sequence (region P, region Q) was determined. The PCR reaction was held at 95°C for 2 minutes, followed by 40 cycles of 95°C for 10 seconds, 50°C (primer set I) or 60°C (primer set II) for 15 seconds, and 72°C for 20 seconds, followed by a final extension reaction at 72°C for 1 minute.

[0084] Similarly, quantitative PCR was performed to determine the DNA copy number of the 16S ribosomal RNA gene (V3-V4 region) using the primers of SEQ ID NOs: 39 and 40. The PCR reaction was held at 95°C for 2 minutes, followed by 40 cycles of 95°C for 10 seconds, 60°C for 15 seconds, and 72°C for 15 seconds, followed by a final extension reaction at 72°C for 1 minute.

[0085] Next, the "nanA gene DNA copy number" per 1 μL of template DNA solution was divided by the "16S rRNA gene DNA copy number" to calculate the "nanA level." The "nanA level" was calculated as the average for each group, and differences between groups were analyzed using the Mann-Whitney test with GraphPad Prism v.9.5.1, with P<0.05 considered significant (*). The results are shown in Figure 4.

[0086] As shown in Figure 4(a), when primer set I was used, the average nanA level was 0.191895 × 10 in the healthy control group. -2 , 0.269909 × 10 in the patient group -2The mean nanA gene level was 0.0031601 × 10 in the patient group and 0.0031601 × 10 in the healthy group. -2 , 0.1285 × 10 in the patient group -2 The level of nanA gene in the patient group was significantly higher (P<0.001) than in the healthy control group. In other words, the amount (abundance ratio) of the nanA gene was significantly increased in patients with pancreatic ductal carcinoma compared to healthy controls. These results demonstrate that the amount of nanA gene homologs, or the amount of bacteria that possess this gene in their genomic DNA, can be used as an indicator for determining the susceptibility to pancreatic cancer.

[0087] Example 5: Quantitation of Blautia wexcellellae in pancreatic cancer patients According to the results of the 16S rRNA metagenomic analysis in Example 1, the abundance ratio of Blautia wexlerae was lower in the patient group than in the healthy subject group. Therefore, it was decided to quantitatively analyze Blautia wexlerae by PCR.

[0088] (1) Specific primers The DNA sequences of the xanthine dehydrogenase (XDH) genes of nine different strains of Blautia wexcellellae and Blautia luti were aligned, and based on this, the following primers were designed to specifically amplify the XDH gene of Blautia wexcellellae. <Primers for amplifying the XDH gene of Blautia wexcellae> Forward primer: 5'-GGACACAGATTTACTGGATGGCAGG-3' (SEQ ID NO: 41) Reverse primer: 5'-ACTGAACAGCACCTGCTTTTCCATAA-3' (SEQ ID NO: 42)

[0089] (2) Quantitative PCR Quantitative PCR was performed using total fecal DNA from the patient group and healthy control group in Example 1(1) as a template, quantitative PCR was performed using the quantitative PCR reagent "PowerTrack SYBR Green Master Mix" (Thermo Fisher Scientific) and primers of SEQ ID NOs: 41 and 42 to determine the DNA copy number of the XDH gene of Blautia wexcellellae. The PCR reaction was held at 95°C for 2 minutes, followed by 40 cycles of 95°C for 10 seconds, 55°C for 15 seconds, and 72°C for 15 seconds, followed by a final extension reaction at 72°C for 1 minute.

[0090] Similarly, quantitative PCR was performed using the primers of SEQ ID NOs: 39 and 40 to determine the DNA copy number of the 16S ribosomal RNA gene (V3-V4 region). The PCR reaction was carried out as described in Example 4(2).

[0091] Since the DNA copy number of the 16S rRNA gene reflects the total bacterial population, and the DNA copy number of the XDH gene of Blautia wexcellerae reflects the number of Blautia wexcellerae bacteria, we calculated the "XDH gene DNA copy number" per 1 μL of template DNA solution divided by the "16S rRNA gene DNA copy number," and used this value as the "Blautia wexcellerae level." The "Blautia wexcellerae level" was calculated as the average for each group, and differences between groups were analyzed using the Mann-Whitney test in GraphPad Prism v.9.5.1. P < 0.05 was considered significant (*). The results are shown in Figure 5.

[0092] As shown in Figure 5, the mean Blautia wexerellae level was 0.520086 × 10 -2 , 0.3608 × 10 in the patient group -2The percentage of Blautia wexsellellae in the patient group was significantly lower than that in the healthy control group (P = 0.0367). In other words, the proportion of Blautia wexsellellae in patients with pancreatic ductal carcinoma was significantly reduced compared to healthy control subjects. These results demonstrate that the amount of Blautia wexsellellae, or the amount of the XDH gene carried by Blautia wexsellellae, can be used as an indicator for determining the susceptibility to pancreatic cancer.

Claims

1. A method for detecting pancreatic cancer, comprising detecting the amount of a bacterial N-acetylneuraminic acid lyase gene in a sample from a subject.

2. A method for testing for pancreatic cancer, comprising detecting the amount of bacteria carrying the N-acetylneuraminic acid lyase gene in the genomic DNA in a sample from a subject.

3. The method for detecting N-acetylneuraminic acid lyase according to claim 1 or 2, wherein the N-acetylneuraminic acid lyase gene is a gene comprising the following DNA sequence (a) or (b): (A) a DNA sequence having a sequence identity of 66.7% or more with SEQ ID NO: 9; (i) A DNA sequence having a sequence identity of 70% or more with SEQ ID NO:

38.

4. The testing method according to claim 2 , wherein the bacteria consist of two or more species, and the amount of the bacteria is positively correlated with the likelihood of developing pancreatic cancer.

5. The testing method according to claim 1 or 2, further comprising detecting the amount of Blautia wexellellae in a sample from a subject.

6. A diagnostic marker for pancreatic cancer, comprising a bacterial N-acetylneuraminic acid lyase gene.

7. A diagnostic marker for pancreatic cancer, comprising a bacterium having an N-acetylneuraminic acid lyase gene in its genomic DNA.

8. A pancreatic cancer testing kit comprising a PCR primer set capable of amplifying a bacterial N-acetylneuraminic acid lyase gene.

9. A pancreatic cancer test kit comprising a PCR primer set capable of detecting bacteria that have the N-acetylneuraminic acid lyase gene in their genomic DNA.

10. A method for screening for a prophylactic or ameliorating agent for pancreatic cancer, comprising detecting the amount of a bacterial N-acetylneuraminic acid lyase gene in a sample.

11. A method for screening for a prophylactic or ameliorating agent for pancreatic cancer, comprising detecting the amount of bacteria in a sample that carry an N-acetylneuraminic acid lyase gene in their genomic DNA.

Images