Micro-dystrophin gene therapy constructs and uses thereof
Microdystrophin gene therapy vectors using recombinant AAVs address the limitations of full-length dystrophin gene therapy by optimizing expression and reducing immunogenicity, effectively improving muscle function and cardioprotection in dystrophinopathies.
Patent Information
- Application Number
- JP2025175606
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-05-14
- Filing Date
- 2025-10-17
- Publication Date
- 2026-02-18
AI Technical Summary
Current treatments for dystrophinopathies, such as Duchenne and Becker muscular dystrophy, are limited by the large size of the dystrophin gene and the immune response to therapeutic proteins, leading to inefficiencies and safety concerns in gene therapy.
Development of microdystrophin gene therapy vectors, using recombinant AAV vectors, that express a truncated form of dystrophin with optimized nucleotide sequences and promoters to enhance expression and reduce immunogenicity, targeting muscle and CNS cells to improve muscle function and cardioprotection.
The microdystrophin vectors demonstrate improved efficacy and safety by enhancing muscle strength, reducing organ and muscle weights, and slowing the progression of dystrophinopathy symptoms.
Smart Images

Figure 2026027271000001_ABST
Abstract
Description
[Technical Field]
[0001] Sequence Listing This application contains a Sequence Listing which has been submitted electronically in ASCII format and is incorporated by reference in its entirety. This ASCII copy was created on November 25, 2020. The file name is 38013_0009P1_Sequence_Listing.txt and its size is 249,417 bytes.
[0002] The present invention relates to a novel microdystrophin and a method for producing the novel microdystrophin. Gene therapy vectors, such as recombinant AAV vectors, and compositions and uses thereof, It also relates to a method of treatment using the same. [Background technology]
[0003] A group of neuromuscular diseases called dystrophinopathies is caused by mutations in the DMD gene. Each dystrophinopathy has a distinct phenotype, and all patients experience muscle They suffer from muscle weakness and eventually develop cardiomyopathy of varying severity. Diabetes Mellitus (DMD) is a severe, X-linked, progressive neuromuscular disorder that affects 3,600 live-born males. Affecting approximately 1 in 9,200 people, this disorder is caused by an altered expression of the dystrophin protein. caused by a frameshift mutation in the dystrophin gene that disables The lack of dystrophin protein leads to damage to skeletal muscles, and ultimately to cardiac and respiratory muscles (e.g., Degeneration of muscles (e.g., intercostal muscles and diaphragm) leads to early death. Progressive muscle weakness and atrophy It begins in childhood. Affected individuals experience breathing difficulties, respiratory infections, and swallowing problems. All patients with DMD develop cardiomyopathy. Pneumonia complicated by cardiac involvement is the most common cause of death. The onset of the disease is often within 30 years.
[0004] Becker muscular dystrophy (BMD) is a milder form of the disease than DMD, but still develops early. Compared to DMD, BMD is characterized by delayed onset of skeletal muscle loss. People with BMD become wheelchair dependent by age 13, whereas people with BMD become unable to walk after age 16. Patients with BMD also have poor neck flexor strength, unlike those with DMD. Although skeletal muscle involvement is mild, dilated cardiomyopathy (DCM) associated with DMD is also observed. Heart failure, which is a common cause of mortality in BMD, is the most common cause of death, occurring on average in the 40s. It occurs midway.
[0005] Dystrophin is a cytoplasmic protein encoded by the DMD gene and is involved in the function of cells Its function is to connect skeletal actin filaments and membrane proteins. Usually, dystrophin The protein is mainly found in skeletal and cardiac muscles, and is expressed in small amounts in the brain, but is also involved in the activation of the contractile apparatus. It acts as a shock absorber during muscle fiber contraction by connecting cutin to the connective tissue layer that surrounds each muscle fiber. In muscle, dystrophin is localized to the cytoplasmic face of the sarcolemma. There are.
[0006] The DMD gene is the largest known human gene. The most common mutation causing this is a large deletion of one or more exons (60-70%). However, duplication mutations (5–10%) and single nucleotide variants (small deletions or Pathogenic variants in males with DMD, including insertions, single-base changes, and splice site alterations Approximately 25-35% of women with BMD and approximately 10-20% of men with BMD) also have pathogenic dysplasia. In DMD, the mutation results in a frameshift. often resulting in premature termination codons or short, non-functional or unstable proteins. Nonsense point mutations can also produce the same result by prematurely introducing a stop codon. Mutations that cause DMD can affect any exon, but Exons 2-20 and 45-55 are hotspots where large deletions and duplications frequently occur. In-frame deletions cause patients to express a truncated, partially functional dystrophin. This leads to a less severe form of Becker muscular dystrophy (BMD).
[0007] Full-length dystrophin is a large (427 kDa) protein, and several functions contribute to its function. These subdomains include those that extend from the amino terminus to the carboxy terminus. Towards the end, they contain an N-terminal actin-binding domain, a central so-called "rod" domain, It contains a domain, a cysteine-rich domain, and finally a carboxy-terminal domain or region. The rod domains are composed of the following order: the first hinge domain (H1), three spectral It contains 16 or more structural repeats (R1, R2, R3), a second hinge domain (H2), and Trin-like repeats (R4, R5, R6, R7, R8, R9, R10, R11, R12, R 13, R14, R15, R16, R17, R18, R19), the third hinge domain (H 3), 5 or more spectrin-like repeats (R20, R21, R22, R23, R24), and the fourth hinge domain (H4) (containing the WW domain), which contains four proline residues. The 24 spectrin-like repeats (abbreviated as R) are located in the hinge domain (abbreviated as H). The rod domain is followed by a cysteine-rich domain and a COOH(C)-terminal There is a terminal (CT) domain.
[0008] Adeno-associated virus (AAV)-mediated gene therapy has the potential to treat a variety of rare diseases. As the use of therapeutics advances, AAV is being used to treat DMD, BMD, and less severe dystrophinopathies. There is interest and expectation that AAV vectors can be used to treat cancer. Since there is a limit to the size of the gene, it is necessary to , a small dystrophin with nonessential subdomains removed, called micro- or mini-dystrophin. Attention is focused on creating dystrophin. AAV-mediated mini-dystrophin gene therapy in mice demonstrates efficient expression in muscle and It has been reported that this treatment improves muscle function (e.g., Wang et al., JO (See rthop. Res.27:421(2009)).
[0009] Therefore, in the art, there are transduced cells for subjects with DMD or BMD. The therapeutic protein is expressed at an effective level in the host, preferably to maximize the immune response to the therapeutic protein. AAV vectors encoding micro- or mini-dystrophins can be used to minimize A target is needed. Summary of the Invention
[0010] A novel gene encoding a microdystrophin protein for use in gene therapy The invention is based in part on the constructs described herein. The construct and expression cassette are transfected via viral vectors in muscle cells and / or CNS cells. When expressed by a drug, the drug exhibits improved efficacy, potency and safety in a subject. Based on in vivo treatment models, the miniaturized version of this disclosure was designed to be a therapeutic approach. Dystrophin gene therapy improves measures of grip strength, maximal strength, and specific strength and / or showed a reduction in organ and muscle weights. Therefore, improved gene therapy vectors, e.g. For example, these constructs for gene therapy expression of microdystrophin protein recombinant AAV vectors, such as recombinant AAV8 or AAV9 vectors containing the Methods for using these gene therapy vectors in therapeutic methods and methods for the treatment of cancer, as described herein Methods for producing these gene therapy vectors are provided.
[0011] N-terminal actin-binding domain and subdomains of hinge, rod, and spectrin domains followed by the cysteine-rich domain and, optionally, the C-terminal domain. Microdystrophin proteins, including all or a portion thereof, e.g., the helix 1-containing portion. Proteins and nucleic acid constructs encoding the same are provided. In this study, microdystrophin is a protein that contains all or part of the C-terminal domain or its α1 - C-terminal domain with syntrophin and / or α-dystrobrevin binding moieties or having an α1-syntrophin and / or α-dystrobrevin binding portion thereof Micro-dystrophin has improved cardioprotective activity and / or reduced myocardial It may result in improved function or reduce / delay its progression.
[0012] Exemplary microdystrophin-encoding constructs are shown in Figures 1A and 22. The embodiments described herein include, from amino terminus to carboxy terminus:
[0013] ABD-H1-R1-R2-R3-H3-R24-H4-CR,
[0014] ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT
[0015] ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT, or
[0016] Microdisc with ABD-H1-R1-R2-R16-R17-R24-H4-CR is a strophin protein,
[0017] where ABD is the actin-binding domain of dystrophin and H1 is the dystrophin-binding domain. R1 is the hinge 1 region of dystrophin, R2 is the spectrin 1 region of dystrophin, and R3 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R3 is the spectrin 2 region of dystrophin. H3 is the hinge 3 region of dystrophin, and R16 is the dystrophin R16 is the spectrin 16 region of dystrophin, and R17 is the spectrin 17 region of dystrophin. R24 is the spectrin 24 region of dystrophin, and CR is the dystrophin The cysteine-rich region of the fin or at least the portion that binds to β-dystroglycan CT is at least a portion of the C-terminal region of dystrophin, , containing an α1-syntrophin binding site and / or an α-dystrobrevin binding site. In certain embodiments, the CT domain is selected from the group consisting of amino acids 35, 70, or 83. In certain embodiments, the H3 domain has the entire sequence of SEQ ID NO: 11. The CR domain may be a full-length CR domain or a truncated CR domain, particularly a β-distreptin. In certain embodiments, the CCR domain may be a truncated CCR domain that binds to a cognate glycan. The R domain has the amino acid sequence of SEQ ID NO: 15 or 90. In certain embodiments, In the present invention, an endogenous linker sequence connects the domains, e.g., endogenous human dystrophin All or a 3-amino acid portion of the linker between R23 and R24 of the protein is Alternatively, in some embodiments, H3 links the disulfide and R24 domains. It can be substituted with the hinge 2 region (H2) of trophin.
[0018] The microdystrophins provided herein are capable of binding to (1) actin, β-dystrophy glycoproteins, and Kan, α1-syntrophin, α-dystrobrevin, and nNOS (α1-syntrophin nNOS, which binds indirectly via ATP, is one of the following: (2) binding to or all of the above; (3) binding to or all of the above in animal models (e.g., the md x mouse models) or human subjects to promote improvement in muscle function or muscle and / or (3) slowing the progression of functional decline in animal models or human patients. It has cardioprotective properties, or improves myocardial function or alleviates cardiac dysfunction. Dystrophin functions, such as promoting or slowing the progression of cardiac decline (See Figure 13.)
[0019] In certain embodiments, the microdystrophin is selected from the group consisting of SEQ ID NOs: 1, 2, 79, 91, It has a sequence of 92 or 93 amino acids.
[0020] Provided herein are transgenes or gene cassettes for use in gene therapy. In an embodiment, the nucleic acid encoding the micro-dystrophin comprises a micro-dystrophin fragment. Dystrophin is a nucleic acid sequence of SEQ ID NO: 20, 21, 81, 101, 102, or 103. The nucleotide sequence or amino acid sequence of SEQ ID NO: 1, 2, 79, 91, 92, or 93 The construct may be encoded by any nucleotide sequence encoding the sequence. 1A and 22. In certain embodiments, the construct comprises a In some embodiments, the 5' end of the microdystrophin coding sequence contains an intron. In certain embodiments, the intron is less than 100 nucleotides in length. The construct contains the human immunoglobulin heavy chain variable region (VH) 4 (VH4) intron. The intron is located 5' to the microdystrophin coding sequence. The presence of the VH4 intron results in increased cellular expression compared to expression from nucleic acid constructs lacking the VH4 intron. This may result in improved microdystrophin expression in the alveoli.
[0021] The transgenes provided herein can be used to express muscle cells (skeletal, cardiac, and / or smooth muscle). and / or CNS cells. Contains a promoter that drives expression. Gene therapy, such as recombinant AAV vector therapy Reducing the size of the transgene used in recombinant AAV vectors The present invention provides methods for improving the efficacy and efficiency of muscle-specific promoters. The transgene may be a promoter, a CNS-specific promoter, or both. In certain embodiments, the promoter is a muscle-specific promoter less than 350 kb in length. In some embodiments, the promoter is the SPc5-12 promoter. (SEQ ID NO: 39). Provided herein is a transgene, the promoter of which is The motor induces the expression of microdystrophin, which is more fully described herein. A truncated SPc5-12 promoter (SEQ ID NO: 4) that is shorter than the SPc5-12 promoter In certain embodiments, the promoter is a CNS It is a specific promoter.
[0022] The microdystrophin coding sequence is codon-optimized for increased expression. Genes or gene cassettes are also provided. Additionally or alternatively, microdystrophy The gene coding sequence and / or transgene sequence may be CpG-free to reduce immunogenicity. In some embodiments, the micro-dystrophin transgene may be removed. Fewer than two (2) CpG islands or one (1) CpG island (especially (as defined herein), and in certain embodiments, have CpG islands. Transgenes with less than 2, 1, or 0 CpG islands do not affect anti-drug antibody titers. Thus, when measured, microdystrophin conjugates with more than two CpG islands Compared to the construct, immunogenicity was reduced.
[0023] Provided herein are exemplary gene cassettes or sequences encoding transgenes. Nucleotide sequence of sequence numbers 53, 54, 55, 56, 82, 104, 105, or 106 It is a nucleic acid containing a sequence.
[0024] The recombinant vectors for delivering the transgenes described herein are non-replicating recombinant vectors. Adeno-associated viral vectors (rAAV) are available in AAV8 or AAV9 serotypes. or to muscle cells, including both skeletal and cardiac muscle, and / or CNS cells. The vector may be any other serotype suitable for delivery of the dystrophin coding sequence. expressing dystrophin and / or delivering it to muscle cells to provide additional benefits to patients do.
[0025] Also provided herein are microdispersions, each containing a pharmaceutically acceptable excipient. Pharmaceutical compositions comprising recombinant vectors encoding lophin, and subjects in need thereof and administering to an elephant any dystrophic disease by administering the gene therapy vectors described herein. Muscular dystrophy, e.g., Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy trophy (BMD), X-linked dilated cardiomyopathy, and female carriers of DMD or BMD Also provided are methods of treating a disease comprising administering a transgene or gene cassette as described herein. By administering rAAV containing micro-dystrophin, , and / or smooth muscles) and / or require it to be delivered to the CNS administering to a subject a dystrophinopathy, such as Duchenne muscular dystrophy, DMD (Dilated Myocardial Infarction), Becker Muscular Dystrophy (BMD), X-linked Dilated Cardiomyopathy Methods for treating, ameliorating, or managing the symptoms thereof are provided. In certain embodiments, rA AV is administered systemically.
[0026] Also provided are methods for producing viral vectors, particularly AAV-based viral vectors, and Host cells producing the vectors are also provided. In certain embodiments, recombinant AAV 1. A method for producing an AAV IT vector comprising culturing a host cell, the host cell comprising: an artificial genome comprising a cis expression cassette flanked by R, is operably linked to an expression control element that controls expression of the transgene in human cells. an artificial genome, AA, containing a transgene encoding a therapeutic micro-dystrophin; V. A trans expression cassette lacking ITRs, which is capable of expressing AAVr in host cells in culture. Drives expression of ep and capsid proteins, and rep and cap proteins in trans AAV rep and capsid proteins operably linked to expression control elements that provide An artificial genome encoding a protein, a trans-expression cassette, and an AAV capsid protein The adenovirus contains sufficient adenovirus helper functions to allow replication and packaging of the virus. and culturing the cells, and producing recombinant AAVs containing the artificial genome in capsids from the cell culture. and recovering the same.
[0027] The present invention demonstrates the construction, production, and efficacy of micro-dystrophin vectors. This is illustrated by the examples set out below for in vitro and in vivo assays.
[0028] Illustrative Embodiments 1. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein. Therefore, the microdystrophin protein consists of the following structures from the amino to carboxy terminus: ABD -Dystrophy arranged in H1-R1-R2-R3-H3-R24-H4-CR-CT and comprising or consisting of the dystrophin domain, wherein the ABD is the dystrophin ABD. H1 is the dystrophin-binding domain, H2 is the hinge 1 region of dystrophin, and R3 is the dystrophin-binding domain. R1 is the spectrin 1 domain of strophin, and R2 is the spectrin 2 domain of dystrophin. R3 is the spectrin 3 region of dystrophin, and H3 is the dystrophin R24 is the spectrin 24 region of dystrophin; H 4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin. CT is the C-terminal region of dystrophin or its β-dystroglycan-binding portion. C containing the terminal region or the α1-syntrophin or dystrobrevin binding site A nucleic acid composition that is part of a terminal region.
[0029] 2. (1) A microdystrophin protein having the amino acid sequence of SEQ ID NO: 1 or 91 a nucleic acid sequence encoding a protein, or at least 90%, 95% or is a nucleic acid sequence that is 98% identical to, or a therapeutically functional microdystrophin protein or (2) SEQ ID NO: 20 or 100. or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or its reverse complement, and the nucleic acid sequence comprises or consists of: 10. The nucleic acid of embodiment 1, encoding a therapeutically functional micro-dystrophin protein. Acid composition.
[0030] 3. (1) A microdystrophin protein having the amino acid sequence of SEQ ID NO: 79 a nucleic acid sequence encoding, or at least 90%, 95%, or 98% identical thereto or a nucleic acid sequence encoding a therapeutically functional micro-dystrophin protein. or (2) the nucleic acid sequence of SEQ ID NO: 81, or the reverse complement thereof. a nucleic acid sequence that is at least 90%, 95% or 98% identical to any of the above, or The nucleic acid comprises or consists of the reverse complement of the nucleic acid, and the nucleic acid is a therapeutically functional microorganism. 2. The nucleic acid composition of embodiment 1, encoding a lophin protein.
[0031] 4. Linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein A nucleic acid composition comprising a nucleic acid sequence containing an intron (I), Proteins are arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H 3-R24-H4-CR dystrophin domain or wherein ABD is the actin-binding domain of dystrophin and H1 is R1 is the hinge 1 region of dystrophin, and R2 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R3 is the dystrophin H3 is the spectrin 3 region, H4 is the hinge 3 region of dystrophin, and R24 is Spectrin 24 domain of dystrophin, H4 is the hinge 4 domain of dystrophin and CR is a cysteine-rich region of dystrophin.
[0032] 5. (1) A microdystrophin protein having the amino acid sequence of SEQ ID NO: 2 is cloned. or a nucleic acid sequence at least 90%, 95% or 98% identical thereto. (2) a nucleic acid comprising a nucleic acid sequence, or a reverse complement thereof, of SEQ ID NO: 21 sequence, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or their reverse complements, and the nucleic acid is therapeutically functional. 5. The nucleic acid composition of embodiment 4, encoding a suitable dystrophin.
[0033] 6. Linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein The nucleic acid composition according to any one of embodiments 1 to 3, further comprising an intron (I).
[0034] 7. Human immunoglobulin I, located 5' to the microdystrophin coding sequence Heavy chain variable region (VH) 4 intron (VH4) or SV40 intron or chimeric 7. The nucleic acid composition according to any one of embodiments 4 to 6, wherein the nucleic acid composition is a transintron.
[0035] 8. The nucleic acid sequence encoding the VH4 intron is the nucleic acid sequence of SEQ ID NO: 41, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or and a reference nucleic acid comprising or consisting of the reverse complement of the VH4 intron sequence. Compared with the nuclei encoding chimeric introns, which increase microdystrophin expression, The nucleic acid sequence is at least 90%, 95% identical to the nucleic acid sequence of SEQ ID NO: 75, or or 98% identical to the nucleic acid sequence, or their reverse complements. and enhances microdystrophin expression compared to a reference nucleic acid lacking the chimeric intron sequence. Alternatively, the nucleic acid sequence encoding the SV40 intron is a nucleic acid sequence, or a nucleic acid sequence at least 90%, 95%, or 98% identical thereto or their reverse complements, and 8. The method of claim 7, wherein the method increases microdystrophin expression relative to a reference nucleus lacking the sequence. The nucleic acid composition described above.
[0036] 9. The nucleic acid sequence encoding the CT domain is the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence at least 90%, 95% or 98% identical to, or A reference microdisk containing or consisting of a reverse complement and lacking the CT domain sequence. Compared to dystrophin, α1-syntrophin, β-syntrophin, and microdystrophin or CT domains that increase binding to dystrobrevin and / or dystrobrevin The nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 70, or at least 90%, 95% or a nucleic acid sequence that is 98% identical to, or a reverse complement thereof, Compared to the reference microdystrophin, which consists of The trophins α1-syntrophin, β-syntrophin, and / or dystrophy or the nucleic acid sequence encoding the minimal CT domain has the sequence Nucleic acid sequence number 80, or at least 90%, 95%, or 98% identical thereto or their reverse complements, and lacking the CT domain sequence. Compared with dystrophin, microdystrophin binds to α1-syntrophin. The nucleic acid composition according to any one of embodiments 1 to 3 or 6 to 8, wherein the nucleic acid composition increases
[0037] 10. The CT domain has the amino acid sequence of SEQ ID NO: 16 or 83, or 10. The nucleic acid composition of embodiment 9, comprising the amino acid sequence of SEQ ID NO: 84.
[0038] 11. The nucleic acid sequence encoding the CR domain is the nucleic acid sequence of SEQ ID NO: 34 or 69; or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or their reverse complements, and lacking a CR domain sequence. Compared with the control microdystrophin, the activity of microdystrophin in β-dystroglycan and the nucleic acid sequence encoding the CR domain is SEQ ID NO: 100 or 10 9, or at least 90%, 95%, or 98% identical thereto. A nucleic acid sequence comprising or consisting of a nucleic acid sequence, or its reverse complement, and having a CR domain. Compared with the reference microdystrophin lacking the β-dystrophin sequence, 10. The nucleic acid composition of any preceding embodiment, wherein the nucleic acid composition increases binding to troglycan.
[0039] 12. Embodiment 1, wherein the CR domain has the amino acid sequence of SEQ ID NO: 15 or 90. 1. A nucleic acid composition according to claim 1.
[0040] 13. The nucleic acid sequence encoding ABD is SEQ ID NO: 22 or 57, or SEQ ID NO: 2 At least 75%, at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 98% or at least 99% identity and the nucleic acid sequence encoding H1 comprises a sequence having the sequence of SEQ ID NO: 24 or 59, or is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 9 9% identity, and the nucleic acid sequence encoding R1 is SEQ ID NO: 26 or 61, or at least 75%, at least 80% of SEQ ID NO: 26 or 61 , at least 85%, at least 90%, at least 95%, at least 98% or The nucleic acid sequence encoding R2 is SEQ ID NO: SEQ ID NO: 27 or 62, or at least 75% of SEQ ID NO: 27 or 62 at least 80%, at least 85%, at least 90%, at least 95%, at least 9 A nucleic acid sequence encoding R3, which comprises a sequence having 8% or at least 99% identity to the nucleic acid sequence The sequence is SEQ ID NO: 29 or 64, or at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, A sequence having at least 98% or at least 99% identity with H2. The nucleic acid sequence to be downloaded is SEQ ID NO: 38, or is at least 50% similar to SEQ ID NO: 38. at least 60%, at least 70%, at least 75%, at least 80%, at least 8 5%, at least 90%, at least 95%, at least 98% or at least 99 % identity, and the nucleic acid sequence encoding H3 is SEQ ID NO: 30 or 65, or at least 75%, at least 80% relative to SEQ ID NO: 30 or 65; At least 85%, at least 90%, at least 95%, at least 98% or less a nucleic acid sequence encoding R24 having at least 99% identity to a sequence of SEQ ID NO: SEQ ID NO: 32 or 67, or at least 75% of SEQ ID NO: 32 or 67 at least 80%, at least 85%, at least 90%, at least 95%, at least 9 A nucleic acid sequence encoding H4 having a sequence identity of 8% or at least 99% The sequence is SEQ ID NO: 33 or 68, or at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, It consists of a sequence having at least 98% or at least 99% identity and encodes CR. The nucleic acid sequence to be downloaded is SEQ ID NO: 34, 69, 100 or 109, or SEQ ID NO: 34, At least 75%, at least 80%, at least for 69, 100 or 109 85%, at least 90%, at least 95%, at least 98% or at least 9 9% identity to the sequence, and if present, the nucleic acid sequence encoding CT is No. 35, 70 or 80, or at least SEQ ID NO: 35, 70 or 80 At least 75%, at least 80%, at least 85%, at least 90%, at least 95% , consisting of sequences with at least 98% or at least 99% identity, and optionally The nucleic acid sequence I is linked to the 5' end of the nucleic acid sequence encoding microdystrophin. the nucleic acid sequence of SEQ ID NO: 41, or a sequence at least 75% at least 80%, at least 85%, at least 90%, at least 95%, at least 9 8% or at least 99% identity. The nucleic acid composition according to any one of the preceding claims.
