Lettuce lsiqd16 genes and uses thereof
The LsIQD16 gene is used to enhance lettuce production by increasing leaf area and biomass in transgenic lines, addressing market demand and supply issues.
Patent Information
- Application Number
- JP2025126336
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-01
- Filing Date
- 2025-07-29
- Publication Date
- 2026-02-16
- Estimated Expiration
- 2045-07-29
AI Technical Summary
The demand for lettuce in the Chinese market has increased, leading to low production and insufficient supply, necessitating the identification of important genes to improve lettuce cultivation.
The LsIQD16 gene from a wild-type lettuce plant is amplified and overexpressed in transgenic lettuce lines using specific primers, resulting in increased leaf area and biomass.
Transgenic LsIQD16 lettuce overexpression lines show a 16% increase in fresh weight, 18% increase in dry weight, and 34% increase in leaf area, addressing the production deficiencies.
Smart Images

Figure 2026025981000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to biotechnology, and specifically to the lettuce LsIQD16 gene and its uses. [Background technology]
[0002] The disclosure of information in this background section is intended to enhance understanding of the overall background of the present invention and does not necessarily constitute an admission or in any way imply that the information constitutes prior art known to those skilled in the art.
[0003] Lettuce (Lactuca sativa L.) is one of the world's most important leafy vegetables. Currently, China's lettuce cultivation area and production volume are 607.98 hectares, respectively, ranking first in the world and accounting for 50% of the world's total. It is grown in cool environments and uses very little or no pesticides, making it a pollution-free vegetable and popular with a wide range of consumers. Lettuce is rich in a variety of vitamins, including folic acid, vitamin C, and vitamin E, dietary minerals such as iron, and bioactive compounds such as carotenoids and phenolic compounds, making it highly nutritious. Furthermore, lettuce has high medicinal health value, and its antioxidant compounds have cardioprotective, anti-inflammatory, anti-cancer, anti-diabetic, and antioxidant effects.
[0004] In recent years, the demand for lettuce in the Chinese market has increased dramatically, and the cultivation area has expanded, resulting in significant problems such as low lettuce production and insufficient supply in the market. Therefore, it is important to search for important genes to improve lettuce production. Summary of the Invention
[0005] In response to the deficiencies of the prior art, the primary object of the present invention is to provide the lettuce LsIQD16 gene. A second object of the present invention is to provide uses of the above-mentioned lettuce LsIQD16 gene.
[0006] In order to achieve the above object, the present invention employs the following technical means.
[0007] The lettuce LsIQD16 gene, whose CDS sequence is shown in SEQ ID NO: 1.
[0008] Furthermore, the LsIQD16 gene is obtained by extracting it from a wild-type lettuce plant and amplifying it.
[0009] Furthermore, the amplification primers for the LsIQD16 gene are LsIQD16-F-1: ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT (SEQ ID NO: 2) LsIQD16-R-1: CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC (SEQ ID NO: 3)
[0010] Use of the lettuce LsIQD16 gene in improving lettuce leaf area and biomass.
[0011] The beneficial effects of the present invention are as follows: The transgenic LsIQD16 lettuce overexpression lines significantly improved leaf area and biomass. The average fresh weight increased from 120.7 g / head to 140 g / head, a 16% increase. The dry weight increased by approximately 18%. The leaf area increased by approximately 250 cm. 2 / 337-339cm from the ball 2 / ball, an increase of approximately 34%. [Brief explanation of the drawings]
[0012] The accompanying drawings, which form a part hereof, are used to provide a further understanding of the present invention, and the illustrative embodiments of the present invention and the description thereof are intended to be illustrative of the present invention and are not intended to unduly limit the present invention.
[0013] [Figure 1] FIG. 1 shows LsIQD16 amplified fragments. [Figure 2]FIG. 1 shows the results of screening some of the overexpression strains. [Figure 3] FIG. 1 shows the results of significant difference analysis of LsIQD16 overexpression strains. [Figure 4] Phenotype diagrams of the wild-type and LsIQD16-overexpressing strains after 45 days of growth: Figure 4a shows the wild-type after 45 days of growth, Figure 4b shows the overexpressing strain OE1 after 45 days of growth, and Figure 4c shows the overexpressing strain OE4 after 45 days of growth. [Figure 5] Fig. 10 shows leaf phenotypes of the wild-type and LsIQD16-overexpressing lines after 45 days of growth. [Figure 6] Figure 6 shows the results of measuring the leaf area, plant fresh weight, and dry weight of the wild-type and LsIQD16 overexpression lines. Figure 6a is a statistical graph of the leaf area of the wild-type and LsIQD16 overexpression lines, Figure 6b is a statistical graph of the plant fresh weight of the wild-type and LsIQD16 overexpression lines, and Figure 6c is a statistical graph of the plant dry weight of the wild-type and LsIQD16 overexpression lines. DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention will be further described below with reference to specific examples. Note that these examples are for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. In the following examples, experimental methods for which specific conditions are not specified are generally performed in accordance with the conditions suggested by the manufacturer.