[0041] 14. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, and encodes H1. the nucleic acid sequence encoding R1 consists of SEQ ID NO: 24 or 59, 26 or 61, and the nucleic acid sequence encoding R2 is SEQ ID NO: 27 or 62 the nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, the nucleic acid sequence encoding H3 consists of SEQ ID NO: 38, and the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 65, the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, 24 consists of SEQ ID NO: 32 or 67, and the nucleic acid encoding CR The sequence consists of SEQ ID NO: 34, 69, 100 or 109, and I consists of SEQ ID NO: 41. and / or the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80. , the nucleic acid composition of any one of the preceding embodiments.
[0042] 15. Microdystrophin protein, from amino terminus to carboxy terminus: AB D-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-C T or ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24- comprising or consisting of dystrophin sequences located in H4-CR, and L1, L2, L3, and L4 are linkers. The nucleic acid composition described above.
[0043] 16. The nucleic acid sequence encoding L1 comprises SEQ ID NO: 23 or 58, or L2 comprises or consists of SEQ ID NO: 25 or 60, and L3 comprises or consists of SEQ ID NO: 25 or 60. L4 comprises or consists of SEQ ID NO: 31, 36, Any of the preceding embodiments including or consisting of 37, 66, 71 or 72. 1. A nucleic acid composition according to any one of claims 1 to 10.
[0044] 17. A nucleic acid composition comprising a nucleic acid sequence encoding a microdystrophin protein. The microdystrophin protein has the following structure from amino to carboxy terminus: AB Dystrophy located in D-H1-R1-R2-R16-R17-R24-H4-CR and comprising or consisting of the dystrophin domain, wherein the ABD is the dystrophin ABD. H1 is the dystrophin-binding domain, H2 is the hinge 1 region of dystrophin, and R3 is the dystrophin-binding domain. R1 is the spectrin 1 domain of strophin, and R2 is the spectrin 2 domain of dystrophin. R16 is the spectrin 16 region of dystrophin, and R17 is the dystrophin R24 is the spectrin 17 region of dystrophin, and R25 is the spectrin 24 region of dystrophin. region, H4 is the hinge 4 region of dystrophin, and CR is the A nucleic acid composition that is a cysteine-rich region.
[0045] 18. (1) Microdystrophin protein having the amino acid sequence of SEQ ID NO: 93 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or (2) a nucleic acid sequence having the sequence SEQ ID NO: 103, or the reverse complement thereof; or a nucleic acid sequence at least 90%, 95% or 98% identical thereto The nucleic acid may comprise or consist of a nucleic acid sequence, or its reverse complement, 18. The nucleic acid composition of embodiment 17, encoding a functional micro-dystrophin.
[0046] 19. The C-terminal end of the CR domain contains an α1-syntrophin binding site and / or disulfide. The present invention further comprises a nucleotide sequence encoding a CT domain containing a thrombrevin binding site. 19. The nucleic acid composition of embodiment 17 or 18.
[0047] 20. (1) Microdystrophin protein having the amino acid sequence of SEQ ID NO: 92 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, or (2) a nucleic acid sequence having the sequence set forth in SEQ ID NO: 102 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto The nucleic acid may comprise or consist of a nucleic acid sequence, or its reverse complement, 20. The nucleic acid of any one of embodiments 19, encoding a functional micro-dystrophin. Acid composition.
[0048] 21. The nucleic acid sequence encoding the CT domain is the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence that is at least 90%, 95% or 98% identical to a reference microdisk comprising or consisting of the reverse complement of a reference microdisk lacking a CT domain sequence; Compared to dystrophins, microdystrophin, α1-syntrophin, and β-syntrophin or enhances binding to dystrobrevin and / or dystrobrevin, or encodes a CT domain. The nucleic acid sequence is at least 90%, 95%, or more identical to the nucleic acid sequence of SEQ ID NO: 70. 100% or 98% identical to or containing a nucleic acid sequence, or their reverse complements. Compared with the reference microdystrophin, which consists of the CT domain sequence, Strophin α1-syntrophin, β-syntrophin, and / or dystrophy Alternatively, a nucleic acid sequence encoding a minimal CT domain may be used in the sequence. 80, or at least 90%, 95%, or 98% identical thereto a reference nucleic acid sequence consisting of a nucleic acid sequence identical to that of the reference nucleic acid sequence, or its reverse complement, lacking the CT domain sequence. Binding of microdystrophin to α1-syntrophin compared with clodystrophin 21. The nucleic acid composition of embodiment 19 or 20, wherein the nucleic acid composition increases
[0049] 22. The nucleic acid sequence encoding ABD is SEQ ID NO: 22 or 57, or SEQ ID NO: 2 At least 75%, at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 98% or at least 99% identity and the nucleic acid sequence encoding H1 comprises a sequence having the sequence of SEQ ID NO: 24 or 59, or is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 9 9% identity, and the nucleic acid sequence encoding R1 is SEQ ID NO: 26 or 61, or at least 75%, at least 80% of SEQ ID NO: 26 or 61 , at least 85%, at least 90%, at least 95%, at least 98% or The nucleic acid sequence encoding R2 is SEQ ID NO: SEQ ID NO: 27 or 62, or at least 75% of SEQ ID NO: 27 or 62 at least 80%, at least 85%, at least 90%, at least 95%, at least 9 A nucleic acid encoding R16, comprising a sequence having 8% or at least 99% identity The sequence is SEQ ID NO: 94 or 98, or at least At least 75%, at least 80%, at least 85%, at least 90%, at least 95% , R17, R20, R30, R40, R50, R60, R70, R80, R90, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31, R32, R The nucleic acid sequence encoding the At least 75%, at least 80%, at least 85%, at least 90%, from sequences with at least 95%, at least 98% or at least 99% identity and the nucleic acid sequence encoding R24 is SEQ ID NO: 32 or 67, or SEQ ID NO: 32 Or at least 75%, at least 80%, at least 85%, or less than 67 90%, at least 95%, at least 98%, or at least 99% identity wherein the nucleic acid sequence encoding H4 is SEQ ID NO: 33 or 68, or At least 75%, at least 80%, at least 8% of SEQ ID NO: 33 or 68 5%, at least 90%, at least 95%, at least 98% or at least 99 % identity, and the nucleic acid sequence encoding CR is SEQ ID NO: 34, 69, 100 or 109, or at least 75% relative to SEQ ID NO: 34 or 69, at least 80%, at least 85%, at least 90%, at least 95%, at least A nucleic acid encoding CT, which comprises a sequence having 98% or at least 99% identity to the nucleic acid. The sequence is SEQ ID NO: 35, 70 or 80, or a sequence corresponding to SEQ ID NO: 35, 70 or 80. At least 75%, at least 80%, at least 85%, at least 90%, at least sequences having at least 95%, at least 98%, or at least 99% identity 22. Any of embodiments 17 to 21, wherein the micro-dystrophin gene encodes a functionally active micro-dystrophin. The nucleic acid composition described above.
[0050] 23. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, and encodes H1. the nucleic acid sequence encoding R1 consists of SEQ ID NO: 24 or 59, 26 or 61, and the nucleic acid sequence encoding R2 is SEQ ID NO: 27 or 62 the nucleic acid sequence encoding R16 consists of SEQ ID NO: 94 or 98, and R17 consists of the nucleic acid sequence encoding H4 consists of SEQ ID NO: 95 or 99, R24 consists of SEQ ID NO: 32 or 67, CR The nucleic acid sequence encoding the compound consists of SEQ ID NO: 34, 69, 100 or 109, wherein the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80. 23. The nucleic acid composition according to any one of 17 to 22.
[0051] 24. A nucleic acid sequence encoding a microdystrophin protein, The nucleic acid composition according to any one of embodiments 17 to 23, further comprising an intron (I).
[0052] 25.I is a human immunoglobulin located 5' to the microdystrophin coding sequence Viral heavy chain variable region (VH) 4 intron (VH4) or SV40 intron or chimera 25. The nucleic acid composition of any of embodiments 24, wherein the nucleic acid composition is an intron.
[0053] 26. The nucleic acid sequence encoding the VH4 intron is the nucleic acid sequence of SEQ ID NO: 41, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or a reference nucleic acid comprising or consisting of the reverse complement of these sequences and lacking the VH4 intron sequence; increase microdystrophin expression compared to or encode a chimeric intron The nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 75, or at least 90%, 95% or a nucleic acid sequence that is 98% identical to, or a reverse complement thereof, and (b) determining whether or not a chimeric intron sequence is present in a nucleic acid sequence that is capable of expressing microdystrophin, as compared to a reference nucleic acid lacking the chimeric intron sequence. or the nucleic acid sequence encoding the SV40 intron is SEQ ID NO: 76 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto a chimeric introductory sequence comprising or consisting of a nucleic acid sequence, or its reverse complement,
[0023] Embodiment 2, wherein the nucleic acid sequence of embodiment 2 increases micro-dystrophin expression relative to a reference nucleic acid lacking the dystrophin sequence. 6. The nucleic acid composition according to claim 5.
[0054] 27. Microdystrophin protein, from amino to carboxy terminus: AB D-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R2 4-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R16- The dystrophin sequence is located at L4.1-R17-L4.2-R24-H4-CR wherein L1, L2, L3, L4.1 and L4.2 are , a linker.
[0055] 28. The nucleic acid sequence encoding L1 comprises SEQ ID NO: 23 or 58, or wherein the nucleic acid sequence encoding L2 comprises or is SEQ ID NO: 25 or 60. and wherein the nucleic acid sequence encoding L3 comprises SEQ ID NO: 28 or 63, or and wherein the nucleic acid sequence encoding L4.1 comprises SEQ ID NO: 107 or 125. or consisting thereof, wherein the nucleic acid sequence encoding L4.2 is SEQ ID NO: 108 or 12 28. The nucleic acid composition of embodiment 27, comprising or consisting of:
[0056] 29. The nucleic acid is operable to a nucleic acid sequence encoding a micro-dystrophin protein. Linked transcriptional regulatory elements that promote expression in muscle and / or CNS tissues 10. The nucleic acid composition of any one of the preceding embodiments, wherein the nucleic acid composition is a nucleic acid vector comprising
[0057] 30. The transcriptional regulatory element comprises a muscle-specific promoter, optionally a promoter for skeletal muscle, smooth muscle, or the like. 30. The nucleic acid composition of embodiment 29, comprising a muscle- and / or cardiac muscle-specific promoter.
[0058] 31. Embodiment 29, wherein the promoter is SPc5-12 or a transcriptionally active portion thereof. Or the nucleic acid composition described in 30.
[0059] 32. The method of embodiment 31, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39 or 40. The nucleic acid composition described.
[0060] 33. The method of embodiment 29, wherein the transcriptional regulatory element comprises a CNS-specific promoter. Nucleic acid composition of.
[0061] 34. The promoter is a CB7 promoter, a cytomegalovirus (CMV) promoter, or promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 promoter lufa promoter (SEQ ID NO: 118), UB6 promoter, chicken beta-actin promoter, CAG promoter (SEQ ID NO: 116), RPE65 promoter, Propagation promoter, TBG (thyroxine-binding globulin) promoter, APOA2 promoter promoter, SERPINA1 (hAAT) promoter, MIR122 promoter, or an inducible promoter, such as a hypoxia-inducible or rapamycin-inducible promoter 30. The nucleic acid composition of embodiment 29, wherein
[0062] 35. Muscle-specific transcriptional regulatory elements are found in the CK1 promoter, CK4 promoter, and C K5 promoter, CK6 promoter, CK7 promoter, CK8 promoter (sequence Sequence number 115), MCK promoter (or its truncated form) (SEQ ID NO: 121), Desmi promoter (SEQ ID NO: 119), MHCK7 promoter (SEQ ID NO: 120), en h358MCK promoter, dMCK promoter, or tMCK promoter 31. The nucleic acid composition of embodiment 29 or 30, which is one of:
[0063] 36. The nucleotide sequence is a nucleotide sequence encoding microdystrophin. 10. The nucleic acid composition of any preceding embodiment, comprising a 3' polyadenylation signal.
[0064] 37. An embodiment in which the polyadenylation signal has the nucleotide sequence of SEQ ID NO: 42. 37. The nucleic acid composition according to embodiment 36.
[0065] 38. A nucleic acid comprising, from 5' to 3', (i) an AAV ITR - transcriptional regulatory element - N-terminus; to the C-terminus as ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT Nucleic acid sequence encoding the micro-dystrophin domain - polyadenylation sequence -AAV ITR; (ii) AAV ITR-transcriptional regulatory element-N-terminal to C-terminal Microphones located at ABD-H1-R1-R2-R3-H3-R24-H4-CR nucleic acid sequence encoding the dystrophin domain - polyadenylation sequence - AAV ITR; (iii) AAV ITR-transcriptional regulatory element, from N-terminus to C-terminus, ABD-H1-R Microdisc arranged in 1-R2-R16-R17-R24-H4-CR-CT a nucleic acid sequence encoding a lophin domain-polyadenylation sequence-AAV ITR; or (iv) AAV ITR-transcriptional regulatory element, ABD-H1-R1 from N-terminus to C-terminus -Microdystrophin arranged in R2-R16-R17-R24-H4-CR AAV vector containing a nucleic acid sequence encoding the domain, a polyadenylation sequence, and an AAV ITR. and the AAV ITRs optionally contain AAV2 ITRs. 3. The nucleic acid composition of any one of the preceding embodiments, wherein
[0066] 39. The nucleotide sequence is codon-optimized and / or CpG sequence-removed. 10. The nucleic acid composition of any one of the preceding embodiments.
[0067] 40. Having less than two or one CpG island or 10. The nucleic acid composition of any preceding embodiment, wherein the nucleic acid composition does not have a nucleotide sequence.
[0068] 41. When administered to human subjects, has a CpG titer greater than 0 as measured by anti-drug antibody titers. Reduced immunogenicity compared to island-containing micro-dystrophin constructs 41. The nucleic acid composition of embodiment 40, wherein:
[0069] 42. Nucleic acid of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106 10. The nucleic acid composition of any one of the preceding embodiments, comprising the sequence
[0070] 43. AAV vector nucleotide sequence containing AAV ITRs at the 5' and 3' ends of the nucleic acid sequence. and the AAV ITRs are optionally AAV2 ITRs. 2. The nucleic acid composition of any one of the aspects.
[0071] 44. The 5' ITR comprises or consists of the nucleotide sequence of SEQ ID NO:73. and the 3' ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 74. 44. The nucleic acid composition of embodiment 43.
[0072] 45. An expression cassette comprising the nucleic acid composition of any one of the preceding embodiments, AAV particles.
[0073] 46. AAV type 1 (AAV1), type 2 (AAV2), type 3 (AAV3), Type 4 (AAV4), type 5 (AAV5), type 6 (AAV6), type 7 (AA V7), type 8 (AAV8), type rh8 (AAVrh8), type 9 (AAV9) , Type PHP.B (AAVPHP.B), Type hu37 (AAV.hu37), Thailand Type hu31 (AAV.hu31), type hu32 (AAV.hu32), type rh1 0 (AAVrh10), type rh20 (AAVrh20), type rh39 (AAVr h39), and at least one AA selected from type rh74 (AAVrh74) 46. The rAAV particle of embodiment 45, having a capsid protein derived from a V type.
[0074] 47. The capsid protein is less than SEQ ID NO: 77 (AAV8 capsid). or having an amino acid sequence that is 95% identical to the amino acid sequence of SEQ ID NO: 77. 47. The rAAV particle of embodiment 45 or 46,
[0075] 48. The capsid protein is less than SEQ ID NO: 78 (AAV9 capsid). or having an amino acid sequence that is 95% identical to the amino acid sequence of SEQ ID NO: 78. 47. The rAAV particle of embodiment 45 or 46,
[0076] 49. A therapeutically effective amount of the rAAV particles of any one of embodiments 45-48; and a pharmaceutically acceptable carrier.
[0077] 50. A method for delivering a transgene to a cell, comprising: and contacting the cells with the rAAV particles described in any one of the above. How to do it.
[0078] 51. Treating a dystrophinopathy in a human subject in need thereof 50. A pharmaceutical composition for treating a patient suffering from atopic dermatitis, comprising a therapeutically effective amount of the compound according to any one of embodiments 45 to 49. and optionally, the rAAV particles are circulating in the subject. A pharmaceutical composition formulated for administration to the brain, muscle tissue, or CNS.
[0079] 52. Treating a dystrophinopathy in a human subject in need thereof The method comprises: A medicament comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45 to 49. The composition is administered to the subject, thereby producing micro-dystrophin in the muscle of the subject. A method for forming a protein-releasing depot.
[0080] 53. A human subject in need thereof to prevent the transmission of a dystrophinopathy to offspring. A method for carrying out the method comprising the steps of: A medicament comprising a therapeutically effective amount of the rAAV particles of any one of embodiments 45 to 49. The composition is administered to the subject, whereby the nucleic acid encoding micro-dystrophin is The method of claim 1, wherein the gene is integrated into the germ cells of the subject.
[0081] 54. The dystrophinopathy is DMD, BMD, X-linked dilated cardiomyopathy, or or the subject is a female DMD or BMD carrier, as described in embodiments 51 to 53. A pharmaceutical composition or method of
[0082] 55. The composition comprises a compound selected from the group consisting of a compound having a hydroxybenzoate and a compound having a hydroxybenzoate. 55. The pharmaceutical composition or method according to embodiments 51 to 54, wherein the composition is administered intravenously.
[0083] 56. The second drug is an antisense inhibitor that induces exon skipping of the DMD gene. Oligonucleotides, anti-myostatin antibodies, and ribosomal readthrough of nonsense mutations drugs that promote premature termination, drugs that suppress premature termination, anabolic steroids and corticosteroids 56. The pharmaceutical composition or method of embodiment 55, wherein the compound is selected from the group consisting of steroids.
[0084] 57. The administration improves the patient's grip strength, increases maximum muscle strength and specific muscle strength, and / or The pharmaceutical composition according to any one of embodiments 51 to 56, wherein the composition reduces organ and muscle weight. A thing or method.
[0085] 58. Administration of rAAV particles improves or maintains cardiac function or reduces cardiac dysfunction. 58. The pharmaceutical composition or method of any one of embodiments 51 to 57, wherein the
[0086] 59. Administration of rAAV particles increases muscle mass or strength, or maintain muscle mass or strength or reduce the likelihood of muscle mass or strength loss, 59. The pharmaceutical composition or method according to any one of aspects 51 to 58.
[0087] 60. From amino terminus to carboxy terminus: ABD-H1-R1-R2-R3-H3-R2 containing or containing a dystrophin domain arranged in 4-H4-CR-CT where ABD is the actin-binding domain of dystrophin and H1 is the dystrophin-binding domain. R1 is the hinge 1 region of strophin, and R2 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R3 is the spectrin 3 region of dystrophin. pectin 3 region, H3 is the hinge 3 region of dystrophin, and R24 is the dystrophin spectrin 24 region of strophin, and CR is the cysteine-rich region of dystrophin. The CT region is the α1-syntrophin binding site, the β-syntrophin binding site, and / or at least a portion of the C-terminal region of dystrophin containing the dystrobrevin site. , the microdystrophin protein.
[0088] 61. A nucleic acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 1, 79, or 91. 61. The micro-dystrophin protein of embodiment 60,
[0089] 62. The CT domain is a truncated CT domain containing the α1-syntrophin binding site. 62. The micro-dystrophin protein of embodiment 60 or 61,
[0090] 63. The CT domain comprises the amino acid sequence of SEQ ID NO: 16 or 83, or or comprising the amino acid sequence of SEQ ID NO: 84. The micro-dystrophin protein according to any one of the above.
[0091] 64. The method of any one of embodiments 60 to 63, wherein the CR domain comprises a β-dystroglycan binding site. The micro-dystrophin protein according to any one of the above.
[0092] 65. The CR domain comprises the amino acid sequence of SEQ ID NO: 15 or 90, or The micro-dystrophin protein according to any one of embodiments 60 to 64, Plagiarism.
[0093] 66. ABD is SEQ ID NO: 3, or at least 80% of SEQ ID NO: 3, At least 85%, at least 90%, at least 95%, at least 96%, at least 97% , from amino acid sequences with at least 98%, or at least 99% sequence identity and H1 is SEQ ID NO: 5, or at least 80%, at least 80%, or 5%, at least 90%, at least 95%, at least 96%, at least 97%, Consists of amino acid sequences with at least 98% or at least 99% sequence identity , R1 is SEQ ID NO: 7, or at least 80%, at least 85% of SEQ ID NO: 7 , at least 90%, at least 95%, at least 96%, at least 97%, at least R consists of amino acid sequences that share 98% or at least 99% sequence identity with R 2 is SEQ ID NO: 8, or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity of the amino acid sequence, and H3 , SEQ ID NO: 11, or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 96%, at least 97%, at least R24 consists of an amino acid sequence having 98% or at least 99% sequence identity is SEQ ID NO: 13, or at least 80%, at least 85% relative to SEQ ID NO: 13, At least 90%, at least 95%, at least 96%, at least 97%, at least and H4 has an amino acid sequence that has 98% or at least 99% sequence identity with H4. is SEQ ID NO: 14, or at least 80%, at least 85% relative to SEQ ID NO: 14, At least 90%, at least 95%, at least 96%, at least 97%, at least CR is SEQ ID NO: 15 or 90, or at least 8 relative to SEQ ID NO: 15 or 90 0%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity CT is SEQ ID NO: 16 or 83, or SEQ ID NO: 16 or At least 80%, at least 85%, at least 90%, at least 95% of 83 %, at least 96%, at least 97%, at least 98%, or at least 99 67. The method according to any one of embodiments 60 to 66, wherein the amino acid sequence has at least one amino acid sequence having at least one amino acid sequence identity of at least one amino acid sequence ... Micro-dystrophin protein.
[0094] 67. ABD consists of SEQ ID NO: 3, H1 consists of SEQ ID NO: 5, or R1 consists of SEQ ID NO: 7, R2 consists of SEQ ID NO: 8, R3 consists of SEQ ID NO: 10, or H3 consists of SEQ ID NO: R24 consists of SEQ ID NO: 13, or H4 consists of SEQ ID NO: 14 or CR consists of SEQ ID NO: 15 or 90, or CT consists of SEQ ID NO: 16 or 8 67. The microdystrophin protein according to any one of embodiments 60 to 66, comprising: Quality.
[0095] 68. Amino to carboxy terminus: ABD-L1-H1-L2-R1-R2-L The dystrophin domain is arranged as 3-R3-H3-L4-R24-H4-CR-CT. 60 to 62, wherein L1, L2, L3, and L4 are linkers. 67. The microdystrophin protein of any one of claims 67 to 67.
[0096] 69. The amino acid sequences of L1, L2, L3, and L4 are SEQ ID NOs: 4, 6, 9, and 69, respectively. and 12. The micro-dystrophin protein of embodiment 68, consisting of
[0097] 70. From amino terminus to carboxy terminus, ABD-H1-R1-R2-R16-R17- comprising or consisting of a dystrophin domain arranged in R24-H4-CR where ABD is the actin-binding domain of dystrophin and H1 is the dystrophin-binding domain. R1 is the hinge 1 region of dystrophin, and R2 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R16 is the spectrin 2 region of dystrophin. R16 is the spectrin 16 region of dystrophin, and R17 is the spectrin 17 region of dystrophin. R24 is the spectrin 24 region of dystrophin, and CR is the dystrophin synthase. stain-rich region, microdystrophin protein.
[0098] 71. The method according to embodiment 70, comprising or consisting of the amino acid sequence of SEQ ID NO: 93. 1. The microdystrophin protein described herein.
[0099] 72. From amino terminus to carboxy terminus, ABD-H1-R1-R2-R16-R17- containing or containing a dystrophin domain arranged in R24-H4-CR-CT wherein CT is an α1-syntrophin binding site or a dystrobrevin binding site. 71. The method of claim 70, wherein the C-terminal region of dystrophin comprises at least a portion of the C-terminal region of dystrophin containing the binding site. microdystrophin protein.
[0100] 73. The CT domain comprises the amino acid sequence of SEQ ID NO: 16 or 83, or 73. The method of claim 72, wherein the antibody comprises the amino acid sequence of SEQ ID NO: 84. Microdystrophin protein.
[0101] 74. The method of embodiment 72 or 73, comprising or consisting of the amino acid sequence of SEQ ID NO: 92. 73 describes a microdystrophin protein.
[0102] 75. The antibody of any one of embodiments 70 to 74, wherein the H4 domain comprises a β-dystroglycan binding site. The micro-dystrophin protein according to any one of the above.
[0103] 76. ABD is SEQ ID NO: 3, or at least 80% of SEQ ID NO: 3, At least 85%, at least 90%, at least 95%, at least 96%, at least 97% , from amino acid sequences with at least 98%, or at least 99% sequence identity and H1 is SEQ ID NO: 5, or at least 80%, at least 80%, or 5%, at least 90%, at least 95%, at least 96%, at least 97%, Consists of amino acid sequences with at least 98% or at least 99% sequence identity , R1 is SEQ ID NO: 7, or at least 80%, at least 85% of SEQ ID NO: 7 , at least 90%, at least 95%, at least 96%, at least 97%, at least R consists of amino acid sequences that share 98% or at least 99% sequence identity with R 2 is SEQ ID NO: 8, or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 96%, at least 97%, at least R16 consists of an amino acid sequence having 98% or at least 99% sequence identity is SEQ ID NO: 86, or at least 80%, at least 85% relative to SEQ ID NO: 86, At least 90%, at least 95%, at least 96%, at least 97%, at least R1 has an amino acid sequence with at least 98% or at least 99% sequence identity. 7 is SEQ ID NO: 87, or at least 80%, at least 85% of SEQ ID NO: 87 , at least 90%, at least 95%, at least 96%, at least 97%, at least R consists of amino acid sequences that share 98% or at least 99% sequence identity with R 24 is at least 80%, at least 85%, or the same as SEQ ID NO: 13, or SEQ ID NO: 13 %, at least 90%, at least 95%, at least 96%, at least 97%, at least consisting of amino acid sequences with at least 98% or at least 99% sequence identity, H4 is SEQ ID NO: 14, or at least 80%, at least 85%, or %, at least 90%, at least 95%, at least 96%, at least 97%, at least consisting of amino acid sequences with at least 98% or at least 99% sequence identity, CR is SEQ ID NO: 15 or 90, or at least At least 80%, at least 85%, at least 90%, at least 95%, at least 96% , at least 97%, at least 98%, or at least 99% sequence identity 76. The microdystrophy of any one of embodiments 70 to 75, which comprises an amino acid sequence Fin protein.
[0104] 77. The CR domain comprises or consists of a CT domain at the C-terminus thereof, wherein CT is SEQ ID NO: 16 or 83, or at least 80% of SEQ ID NO: 16 or 83 , at least 85%, at least 90%, at least 95%, at least 96%, less amino acids that share 97%, at least 98%, or at least 99% sequence identity with each other The microdystrophin protein according to any one of embodiments 70 to 76, comprising a nucleic acid sequence Quality.
[0105] 78. ABD consists of SEQ ID NO: 3, H1 consists of SEQ ID NO: 5, or R1 consists of SEQ ID NO: 7, R2 consists of SEQ ID NO: 8, R16 consists of SEQ ID NO: 86, or R17 consists of SEQ ID NO: 87, R24 consists of SEQ ID NO: 13, or H4 consists of SEQ ID NO: 14 or CR consists of SEQ ID NO: 15 or 90, and / or CT consists of SEQ ID NO: 16 or 83, Protein.
[0106] 79. Any one of embodiments 70-78, wherein CT consists of SEQ ID NO: 16 or 83. The micro-dystrophin protein described in
[0107] 80. Amino to carboxy terminus: ABD-L1-H1-L2-R1-R2-L 3-R16-L4.1-R17-L4.2-R24-H4-CR-CT or ABD-L 1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H 4-CR, where L1, L2, L3, 81. The method of any one of embodiments 70 to 80, wherein L4.1 and L4.2 are linkers. Microdystrophin protein.
[0108] 81. The amino acid sequences of L1, L2, L3, L4.1 and L4.2 are respectively SEQ ID NO: 4 81. The microdystrophin protein of embodiment 80, consisting of: quality.
[0109] 82. Treating a dystrophinopathy in a human subject in need thereof a therapeutically effective amount of a compound selected from the group consisting ... A microdystrophin protein according to any one of embodiments 60 to 81 is delivered. A method, including reaching
[0110] 83. A pharmaceutical composition for the treatment of dystrophinopathy in a human subject, comprising: a therapeutic agent formulated for delivery to the circulation, muscle tissue, and / or cerebrospinal fluid of said human subject. a therapeutically effective amount of the microdystrophin protein of any one of embodiments 60 to 81. A pharmaceutical composition comprising a protein.
[0111] 84. The dystrophinopathy is DMD, BMD, or X-linked dilated cardiomyopathy. 84. The method or pharmaceutical composition according to embodiment 82 or 83.
[0112] 85. The CT domain is the α1-syntrophin binding site and the β-syntrophin binding site. and / or a dystrobrevin binding site. The method or pharmaceutical composition described.
[0113] 86. The CT domain is a truncated CT domain containing the α1-syntrophin binding site. 86. The method or pharmaceutical composition of embodiment 85, wherein
[0114] 87. Any of embodiments 82-86, wherein H4 comprises a β-dystroglycan binding site. 1. The method or pharmaceutical composition according to claim 1.
[0115] 88. A method for producing a recombinant AAV, comprising: (a) culturing a host cell, the host cell comprising: (i) an artificial genome comprising a cis expression cassette, the cis expression cassette being in the form An artificial genome comprising the nucleic acid composition according to any one of aspects 38 to 44. (ii) a trans expression cassette lacking AAV ITRs, which is delivered to host cells in culture; It drives expression of AAV rep and capsid proteins in trans. AAV rep and ap proteins operably linked to expression control elements that provide the protein. a trans expression cassette encoding the ribonucleotide and capsid proteins; (iii) Replication and packaging of the artificial genome by AAV capsid proteins. Sufficient adenovirus helper function to enable and culturing the compound comprising: (b) recovering the recombinant AAV encapsidated with the artificial genome from the cell culture; and A method comprising:
[0116] 89.a. An artificial genome comprising a cis expression cassette, the cis expression cassette being An artificial genome comprising the nucleic acid composition according to any one of embodiments 38 to 44. b. A trans expression cassette lacking AAV ITRs, which is expressed in host cells in culture drives expression of AAV rep and capsid proteins in trans AAV rep and ka operably linked to expression control elements that provide the protein a trans expression cassette encoding a psid protein, and c. AAV capsid proteins that allow replication and packaging of the artificial genome. Adenovirus helper function sufficient to A host cell comprising: [Brief explanation of the drawings]
[0117] [Figure 1A] The vector gene expression cassette and micro-dystrophin constructs used in Cis plasmids for gene therapy are shown. The DNA length of each component and the complete transgene for each construct is listed. SPc5-12: synthetic muscle-specific promoter; Mini-SPc: truncated synthetic muscle-specific promoter; CT1.5: truncated / minimal CT domain; VH4: human immunoglobulin heavy chain variable region intron; ABD: actin-binding domain; H: hinge; R: rod; CR: cysteine-rich domain; CT: C-terminal domain; smPA: small poly(A); ABD: actin-binding domain 1 (ABD1). [Figure 1B] Protein bands detected by Western blot (antibody to dystrophin (1c7)) are shown, along with the relative sizes of micro-dystrophin proteins expressed from plasmids RGX-DYS1, RGX-DYS3, and RGX-DYS5. [Figure 1C]Protein bands detected by Western blot (antibody to dystrophin (1c7)) are shown, along with the relative sizes of micro-dystrophin proteins expressed from plasmids RGX-DYS1, RGX-DYS3, and RGX-DYS5. [Figure 2] Fluorescence microscopy of differentiated C2C12 cells 3 days after infection with reporter AAV vectors AAV8-GFP (A-C) and AAV8-VH4-GFP (D-F) at various doses (indicated above the images: 5 x 10e5 vg / cell (A, D), 1 x 10e5 vg / cell (B, E), and 0.2 x 10e5 vg / cell (C, F)). Scale bar: 200 μM. vg: vector genome. [Figure 3] Shown is the mean fluorescence intensity (units) of transduced C2C12 cells measured 3 days after infection with AAV8-GFP and AAV8-VH4-GFP vectors at three different doses: 5x10e5vg / cell, 1x10e5vg / cell, and 0.2x10e5vg / cell. [Figure 4] Fluorescence microscopy of differentiated C2C12 cells 6 days after infection with AAV8-CAG-GFP is shown. Images A–C were taken daily using an EVOS™ microscope with the same magnification in the transmitted light and GFP channels. A: Microscope image set to the GFP channel; B: Brightfield (or phase contrast) image to observe cell confluence; C: Merged image of A and B to observe the number of infected cells (approximately 50%). [Figure 5] In vitro efficacy testing of micro-dystrophin vectors (RGX-DYS1-03, E-H) compared to a reference control (RGX-DYS-RS, A-D) by immunofluorescence staining of dystrophin protein. Three replicates were performed for each dose (indicated above each image): 1e12 vg / ml (A, E), 4e11 vg / ml (B, F), 1.6e11 vg / ml (C, G), and 6.4e10 vg / ml (D, H). [Figure 6]As an indicator of vector efficacy, the infectivity data for each vector in the mouse muscle cell line C2C12 cells are shown. Normalized data (vector copy number / reference control) are shown for each vector batch: RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3-02, RGX-DYS4-01, and RGX-DYS1-RS. An internal control vector based on the initial batch of DYS1 (RGX-DYS1-RS) was used as the reference standard (1.0). [Figure 7] As an indicator of mRNA expression, microdystrophin data are shown in the mouse muscle cell line C2C12 cells for different production batches of each vector (RGX-DYS1-01, RGX-DYS1-02, RGX-DYS2-01, RGX-DYS3-01, RGX-DYS3-02, RGX-DYS4-01, and RGX-DYS1-RS) using the same process. Two different vector doses were used to infect C2C12 cells (1e5 vg / cell and 5e4 vg / cell). The mRNA expression level for each batch was calculated as the fold change (delta CT) in qPCR between the primer / probe for microdystrophin and the endogenous control mouse GAPDH for the same cDNA sample. The graph shows the fold increase, with RGX-DYS1-RS as the 100% reference standard and set at 1. [Figure 8] Weekly changes in body weight (g) are shown. Data are presented as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. [Figure 9A] Mouse muscle and organ weight measurements are shown (normalized to body weight, g / kg). Quadriceps and soleus muscle weights are shown. Data are presented as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. ***P≦0.001 (one-way ANOVA); ###P≦0.001 (t-test). [Figure 9B]Mouse muscle and organ weight measurements are shown (normalized to body weight, g / kg). Triceps and TA weights are shown. Data are shown as mean ± SEM. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. ***P≦0.001 (one-way ANOVA); ###P≦0.001 (t-test). [Figure 10] Grip strength measurements are shown (KGF / kg). *: One-way ANOVA (***P≦0.001); #: t-test (###p≦0.001). Grip strength of the forearm muscles was normalized to muscle weight for each mouse. n=12 for the mdx RGX-DYS1 group; n=13 for the mdx vehicle group; n=14 for the BL10 vehicle group. [Figure 11] In vitro muscle contractile force analysis at 6 weeks post-treatment revealed significant improvement in muscle strength in mdx mice treated with RGX-DYS1 compared to vehicle-treated mdx mice. Maximum force (mN) and specific muscle strength (kN / m2) are shown. ***: p<0.001 by one-way ANOVA. ###: p<0.001 by t-test. n=12 for mdx RGX-DYS1 group; n=13 for mdx vehicle group; n=14 for BL10 vehicle group. [Figure 12] Vector copy numbers (vg / diploid genome) in skeletal muscle, cardiac muscle, and liver by ddPCR are shown. Stilla Technologies' Naica Crystal Digital PCR system was used. n=13 for each treatment tissue. Numbers shown are mean ± Standard Dev. Vector copy numbers were calculated as 2× microdystrophin transgene copy number / endogenous control mouse glucagon copy number. Uninjected mdx liver samples (n=13) were used as negative control samples. TA: tibialis anterior; EDL: extensor digitorum longus. [Figure 13]Figure 1 shows an illustration of the sarcolemma showing the interaction of wild-type dystrophin or dystrobrevin and micro-dystrophins containing α1-syntrophin and β1-syntrophin binding sites, such as RGX-DYS1, with the dystrophin-associated protein complex (DAPC) and the actin cytoskeleton. RGX-DYS1, which contains dystrobrevin, α1-syntrophin, and β1-syntrophin binding sites, is thought to recruit nNOS to some extent and anchor it to the sarcolemma via α1-syntrophin. [Figure 14-1] Immunofluorescence staining of gastrocnemius muscle from the mdx RGX-DYS1 group, mdx control group, and WT control group is shown. Cryosections were stained with anti-α-dystrobrevin, anti-dystroglycan, anti-nNos, anti-dystrophin (anti-dys), and anti-α-syntrophin. Secondary antibodies were labeled with CY3, and all sections were counterstained with DAPI before mounting. [Figure 14-2] Continuation of Figure 14-1 [Figure 15] Western blots for dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-μ-dystrophin vector are shown. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin serves as a loading control for each lane. Mdx (lane 13) represents an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution of 1:10,000, and a secondary (anti-rabbit) antibody was used at a dilution of 1:20,000. [Figure 16A] Quantification of μ-dystrophin bands by Western blot is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 16B]AAV-μ-Dys vector copy number by ddPCR is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 16C] Quantitation of μ-dystrophin bands normalized by AAV-μ-Dys vector copy number is shown. *p<0.05; **P<0.01; ***P<0001. [Figure 17A] Figure 1 shows the mRNA expression of μ-dystrophin and wild-type (WT) dystrophin in skeletal muscle (gastrocnemius). Total RNA was extracted from skeletal muscle, and cDNA was synthesized. The mRNA copy numbers of μ-dystrophin, WT-dystrophin, and the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). Relative μ-dystrophin or WT-dystrophin mRNA expression was normalized to GAPDH. The ratio of WT-dystrophin to GAPDH in B6-WT skeletal muscle was considered to be 1. [Figure 17B] Relative μ-dystrophin or WT-dystrophin mRNA expression in single cells is shown. μ-dystrophin or WT-dystrophin mRNA expression copy number was normalized by GAPDH and genome copy number per cell. [Figure 18] Gastrocnemius muscles were excised from mdx mice, tissue sections were prepared, and immunofluorescence (IF) staining was performed for dystrophin and the dystrophin-associated protein complex, including dystrobrevin, β-dystroglycan, and syntrophin. Mice were treated as described: 16 (untreated wild-type mice); RGX-DYS1 (mouse ID3553 and mouse ID3588); RGX-DYS3 (mouse ID5 and mouse ID7); and RGX-DYS5 (mouse ID9 and mouse ID11). Objective: 40x magnification. [Figure 19A]Figure 1 shows syntrophin expression in skeletal muscle. Gastrocnemius muscles were excised from mdx mice, tissue sections were prepared, and immunofluorescence (IF) staining for syntrophin was performed. Mice were treated as described: 16 (untreated wild-type mice); RGX-DYS1 (mouse ID3553 and mouse ID3588); RGX-DYS3 (mouse ID5 and mouse ID7); and RGX-DYS5 (mouse ID9 and mouse ID11). Objective lens: 40x. [Figure 19B] Western blot for syntrophin from muscle tissue lysates is shown. [Figure 19C] Quantitation of Western blot bands is shown. *: p<0.05; ***: p<0.0001. [Figure 19D] Western blot for syntrophin from total muscle membrane protein is shown. [Figure 19E] Quantification of Western blot bands. [Figure 20A] 1 shows nNOS expression in skeletal muscle. Immunofluorescence staining for nNOS is shown. [Figure 20B] Western blot for nNOS is shown. [Figure 20C] Quantitation of Western blot bands is shown. [Figure 21-1] Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. (A-B) RNAScope images of mdx mice treated with RGX-DYS1 reveal co-expression of μ-dystrophin (red) and pax7 satellite cells (green). RNAscope multiplex fluorescence analysis of AAV transgene and Pax7 mRNA expression was performed by Advanced Cell Diagnostics Inc. (Newark, CA). [Figure 21-2] Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. C shows the percentage of satellite cells transduced with AAV-DMD. D shows the total satellite cell count in RNAscope images. [Figure 21-3]Transduction of satellite cells with an AAV vector encoding the μ-dystrophin gene and alleviation of cell regeneration. E shows Pax7 mRNA expression in skeletal muscle of different groups revealed by ddPCR. The primers and probe for μ-dystrophin were the same as those described above. The ratio of pax7 to GAPDH in B6-WT skeletal muscle was considered to be 1. **: p<0.01; ***: p<0.001; ****: p<0.0001 when compared with untreated mdx mice. [Figure 22] Illustrations of additional modified μ-dystrophin constructs are shown: Truncated CR: cysteine-rich domain 150 bp shorter than wild-type dystrophin; R16 / R17: dystrophin spectrin-like repeats 16 and 17. [Figure 23A] Figure 1 shows in vitro infection of C2C12 myotubes with different versions of the AAV8-μ-dystrophin construct. C2C12 myoblasts were induced with differentiation medium and then infected with AAV vectors. Cells were harvested 5 days postinfection for Western blot or mRNA expression. 1: negative control; 2: RGX-DYS8; 3: RGX-DYS7; 4: RGX-DYS6; 5: RGX-DYS3; 6: RGX-DYS5; 7: RGX-DYS1; 8: RGX-DYS1; 9: RGX-DYS1; 10: RGX-DYS1; 11: RGX-DYS1. Western blot analysis of μ-dystrophin expression from C2C12 cells. [Figure 23B] Quantitation of Western blot analysis is shown. [Figure 23C] 1 shows detection of μ-dystrophin mRNA expression by ddPCR. DETAILED DESCRIPTION OF THE INVENTION
[0118] Microdystrophin proteins, such as those shown in Figures 1A and 22, and nucleic acid compositions and rAAV vectors encoding the same, as well as related Pharmaceutical compositions and methods of treatment are provided.
[0119] 5.1.Definition The term "AAV" or "adeno-associated virus" refers to the family Parvoviridae AAV refers to the naturally occurring "wild-type" AAV derived from a virus, the capsid encoded by the naturally occurring cap gene AAV derived from the rAAV genome packaged into a protein-containing capsid and and / or a capsid protein encoded by a non-naturally occurring capsid gene. The AAV may be derived from a rAAV genome packaged in a capsid containing the protein. Examples of the latter include sequences modified from the amino acid sequence of a naturally occurring capsid and / or Examples include rAAVs having capsid proteins with peptide inserts.
[0120] The term "rAAV" refers to "recombinant AAV." In some embodiments The recombinant AAV has part or all of the rep and cap genes replaced with heterologous sequences. It has the AAV genome.
[0121] The term "rep-cap helper plasmid" refers to the plasmid that contains the rep and cap genes of the virus. rAAV genome that provides gene functions and lacks functional rep and / or cap gene sequences Refers to the plasmid that aids in the production of AAV from the host.
[0122] The term "cap gene" refers to the gene that forms or shapes the capsid coat of a virus. It refers to the nucleic acid sequence that encodes the capsid protein that helps in the synthesis of the virus. The protein can be VP1, VP2, or VP3.
[0123] The term "rep genes" refers to the genes encoding the nonstructural proteins required for viral replication and production. It refers to a nucleic acid sequence that encodes
[0124] The terms "nucleic acid" and "nucleotide sequence" refer to a DNA molecule (e.g., a cDNA or genomic DNA), RNA molecules (e.g., mRNA), and combinations of DNA and RNA molecules. Combined or hybrid DNA / RNA molecules, and analogs of DNA or RNA molecules Such analogs can be generated, for example, using nucleotide analogs. These include, but are not limited to, inosine or tritylated bases. Such analogs may also be used, for example, to enhance nuclease resistance or the ability to cross cell membranes. DNA or RNA molecules containing modified backbones that confer beneficial attributes to the molecules, such as increased strength A nucleic acid or nucleotide sequence may be single-stranded, double-stranded, or both. It may contain both double-stranded and triple-stranded portions, but is preferably double-stranded DNA. do.
[0125] The amino acid residues disclosed herein may be used to determine overall polypeptide structure and / or function. Modifications may be made by conservative substitutions that maintain or substantially maintain the amino acid sequence. In this context, "conservative amino acid substitution" refers to the following: hydrophobic amino acids (i.e., Ala, Cy s, Gly, Pro, Met, Val, Ie, and Leu) are other hydrophobic amino acids. Substitution of hydrophobic amino acids with bulky side chains (i.e., Phe, Ty) is possible. r, and Trp) can be substituted with other hydrophobic amino acids with bulky side chains. Amino acids with positively charged side chains (i.e., Arg, His, and Lys) are positively charged. It can be substituted with other amino acids that have charged side chains, and negatively charged side chains. Amino acids with negatively charged side chains (i.e., Asp and Glu) are more likely to be negatively charged than other amino acids with negatively charged side chains. and amino acids with polar uncharged side chains (i.e., Ser, Thr, Asn, and Gln) can be substituted with other amino acids that have polar, uncharged side chains. What you can do.
[0126] The terms "subject," "host," and "patient" are used interchangeably. or non-primates (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or primates Preferably, the subject is a mammal, such as a monkey or human, and most preferably a human.
[0127] The term "therapeutically functional micro-dystrophin" is used herein in Section 5. in one or more of the therapeutic utility assays described in Section 4 or in Section 5 of this specification. In the evaluation of the treatment methods described in Section 5.5, microdystrophin was found to be therapeutically effective. It means to show gender.
[0128] The terms "subject," "host," and "patient" are used interchangeably. or non-primates (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or primates Preferably, the subject is a mammal, such as a monkey or human, and most preferably a human.