[0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art. Any reagents or raw materials used in the present invention can be commercially obtained using conventional methods, and unless otherwise specified, any reagents or raw materials used in the present invention are used according to conventional methods in the art or in accordance with the product instructions. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred methods and materials described in the present invention are merely illustrative. The present invention will now be described with reference to the accompanying drawings.
[0016] Example 1: Construction of vectors and construction of transgenic plants
[0017] (1) The LsIQD16 gene was cloned, and 15-20 bp homologous recombination fragments were introduced into the 5' and 3' ends of the LsIQD16 gene. The full-length CDS sequence of the gene was obtained by PCR amplification using wild-type lettuce "Luca sativa" (L46) cDNA as a template and the KOD-plus-Neo high-fidelity enzyme. The primer sequences used for gene amplification are as follows: LsIQD16-F-1:ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT LsIQD16-R-1:CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC
[0018] PCR reaction system [Table 1]
[0019] PCR reaction process: Pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds; annealing at 55°C for 30 seconds; extension at 68°C for 1 minute; 40 cycles; extension at 68°C for another 7 minutes
[0020] The CDS sequence of the LsIQD16 gene is shown in SEQ ID NO:1.
[0021] FIG. 1 is a diagram of the amplified fragment of LsIQD16.
[0022] (2) The LsIQD16 gene expression fragment obtained in step (1) was cloned into the pEZR(K)-LC expression vector by homologous recombination to obtain a recombinant vector.
[0023] In the method of cloning the LsIQD16 gene expression fragment into the pEZR(K)-LC expression vector, the pEZR(K)-LC expression vector was double-digested with HindIII and BamHI restriction enzymes to form sticky ends, and the expression vector was obtained. Then, the CDS of LsIQD16 was ligated to this expression vector using the Single Fragment Rapid Cloning Kit (C112-02) manufactured by Novozymes to obtain the overexpression vector LsIQD16-pEZR(K)-LC, that is, the recombinant vector.
[0024] The ligation system is as follows.
Table 2
[0025] Process: React at 37 °C for 30 min, cool to 4 °C, or immediately place on ice to cool.
[0026] (3) The recombinant vector obtained in step (2) was introduced into Escherichia coli, and after extracting the plasmid, it was transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens.
[0027] (4) Seeds of wild-type lettuce with loose-leaf lettuce "Lettuce Green Elegance (L46)" as the background were disinfected with alcohol and sodium hypochlorite, then placed in MS medium to germinate. After two cotyledons opened, the cotyledons were cut on a super clean bench and immersed in the bacterial solution of the recombinant Agrobacterium tumefaciens obtained in step (3). A genetic transformation experiment was carried out by the leaf disk method. Finally, it was differentiated into seedlings by dedifferentiation, the seedlings were transplanted into soil, and after flowering and fruiting, the seeds of mature genetically modified lettuce were collected and further propagated to screen for positive pure-line plants.
[0028] The specific steps are as follows. (1) Disinfection of lettuce seeds Filled lettuce seeds were first soaked in 70% ethanol for 1 min, then soaked in 20% sodium hypochlorite for 15 min, and washed three times with sterile water. The treated seeds were then inoculated onto the surface of MS solid medium and cultured at 25°C under a 16-h photoperiod until two cotyledons had developed. Preparation of MS solid medium: 4.43 g / L M519 (Phytotech), 30 g / L sucrose (Sigma), 3.0 g / L plant gel (Sigma), (2) Cotyledon infection The cotyledons of lettuce seedlings were removed with sterile scissors and placed in a 1 / 2 MS suspension of activated recombinant Agrobacterium for approximately 15 minutes of infection. The infected cotyledons were then removed and the excess bacterial solution was absorbed with sterile absorbent paper to dry them. The leaves were then placed on co-cultivation medium MS1 and cultured at 25°C in the dark for 48 hours. Preparation of MS1 solid medium: Add 0.5 mg / L 6-BA and 0.1 mg / L NAA to MS medium. (3) Cotyledon differentiation The infected cotyledons were transferred to differentiation medium MS2 and subcultured at 25°C under a 16-h photoperiod until kanamycin-resistant differentiated seedlings were obtained. Preparation of MS2 solid medium: Supplement MS medium with 200 mg / L Timentin, 0.5 mg / L 6-BA, 0.1 mg / L NAA, and 50 mg / L Kana antibiotic. (4) Rooting The shoots were excised and transferred to rooting medium MS4, thus obtaining kanamycin-resistant plants, which, after the root system had developed, were transferred to soil. Preparation of MS4 solid medium: Add 200 mg / L of timentin and 0.05 mg / L of NAA to MS medium. (5) The lettuce seedlings obtained in step (4) were PCR-identified to screen for positive transgenic plants, and the lettuce seedlings of independent transformation events were obtained and then propagated again. Specifically, the total leaf DNA was used as a template, and the 35S primer in the vector and the reverse primer of the LsIQD16 gene itself were used to screen for positive transgenic plants, and eight positive plants were obtained.