[0129] The term "therapeutic agent" refers to a drug used to treat, manage, or ameliorate symptoms associated with a disease or disorder. The term "transgene" refers to any agent that can be used to treat a disease or disorder that is caused by a transgene. A "therapeutically effective amount" refers to an amount of a compound or compound that is effective in treating or managing a disease or disorder of interest. In theory, it provides at least one therapeutic benefit when administered to an affected subject. It refers to the amount of agent provided (e.g., the amount of product expressed by the transgene). A therapeutically effective amount with respect to an agent of the invention is an amount that is at least 200 mg / kg / day effective in the treatment or management of a disease or disorder. an amount of drug alone or in combination with other therapies that provides at least one therapeutic benefit This means the amount in the case where
[0130] The term "prophylactic agent" refers to an agent that prevents, reduces the likelihood of, delays, or prevents the development of a disease or disorder. refers to any agent that can be used in slowing the progression of the disease or disorder A "prophylactically effective amount" refers to a dose that is effective to treat a disease or condition of interest. has at least 1 benefit in preventing or delaying a disorder when administered to a subject predisposed to the disorder. The amount of prophylactic agent (e.g., the amount of the gene expressed by the transgene) that provides a prophylactic benefit A prophylactically effective amount also refers to the prevention of the onset of a disease or disorder of interest, or the likelihood of its occurrence. A drug sufficient to reduce or delay the likelihood or slow the progression of the disease or disorder of interest. an amount sufficient to delay or minimize the onset of the disease or disorder of interest, or to prevent its recurrence Alternatively, a prophylactically effective amount may refer to an amount sufficient to prevent or slow the spread of the disease. It can refer to an amount of an agent sufficient to prevent or delay the progression of symptoms of a disease or disorder. A prophylactically effective amount for a specific prophylactic agent is at least one effective dose in preventing or delaying a disease or disorder. Amount of prophylactic agent, alone or in combination with other agents, that provides at least one prophylactic benefit This means the amount in the case where
[0131] The prophylactic agents of the invention can be administered to subjects "predisposed" to the disease or disorder of interest. A subject who is "predisposed" to a disease or disorder is one who has symptoms associated with the development of the disease or disorder. or genetic makeup, environmental exposures, or if there is evidence of such a disease or disorder. have other risk factors but do not yet have symptoms that warrant diagnosis as a disease or disorder For example, the gene associated with the defective gene (provided by the transgene) Patients with a family history of a given disease may be considered to be predisposed to that disease. Additionally, patients with dormant tumors that persist after removal of the primary tumor may be predisposed to tumor recurrence. It can be regarded as.
[0132] The term "CpG island" refers to a region of the dinucleotide CpG (e.g., C (cytosine) A genome that contains a high frequency of CpG (a base immediately followed by a G (guanine) base) The G+C content of a CpG island is therefore the same as that of a non-island D CpG islands are characterized by their nucleotide length, nucleotide composition, and and CpG dinucleotide frequency analysis. The CpG island content in a nucleotide sequence or genome is measured using the following criteria: Island size > 100, GC percentage > 50.0%, and The observed number of CG dinucleotides compared to the expected number based on the number of Gs and Cs in the segment. Ratio > 0.6 (Obs / Exp > 0.6). CpG actual / predicted = number of CpGs * N / (number of Cs * number of Gs)
[0133] where N = sequence length.
[0134] For such calculations, see world-wide-web.urogene.org / cg i-bin / methprimer / methprimer.cgi, world-wi de-web.cpgislands.usc.edu / , world-wide-we b.ebi.ac.uk / Tools / emboss / cpgplot / index.h tml and world-wide-web.bioinformatics.org / s Various software tools are available, such as ms2 / cpg_islands.html (Gardiner-Garden and Frommer, J Mol Biol. ol.1987 Jul 20;196(2):261-82;Li LC and D ahiya R.MethPrimer:designing primers for methylation PCRs. Bioinformatics.2002 N ov;18(11):1427-31). In one embodiment, the CpG The algorithm for identifying RAND is available at www.urogene.org / cgi-b It is located in / methprimer / methprimer.cgi.
[0135] 5.2. Microdystrophin transgene 5.2.1 Microdystrophin The embodiments described herein include, from amino terminus to carboxy terminus: ABD-H1- R1-R2-R3-H3-R24-H4-CR (e.g., SEQ ID NO: 2) or ABD1- Mycobacterium erythroblastoma (MYC) with H1-R1-R2-R16-R17-R24-H4-CR (SEQ ID NO: 93) The actin-binding domain of dystrophin is a dystrophin protein. H1 is the hinge 1 region of dystrophin, and R1 is the dystrophin R1 is the spectrin 1 domain of dystrophin, and R2 is the spectrin 2 domain of dystrophin. R3 is the spectrin 3 region of dystrophin, and H3 is the dystrophin kinase. R16 is the spectrin 16 region of dystrophin, and R17 is The spectrin 17 region of dystrophin, R24, is the spectrin 17 region of dystrophin. H4 is the hinge 4 region of dystrophin, and CR is the dystrophin This is the cysteine-rich region of the protein.
[0136] As described above, the microdystrophin of the present disclosure comprises ABD-H1-R1 -R2-R3-R24-H4 or ABD-H1-R1-R2-R16-R17-R24 The NH2-terminus and the region in the rod domain of dystrophin contain -H4. The rod domain of wild-type dystrophin binds directly to cutin but does not cross-link it. It consists of four repeating units and is similar to the triple helix repeat of spectrin. The repeat unit makes up the majority of the dystrophin protein and is similar to β-spectrin. These α-helical coils are thought to give the molecule a similar flexible rod-like structure. The coiled-coil repeats are interrupted by four proline-rich hinge regions. 24 At the end of the fourth repeat is the fourth hinge region, immediately followed by the WW domain. [Blake,D.et al,Function and Genetics of Dystrophin and Dystrophin-Related Protei ns in Muscle.Physiol.Rev.82:291-329,2002 The microdystrophins disclosed herein do not contain R4 to R23 or Alternatively, R3 (or in some embodiments R4) through R15 and R18 through R23 (i.e., microdystrophin contains R16 and R17 and is In some embodiments, R3 may not be included), two of the four hinge regions or portions thereof Embodiments include only one or three of the dysproteins believed to anchor nNOS to the sarcolemma. It may contain trophin spectrin-like repeats 16 and 17. In this case, no new amino acid residues or linkers are introduced into microdystrophin.
[0137] In some embodiments, the antibody comprises micro-dystrophin H3 (e.g., SEQ ID NO: 1, 2, or 79). In embodiments, H3 is the complete endogenous H3 from N-terminus to C-terminus. The H3 domain may be, for example, SEQ ID NO: 11. Microdystrophin embodiments contain the H3 domain rather than a fragment of the H3 domain. In some embodiments, the C-terminal amino acid of the R3 domain is It is directly (or covalently) bound to the N-terminal amino acid of the H3 domain. In an embodiment, the C-terminal amino acid of the R3 domain linked to the N-terminal amino acid of the H3 domain In some embodiments, the acid is Q. The 5' amino acid is Q.
[0138] In other embodiments, the microdystrophin comprises H2 instead of H3. may be the complete endogenous H2 domain (SEQ ID NO: 19). An embodiment of the lophin protein is, from amino terminus to carboxy terminus: ABD-H1-R 1-R2-R3-H2-R24-H4-CR. The C-terminal amino acid of the R3 domain that connects to the N-terminal amino acid of the range domain is Q. In another embodiment, the N-terminal amino acid of the H2 domain linked to the R3 domain is P. In certain embodiments, the C-terminal amino acid of the R3 domain is a C-terminal amino acid of the hinge domain. wherein the N-terminal amino acid of the hinge domain is P or is Q. In yet another embodiment, the C-terminal amino acid of the R3 domain is directly linked to the N-terminal amino acid of the H2 domain, where the N-terminal amino acid of the H2 domain is P. do.
[0139] Without being bound by any theory, the complete hinge domain is Any microorganisms based on the dystrophin protein must be used to achieve full activity. Dystrophin constructs may also be suitable. Dystrophin hinge segments is recognized to be naturally rich in proline, which allows flexibility in the protein product. (Koenig and Kunkel, 265(6):4560-4 566, 1990). Deletion of a portion of the hinge, specifically removal of one or more proline residues, Its flexibility is reduced, thus hindering its interaction with other proteins in the DAP complex. This can also reduce its effectiveness.
[0140] The micro-dystrophins disclosed herein contain wild-type dystrophin H4 sequences (W W domain) to the CR domain (represented by a single underline in SEQ ID NO: 15) Contains the ZZ domain (UniProtKB-P11532 aa 3307-3354) ) WW domains are proteins found in several signal transduction and regulatory molecules. The WW domain is similar to the src homology 3 (SH3) domain. This region binds to proline-rich substrates in a controlled manner. The main chain is proline-rich, which indicates the interaction between β-dystroglycan and dystrophin. The WW domain is located within hinge 4 (H4 region). The CR domain is located within the α -actinin, and contains two EF-hand motifs that mediate intracellular Ca 2+ can bind to The ZZ domain contains multiple conserved cysteine residues, which are involved in the binding of Zn 2+ Bivalent ZZ domains are predicted to form coordination sites for metal cations. It is similar to zinc fingers and is present in both nuclear and cytoplasmic proteins. The ZZ domain of the fin binds Ca 2+ It binds calmodulin in a Z-dependent manner. The Z domain may represent a functional calmodulin binding site, and other dysregulations of calmodulin may be involved. This may affect binding to lophin-related proteins.
[0141] Certain embodiments include a truncated portion of the CR domain, including the ZZ domain. For example, the microdystrophin protein has the following structure from amino to carboxy terminus: AB D-H1-R1-R2-R3-H3-R24-H4-CR(truncated)-CT (e.g., sequence 91, see RGX-DYS6 in Figure 22). The domain has, for example, the amino acid sequence of SEQ ID NO:90.
[0142] To overcome the packaging limitations typical of AAV vectors, Many microdystrophin genes lack the CT domain. However, it has been suggested that the C-terminal domain is not required for DAPC assembly, or that the C-terminus is not essential. Crawford, et al., J Cell Biol, 20 00,150(6):1399-1409; and Ramos, JN, et al.Mo Lecture Therapy 2019,27(3):1-13]. However, The CT domain of the dystrophin protein may have beneficial effects on cardiomyopathy. A specific interaction between the CT domain of trophins and cardiac β-dystroglycan has been demonstrated. The direct molecular interactions at the plasma membrane interface suggest that the myocardial membrane A direct role for the CT domain in anchoring the DAP complex has been demonstrated [Stevenso n,S.,et al.,Spatial relationship of the C-terminal domains of dystrophin and bet a-dystroglycan in cardiac muscle support a direct molecular interaction at the p Lasma membrane interface. Circ Res,1998. 82(1):pp.82-93]. 274 patients with Duchenne and Becker muscular dystrophy Correction of dystrophin genotype and cardiac phenotype in a study of patients with N-terminal The presence of the actin-binding domain (ABD1) and the CR domain + CT domain It has been revealed that the risk of cardiomyopathy is reduced, and furthermore, the CT of the dystrophin protein The beneficial cardioprotective effects of domains have been noted [Tandon, A., et al., Dystrophin genotype-cardiac phenotype co rrelations in Duchenne and Becker muscul ar dystrophies using cardiac magnetic re sonance imaging. Am J Cardiol,2015.115(7 ):pp.967-71]. Therefore, the CT domain in the skeletal muscle of mdx mice An excess of microdystrophin genes containing helix 1 of the coiled-coil motif Expression of sarcolemmal endothelial cells functions as a modular adaptor for signaling proteins recruited to the sarcolemma. The DAP complex members α1-syntrophin and α-dystrobrevin function in Increases recruitment [Koo, T., et al., Delivery of AAV2 / 9-microdystrophin genes incorporating he lix 1 of the coiled-coil motif in the C- terminal domain of dystrophin improves m uscle pathology and restores the level o f α1-syntrophin and α-dystrobrevin in sk eletal muscles of mdx mice. Hum Gene Th er,2011.22(11):pp.1379-88]. A longer version of Micro Overexpression of dystrophin also significantly reduced the extensor contractility of mdx mice compared with the shortened version. Improved muscle resistance to muscle damage caused by contraction [Koo, T., et al. 2011, supra] Posted].
[0143] It is known that DMD patients have a persistent state of severely impaired cardiac function. Treatments that restore nitric oxide synthase (nNOS) function may improve cardiac function by This appears to be beneficial in patients with myocardial infarction, with significant improvements in systolic blood pressure, shortening fraction, and ejection fraction, as well as myocardial fiber The progression of myocardial fibrosis begins when patients first experience left ventricular (LV) dilation and hypertrophy. This is manifested by progression to a stage known as dilated cardiomyopathy (DCM).
[0144] The CT domain of dystrophin is an α-helical coiled coil domain similar to the rod domain. It contains two polypeptide stretches predicted to form a chain (Table 1 below). H1 is indicated by a single underline and H2 is indicated by a double underline in SEQ ID NO: 16 Each coiled coil contains a conserved amino acid sequence similar to that found in leucine zippers. Repeating heptad (a, b, c, d, e, f, g) n and Leuco in the "d" position. This domain is called the CC (coiled-coil) domain. The CC region of dystrophin forms the binding site for dystrobrevin and α1-synthesis. It may regulate the interaction between dystrophin and other dystrophin-associated proteins.
[0145] The syntrophin isoforms α1-syntrophin and β1-syntrophin Both genes express dystrophin via two or more binding sites in dystrophin exons 73 and 74. It is thought that it directly interacts with the enzyme (Yang et al., JBC 270(10) :4975-8(1995)). α1-syntrophin and β1-syntrophin are The binding site for α1-syntrophin is small, and the C-terminal domain of strophin is distinct. The binding site for β1-syntrophin is located at least within amino acid residues 3447-3481. , located within amino acid residues 3495 to 3535 (Table 1, SEQ ID NO: 16, italics) Alpha 1-(α1-) syntrophin and alpha-syntrophin are referred to herein as , are used interchangeably.
[0146] Coiled carp in the C-terminal (CT) domain of the microdystrophin gene cassette Helix 1 of the ATP motif (single underlined sequence in SEQ ID NO: 16 in Table 1 below) H1 (shown as H1) is involved in cardiomyocyte protection and other dystrophin-related This may be advantageous for stabilizing the DAP complex (DAPC). may be involved not only in structural roles but also in important signaling roles. Other effects resulting from changes in the production of nitric oxide (NO) and the destabilization and disappearance of this complex The possibility of changes in the function of
[0147] Unexpectedly, certain micro-dystrophin constructs disclosed herein alpha-syntrophin, alpha-dystrobrevin and beta-dystroglycan It was found that not only CAN but also nNOS binds to and recruits nNOS. Development of a microdystrophin construct containing the C-terminal domain of dystrophin binding to nNOS. In the vein, binding to nNOS is associated with the activation of the microdystrophin complex expressed in muscle tissue. Immunostaining of the tract with appropriate antibodies identified alpha-syntrophin, alpha- On the sarcolemma in sections of muscle tissue transduced with dystrobrevin and nNOS. or near the sarcolemma. See Examples 5 and 7 in 6.5 and 6.7. In certain embodiments, The chromostrophin protein is a microdystrophin equivalent that does not contain the C-terminal domain. fin (otherwise the same amino acid sequence, i.e., "reference microdystrophin" α1-syntrophin, β-syntrophin and / or or dystrobrevin, which has a C-terminal domain that "increases binding" to α1- Syntrophin, β-syntrophin, α-dystrobrevin, β-dystroglycan Immunostaining of muscle sections for one or more DAPC components, including nNOS or Western blot analysis of tissue lysates or muscle membrane preparations identified one or more DAPC components were treated with microdystrophin containing the C-terminal domain. In mouse muscle, the reference microdystrophin protein (which does not have the C-terminal domain) mdx mouse muscle treated with dystrophin (which has the same sequence and dystrophin components except for the The C-terminal domain, as determined by greater levels compared to meat (otherwise has the same amino acid sequence as microdystrophin) DAPC is stabilized or anchored to the sarcolemma to a greater extent than dystrophin (see sections 6.5 and 6.7 below).
[0148] In some embodiments, a microdystrophin comprising the C-terminal domain of dystrophin is The trophin constructs contain syntrophin binding sites and / or disulfide bonds in the C-terminal domain. In some embodiments, the α1-syntrophin binding site comprises a thrombrevin binding site. The C-terminal domain containing the site is a truncated C-terminal domain. and the amino acid sequence of the truncated C-terminal domain is SEQ ID NO: 83. In the truncated C-terminal domain, the amino acid sequence MENSNGSYLNDSISPNE SIDDEHLLIQHYCQSLNQ (α1-syntrophin binding site) (SEQ ID NO: 8 4). In certain embodiments, the truncated C-terminal domain comprises an α1-syntrophin. The binding site contains the amino acid sequence MENSNGSYLNDSISPN ESIDDEHLLIQHYCQSLNQ (SEQ ID NO: 84), but It does not have fin or dystrobrevin binding sites.
[0149] The micro-dystrophin constructs of the present disclosure are After administration of lactate, there was a decrease in myocardial macrophage concentration, a decrease in the expression of adhesion molecules, and and / or electrocardiogram (ECG) measurements, e.g., end-systolic volume (left ventricle), end-diastolic volume, Progression as measured by normalization of stroke volume, ejection fraction, heart rate, or cardiac output End-systolic volume and other cardiac measurements may be measured using MRI (magnetic resonance imaging). cardiac computed tomography (CT) or single photon emission computed tomography (SPECT) The micro-dystrophin of the present invention can also be measured using computer tomography. Improvement in cardiac function after administration of the construct was observed in the DBA / 2J-mdx mouse model. It can also be tested.
[0150] Thus, the embodiments described herein provide a method for preparing a coiled-coil motif comprising: The present invention may further comprise all or part of the CT domain, including 1. For example, Proteins are arranged from amino to carboxy termini as follows: ABD-H1-R1-R2-R3- H3-R24-H4-CR-CT (e.g., SEQ ID NO: 1, 79, or 91) or ABD -H1-R1-R2-R16-R17-R24-H4-CR-CT (e.g., SEQ ID NO: 9 2). In some embodiments, the CT comprises α1-sinusoids, as shown in FIG. C of dystrophin containing the dystrophyin-binding site and / or the dystrobrevin-binding site In certain embodiments, the CT domain is at least a portion of the terminal domain. Contains α1-syntrophin binding sites and binds β1-syntrophin or dystrobrevin It does not have a binding site, for example, it has the amino acid sequence of SEQ ID NO: 83, and in part, α1-syn It functions via trophin to recruit and anchor nNOS to the sarcolemma. In one embodiment, CT comprises the amino acid sequence of SEQ ID NO: 16 or 83.
[0151] Microdystrophin embodiments may include linkers connecting the domains, as shown below. (L1, L2, L3, L4, L4.1 and / or L4.2) or parts thereof Available: ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24- H4-CR-CT (e.g., SEQ ID NO: 1, 79, or 91), ABD1-L1-H1- L2-R1-R2-L3-R3-H3-L4-R24-H4-CR (e.g., SEQ ID NO: 2 ), ABD1-L1-H1-L2-R1-R2-L3-R16-L4.1-R17-L4 .2-R24-H4-CR (e.g., SEQ ID NO: 92), or ABD1-L1-H1-L 2-R1-R2-L3-R16-L4.1-R17-L4.2-R24-H4-CR-C T (e.g., SEQ ID NO: 93). L1 is an endogenous linker that can link ABD1 to H1. L2 can link H1 to R1. L3 can be an intrinsic linker L2 (e.g., SEQ ID NO: 6) that can convert R2 to R3 or It may be an endogenous linker L3 (eg, SEQ ID NO: 9) that can be linked to R16.
[0152] L4 may also be an endogenous linker that can connect H3 and R24. In some embodiments, L4 is 3 amino acids, e.g., 4 amino acids in the native dystrophin sequence. In another embodiment, L4 is a TLE (SEQ ID NO: 12) preceding R24. the four amino acids preceding R24 in the native dystrophin sequence (SEQ ID NO: 17); or In another embodiment, H3 may be the two amino acids preceding R24 (SEQ ID NO: 18). There is no L4 or another linker between H3 and R24. As such, there is no linker; rather, R3 is directly connected to H3 or alternatively to H2. It is tied.
[0153] L4.1 may be an endogenous linker that can connect R16 and R17. In some embodiments, L4.1 is a 2 amino acid sequence, e.g., a sequence identical to that of a native dystrophin sequence. In another embodiment, L is the SV (SEQ ID NO: 110) preceding R17 in the sequence. 4.2 is an endogenous linker or endogenous linker that can connect R17 and R24 In some embodiments, L4.2 can be a portion of 4 amino acids, e.g. , Q following R17 and TLE (SEQ ID NO: 12) preceding R24 (SEQ ID NO: 89) .
[0154] The above components of other domains of microdystrophin not specifically mentioned are as follows: The amino acid sequences of the domains provided herein may be as follows: The sequence is from dystrophin in UniProtKB-P11532 (DMD_HUMAN). Other embodiments correspond to isoforms, which are incorporated herein by reference. UniProtKB-A0A075B6G3(A0A075B6G3_HUMAN)(Reference Naturally occurring nucleotides known in the art, such as nucleotides of the nucleotide sequence nucleotides (which are incorporated herein by reference), are also known in the art. The dystrophin domain may comprise a domain derived from a functional dystrophin isoform, e.g., R24 has R substituted for Q at amino acid 3 of SEQ ID NO:13. [Table 1-1] [Table 1-2] [Table 1-3]
[0155] The present disclosure also provides methods for preparing fusion proteins in which the functions of each domain and linker are substantially maintained and / or As long as the therapeutic effect of micro-dystrophin containing these variants is substantially maintained, Variants of the sequence are also contemplated. Functional activities include (1) actin, β-dystrophy, one of glycan, α1-syntrophin, α-dystrobrevin, and nNOS, (2) binding to animal models (e.g., those described herein); Improved muscle function in the mdx mouse model described above) or in a human subject; and / or (3) Cardioprotection or improvement of myocardial function in animal models or human patients In particular, microdystrophin is SEQ ID NO: 3 or at least 8% of SEQ ID NO: 3. 0%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity an ABD consisting of the amino acid sequence SEQ ID NO: 5 or at least 80% of SEQ ID NO: 5; at least 85%, at least 90%, at least 95%, at least 96%, at least Amino acid sequences with 97%, at least 98%, or at least 99% sequence identity H1 consisting of the sequence SEQ ID NO: 7 or at least 80% of SEQ ID NO: 7, at least 8 5%, at least 90%, at least 95%, at least 96%, at least 97%, Consists of an amino acid sequence that has at least 98% or at least 99% sequence identity R1: SEQ ID NO: 8 or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 96%, at least 97%, at least 9 R2, consisting of an amino acid sequence with 8% or at least 99% sequence identity; At least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or H2 consisting of an amino acid sequence having at least 99% sequence identity; SEQ ID NO: 1 At least 80%, at least 85%, at least 90% relative to SEQ ID NO: 1 or SEQ ID NO: 11 , at least 95%, at least 96%, at least 97%, at least 98%, or H3, consisting of an amino acid sequence with at least 99% sequence identity; SEQ ID NO: 13; is at least 80%, at least 85%, at least 90%, or at least at least 95%, at least 96%, at least 97%, at least 98%, or at least R24 consisting of an amino acid sequence having at least 99% sequence identity; SEQ ID NO: 14 or SEQ ID NO: At least 80%, at least 85%, at least 90%, at least for column number 14 at least 95%, at least 96%, at least 97%, at least 98%, or at least H4, consisting of an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 15 or 90; or at least 80%, at least 85%, at least At least 90%, at least 95%, at least 96%, at least 97%, at least 98% or a CR consisting of an amino acid sequence having at least 99% sequence identity; 16 or 83 or at least 80% relative to SEQ ID NO: 16 or 83, At least 85%, at least 90%, at least 95%, at least 96%, at least 97% , from amino acid sequences with at least 98%, or at least 99% sequence identity Alternatively, the CT may comprise a CT comprising SEQ ID NO: 84. The amino acid sequence is SEQ ID NO: 19 or at least 50%, at least 60% of SEQ ID NO: 19 , at least 70%, at least 75%, at least 80%, at least 85%, less 90%, at least 95%, at least 98%, or at least 99% identity This is the same as above, except that the H2 domain is replaced by a sequence having the and encodes microdystrophin, which also has functional activity. In addition, microdystrophin contains or consists of the following sequences at the above positions: The linker may comprise: SEQ ID NO: 4 or at least 80% of SEQ ID NO: 4, At least 85%, at least 90%, at least 95%, at least 98%, or L1 consisting of an amino acid sequence having at least 99% sequence identity; SEQ ID NO: 6 or sequence At least 80%, at least 85%, at least 90%, at least 9 for number 6 Amino acid sequences with 5%, at least 98%, or at least 99% sequence identity L2 consisting of SEQ ID NO: 9 or having at least 50% identity to SEQ ID NO: 9 an L3 consisting of a variant with conservative substitutions in both residues of the amino acid sequence or L3; and and SEQ ID NO: 12, 17, or 18 or SEQ ID NO: 12, 17, or 18 L4 consists of an amino acid sequence having at least 50%, at least 75% sequence identity.
[0156] In particular, microdystrophin is SEQ ID NO: 3 or at least 8% to SEQ ID NO: 3 0%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity an ABD consisting of the amino acid sequence SEQ ID NO: 5 or at least 80% of SEQ ID NO: 5; at least 85%, at least 90%, at least 95%, at least 96%, at least Amino acid sequences with 97%, at least 98%, or at least 99% sequence identity H1 consisting of the sequence SEQ ID NO: 7 or at least 80% of SEQ ID NO: 7, at least 8 5%, at least 90%, at least 95%, at least 96%, at least 97%, Consists of an amino acid sequence that has at least 98% or at least 99% sequence identity R1: SEQ ID NO: 8 or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 96%, at least 97%, at least 9 R2, consisting of an amino acid sequence with 8% or at least 99% sequence identity; At least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or R16 consisting of an amino acid sequence having at least 99% sequence identity; SEQ ID NO: 87 or at least 80%, at least 85%, at least 90% relative to SEQ ID NO: 87 %, at least 95%, at least 96%, at least 97%, at least 98%, if R17, consisting of an amino acid sequence having at least 99% sequence identity; SEQ ID NO: 13 or at least 80%, at least 85%, at least 90% relative to SEQ ID NO: 13; At least 95%, at least 96%, at least 97%, at least 98%, or R24 consisting of an amino acid sequence with at least 99% sequence identity; SEQ ID NO: 14 or is at least 80%, at least 85%, at least 90%, or at least at least 95%, at least 96%, at least 97%, at least 98%, or at least H4 consisting of an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 15 or 9 0 or at least 80%, at least 85%, at least at least 90%, at least 95%, at least 96%, at least 97%, at least 9 CR consisting of an amino acid sequence with 8% or at least 99% sequence identity; No. 16 or 83 or at least 80% relative to SEQ ID NO: 16 or 83 at least 85%, at least 90%, at least 95%, at least 96%, at least 9 Amino acid sequences with 7%, at least 98%, or at least 99% sequence identity or a CT comprising SEQ ID NO: 84. The strophin contains a linker at the above positions that includes or consists of the following sequence: SEQ ID NO: 4 or at least 80%, at least 85%, or at least at least 90%, at least 95%, at least 98%, or at least 99% L1 consisting of an amino acid sequence having sequence identity with SEQ ID NO: 6 or at least one amino acid sequence having sequence identity with SEQ ID NO: 6; at least 80%, at least 85%, at least 90%, at least 95%, at least 9 L2 consisting of an amino acid sequence having 8% or at least 99% sequence identity; No. 9 or an amino acid sequence having at least 50% identity to SEQ ID NO: 9, or L3 consisting of a variant with conservative substitutions at both residues of L3; SEQ ID NO: 110; or Amino acids having at least 50% and at least 75% sequence identity to SEQ ID NO: 110 L4.1 consisting of the amino acid sequence of SEQ ID NO: 89 or at least 5 amino acids selected from the group consisting of SEQ ID NO: 89 0%, L4.2 consisting of an amino acid sequence with at least 75% sequence identity.
[0157] Table 2 provides the amino acid sequences of microdystrophin embodiments according to the present disclosure. Other embodiments include those defined by SEQ ID NOs: 1, 2, 79, 91, 92, or 93. It is contemplated that the microdystrophin may be a substitution variant of the microdystrophin that contains a conservative substitution. Substitutions may be made into SEQ ID NOs: 1, 2, 79, 91, 92, or 93, while substantially maintaining their functional activity. In an embodiment, the micro-dystrophin can be selected from the group consisting of SEQ ID NOs: 1, 2, At least 60%, at least 7 for the amino acid sequence of 79, 91, 92, or 93 0%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the sequence The same applies to in vitro assays, such as those disclosed in Section 5.4 below. or as determined by one or more in vivo assays in animal models. In addition, functional micro-dystrophin activity can be maintained. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7]
[0158] 5.2.2 Microdystrophin-Encoding Nucleic Acid Compositions Another aspect of the present disclosure is a nucleic acid encoding the microdystrophin described herein. Such nucleic acids are arranged from N-terminus to C-terminus as follows: The present invention relates to a method for producing a dystrophin gene comprising the steps of: Mu:ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD1- H1-R1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R 16-R17-R24-H4-CR-CT, or ABD1-H1-R1-R2-R16 -R17-R24-H4-CR. The nucleotide sequence may be any nucleotide encoding a domain. The nucleotide sequence may be a coding sequence for expression in an appropriate context. Sequence optimization and / or removal of CpG islands may be performed. In certain embodiments, The nucleotide sequence may be selected from the group consisting of the amino acid sequences of SEQ ID NOs: 1, 2, 79, 91, 92, and 93. The nucleotide sequence is SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Microdiscs of SEQ ID NO: 2, SEQ ID NO: 79, SEQ ID NO: 91, SEQ ID NO: 92, or SEQ ID NO: 93 The nucleotide sequence may be any sequence encoding a microdystrophin, including a dystrophin. The sequence of the DMD domain may vary due to code degeneracy. Tables 3 and 4 show the sequences encoding the DMD domain. Exemplary nucleotide sequences are provided. As follows, Table 3 lists the wild-type DMD nucleotides of the constituent The nucleotide sequences are provided, and Table 4 provides codon optimization and / or CpG island CpG sequences. Nucleotides of the DMD components used in the constructs herein, including the sequences where deletions were made, are The nucleotide sequence is provided. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]
[0159] In some embodiments, such compositions comprise functionally active microorganisms. SEQ ID NO: 22, or at least 75% to SEQ ID NO: 22, encoding lophin; At least 80%, at least 85%, at least 90%, at least 95%, at least also encodes ABD1 with a sequence that has 98% or at least 99% identity. nucleic acid sequence; SEQ ID NO: 24, or at least 75%, at least 8% of SEQ ID NO: 24 0%, at least 85%, at least 90%, at least 95%, at least 98% a nucleic acid sequence encoding H1 consisting of a sequence having at least 99% identity; No. 26, or at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 9 a nucleic acid sequence encoding R1 consisting of a sequence with 9% identity; SEQ ID NO: 27; or a sequence At least 75%, at least 80%, at least 85%, at least for column number 27 have at least 90%, at least 95%, at least 98% or at least 99% identity a nucleic acid sequence encoding R2 consisting of a sequence corresponding to SEQ ID NO: 29, or a sequence corresponding to SEQ ID NO: 29 at least 75%, at least 80%, at least 85%, at least 90%, and sequences that share 95%, at least 98%, or at least 99% identity with each other. a nucleic acid sequence encoding R3; SEQ ID NO: 30, or at least 75% to SEQ ID NO: 30 %, at least 80%, at least 85%, at least 90%, at least 95%, at least It encodes H3 consisting of a sequence with at least 98% or at least 99% identity. nucleic acid sequence; SEQ ID NO: 32, or at least 75%, at least 8% of SEQ ID NO: 32 0%, at least 85%, at least 90%, at least 95%, at least 98% a nucleic acid sequence encoding R24 consisting of a sequence having at least 99% identity; No. 33, or at least 75%, at least 80%, or at least At least 85%, at least 90%, at least 95%, at least 98% or at least a nucleic acid sequence encoding H4 consisting of a sequence with 99% identity; SEQ ID NO: 34; or 109, or at least 75%, at least 80% of SEQ ID NO: 34 or 109 %, at least 85%, at least 90%, at least 95%, at least 98% or a nucleic acid sequence encoding a CR consisting of a sequence having at least 99% identity; and / or or SEQ ID NO: 35, or at least 75%, at least 80% relative to SEQ ID NO: 35, At least 85%, at least 90%, at least 95%, at least 98% or less The present invention also includes nucleic acid sequences encoding CT that have at least 99% identity to the sequence. In some embodiments, the H3 nucleic acid sequence is SEQ ID NO: 38, or at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, At least 85%, at least 90%, at least 95%, at least 98% or less replaced by a nucleic acid encoding H2 having a sequence with at least 99% identity Similar to the above, except that it is a microdystrophy with similar functional activity. It encodes the
[0160] In some embodiments, such compositions comprise SEQ ID NO: 22 or SEQ ID NO: 22 At least 75%, at least 80%, at least 85%, at least 90%, sequences with at least 95%, at least 98%, or at least 99% identity a nucleic acid sequence encoding ABD1, comprising: SEQ ID NO: 24 or at least 75%, at least 80%, or at least at least 85%, at least 90%, at least 95%, at least 98% or at least H1 domain of SEQ ID NO: 5, which has a sequence having 99% identity with a nucleic acid sequence encoding SEQ ID NO:26 or at least 75% of SEQ ID NO:26, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the R1 domain of SEQ ID NO: 7 a nucleic acid sequence encoding R1; SEQ ID NO: 27 or SEQ ID NO: 27 at least 75%, at least 80%, at least 85%, at least 90%, and sequences having 95%, at least 98%, or at least 99% identity with each other. a nucleic acid sequence encoding R2, encoding the R2 domain of SEQ ID NO: 8; a nucleic acid sequence encoding R2, or at least 75%, at least 80%, at least 85%, at least at least 90%, at least 95%, at least 98% or at least 99% identical and R3 domain of SEQ ID NO: 10. nucleic acid sequence; SEQ ID NO: 30 or at least 75%, at least 80% of SEQ ID NO: 30 %, at least 85%, at least 90%, at least 95%, at least 98% or The H3 domain of SEQ ID NO: 11 is composed of a sequence having at least 99% identity with the H3 domain of SEQ ID NO: 11. a nucleic acid sequence encoding H3, which encodes SEQ ID NO: 32 or a sequence at least as similar to SEQ ID NO: 32; At least 75%, at least 80%, at least 85%, at least 90%, at least 95% , consisting of a sequence having at least 98% or at least 99% identity to SEQ ID NO: a nucleic acid sequence encoding R24, encoding the R24 domain of SEQ ID NO: 33; or At least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity a nucleic acid encoding H4, comprising a sequence having the sequence: Sequence number 34 or 109 or at least At least 75%, at least 80%, at least 85%, at least 90%, at least 95% , consisting of a sequence having at least 98% or at least 99% identity to SEQ ID NO: a nucleic acid sequence encoding a CR, encoding 15 or 90 CR domains; and / or SEQ ID NO: 35 or 80 or at least 75% to SEQ ID NO: 35 or 80; At least 80%, at least 85%, at least 90%, at least 95%, at least also consisting of a sequence having 98% or at least 99% identity with SEQ ID NO: 16 or 83 CT domain. The H3 nucleic acid sequence is SEQ ID NO: 38 or at least 75% similar to SEQ ID NO: 38. at least 80%, at least 85%, at least 90%, at least 95%, at least 9 8% or at least 99% identity to the H2 domain of SEQ ID NO: 19 The nucleic acid encoding H2 is substituted for the nucleic acid encoding H1. It's the same.
[0161] In addition to the above, the nucleic acid composition may comprise or consist of the following sequences at the locations listed above: Optionally, the sequence may include a nucleotide sequence encoding a linker, such as SEQ ID NO: 23 or is at least 80%, at least 85%, at least 90%, or at least sequences with at least 95%, at least 98%, or at least 99% sequence identity A nucleic acid sequence encoding an L1 (e.g., encoding the L1 domain of SEQ ID NO: 4) consisting of: SEQ ID NO: 25 or at least 80%, at least 85%, at least at least 90%, at least 95%, at least 98%, or at least 99% of the sequence The L2 domain of SEQ ID NO: 6 is encoded by a sequence having the same sequence as the L2 domain of SEQ ID NO: 6. SEQ ID NO:28 or at least 50% identical to SEQ ID NO:28 and encoding an L3 consisting of a sequence having the properties of the L3 domain of SEQ ID NO: 9 or both of the L3 domains. Nucleic acid sequences encoding variants with conservative substitutions of residues; and SEQ ID NOs: 31, 36, or 37 or at least 50% less than SEQ ID NO: 31, 36, or 37 and encoding L4 consisting of a sequence having at least 75% sequence identity (e.g., SEQ ID NO: 1). Conservative substitutions in either 2, 17, or 18 L4 domains or L4 residues a nucleic acid sequence encoding a variant.
[0162] In some embodiments, such compositions comprise functionally active microorganisms. SEQ ID NO: 22, or at least 75% to SEQ ID NO: 22, encoding lophin; At least 80%, at least 85%, at least 90%, at least 95%, at least also encodes ABD1 with a sequence that has 98% or at least 99% identity. nucleic acid sequence; SEQ ID NO: 24, or at least 75%, at least 8% of SEQ ID NO: 24 0%, at least 85%, at least 90%, at least 95%, at least 98% a nucleic acid sequence encoding H1 consisting of a sequence having at least 99% identity; No. 26, or at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 9 a nucleic acid sequence encoding R1 consisting of a sequence with 9% identity; SEQ ID NO: 27; or a sequence At least 75%, at least 80%, at least 85%, at least for column number 27 have at least 90%, at least 95%, at least 98% or at least 99% identity a nucleic acid sequence encoding R2 consisting of a sequence corresponding to SEQ ID NO: 94, or a nucleic acid sequence corresponding to SEQ ID NO: 94 at least 75%, at least 80%, at least 85%, at least 90%, and sequences that share 95%, at least 98%, or at least 99% identity with each other. a nucleic acid sequence encoding R16; SEQ ID NO: 95, or at least 7 sequences related to SEQ ID NO: 95 5%, at least 80%, at least 85%, at least 90%, at least 95%, encoding R17 consisting of a sequence having at least 98% or at least 99% identity a nucleic acid sequence corresponding to SEQ ID NO: 32, or at least 75%, at least At least 80%, at least 85%, at least 90%, at least 95%, at least 98% or a nucleic acid sequence encoding R24 consisting of a sequence having at least 99% identity; SEQ ID NO: 33, or at least 75%, at least 80%, or at least at least 85%, at least 90%, at least 95%, at least 98% or less a nucleic acid sequence encoding H4 consisting of a sequence having 99% identity with SEQ ID NO: 34; or 109, or at least 75% of SEQ ID NO: 34 or 109, or at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or a nucleic acid sequence encoding CR consisting of a sequence having at least 99% identity; and / or SEQ ID NO: 35, or at least 75%, at least 80% of SEQ ID NO: 35 %, at least 85%, at least 90%, at least 95%, at least 98% or The present invention also includes nucleic acid sequences encoding CT that have at least 99% identity to the sequence. An alternative embodiment is where the H3 nucleic acid sequence is SEQ ID NO:38, or at least SEQ ID NO:38. At least 50%, at least 60%, at least 70%, at least 75%, at least 80% %, at least 85%, at least 90%, at least 95%, at least 98% or is replaced by a nucleic acid encoding H2 having a sequence with at least 99% identity The microdystrophy is similar to that described above, except that it has the same functional activity. It is what codes the fin.
[0163] In some embodiments, such compositions comprise SEQ ID NO: 22 or SEQ ID NO: 22 At least 75%, at least 80%, at least 85%, at least 90%, sequences with at least 95%, at least 98%, or at least 99% identity a nucleic acid sequence encoding ABD1, comprising: SEQ ID NO: 24 or at least 75%, at least 80%, or at least at least 85%, at least 90%, at least 95%, at least 98% or at least H1 domain of SEQ ID NO: 5, which has a sequence having 99% identity with a nucleic acid sequence encoding SEQ ID NO:26 or at least 75% of SEQ ID NO:26, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the R1 domain of SEQ ID NO: 7 a nucleic acid sequence encoding R1; SEQ ID NO: 27 or SEQ ID NO: 27 at least 75%, at least 80%, at least 85%, at least 90%, and sequences having 95%, at least 98%, or at least 99% identity with each other. a nucleic acid sequence encoding R2, encoding the R2 domain of SEQ ID NO: 8; a nucleic acid sequence encoding R2, or at least 75%, at least 80%, at least 85%, at least at least 90%, at least 95%, at least 98% or at least 99% identical and encoding the R16 domain of SEQ ID NO: 86. a nucleic acid sequence corresponding to SEQ ID NO: 95 or at least 75% of SEQ ID NO: 95, 80%, at least 85%, at least 90%, at least 95%, at least 98% or a sequence having at least 99% identity to the R17 domain of SEQ ID NO: 87 a nucleic acid sequence encoding R17; At least 75%, at least 80%, at least 85%, at least 90%, at least a sequence having at least 95%, at least 98%, or at least 99% identity to the A nucleic acid sequence encoding R24, encoding the R24 domain of SEQ ID NO: 13; SEQ ID NO: 3 3 or at least 75%, at least 80%, at least 85% relative to SEQ ID NO: 33 , at least 90%, at least 95%, at least 98% or at least 99% and encoding the H4 domain of SEQ ID NO: 14. SEQ ID NO: 34 or 109 or a nucleic acid sequence corresponding to SEQ ID NO: 34 or 109 At least 75%, at least 80%, at least 85%, at least 90%, at least a sequence having at least 95%, at least 98%, or at least 99% identity to the A nucleic acid sequence encoding a CR, encoding the CR domain of SEQ ID NO: 15 or 90; and / or SEQ ID NO: 35 or 80 or at least SEQ ID NO: 35 or 80 75%, at least 80%, at least 85%, at least 90%, at least 95%, comprising a sequence having at least 98% or at least 99% identity with SEQ ID NO: 1 6 or 83 CT domains. In an embodiment, the H3 nucleic acid sequence is SEQ ID NO: 38 or at least 75% similar to SEQ ID NO: 38. %, at least 80%, at least 85%, at least 90%, at least 95%, at least and consisting of a sequence having at least 98% or at least 99% identity with SEQ ID NO: 19. encoding the H2 domain, except that it is replaced by nucleic acid encoding H2. , the same as above.
[0164] In addition to the above, the nucleic acid composition may comprise or consist of the following sequences at the locations listed above: Optionally, the sequence may include a nucleotide sequence encoding a linker, such as SEQ ID NO: 23 or is at least 80%, at least 85%, at least 90%, or at least sequences with at least 95%, at least 98%, or at least 99% sequence identity A nucleic acid sequence encoding an L1 (e.g., encoding the L1 domain of SEQ ID NO: 4) consisting of: SEQ ID NO: 25 or at least 80%, at least 85%, at least at least 90%, at least 95%, at least 98%, or at least 99% of the sequence The L2 domain of SEQ ID NO: 6 is encoded by a sequence having the same sequence as the L2 domain of SEQ ID NO: 6. SEQ ID NO:28 or at least 50% identical to SEQ ID NO:28 and encoding an L3 consisting of a sequence having the properties of the L3 domain of SEQ ID NO: 9 or both of the L3 domains. Nucleic acid sequences encoding variants with conservative substitutions of residues; SEQ ID NO: 125 or sequence From sequences with at least 50% and at least 75% sequence identity to no. 125 110 or L4.1 a nucleic acid sequence encoding a variant having conservative substitutions for any of the residues; and SEQ ID NO: 126 or at least 50%, at least 75% sequence identity to SEQ ID NO: 126 L4.2 (e.g., the L4.2 domain of SEQ ID NO: 89 or L4. (encoding variants with conservative substitutions of either of the two residues) nucleic acid sequences.
[0165] In various embodiments, the nucleic acid is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 79, SEQ ID NO: 91, SEQ ID NO: 92, or SEQ ID NO: 93. In an embodiment, the nucleic acid comprises a nucleotide sequence encoding the sequence SEQ ID NO: 20. In column number 21, sequence number 81, sequence number 101, sequence number 102, or sequence number 103 The nucleotide sequences are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 79, and SEQ ID NO: 1, respectively. (encoding microdystrophins of SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:93). In some embodiments, the nucleotide sequence encoding microdystrophin is the sequence Nucleotide sequences of numbers 20, 21, 83, 101, 102, or 103 (Table 5) or their reverse complements, at least 50%, at least 60%, at least 70% , at least 75%, at least 80%, at least 85%, at least 90%, less have 95%, at least 98%, or at least 99% sequence identity with each other, and are therapeutically effective It may encode a functional microdystrophin. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10] [Table 5-11] [Table 5-12] [Table 5-13] [Table 5-14] [Table 5-15] [Table 5-16] [Table 5-17] [Table 5-18] [Table 5-19] [Table 5-20]
[0166] 5.2.2.1 Codon optimization and CpG removal In one embodiment, the nucleotide sequence encoding the micro-dystrophin cassette is Modified by codon optimization and removal of CpG dinucleotides and CpG islands The immune response to the microdystrophin transgene is the first Duchenne muscle DMD gene therapy clinical trials and some canine animal models As demonstrated by adeno-associated virus (AAV)-minidystrophin gene therapy, This is a concern for clinical use [Mendell, JR, et al., Dys trophin immunity in Duchenne's muscular dystrophy. N Engl J Med,2010.363(15):p.1 429-37;and Kornegay,JN,et al.,Widespre ad muscle expression of an AAV9 human mi ni-dystrophin vector after intravenous i injection in neonatal dystrophin-deficiency t dogs. Mol Ther,2010.18(8):p.1501-8].
[0167] The AAV-induced immune response reduces the number of CpG dinucleotides in the AAV genome. Faust, SM, et al., CpG-depl eted adeno-associated virus vectors evad e immune detection. J Clin Invest,2013.1 23(7):pp.2994-3001]. Remove CpG motifs from the transgene sequence. This highlights the role of TLR9 in activating innate immunity when transgenes are recognized as non-self. This can result in stable and long-term transgene expression. D., PWLTai, and G. Gao, Adeno-associated virus vector as a platform for gene ther apy delivery. Nat Rev Drug Discov,2019.1 8(5):p.358-378.; and Rabinowitz, J., YKChan. ,and RJ Samulski,Adeno-associated Virus (AAV)versus Immune Response. Viruses,201 See also 9.11(2). In embodiments, the micro-dystrophin cassette The DNA is human codon optimized with CpG removal. The nucleotide sequences obtained are analyzed using, for example, Thermo Scientific™ using GeneOptimizer. Fisher Scientific GeneArt Gene Synthesis Any suitable method known in the art may be used, including the use of a fluororesin (Waltham, MA USA) or a fluororesin (Waltham, MA USA). The amino acid sequence of SEQ ID NOs: 20, 21, 57 to 72 described herein can be designed by any method. The nucleotide sequences of nucleotides 80, 81, and 101-103 were codon-optimized and CpG-removed. This represents the array in which
[0168] By reducing the number of CpG dinucleotide sequences, the number of CpG islands Reduced numbers of micro-dystrophin transgenes are provided. In the present study, the microdystrophin nucleotide sequence contained less than two (2) CpG sequences. land, or one (1) CpG island, or zero (0) CpG islands In embodiments, the antibody has more than two CpG antigens as measured by anti-drug antibody titers. Reduced immunogenicity compared to the microdystrophin transgene with IRAN. Microdiscs with less than or 1 CpG island, or 0 CpG islands A trophin transgene is provided. In certain embodiments, SEQ ID NOs: 20, 21 Microdystrophin nucleosomes consisting essentially of 81, 101, 102, or 103 In another embodiment, the promoter sequence has zero (0) CpG islands. A microdystrophin gene operably linked to a microdystrophin target is used in the present invention. The nucleotide sequence of the strophin transgene contains no more than two (2) CpG islands. wherein the microdystrophin is selected from the group consisting of SEQ ID NOs: 20, 21, 81, 101, 102 or 103. In yet another embodiment, A microdystrophin transgene consisting essentially of an inserted microdystrophin gene. The nucleotide sequence of the present invention has one (1) CpG island, where The trophin consists of SEQ ID NO: 20, 21, 81, 101, 102 or 103.