[0029] As a result of the identification, the primers were: 35S-F:ATTGCCCAGCTATCTGTCACTT LsIQD16-R:TGCTGAGTTTCTGCATCTTG
[0030] Screening PCR reaction system (Beijing Aide Lai Biotechnology Co., Ltd. 2x Taq PCR MasterMix) [Table 3]
[0031] Screening PCR reaction process Pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min, 31 cycles, and extension at 72°C for 5 min again. The expression level of LsIQD16 in the plant body was measured using qRT-PCR for the obtained positive lines, and two lines with relatively high expression levels were selected and named 35S:LsIQD16-1 (OE1) and 35S:LsIQD16-4 (OE4) based on their expression levels. They were propagated to the T2 generation and used in subsequent experiments.
[0032] Figure 2 shows the results of screening several overexpression lines. As can be seen from the results, the PCR identification results of the eight obtained seedlings were all positive.
[0033] 3 shows the results of significant difference analysis of LsIQD16 overexpression strains. As can be seen from the results, the expression levels of the two recombinant strains OE1 and OE4 are relatively high, 37X and 28X, respectively.
[0034] Measurement of biomass amount Wild-type and LsIQD16-overexpressing lettuce seeds were placed on moist filter paper for 3–4 days to allow rooting and then placed in 7 × 7 cm seedling pots. Approximately 20 days later, 25 WT, 25 OE1, and 25 OE4 plants were inoculated into larger 26 × 26 cm pots. After 45 days of growth, 20 plants with the best growth trends were selected and measured for leaf area and biomass. Leaf area was measured from the fourth fully expanded leaf. Fresh weight was determined by weighing all selected aboveground parts, placing the aboveground parts in a 45°C oven, and thoroughly drying them after one week. Dry weight was then measured. Figure 4 shows the phenotypes of the wild-type and LsIQD16 overexpression lines after 45 days of growth. Figure 4a shows the phenotype of the wild-type (WT) line after 45 days of growth. Figure 4b shows the phenotype of the overexpression line OE1 after 45 days of growth. Figure 4c shows the phenotype of the overexpression line OE4 after 45 days of growth. Figure 5 shows the leaf phenotypes of the wild-type and LsIQD16 overexpression lines after 45 days of growth. Figure 6 shows the leaf area, fresh weight, and dry weight measurements of the wild-type and LsIQD16 overexpression lines. Figure 6a shows the leaf area statistics of the wild-type and LsIQD16 overexpression lines. Figure 6b shows the fresh weight statistics of the wild-type and LsIQD16 overexpression lines. Figure 6c shows the dry weight statistics of the wild-type and LsIQD16 overexpression lines. As can be seen from the results, the LsIQD16 overexpressing lettuce lines showed improved leaf area and biomass, with the average fresh weight increasing from 120.7g / head to 140g / head, a 16% increase, and the corresponding dry weight increasing by approximately 18%. The leaf area increased to 250cm / head. 2 / 337-339cm from the ball 2 / ball, an increase of approximately 34%.
[0035] The above are only preferred embodiments of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art may still modify the technical solutions described in the above embodiments or make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
[0036] SEQ ID NO:1: SEQ ID NO:2: acgctcgagctcaagcttatgggaaagaaaggaagtggtt SEQ ID NO:3: cgcggccccggtggatcctcacctaagccaccttcttaaatc
Claims
1. The lettuce LsIQD16 gene, characterized in that the CDS sequence is shown in SEQ ID NO:
1.
2. The lettuce LsIQD16 gene according to claim 1, characterized in that the LsIQD16 gene is obtained by extracting it from a wild-type lettuce plant and amplifying it.
3. The amplification primers for the LsIQD16 gene are: LsIQD16-F-1: ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT LsIQD16-R-1: CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC The lettuce LsIQD16 gene according to claim 2, characterized in that it is
4. The use of the lettuce LsIQD16 gene according to claim 1, characterized in that the lettuce LsIQD16 gene is overexpressed to improve the leaf area and biomass of lettuce.
Citation Information
Patent Citations
Lettuce plants comprising resistance to lettuce aphid (nasonovia ribisnigri) biotype 1
JP2017532056A