[0169] 5.3. Gene Cassettes and Regulatory Elements Another aspect of the present invention is a method for producing a gene encoding a dystrophin-containing protein (e.g., a dystrophin gene) designed to confer or enhance expression of micro-dystrophin. The present invention relates to a nucleic acid expression cassette comprising a promoter element. and optionally, enhancer elements and / or introns, It may further comprise regulatory elements to enhance or promote expression of the transgene. In embodiments, the rAAV vector also delivers the nucleic acid (transgene) into a target cell of a subject. affecting the expression of RNA and / or protein products encoded by the Regulatory control elements include those known to those skilled in the art that are tissue-specific. may be selective, i.e., active only in the target cells / tissues (or may be substantially more potent). (more active or significantly more active).
[0170] 5.3.1 Promoter 5.3.1.1 Tissue-specific promoters In certain embodiments, the expression cassette of the AAV vector allows expression in the target tissue. The promoter comprises a regulatory sequence, such as a promoter, operably linked to the transgene. The promoter may be a constitutive promoter, for example, the CB7 promoter. The promoters include the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RS) promoter, and V) promoter, MMT promoter, EF-1 alpha promoter (SEQ ID NO: 11 8), UB6 promoter, chicken beta-actin promoter, CAG promoter (SEQ ID NO: 116), RPE65 promoter, opsin promoter, TBG (Tyrosine oxidase-binding globulin) promoter, APOA2 promoter, SERPINA1 (h AAT promoter, or MIR122 promoter. In some cases, it may be desirable to turn off transgene expression, particularly inducible promoters. For example, hypoxia-inducible or rapamycin-inducible promoters are used.
[0171] In certain embodiments, the promoter is a muscle-specific promoter. The terms "allergic," "muscle-selective," or "muscle-targeting" refer to a nucleic acid element that is capable of exerting its activity. The interaction of these elements with the intracellular environment of the muscle cells results in adaptation to the muscle cells or tissues. Such muscle cells include myocytes, myotubes, and cardiomyocytes. The characteristics of muscle cells, such as cardiac myocytes, skeletal cells, and smooth muscle cells, which have distinct properties, can be Various therapies may benefit from muscle-specific expression of transgenes. In particular, various forms of muscular dystrophy can be delivered to muscle cells, allowing for high transduction efficiency. Gene therapy to treat phi involves delivering the transgene to the cells where it is most needed. Cardiac tissue also has the added advantage of inducing muscle-directed expression of transgenes. The muscle-specific promoter can be operably linked to the transgene of the present invention. In some embodiments, the muscle-specific promoter is SPc5-12 Promoter, muscle creatine kinase myosin light chain (MLC) promoter, myosin Heavy chain (MHC) promoter, desmin promoter (SEQ ID NO: 119), MHCK7 promoter promoter (SEQ ID NO: 120), CK6 promoter, CK8 promoter (SEQ ID NO: 1 15), MCK promoter (or a truncated version thereof) (SEQ ID NO: 121), alpha actin actin promoter, beta-actin promoter, gamma-actin promoter, E-sy n promoter, cardiac troponin C promoter, troponin I promoter, myoD The gene family promoter or muscle protein present within intron 1 of the eye-type Pitx3 Selected from alternative promoters.
[0172] The synthetic promoter c5-12, known as the SPc5-12 promoter (Li, X. et al.Nature Biotechnology Vol.17,pp.241 -245, MARCH 1999) is cell type-restricted in expression, particularly in muscle cells. The SPc5-12 promoter is 350 bp in length. It is shorter than most endogenous promoters and is suitable for encoding therapeutic proteins. It may be advantageous if the length of the nucleic acid to be encoded is relatively long. A gene therapy cassette having a .DELTA. ...
[0173] To further reduce the length of the vector, the regulatory elements may be integrated into the promoters described herein. A reduced or truncated version of any one of the motors (referred to herein as a "minimal promoter" A minimal promoter may be a promoter that contains at least a full-length transcriptionally active domain. It contains a gene and is therefore still capable of driving expression. In one embodiment, the AAV vector is operably linked to a therapeutic protein transgene. The transcriptional activation domain of a selected muscle-specific promoter, e.g., the minimal SPc5-12 promoter In embodiments, the therapeutic protein may comprise a target (e.g., SEQ ID NO: 40). The minimal promoter of the present disclosure is a micro-dystrophin promoter. It may or may not contain the portion of the promoter sequence that contributes to the regulation of specific expression. That's fine.
[0174] Thus, in an embodiment, a vector having the SPc5-12 promoter (SEQ ID NO: 39) In an embodiment, a gene therapy cassette is provided for the induction of microdissection in muscle cells. A gene therapy cassette is provided that includes a minimal promoter that drives the expression of a trophin. One such promoter is the minimal SPc5-12 promoter of SEQ ID NO: 40. The sequences of these promoters are provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3]
[0175] In certain embodiments, the promoter is a CNS-specific promoter. For example, the expression cassette may contain a promoter isolated from the gene for neuron-specific enolase (NSE). any promoter of the dopamine-1 receptor or dopamine-2 receptor promoter, synapsin promoter, CB7 promoter (chicken β-actin promoter and CMV enhancer), RSV promoter, GFAP promoter ( glial fibrillary acidic protein), MBP promoter (myelin basic protein), M MT promoter, EF-1α, U86 promoter, RPE65 promoter or pusin promoter, inducible promoters, e.g., hypoxia-inducible promoters, and Drug-induced promoters, such as those induced by rapamycin and related drugs, are also The promoter may be selected from the group consisting of:
[0176] In yet another embodiment, the expression cassette comprises a micro-dystrophin transgene. The expression cassette may contain multiple promoters that may be arranged in tandem. Tandem or hybrid promoters may be used to enhance expression and / or to control multiple and the like (see, for example, the references herein incorporated by reference) may be employed to induce expression in a variety of tissue types. PCT International Publication No. WO2019154939, published August 15, 2019 A1), in particular PCT International Application No. PCT / U filed on 24 July 2020. LM disclosed in S2020 / 043578 (incorporated herein by reference). TP6, LMTP13, LMTP14, LMTP15, LMTP18, LMTP19, or or LMTP20 may be employed.
[0177] 5.3.2 Introns Another aspect of the present disclosure relates to AAV vectors that contain an intron within the regulatory cassette. Example 2 shows the 5' VH4 intron of the microdystrophin coding sequence in a suitable splice. These results suggest that dystrophin promotes isolating and therefore promotes microdystrophin expression. Thus, in some embodiments, the intron is a microdystrophin Proteins such as ABD-H1-R1-R2-R3-H3-R24-H4-CR, A BD-H1-R1-R2-R3-H3-R24-H4-CR-CT, ABD-H1-R1 -R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R1 It is linked to the 5' end of the sequence encoding 6-R17-R24-H4-CR-CT. In other embodiments, the intron may be linked to an actin-binding domain. The nucleotides are less than 100 nucleotides in length.
[0178] In an embodiment, the intron is a VH4 intron. , may include SEQ ID NO: 41 shown in Table 7 below. [Table 7]
[0179] In another embodiment, the introns are chiral sequences derived from human β-globin and Ig heavy chains. It is a β-globin splice donor / immunoglobulin heavy chain splice donor Also known as acceptor intron or β-globin / IgG chimeric intron ) (Table 7, SEQ ID NO: 75). Chicken β-actin intron, minute virus of mice (M VM) intron, human factor IX intron (e.g., FIX truncated intron 1), β-globin splice donor / immunoglobulin heavy chain splice acceptor intron , adenovirus splice donor / immunoglobulin splice acceptor intron , SV40 late splice donor / splice acceptor (19S / 16S) intro Other introns well known to those skilled in the art, such as the intron (Table 7, SEQ ID NO: 76), may also be employed. Good too.
[0180] 5.3.3 Other regulatory elements 5.3.3.1 PolyA Another aspect of the present disclosure is a method for detecting a dystrophin gene downstream of the coding region of the microdystrophin transgene. Regarding expression cassettes containing polyadenylation (polyA) sites, which signal the end of transcription and Any polyA site that directs the synthesis of an A-tail is suitable for use in the AAV vectors of the present disclosure. Exemplary poly A signals are derived from, but not limited to, the following: 40 late genes, rabbit β-globin gene, bovine growth hormone (BPH) gene, human A human growth hormone (hGH) gene, and a synthetic polyA (SPA) site. The polyA signal comprises SEQ ID NO: 42 shown in Table 8. [Table 8]
[0181] 5.3.4 Viral vectors The micro-dystrophin transgenes of the present disclosure are suitable for gene therapy administration to human subjects. In some embodiments, recombinant AAV (rAAV) vectors may be included in the AAV vectors for AAV (AAV) vectors are composed of an AAV viral capsid and an AAV inverted terminal repeat (ITR) sequence. and a viral genome or artificial genome containing an expression cassette flanked by The kit controls transgene expression in human muscle or CNS cells and induces microdisruption. a microorganism operably linked to one or more regulatory sequences for expression and delivery of lophine; The provided methods involve the use of microdissections of the cells described herein, including a dystrophin transgene. Use in the production of any isolated recombinant AAV particle for delivery of strophin , a composition comprising any isolated recombinant AAV particle encoding micro-dystrophin or in the production of products suitable for treatment with micro-dystrophin. A method for treating a disorder in a subject in need thereof, comprising administering to a subject a compound according to any one of claims 1 to 4, further comprising administering to said ... Injection of any isolated recombinant AAV particle encoding micro-dystrophin carrying the vector Thus, rAAV is suitable for use in methods that are well known in the art, including administering any serotype known in the art, its variants, modifications, hybrids, or derivatives serotype, or any combination of these (collectively referred to as "serotypes"). In some embodiments, the AAV serotype has a tropism for muscle tissue. Thus, the AAV serotype has a tropism for the CNS. The type has tropism for both muscle tissue and the CNS. AV serotypes have a tropism for the liver, where AAV-transduced hepatocytes can be transformed into mammary glands. Forming a depot of microdystrophin-secreting cells and releasing microdystrophin into the circulation To secrete.
[0182] In some embodiments, the rAAV particles comprise AAV1, AAV2, AAV3, AA V4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AA V.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RH M4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV .7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF , AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HS C3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, A AV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV .HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or is selected from AAV.HSC16 or a derivative, variant, or pseudotype thereof In some embodiments, the capsid protein is derived from an AAV serotype. The rAAV particles may be, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV 6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13 , AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV .rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.h u37, AAV.Anc80, rAAV.Anc80L65, AAV.7m8, AAV. PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AA V.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HS C4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, A AV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AA V.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC1 6, or a derivative, variant, or pseudotype thereof. At least 80% identical to the VP1, VP2, and / or VP3 sequences of the serotype, e.g. For example, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 9 4%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 10 Contains capsid proteins that are 0% identical.
[0183] For example, a population of rAAV particles can include more than one serotype, e.g., AAV1, AA V2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AA V10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16 , AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV. Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.A nc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV 2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV. HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6 , AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AA V.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AA Two or more of V.HSC15, or AAV.HSC16, or other rAAV particles , or a combination of two or more of these).
[0184] In some embodiments, the rAAV particles are prepared using the method of Zinn et al., 2015, As described in Cell Rep. 12(6):1056-1068, Anc80 or Anc80L65 capsid, which is incorporated by reference in its entirety. In certain embodiments, the rAAV particles are prepared as described in U.S. Patent No. 9,193,956; Nos. 9,458,517; and 9,587,282 and U.S. Patent Application Publication No. 201 6 / 0376323, the following amino acid insertion: LGETTRP or L Each of these contains a capsid containing one of the ALGETTRPs, In some embodiments, the rAAV particles are prepared from the U.S. Patent Nos. 9,193,956; 9,458,517; and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, AAV .7m8 capsid, each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV particles are prepared as described in U.S. Patent No. 9,585,971. Some embodiments include any AAV capsid, such as AAVPHP.B, disclosed in US Pat. In embodiments, the rAAV particles are prepared using the methods described in U.S. Pat. No. 9,840,719 and WO2015 / 015166. Any AAV species, such as AAV.Rh74 and RHM4-1, as disclosed in US Pat. No. 6,331,313, is also disclosed. and psides, each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV particles are those disclosed in WO2014 / 172669. and any AAV capsid, such as AAV rh.74, which is incorporated herein by reference in its entirety. In some embodiments, the rAAV particles are prepared from the Geor giadis et al.,2016,Gene Therapy 23:857-8 62 and Georgiadis et al., 2018, Gene Therapy 25:450, each of which contains an AAV2 / 5 capsid. , which is incorporated by reference in its entirety. In some embodiments, the rAAV particles comprise W Any AV capsid, such as AAV2tYF, disclosed in O2017 / 070491 and the like, which is incorporated herein by reference in its entirety. In this study, rAAV particles were synthesized as described in Puzzo et al., 2017, Sci. Transl Med. 29(9):418, AAVLK03 or AAV3B , which is incorporated by reference in its entirety. In the present invention, rAAV particles are prepared as described in U.S. Patent Nos. 8,628,966; 8,927,514 No. 9,923,120 and HSC disclosed in WO2016 / 049230 1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC 9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, and includes any AAV capsid, such as HSC16, each of which is referenced in its entirety. Incorporated by
[0185] In some embodiments, the rAAV particles are disclosed in any of the following patents and patent applications: The AAV capsids shown are each incorporated herein by reference in their entirety. Incorporated herein by reference: U.S. Patent Nos. 7,282,199; 7,906,111; 8 ,524,446;Same No.8,999,678;Same No.8,628,966;Same No.8, No. 927,514; No. 8,734,809; No. 9,284,357; No. 9,4 No. 09,953; No. 9,169,299; No. 9,193,956; No. 9458 517; and 9,587,282; U.S. Patent Application Publication No. 2015 / 037480 No. 3; No. 2015 / 0126588; No. 2017 / 0067908; No. 201 3 / 0224836; 2016 / 0215024; 2017 / 005125 No. 7; and International Patent Application No. PCT / US2015 / 034799; P2015 / 053335. In some embodiments, the rAAV particles are and VP1, VP2 and / or AAV capsids disclosed in any of the patent applications. At least 80% identical to the VP3 sequence, e.g., 85%, 85%, 87%, 88% %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99%, 99.5%, etc., i.e., capsid proteins that are up to 100% identical and U.S. Pat. No. 7,499,299, each of which is incorporated herein by reference in its entirety. , 282,199; 7,906,111; 8,524,446; 8, No. 999,678; No. 8,628,966; No. 8,927,514; No. 8,7 No. 34,809; No. 9,284,357; No. 9,409,953; No. 9,16 Nos. 9,299; 9,193,956; 9,458,517; and 9,587 ,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 0126 No. 588; No. 2017 / 0067908; No. 2013 / 0224836; No. 2 016 / 0215024; 2017 / 0051257; and International Patent Application No. PCT / US2015 / 034799; PCT / EP2015 / 053335.
[0186] In some embodiments, the rAAV particles are those described in International Application Publication No. WO2003 / 052 No. 051 (see, for example, SEQ ID NO: 2 of No. '051), WO2005 / 033321 (See, e.g., SEQ ID NOS: 123 and 88 in '321), WO 03 / 042397 (See, e.g., SEQ ID NOS: 2, 81, 85, and 97 of '397), WO2006 / No. 068888 (see, for example, SEQ ID NOs: 1 and 3-6 in No. '888), WO2006 / 110689 (see, for example, SEQ ID NOs: 5 to 38 in '689), No. 104964 (e.g., SEQ ID NOs: 1 to 5, 7, 9, 20, 22, 24 and 31), WO2010 / 127097 (for example, SEQ ID NOs: 5 to 3 in '097) 8), and WO2015 / 191508 (e.g., SEQ ID NO: 80 of '508). 294), and U.S. Patent Application Publication No. 20150023924 (e.g., '924 (See SEQ ID NOS: 1, 5-10 of the same reference number) and The contents of which are incorporated herein by reference in their entirety. In some embodiments, r AAV particles can be prepared using the methods described in International Application Publication No. WO 2003 / 052051 (e.g., the sequences of '051). See column number 2), WO2005 / 033321 (e.g., SEQ ID NO: 1 of '321) 23 and 88), WO 03 / 042397 (e.g., SEQ ID NO: 2 of '397) , 81, 85, and 97), WO2006 / 068888 (see, e.g., '888 No. 1 and SEQ ID NOs: 1 and 3 to 6 in WO2006 / 110689 (see, for example, WO2006 / 110689; see ... 9, SEQ ID NOS: 5-38), WO2009 / 104964 (e.g., '964 (See SEQ ID NOS: 1 to 5, 7, 9, 20, 22, 24 and 31 in WO2010 / 1 No. 27097 (see, for example, SEQ ID NOs: 5 to 38 in No. '097), and WO2015 / No. 191508 (see, e.g., SEQ ID NOS: 80-294 of '508), and U.S. application Ser. Publication No. 20150023924 (see, for example, SEQ ID NOs: 1, 5-10 in Publication No. '924) At least one VP1, VP2, and / or VP3 sequence of the disclosed AAV capsid All are 80% or more identical, for example, 85%, 85%, 87%, 88%, 89%, 90%, 91% %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% etc. i.e., have capsid proteins that are up to 100% identical to those of these patents each of which is incorporated herein by reference in its entirety.
[0187] Nucleic acid sequences of AAV-based viral vectors and recombinant AAV and AAV capsids Methods for preparing the cellulose acetate ester are described, for example, in U.S. Pat. Nos. 7,282,199 and 7,906,111. ; Same No. 8,524,446; Same No. 8,999,678; Same No. 8,628,966; Same No. 8,927,514; Same No. 8,734,809; Same No. 9,284,357; Same No. 8,734,809; Same No. 9,284,357; No. 9,409,953; No. 9,169,299; No. 9,193,956; No. 9,193,956; 9,458,517; and 9,587,282; U.S. Patent Application Publication No. 2015 / 03 No. 74803; No. 2015 / 0126588; No. 2017 / 0067908; No. 2017 / 0067908; No. 2013 / 0224836; No. 2016 / 0215024; No. 2017 / 00 51257; International Patent Application No. PCT / US2015 / 034799; International Patent Application No. PCT / E P2015 / 053335; WO2003 / 052051, WO2005 / 03332 1, WO03 / 042397, WO2006 / 068888, WO2006 / 11068 9, WO2009 / 104964, WO2010 / 127097, and WO2015 / 1 91508, as well as U.S. Patent Application Publication No. 20150023924.
[0188] In additional embodiments, the rAAV particles comprise pseudotyped AAV capsids. In some embodiments, the pseudotyped AAV capsid is rAAV2 / 8 or is a rAAV2 / 9 pseudotyped AAV capsid. Pseudotyped rAAV particles Methods for producing and using the products are known in the art (see, e.g., Duan et al., J. Am. Chem. Soc. 1999, 144:131-132). et al., J. Virol., 75:7662-7671(2001);Halbe rt et al.,J.Virol.,74:1524-1532(2000);Zo lotukhin et al.,Methods 28:158-167(2002) ; and Auricchio et al., Hum. Molec. Genet. 10: See 3075-3081, (2001).
[0189] In certain embodiments, single-stranded AAV (ssAAV) may be used. In this embodiment, a self-complementary vector, such as scAAV, may be used (e.g., , Wu,2007,Human Gene Therapy,18(2):171-82 ,McCarty et al,2001,Gene Therapy,Vol.8,N Umber 16, Pages 1248-1254; and U.S. Pat. No. 6,596, See US Pat. Nos. 535; 7,125,717; and 7,456,683. each of which is incorporated herein by reference in its entirety).
[0190] In some embodiments, the rAAV particles are selected from AAV8 or AAV9. In some embodiments, the capsid protein is derived from an AAV capsid serotype. The rAAV particles are AAV7, AAV8, AAV9, AAV.rh8, and AAV.rh 10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1 , AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AA an AAV capsid serotype selected from the group consisting of V.PHP.eB, and AAV.7m8 In some embodiments, the rAAV particles comprise capsid proteins derived from AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV. AA such as RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37 It contains a capsid protein with high sequence homology to V8 or AAV9. In some embodiments, the rAAV particles comprise AAV1 or a derivative, variant, or In some embodiments, the rAA The V particles are AAV4 or derivatives, variants, or pseudotypes of AAV capsids. In some embodiments, the rAAV particles have an AAV5 or AAV6 serotype. Derivative, modified, or pseudotyped AAV capsid serotypes. In embodiments, the rAAV particles are AAV8 or derivatives, variants, or syngeneic variants thereof. In some embodiments, the rAAV particles have a serotype of AAV capsid. The child is infected with AAV9 or its derivatives, variants, or pseudotypes containing AAV capsids. It has a clear form.
[0191] In some embodiments, the rAAV particles contain AAV8 or AAV9 capsids. Capsid proteins include those that are derivatives, variants, or pseudotypes of the capsid proteins. In some embodiments, the rAAV particles comprise the AAV8 capsid proteins VP1, VP2, VP3, VP4, VP5, VP6, VP7, VP8, VP9, VP10, VP11, VP12, VP13, VP14, VP15, VP16, VP17, VP18, VP19, VP19, VP11, VP12, VP13, VP 2 and / or VP3 sequences, e.g., 85%, ,87%,88%,89%,90%,91%,92%,93%,94%,95%,96% , 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical AAVs In some embodiments, the capsid protein comprises 8 capsid proteins. The rAAV particles may contain derivatives, variants, or pseudotypes of the AAV9 capsid protein. In some embodiments, the rAAV particles comprise a capsid protein that is an A At least one of the VP1, VP2 and / or VP3 sequences of the AV9 capsid protein 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc. That is, capsid proteins with AAV8 capsid proteins that are up to 100% identical Contains lactic acid bacteria.
[0192] In some embodiments, the rAAV particles comprise AAV7, AAV8, AAV9, AA V.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh7 4, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, or AAV.7m8 capsid protein At least 80% identity to the VP1, VP2 and / or VP3 sequences of For example, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100 In some embodiments, the rAAV comprises a capsid protein having at least one nucleotide sequence identical to that of the rAAV. The particles are AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37 AAV capsid proteins with high sequence homology to either AAV8 or AAV9 At least 80% identity to the VP1, VP2 and / or VP3 sequences of For example, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100 % identity to the capsid protein.
[0193] In additional embodiments, the rAAV particles comprise mosaic capsids. The particles are composed of a mixture of viral capsid proteins from different AAV serotypes. In some embodiments, the rAAV particles are selected from the group consisting of AAV1, AAV2, AAV3, and AAV5. , AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh 8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AA V.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65 , AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV 2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AA V.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HS C7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11 , AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16. Contains capsids.
[0194] In some embodiments, the rAAV particles comprise AAV1, AAV2, AAV5, AA V6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh. It comprises a mosaic capsid containing capsid proteins of serotypes selected from 10.
[0195] In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles. In some embodiments, the pseudotyped rAAV particles comprise: (a) AAV ITRs; and (b) a nucleic acid vector comprising an AAVx (e.g., AAV1, AAV3, AAV4, AA V5, AAV6, AAV7, AAV8, AAV9, AAV10AAV11, AAV12, Capsid proteins derived from AAV13, AAV14, AAV15, and AAV16 In additional embodiments, the rAAV particles comprise a capsid composed of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV17, AAV18, AAV19, AAV20, AAV21, AAV22, AAV23, AAV24 AV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, A AV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV1 6, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV .Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.h u37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.P HP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV .LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC 4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AA V.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV from AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 Pseudotyped rAAVs composed of capsid proteins of selected AAV serotypes In additional embodiments, the rAAV particles comprise AAV8 capsid proteins. In additional embodiments, the rAAV particles include pseudotyped rAAV particles containing contains pseudotyped rAAV particles composed of AAV9 capsid proteins. In some embodiments, the pseudotyped rAAV8 or rAAV9 particles are AAV2 / 8 or rAAV2 / 9 pseudotyped particles. Methods for producing and using AV particles are known in the art (e.g., Du an et al.,J.Virol.,75:7662-7671(2001);Ha lbert et al., J. Virol., 74:1524-1532 (2000) ;Zolotukhin et al.,Methods 28:158-167(20 02); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001).
[0196] In additional embodiments, the rAAV particles contain capsids of two or more AAV capsid serotypes. In a further embodiment, the capsid comprises a capsid containing a capsid protein chimera. Proteins include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, A AV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV .Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AA V.PHP.eB, AAV2.5, AAV2tYF, AAV3B, rAAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV. HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9 , AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13 AAV.HSC14, AAV.HSC15, and AAV.HSC16. It is a chimera of two or more AAV capsid proteins from AV serotypes. In terms of form, the capsid protein is AAV1, AAV2, AAV5, AAV6, AA V7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10 It is a chimera of two or more AAV capsid proteins from the AAV serotype of choice.
[0197] In some embodiments, the rAAV particles comprise an AAV8 capsid protein and an AA V1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AA V9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39 , AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.e B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1 , AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV .HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC 10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC derived from an AAV serotype selected from AAV.HSC14, AAV.HSC15, and AAV.HSC16 and AAV capsid protein chimeras with one or more AAV capsid proteins. In some embodiments, the rAAV particles comprise an AAV8 capsid protein and an AAV 1, AAV2, AAV5, AAV6, AAV7, AAV9, AAV10, AAVrh.8 and one or more AAV capsids derived from an AAV serotype selected from AAVrh.10. It contains an AAV capsid protein chimera with a capsid protein.
[0198] In some embodiments, the rAAV particles comprise the AAV9 capsid protein AAV 1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV 9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and A AV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, A AV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB , AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV. HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC1 0, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC1 one or more AAV capsules selected from AAV.4, AAV.HSC15, and AAV.HSC16 It includes AAV capsid protein chimeras of capsid proteins of the serotypes.
[0199] In some embodiments, the rAAV particles comprise the AAV9 capsid protein AAV 1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9 , AAVrh.8, and AAVrh.10. The present invention also includes AAV capsid protein chimeras of the capsid protein of the present invention.
[0200] In some embodiments, the rAAV particles are of Clade A, B, E, or F. In some embodiments, the rAAV particles comprise Cl In some embodiments, the rAAV comprises the AAV capsid protein ade F. The particles contain Clade E AAV capsid proteins.
[0201] Table 9 below shows the AAV8, AAV9, AAV.rh74, AAV.hu31, and AAV. The amino acid sequences of the hu32 and AAV.hu37 capsid proteins and the AAV2 Examples of nucleic acid sequences for 5'-ITR and 3'-ITR are provided. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5]
[0202] The provided methods are suitable for use in producing recombinant AAV encoding a transgene. In certain embodiments, the transgene is a microgene described herein. In some embodiments, the rAAV genome comprises the following components: (1) AAV terminal inverted repeat sequences flanking the expression cassette; (2) regulatory control elements, e.g. a) a promoter / enhancer, b) a polyA signal, and c) optionally an insert. (3) a vector containing a nucleic acid sequence encoding the transgene described. In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 inverted terminal repeats (ITRs) flanking the expression cassette; (2) Muscle-specific SPc5.12 promoter and regulatory elements including a small poly(A) signal; and (3) providing a nucleic acid encoding the micro-dystrophin described herein. In certain embodiments, the transgenes described herein include transgenes (e.g., encoding). The constructs consist of the following components: (1) AAV2 or AAV8 vectors flanking the expression cassette; ITR; (2) a) muscle-specific SPc5.12 promoter, b) containing a small poly(A) signal and (3) a regulatory element containing, from the N-terminus to the C-terminus, ABD1-H1-R1-R2-R 3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H 4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT In certain embodiments, the co-transfected vectors described herein comprise a dystrophin cassette. The construct contains the following components: (1) AAV2 or AAV8 I vectors flanking the expression cassette; TR; (2) a) CNS promoter, b) control elements including a small poly(A) signal; and (3) ABD1-H1-R1-R2-R3-H3-R24-H from N-terminus to C-terminus. 4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, AB D-H1-R1-R2-R16-R17-R24-H4-CR, or ABD-H1-R Microdystrophin containing 1-R2-R16-R17-R24-H4-CR-CT In certain embodiments, the constructs described herein comprise a set of: Components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) a) muscle specific a) heterologous SPc5.12 promoter, b) intron (e.g., VH4), and c) small poly(A) (3) a regulatory element containing a signal; and (4) an ABD1-H1-R 1-R2-R3-H3-R24-H4-CR, ABD1-H1-R1-R2-R3-H3 -R24-H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H 4-CR, or ABD-H1-R1-R2-R16-R17-R24-H4-CR-C A microdystrophin cassette containing T (ABD1 is directly linked to VH4) In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) a) CNS promoter a) regulatory elements including a) a promoter, b) an intron (e.g., VH4) and c) a small poly(A) signal and (3) ABD1-H1-R1-R2-R3-H3-R from the N-terminus to the C-terminus. 24-H4-CR, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-C T, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or ABD- Microdystrophy containing H1-R1-R2-R16-R17-R24-H4-CR-CT In certain embodiments, the fin cassette (ABD1 is directly linked to VH4) The constructs described herein comprise the following components: (1) an expression cassette; (2) a) AAV2 or AAV8 ITR containing the muscle-specific SPc5.12 promoter or or CNS promoter, b) an intron (e.g., VH4), and c) a small poly(A) signal. and (3) a regulatory element comprising, from the N-terminus to the C-terminus, ABD1-H1-R1-R2 -R3-H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24 -H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR , or containing ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT Contains a micro-dystrophin cassette (ABD1 directly linked to VH4). In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) a) muscle-specific SPc5.1 a) a regulatory sequence containing two promoters, b) an intron (e.g., VH4) and c) a small poly(A) signal and (3) from N-terminus to C-terminus, ABD1-H1-R1-R2-R3- H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24-H4- CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or Microscope containing ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT Contains the dystrophin cassette (ABD1 is directly linked to VH4). In an embodiment, the present invention comprises an AAV ITR flanking a micro-dystrophin expression cassette. The constructs described herein are, from N- to C-terminus, ABD1-H1-R1-R2 -R3-H2-R24-H4-CR, ABD1-H1-R1-R2-R3-H2-R24 -H4-CR-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR , or ABD-H1-R1-R2-R16-R17-R24-H4-CR-CT In some embodiments, the length may be between 4000 nt and 5000 nt. Constructs such as 4900nt, 4800nt, 4700nt, and 4600nt , 4500nt, 4400nt, or 4300nt in length.
[0203] Some nucleic acid embodiments of the present disclosure include SEQ ID NOs: 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, Microdisks containing or consisting of 55, 56, or 82 nucleotide sequences. In various embodiments, the rAAV vector includes a strophin-encoding vector. nucleotide sequences of 53, 54, 55, 56, 82 or their reverse complements. at least 50%, at least 60%, at least 70%, at least 75%, at least 8 0%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity and are therapeutically effective microgenes in muscle cells. rAAV vector suitable for the expression of strophin, comprising a nucleotide sequence encoding the rAAV vector AAV vectors. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] Table 10-5 Table 10-6 Table 10-7 Table 10-8 Table 10-9 Table 10-10 Table 10-11 Table 10-12 Table 10-13 Table 10-14 Table 10-15 Table 10-16 Table 10-17 Table 10-18 Table 10-19 Table 10-20 Table 10-21 Table 10-22 Table 10-23 Table 10-24 Table 10-25 Table 10-26 Table 10-27 Table 10-28 Table 10-29 Table 10-30 Table 10-31 [Table 10-32]
[0204] 5.3.5 Methods for producing rAAV particles Another aspect of the present invention involves making the molecules disclosed herein. In embodiments, the molecules of the present invention comprise any of the capsid protein molecules herein. providing a nucleotide sequence containing the encoding nucleic acid sequence and using a packaging cell line The corresponding rAAV particles with a capsid coat composed of capsid proteins were prepared using the Such capsid proteins are prepared by the method described in Section 5 above. In some embodiments, the nucleic acid sequence is a sequence as described herein. at least 60%, 70%, 80%, 85%, or 90%, or 95%, preferably 96%, 97%, 98%, 99% or 99.9% and encoding a sequence having identity to a capsid protein and a heterologous protein or retains (or substantially retains) the biological function of the inserted peptide from the domain In some embodiments, the nucleic acid is a sequence similar to that of an AAV8 capsid protein. At least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 9 6%, 97%, 98%, 99% or 99.9% identity to the sequence, retains the biological function of the AAV8 capsid protein and inserted peptide (or substantially retained).
[0205] Capsid proteins, coats, and rAAV particles are known in the art. In some embodiments, the viral genome can be produced by a vector. It contains at least one terminal inverted repeat sequence that allows packaging into a In an embodiment, the viral genome comprises a cap gene and / or expression of the cap gene. In an embodiment, the cap and rep genes are further included for splicing. The p gene is provided by the packaging cell and is not present in the viral genome.
[0206] In some embodiments, the nucleic acid encoding the engineered capsid protein is a nucleic acid encoding a previously cloned into the AAV Rep-Cap plasmid in place of the existing capsid gene When introduced into a host cell together, this plasmid encodes the rAAV genome in an encapsidated form. The capsid protein is engineered to act as a protective covering, helping to package the virus into the packaging cell. The vesicles are necessary to facilitate AAV genome replication, capsid assembly, and packaging. The cell type may be any cell type that contains the desired gene.
[0207] Many cell culture systems are known in the art for the production of rAAV particles, including Any of these can be used to practice the methods disclosed herein. These include transfection, stable cell line production, and infectious hybrid virus production systems. These include, but are not limited to, adenovirus-AAV hybrids. , herpesvirus-AAV hybrids and baculovirus-AAV hybrids Included are rAAV production cultures for the production of rAAV viral particles that require: (1) Suitable cell lines, including, for example, human-derived cell lines, mammalian cell lines, or insect-derived cell lines, (2) wild-type or mutant adenovirus (such as temperature-sensitive adenovirus) ), herpesvirus, baculovirus, or a plasmid that provides helper functions. (3) AAV rep and cap genes and gene products; (4) transgenes (transgenes) flanked by AAV ITR sequences (transgenes). (4) cell growth / transgenes (e.g., therapeutic transgenes) and optionally regulatory elements; and (5) cell growth / transgenes. Suitable media and media components (nutrients) to support survival and rAAV production.
[0208] Non-limiting examples of host cells include A549, WEHI, 10T1 / 2, BHK, and MD. CK, COS1, COS7, BSC1, BSC40, BMT10, VERO, W138, HeLa, HEK293 and their derivatives (HEK293T cells, HEK293F cells) ), Saos, C2C12, L, HT1080, HepG2, primary fibroblasts, hepatocytes, Myoblasts, CHO cells or CHO-derived cells, or insect-derived cell lines such as SF-9 ( For example, in the case of baculovirus production systems. -Ubillus et al.,2018,Appl. Microbiol. Bi 102:1045-1054 for manufacturing techniques. is incorporated herein by reference in its entirety.
[0209] In one aspect, provided herein are: (a) a cell culture comprising insect cells; (b) i. the rAAV genome to be packaged, ii. sufficient for packaging; AAV rep protein, and iii. AAV cap protein sufficient for packaging. One or more baculovirus vectors encoding at least one of the proteins are introduced into the cells. (c) adding sufficient nutrients to the cell culture and producing rAAV particles. and maintaining the cell culture under conditions that allow for the production of rAAV particles. In some embodiments, the method comprises: a baculovirus vector encoding the rAAV genome and a second baculovirus vector encoding the rAAV genome. In some embodiments, the method includes using a vector to express the rAAV genome. Using a baculovirus encoding the rep and cap genes and insect cells expressing the rep and cap genes, In some embodiments, the method comprises: This involves using a baculovirus vector encoding the rAAV genome. In some embodiments, the insect cells are Sf-9 cells. In an insect cell, one or more stably integrated heterologous vectors encoding the rep and cap genes are introduced. Sf-9 cells containing the polynucleotide.
[0210] In some embodiments, the methods disclosed herein involve the use of a baculovirus production system In some embodiments, the baculovirus production system uses rep and ca The first baculovirus encodes the p gene and the second encodes the rAAV genome. In some embodiments, the baculovirus production system is , a baculovirus encoding the rAAV genome and expressing the rep and cap genes In some embodiments, the baculovirus production system uses a re A baculovirus is used that encodes the p and cap genes and the rAAV genome. In some embodiments, the baculovirus production system is produced in insect cells, such as Sf-9 cells. Use.
[0211] Those skilled in the art will appreciate that AAV rep and cap genes, AAV helper genes (e.g., adenoviruses), viral E1a gene, E1b gene, E4 gene, E2a gene, and VA gene); and the rAAV genome (one or more target sequences flanked by inverted terminal repeats (ITRs) Those who can introduce the vector (including genes) into cells to produce or package rAAV The term "adenovirus helper function" refers to the ability of AAV to function intracellularly. Many of these proteins are expressed intracellularly (as RNA or protein) to allow efficient growth in the The term "helper gene" refers to a number of viral helper genes. Those skilled in the art will recognize that the term "helper gene" refers to adenovirus and herpes simplex virus. We have demonstrated that helper viruses, including hepatitis C virus (HSV), promote AAV replication and provide essential functions. It is understood that certain genes that provide This can induce changes to the cellular environment that facilitate AAV gene expression and replication, such as In some embodiments of the methods disclosed herein, the AAV rep and cap genes , helper genes, and the rAAV genome contains the AAV rep and cap genes, helper genes, Using one or more plasmid vectors encoding the parenchymal permease gene, as well as the rAAV genome. The vector is introduced into the cell by transfection. In some embodiments, the AAV rep and cap genes, helper genes, and The rAAV genome is a viral vector, e.g., containing the AAV rep and cap genes, Transduction with rHSV vectors encoding the lupar gene and the rAAV genome In some embodiments of the methods disclosed herein, The AAV rep and cap genes, helper genes, and rAAV genome One or more of these are introduced into cells by transduction with rHSV vectors. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper genes. In some embodiments, the rHSV vector encodes an rAAV genome. In some embodiments, the rHSV vector contains the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper genes and In some embodiments, the rHSV vector encodes a rAAV genome. It encodes the par gene and the AAV rep and cap genes.
[0212] In one aspect, provided herein is a method for producing a cell culture comprising: (a) a host cell; (b) i. the rAAV genome to be packaged; ii. the packaging of the rAAV particles; iii. AAV rep proteins sufficient for packaging and iv. at least one of the AAV cap proteins sufficient for packaging. (c) introducing into the cell one or more rHSV vectors encoding one or more of the Add sufficient nutrients and culture the cells under conditions that allow for the production of rAAV particles. In some embodiments, the method comprises: In some implementations, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions. In the present invention, the rHSV vector contains one or more endogenous genes encoding helper functions. In some embodiments, the rHSV vector contains one or more genes encoding helper functions. In some embodiments, the rHSV vector comprises a heterologous gene. In some embodiments, the rHSV vector encodes an AAV rep and cap genes. In some embodiments, the rHSV vector In some embodiments, the rHSV vector encodes the rAAV genome. The vector contains helper functions as well as the AAV rep and cap genes. In embodiments, the cells contain one or more stably integrated genes encoding the rep and cap genes. The heterologous polynucleotide comprises a heterologous polynucleotide.
[0213] In one aspect, provided herein is a method for producing a cell culture comprising: (a) culturing mammalian cells; (b) providing i. the rAAV genome to be packaged; ii. the packaging of the rAAV particles; iii. AAV rep proteins sufficient for packaging and iv. at least one of the AAV cap proteins sufficient for packaging. (c) introducing into the cell one or more polynucleotides encoding one or more of the Add sufficient nutrients to the medium and culture the cells under conditions that allow for the production of rAAV particles. In some embodiments, the method comprises maintaining the rAAV particles. In some embodiments, the helper functions are encoded by adenoviral genes. In this embodiment, the mammalian cell contains one or more stably expressed genes encoding the rep and cap genes. Contains an integrated heterologous polynucleotide.
[0214] AAV rep and cap genes, helper genes, and / or rAAV genome The molecular biology techniques for developing plasmid or viral vectors to load the In some embodiments, AAV rep and The cap gene is encoded by one plasmid vector. In the AAV helper gene (e.g., adenovirus E1a gene, E1b gene), , E4 gene, E2a gene, and VA gene) are expressed by a single plasmid vector. In some embodiments, the E1a gene or the E1b gene is encoded by the host The remaining AAV helper genes are stably expressed by the cells and are contained in a single viral vector. In some embodiments, the vector is introduced into the cell by transfection with a vector. Thus, the E1a and E1b genes are stably expressed by the host cell, and the E4 gene The E2a gene and the VA gene are transfected with one plasmid vector. In some embodiments, one or more helper genes are introduced into the cell. The gene is stably expressed by the host cell, and one or more helper genes are present in a single plasmid. It is introduced into cells by transfection with a smid vector. In embodiments, the helper genes are stably expressed by the host cell. In an embodiment, the AAV rep and cap genes are expressed by a single viral vector. In some embodiments, AAV helper genes (e.g., adenoviruses) are encoded by AAV helper genes. The viral E1a, E1b, E4, E2a, and VA genes , encoded by one viral vector. The E1b gene or E1b gene is stably expressed by the host cell and is transported through the remaining AAV helper - The gene is introduced into cells by transfection with a single viral vector. In some embodiments, the E1a and E1b genes are expressed by the host cell. The E4 gene, E2a gene, and VA gene are stably expressed by one virus. The vector is introduced into the cell by transfection. In the method, one or more helper genes are stably expressed by the host cell, and one or more The helper genes are introduced into cells by transfection with a single viral vector. In some embodiments, the AAV rep and cap genes, Adenovirus helper functions required for caging and the packaged rAAV genome can be produced by transfection with one or more polynucleotides, e.g., vectors. In some embodiments, the method disclosed herein comprises the steps of: two polynucleotides: those encoding the cap and rep genes, necessary for packaging those encoding essential adenoviral helper functions (e.g., adenoviral E1a genes) the E1b gene, the E4 gene, the E2a gene, and the VA gene), and the packaged The method involves transfecting cells with a mixture of rAAV genomes encoding the rAAV vectors. In some embodiments, the cap gene of AAV is the cap gene of AAV8 or AAV9. In some embodiments, the cap gene of AAV is AAV.rh 8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AA V.RHM4-1, AAV.hu37, AAV.PHB, or AAV.7m8cap genes In some embodiments, the cap gene of AAV is AAV.rh10 , AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, and Capsules with high sequence homology to AAV8 or AAV9, such as AAV.hu37 and AAV.hu37 In some embodiments, the packaged rAAV encodes a nucleotide sequence encoding a nucleotide sequence. The vector encoding the genome contains the gene of interest flanked by AAV ITRs. In some embodiments, the AAV ITRs are from AAV1, AAV2, AAV3, AAV 4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, A AV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV .rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM 4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV. 7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HS C1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, A AV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.H SC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.H SC14, AAV.HSC15, or AAV.HSC16 or other AAV serotypes It originates from
[0215] Any combination of vectors can be used to express AAV rep and cap genes, AAV vectors, The luper gene, as well as the rAAV genome, are used to produce or package rAAV particles. In some embodiments of the methods disclosed herein, rAAV genome containing the gene of interest flanked by AAV inverted terminal repeats (ITRs) a first plasmid vector encoding the AAV rep and cap genes; A second vector may be used, as well as a third vector encoding helper genes. In some embodiments, a mixture of three vectors is co-transfected into cells. In some embodiments, both plasmid and viral vectors are used. By doing so, a combination of transfection and infection is used.
[0216] In some embodiments, the rep and cap genes, as well as the AAV helper genes One or more of the molecules are constitutively expressed by the cell and can be transfected or In some embodiments, the cells are transduced with rep and / or c In some embodiments, the cells constitutively express one or more AA In some embodiments, the cells constitutively express V helper genes. In some embodiments, the cells constitutively express a gene encoding the rAAV genome. Contains a stable transgene.
[0217] In some embodiments, AAV rep, cap, and helper genes (e.g., , Ela gene, E1b gene, E4 gene, E2a gene, or VA gene) Similarly, the AAV ITRs can be of any AAV serotype. For example, in some embodiments, the AAV ITRs are from AAV1, AAV2, AA V3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, A AV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV. rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L 65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03 , AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV .HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC 9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC1 3, AAV.HSC14, AAV.HSC15, or AAV.HSC16 or other AAV serotypes (e.g., hybrid serotypes having sequences from more than one serotype) In some embodiments, the cap gene of AAV is derived from AAV8 or AAV9. In some embodiments, the AAV cap gene is derived from the AV9 cap gene. , AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 , AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV1 5 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.r h39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc 80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5 , AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC 2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AA V.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.H SC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.H SC15, AAV.HSC16, AAV.rh74, AAV.hu31, AAV.hu3 2, or AAV.hu37 or other AAV serotypes (e.g., derived from more than one serotype) In some embodiments, the r AAV rep and cap genes for the production of AAV particles are derived from different serotypes For example, the rep gene is derived from AAV2, while the cap gene is derived from AAV8. In another example, the rep gene is derived from AAV2, while the cap gene is derived from AAV It comes from 9.
[0218] In some embodiments, the rep gene is selected from AAV1, AAV2, AAV3, AA V4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, A AV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.R HM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AA V.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV. HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5 , AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV .HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV AAV.HSC14, AAV.HSC15, or AAV.HSC16 or other AAV sera types (e.g., hybrid serotypes having sequences from more than one serotype) In other embodiments, the rep and cap genes are from the same serotype. In an embodiment, the rep and cap genes are from the same serotype, and the rep gene is It contains at least one modified protein domain or modified promoter domain. In certain embodiments, at least one modified domain is distinct from the capsid serotype. The nucleotide sequence of the serotype is included. The variant domains within the rep gene allow for fragmentation of different serotypes. It may be a hybrid nucleotide sequence consisting of two or more fragments.
[0219] The hybrid rep genes are >4kb, >4.1kb, >4.2kB, and 4.3kb. >4.4kB, >4.5kb, or >4.6kb microdystrophin transgenes Packaging efficiency of rAAV particles, including packaging of the viral genome containing the progeny The AAV rep gene encodes nonstructural proteins necessary for viral replication and production. The rep gene consists of a nucleic acid sequence encoding a protein. Transcription of the rep gene is initiated by the p5 or p19 promoter. These proteins are initiated from the ribosomal ribosomal nucleases, which then give rise to two large non-structural Rep proteins (Rep78 and Rep90), respectively. Rep68) and two small non-structural Rep proteins (Rep52 and Rep40) Furthermore, the Rep78 / 68 domain recognizes specific ITR sequences within the ITRs. All four Rep proteins share a common helicase and It contains an ATPase domain and functions in genome replication and / or encapsidation ( Maurer AC,2020,DOI:10.1089 / hum.2020.069) Transcription of the cap gene is initiated from the p40 promoter, which is located in the rep gene. Since it is located within the C-terminus of the gene, other elements in the rep gene may affect p40 promoter activity. The p40 promoter domain contains transcription factor binding elements. The proteins EF1A, MLTF, and ATF, Fos / Jun binding element (AP-1 ), Sp1-like elements (Sp1 and GGT), and a TATA element (P ereira and Muzyczka,Journal of Virology, June 1997, 71(6):4300-4309). In some embodiments In some embodiments, the rep gene comprises a modified p40 promoter. The promoter contains EF1A-binding elements, MLTF-binding elements, and ATF-binding elements. ment, Fos / Jun binding element (AP-1), Sp1-like element (Sp1 or or GGT), or TATA element, are modified. In other embodiments, the rep gene is selected from serotypes 1, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, rh8, rh10, rh20, rh39, rh .74, RHM4-1, or hu37, which contain part of the p40 promoter domain or In yet another embodiment, the rep gene is , serotype 8 or 9, and a portion or element of the p40 promoter domain is present in serum It has been modified to Type 2.
[0220] The ITRs are the complementary sequences of A and A', the complementary sequences of B and B', and the complementary sequences of C and C'. The D sequence is contiguous with the ssDNA genome. The complementary sequence of the ITR is self-anchoring. The formation of hairpin structures by the binding of amino acids (Berns KI. The Unusual l Properties of the AAV Inverted Termina l Repeat. Hum Gene Ther 2020). The D sequence is Rep binding. It contains a terminal resolution element (RBE) and a terminal resolution site (TRS), which together form the AA The ITRs also play a role in the packaging of the genome after replication. In some embodiments, the ITR sequences and the cap gene are also required as a transcription signal. The gene may be a sequence of A and the complement of A', a sequence of B and the complement of B', a sequence of C and the complement of C', or D sequences contain sequences derived from a different serotype than the capsid. In some embodiments, the antibodies are derived from the same serotype, but may be modified. In another embodiment, the modified ITR sequence is derived from the same serotype as the rep gene. The TR sequence and the cap gene are A and A' complementary sequences, B and B' complementary sequences, C and C ', or a complementary sequence of the ITR sequence selected from the D sequence, ap gene) and one or more of the ITR sequences are the same as the rep gene. Except that they are derived from different serotypes.
[0221] In some embodiments, the rep and cap genes are from the same serotype, The p gene contains a modified Rep78 domain, a DNA-binding domain, and an endonuclease domain, ATPase domain, helicase domain, p5 promoter domain, R ep68 domain, p5 promoter domain, Rep52 domain, p19 promoter The p40 promoter domain may comprise a Rep40 domain, a Rep40 domain, or a p40 promoter domain. In this embodiment, the rep and cap genes are derived from the same serotype, and the rep gene is derived from a different Contains at least one protein domain or promoter domain derived from a serotype. In one embodiment, the rAAV contains a transgene flanked by AAV2 ITR sequences. In another embodiment, the vector comprises a hybrid AAV2 / 8 rep vector, an AAV8 cap vector, and an AAV2 / 8 rep vector. In AAV2 / 8 rep, the p40 promoter domain or a part of it is serotype In another embodiment, the AA V2 / 8 rep is a virus whose p40 promoter domain or part of it is identical to that of serotype 8 rep. In some embodiments, the hybridization vector includes serotype 2 rep, except that it is derived from More than two serotypes may be utilized to construct the rep / cap plasmid. .
[0222] Cells can be transfected using any suitable method known in the art. and for producing rAAV particles according to the methods disclosed herein. In some embodiments, the methods disclosed herein can include chemical transcription. Some transfection methods involve transfecting cells. In embodiments, the chemical transfection method is carried out using calcium phosphate, highly branched organic compounds (dendrimers), cationic polymers (e.g., DEAE dextran or or polyethyleneimine (PEI), lipofection. In some embodiments, chemical transfection methods involve the use of cationic polymers (e.g., DEAE). In some embodiments, dextran or polyethyleneimine (PEI) is used. In this study, the chemical transfection method uses polyethyleneimine (PEI). In some embodiments, the chemical transfection method is DEAE dextran. In some embodiments, the chemical transfection method uses phosphate catalysis. Uses Calcium.
[0223] Recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., Standard techniques can be used for transfection (electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as otherwise known in the art. This can be done as commonly accomplished or as described herein. The techniques and procedures generally follow conventional methods well known in the art. and various general and more specific references cited and discussed throughout this specification. This can be done as described in the literature, e.g., Sambrook et al., Molecular Cloning:A Laboratory Manual(2d ed.,Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY (1989)). is incorporated herein by reference for all purposes. Unless otherwise specified, the analytical chemistry, synthetic organic chemistry, and medicinal chemistry and The nomenclature utilized in connection with pharmaceutical chemistry, and the laboratory procedures and techniques therein, are the property of their respective owners. These are well known and commonly used in the fields of chemical synthesis, chemical analysis, Standard techniques may be used for preparation, formulation, and delivery of pharmaceuticals and treatment of patients. .
[0224] Nucleic acid sequences of AAV-based viral vectors, as well as recombinant AAV and AAV capsules Methods for producing sids are described, for example, in US Pat. No. 7,282,199; US Pat. No. 7,790,449; S8,318,480; US8,962,332; and PCT / EP2014 / 0764 66, each of which is incorporated herein by reference in its entirety. do.
[0225] In a preferred embodiment, rAAV is used for therapeutic and The present invention provides transgene delivery vectors that can be used in therapeutic and prophylactic applications.
[0226] 5.4. Therapeutic utility Recombinant gene therapy vectors encoding microdystrophins as disclosed herein A method for assaying a construct comprising the polypeptide for therapeutic efficacy is provided, the method comprising: Both in vitro studies and in vivo studies in the animal models described herein Alternatively, there are known methods in the art for testing the activity and efficacy of microdystrophin. This includes using any other method known in the art.
[0227] 5.4.1 In vitro assays 5.4.1.1 In vitro infection systems for muscle cells Methods for testing the infectivity of recombinant vectors, e.g., rAAV particles, disclosed herein For example, the infectivity of recombinant gene therapy vectors in muscle cells is determined by the present method. It can be tested in C2C12 myoblast cells as described in Example 2 of the specification. Although not limited to these, T0034 (human), L6 (rat), MM14 (mouse), P 19 (mouse), G-7 (mouse), G-8 (mouse), QM7 (quail), H9c2 ( 2-1) (rat), Hs74.Ht (human), and Hs171.Ht (human) cell lines Several muscle or cardiac cell lines are available, including: Microdystrophies can be assessed using polymerase chain reaction technology. Microdystrophin expression levels were measured by measuring the mRNA levels of microdystrophin in cells. It can be tested by
[0228] 5.4.2 Animal models A virus containing a transgene encoding microdystrophin as described herein. The efficacy of the vector was evaluated in, for example, mdx mice and / or golden retriever muscle groups. By using the GRMD model, we were able to identify mutant genes that could be administered to animal models. To replace strophin and evaluate the biodistribution, expression, and therapeutic effects of transgene expression The therapeutic effect can be tested by, for example, This can be assessed by assessing changes in muscle strength in animals treated with the gene. Also, animal models using large mammalian and non-mammalian vertebrates and invertebrates. The models can also be used to evaluate the preclinical therapeutic efficacy of the vectors described herein. Therefore, it is possible to evaluate the efficacy of a treatment according to the method disclosed herein. and a vector encoding a microdystrophy gene disclosed herein in an amount that has been demonstrated to be effective in the production of a dystrophy gene. Compositions and methods for therapeutic administration, including doses of ribozymes, are provided.
[0229] 5.4.2.1 Mouse model The efficacy of gene therapy vectors can be evaluated in mouse models of DMD. x mouse model (Yucel, N., et al., Humanizing the mouse x mouse model of DMD:the long and the sh ort of it,Regenerative Medicine volume 3 ,Article number:4(2018)) has a nonsense mutation in exon 23 This results in a premature stop codon and a truncated protein (mdx). Mice have three times higher blood levels of pyruvate kinase compared to littermate controls. Similar to the disease, mdx skeletal muscle exhibits active myofiber necrosis, cellular infiltration, and a wide range of myofiber sizes and This phenotype is accentuated in the diaphragm and is associated with progressive degeneration. This results in a loss of muscle fibers and a roughly five-fold decrease in isometric muscle contraction. Necrosis and regeneration in the fetus reaches its peak around 3-4 weeks after birth and then stagnates. Mdx mice and mdx mice crossed with other mouse backgrounds (e.g., DBA / 2J) In mice, a mild but significant reduction in cardiac ejection fraction is observed (Van Westering, Molecules 2015,20,8823-8855). Using DMD model mice, we investigated the cardiac function of the gene therapy vectors described herein. The protective effect or improvement or maintenance of cardiac function or alleviation of cardiac dysfunction can be evaluated. Example 3 of the present specification describes a gene therapy vector encoding microdystrophin. We detail the use of the mdx mouse model to evaluate
[0230] Additional mdx mouse models: mdx2cv, mdx3cv, mdx4cv, and mdx Different genetic backgrounds, including the 5cv strain (C57BL / 6 genetic background) Many alternative versions with different structures have been produced. These models are based on chemical collisions. Each strain was generated by treatment with the mutagen N-ethyl-N-nitrosourea. The lineages have different point mutations. Overall, the mdxcv model has significantly more phenotypes than mdx mice. There is little difference in the disease phenotypes observed when comparing the mdx strain with various knockout mouse models. del (e.g., Myod1 - / - , α-integrin 7 - / - , α-dystrobrevin - / - , and utrophin - / - Further mouse models were generated by crossing For a complete list of mouse models currently used in DMD research, see Yucel, N.,et al,Humanizing the mdx mouse model of DMD:the long and the short of it,npj Regenerative Medicine volume 3,Article n umber:4(2018), which is incorporated herein by reference.
[0231] 5.4.2.2 Dogs Most canine studies have been conducted in the Golden Retriever Muscular Dystrophy (GRMD) model. (Korneygay, JN, et al., The golden retriever model of Duchenne muscular dysbiosis trophy. Skeleton Muscle. 2017;7:9, the entire contents of which are incorporated by reference. Dogs with GRMD have a skeletal and cardiac phenotype with selective muscle pathology. Patients with this condition suffer from a progressive, fatal disease with a severe phenotype that more closely resembles that of DMD. Dogs with GRMD have exon skipping and out-of-frame DMD transcripts. The phenotypic features in dogs include serum CK levels Elevation, CRD on EMG, and histopathological evidence of clustered muscle fiber necrosis and regeneration Phenotypic variability is frequently observed in GRMD, as in humans. Dogs with D develop paradoxical muscle hypertrophy, which may contribute to the phenotype of affected dogs. Common features include stiffness when walking, reduced range of motion, and trismus. The objective biomarkers to be evaluated are tonic flexion, tibiofibular joint angle, and eccentric contraction rate. Decreases include maximum hip flexion angle, pelvic angle, anterior sartorius circumference, and quadriceps mass.
[0232] 5.5. Treatment method Any muscle dystrophy that can be treated by providing functional dystrophin. Methods of treating a human subject for DMD are provided. The most common of these diseases is the microdystrophin-producing disease provided herein. The gene therapy vectors that are currently being developed are those for Becker muscular dystrophy (BMD), myotonic dystrophy (MD), and Roffey's disease (Steinert disease), facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy -, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy The micro-dystrophins of the present disclosure can be any of the micro-dystrophins described herein. dystrophin, which may be dystrophin, and which has the following structure in order from the N-terminus to the C-terminus: ABD-H1-R1-R2-R3- H3-R24-H4-CR, ABD-H1-R1-R2-R3-H3-R24-H4-C R-CT, ABD-H1-R1-R2-R16-R17-R24-H4-CR, or A Contains the domain BD-H1-R1-R2-R16-R17-R24-H4-CR-CT wherein ABD is the actin-binding domain of dystrophin; and is the hinge 1 region of dystrophin, and R1 is the spectrin 1 region of dystrophin. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 2 region of dystrophin, and R3 is the dystrophin H3 is the spectrin 3 region of dystrophin, and R16 is the hinge 3 region of dystrophin. R16 is the spectrin 16 region of dystrophin, and R17 is the spectrin 16 region of dystrophin. R24 is the spectrin 16 region of dystrophin, and CR is the cysteine-rich region of dystrophin, and CT is the α1-syntrophin binding region. A small portion of the C-terminal region of dystrophin containing the α-dystrobrevin binding site and / or the α-dystrobrevin binding site In an embodiment, the micro-dystrophin is at least a part of SEQ ID NO: 1, 2, The amino acid sequence of the microdystrophin gene is 79, 91, 92, or 93. In certain embodiments, the vectors used may be constitutive expression, muscle-specific expression (skeletal muscle, regulatory elements for CNS-specific expression, including smooth muscle- and cardiac muscle-specific expression; and SEQ ID NOs: 20, 21, operably linked to other regulatory elements such as a polyA site. , 81, 101, 102 or 103. Such nucleic acids include those having the nucleic acid sequence For example, a rAAV genome flanked by ITR sequences, particularly AAV2 ITR sequences. In certain embodiments, SEQ ID NOs: 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, Constructs having nucleic acid sequences of 5, 56, 82, 104, 105, or 106 and administering to a subject in need thereof a rAAV comprising the rAAV. In the present invention, the patient has been diagnosed with DMD and / or has symptoms associated with DMD (including but not limited to: It is used to deliver a transgene encoding micro-dystrophin. Recombinant vectors that can be used are described in Section 5.3.4.1. The antibody must have tropism for human muscle cells (including skeletal, smooth, and / or cardiac muscle). These include non-replicating rAAVs, particularly those with AAV8 capsids. Recombinant vectors such as those shown in 22 are useful for expressing the recombinant vector in muscle tissue or CN. The recombinant vector can be administered in any manner that will allow it to enter the bloodstream, preferably by administering it to a mammalian host. The compound may be administered by introduction into the
[0233] Such gene therapy targets the muscle via delivery of micro-dystrophin. In certain embodiments, the method also includes the step of treating DMD. Becker muscular dystrophy (BMD), myotonic dystrophy (Steiner Facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy have been diagnosed with other muscular dystrophic diseases such as oculopharyngeal muscular dystrophy, or one or more symptoms associated with these disorders, and are treated with micro-dystrophin have been shown to respond to treatment or to induce genetic alterations via microdystrophin delivery. This includes treating patients who are deemed to be good candidates for gene therapy. In an embodiment, the patient has previously been treated with a synthetic version of dystrophin. and are known to respond to one or more synthetic versions of dystrophin. To determine the responsiveness of dystrophin to human cells, a synthetic version of dystrophin (e.g., in human cell cultures, bioreactors, etc.) The drug (e.g., produced by a chemist) can be administered directly to the subject.
[0234] A therapeutically effective dose of any such recombinant vector may be administered to a subject in need thereof, where the recombinant vector is administered to the muscle ( It should be administered in any manner that will allow the drug to enter the muscle (e.g., skeletal or cardiac muscle), preferably The vector is administered by introducing the recombinant vector into the bloodstream. In this case, the vector is administered subcutaneously, intramuscularly, or intravenously. Administration may involve targeting cells of muscle (including skeletal, cardiac, and / or smooth muscle) and / or CNS. Expression of the transgene product should occur in the muscle and and / or CNS. Alternatively, delivery may , which can result in gene therapy delivery and expression of micro-dystrophin in the liver, and then The soluble micro-dystrophin product is transported through the bloodstream to the muscle, where it exerts its therapeutic effect. In another embodiment, the recombinant vector can be used to confer the effects of For example, but not limited to, intrathecal, intracerebroventricular, intranasal, or suprachoroidal delivery. can be administered to
[0235] The actual dose administered to a particular subject will vary depending on factors including, but not limited to, body weight, severity of condition, and the like. , disease type, previous or current therapeutic interventions, subject specific diseases, and / or route of administration. The clinical outcome may be determined by the clinician, taking into account parameters such as physical and physiological factors, including do.
[0236] The dose is 1 x 10 8 Vector genome / (vg / kg) ~ 1 × 10 15 vg / kg range A therapeutically effective amount may be administered singly over the course of a treatment regimen (i.e., day, week, month, etc.). This can be achieved by administering a single or multiple doses.
[0237] Pharmaceutical compositions suitable for intravenous, intramuscular, subcutaneous or hepatic administration include physiologically compatible aqueous A composition comprising a transgene encoding micro-dystrophin in a formulation buffer comprising a buffer. The formulation buffer contains a suspension of recombinant vectors. It may include one or more of them.
[0238] The gene therapy vectors provided herein are intended to be used in combination with corticosteroids, beta-blockers, and May be administered in combination with other treatments for muscular dystrophy, including ACE inhibitors .
[0239] 5.5.1 Muscle degeneration / regeneration The lack of dystrophin leads to mechanical instability and weakening of muscle fibers, ultimately resulting in DMD patients first show skeletal muscle weakness early in childhood, then , which rapidly progresses to muscle loss, a curvature of the spine known as kyphosis, paralysis, and ultimately , and death from cardiopulmonary failure before age 30. Skeletal muscle in DMD patients also exhibits muscle hypertrophy, particularly Calf muscle hypertrophy, evidence of focal necrotic muscle fibers, abnormal variations in muscle fiber diameter, and They also showed increased fat deposition and fibrosis, as well as a lack of dystrophin staining in immunohistochemical sections. vinegar.
[0240] The target of the gene therapy treatments provided herein is DMD or other muscular dystrophies. - Slowing or stopping the progression of the disease or preventing DMD or other muscular dystrophy diseases The objective of the present invention is to reduce the severity of one or more symptoms associated with the disease. The goals of gene therapy are to reduce muscle degeneration, induce / improve muscle regeneration, and This can interfere with muscle growth and / or regeneration, leading to reduced athletic performance, orthopedic complications, and ultimately respiratory failure. The goal is to prevent / reduce downstream pathologies, including inflammation and fibrosis, that lead to heart failure and heart failure. do.
[0241] Efficacy is assessed by the North Star Ambulatory Assessment (N SAA) (an ordinal scale with 34 indicating complete independent functioning) or age-dependent To measure change from baseline in gross motor function using a modified assessment based on Assess changes in walking function (e.g., 6-minute walking distance <300 m, 300-400 m) or >400 m), and the increase from baseline in the time it takes to stand up from a supine position Conduct a time function test to measure changes (1-8 seconds (good), 8-20 seconds (moderate)). , and 20-35 seconds (poor), stair climbing time (4 steps) and running / walking time evaluation (10 minutes) muscle strength measurements to assess changes from baseline in upper and lower limb muscle strength. By implementing this, it is possible to monitor [Mazzone et al, North Star Ambulatory Assessment,6-minut e walk test and timed items in ambulant boys with Duchenne muscular dystrophy,Ne uromuscular disorders 20(2010)712-716].
[0242] The effectiveness also improves serum creatinine, an enzyme that becomes abnormally high when muscles are damaged. Change (decrease) in CK levels from baseline (normal: 35-175 U / L, DMD: 500–20,000 U / L), serum or urinary creatinine levels (DMD: 10~25μmol / L, mild BMD: 20~30μmol / L, normal >53μmol / L, DMD) and measuring microdystrophin protein levels in muscle biopsies In addition, the infiltration of adipose tissue into skeletal muscle (adipose tissue) can be monitored. Magnetic resonance imaging (MRI) can be performed to assess the rate of icz, J. et al. “Quantifying fat replacement of muscle by quantitative MRI in muscle ar dystrophy.” Journal of Neurology vol. 264,10(2017):2053-2067.doi:10.1007 / s0041 5-017-8547-3).
[0243] For example, the North Start Ambulatory System (North Start Ambulatory System) assesses walking function. compared to untreated controls or nucleic acid compositions as measured using the Pharmacokinetic Assessment Improve gross motor function or slow the decline in gross motor function compared to subjects before treatment with Nucleic acid compositions and methods of administering the compositions are provided, which may be used in combination with other nucleic acid compositions described herein. The nucleic acid composition and the method of administering the nucleic acid composition described herein are improvement in gross motor function as assessed by time function testing, muscle strength testing, and may be associated with a decrease in gross motor function or a decrease in serum creatine kinase (CK) levels. This results in a decrease in adipose tissue infiltration. Serum creatine kinase level was also found to be Isozyme fractions MM-CPK (skeletal muscle), BB-CPK (brain), and MB-CP It can be divided into K (heart).
[0244] Also, for example, the North Start Ambulatory Assessment or the time it takes to stand up from a supine position. The nucleic acid composition is more potent than untreated controls or untreated nucleic acid compositions when assessed by a time function test that measures the time Improve gross motor function or slow the decline in gross motor function compared to subjects before treatment with or improvement in muscle strength or reduction in serum creatine kinase levels. A method for producing a microdystrophin encoding the microdystrophin described herein, which is effective in showing Genes containing nucleic acid sequences, particularly vectors, viral vectors, and AAV vectors A composition is provided that includes a quantity of a nucleic acid composition that includes a gene cassette.
[0245] 5.5.2 Cardiac output Although skeletal muscle involvement is considered the defining feature of DMD, patients may also present with respiratory failure or Death is most commonly due to heart failure. DMD patients lack dystrophic heart cells, which are essential for contractile function. The absence of ATP in cardiac muscle cells leads to dilated cardiomyopathy (DCM). Extracellular calcium influx occurs, leading to protease activation, myocardial cell death, tissue necrosis, and inflammation This process begins with the triggering of This affects the left ventricle (LV), which is responsible for pumping blood to most of the body. , thicker and therefore experience a greater workload. Atrophied cardiomyocytes are Functionally, atrophy and scarring are structurally related to the LV. This leads to instability and hypokinesia, eventually progressing to the common DCM. Sinus tachycardia, decreased circadian index, decreased heart rate variability, shortened PR sensation, right ventricular hypertrophy, ST segment It may be accompanied by various ECG changes such as decreased blood pressure and QTc prolongation.
[0246] The gene therapy treatments provided herein may slow the progression of DMD and other dystrophinopathies. It is possible to slow or prevent the progression of cardiac dysfunction, and in particular to reduce or ameliorate the progression of cardiac dysfunction. and / or maintain or improve cardiac function. Efficacy can be assessed by continuous electrocardiograms and and non-invasive serial imaging (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). ) to assess the signs and symptoms of cardiac pathology or heart failure according to the age and stage of the study population. It can be monitored by periodic assessment. CMR is the forced vital capacity (FCV). (FVC), forced expiratory volume in 1 second (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), maximum Expiratory flow rate (PEF), peak expiratory flow rate during coughing, left ventricular ejection fraction (LVEF), left ventricular fractional shortening ( Used to monitor changes from baseline in LVFS, inflammation, and fibrosis An ECG can be used to monitor for conduction abnormalities and arrhythmias. In particular, the ECG displays the PR interval, the R wave in V1, the Q wave in V6, the ventricular repolarization, the inferior and / or QS waves in the superior lateral wall, conduction disturbances in right bundle branch block, QT C, and QRS It can be used to assess normalization of
[0247] Thus, the nucleic acid encoding the microdystrophin protein disclosed herein nucleic acid compositions, including compositions comprising gene expression cassettes and viral vectors, and methods of administering the compositions, wherein the compositions are administered in a manner that monitors continuous electrocardiograms and / or noninvasive serial imaging studies (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)) ), e.g., a decrease in LVEF below 45% and / or normal function Improve or maintain cardiac function by preventing a decline in cardiac function (LVFS ≥ 28%), or slow the loss of cardiac function. Measurements are taken from untreated controls or from pre-treatment with the nucleic acid composition. Alternatively, the nucleic acid compositions and nucleic acid compositions described herein can be administered to subjects The methods of administration include forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), maximum inspiratory pressure (MIP), and maximum Maximum expiratory pressure (MEP), maximum expiratory flow (PEF), maximum expiratory flow during coughing, left ventricular ejection fraction (LV Changes from baseline in left ventricular fractional shortening (LVFS), inflammation, and fibrosis were monitored. improved cardiac function or reduced loss of cardiac function as assessed by monitoring ECG can be used to monitor conduction abnormalities and arrhythmias In particular, the ECG should include PR interval, R wave in V1, Q wave in V6, ventricular repolarization, inferior and / or superior ventricular contractions. QS waves in the lateral wall, conduction disturbances in right bundle branch block, normalization of QT C and QRS can be used to evaluate.
[0248] 5.5.3 Central nervous system Some people with DMD also have other conditions such as epilepsy, learning and cognitive disabilities, dyslexia, and neurodevelopmental disorders, e.g. , attention deficit hyperactivity disorder (ADHD), autism, and / or obsessive-compulsive disorder, anxiety disorder, or may have psychiatric disorders such as sleep disorders.
[0249] The goal of the gene therapy treatments disclosed herein is to improve cognitive function or to treat dementia. The efficacy may be measured by the age of the study population, the severity of the symptoms of the disorder, and / or the psychiatric disorder. and periodic assessment of behavioral and cognitive function according to disease stage, or for quantifying and qualifying seizure events. Therefore, it can be evaluated.
[0250] Therefore, it can improve cognitive function, reduce the occurrence or severity of seizures, and improve ADHD, obsessive-compulsive disorder, Nucleic acid compositions and microgist for alleviating symptoms of sleep disorders, anxiety disorders and / or sleep disorders - Patents.com Methods for administering lophine gene therapy compositions are provided.
[0251] 5.5.4 Primary patient endpoints The effectiveness of the compositions (including dosages of the compositions) and methods described herein may be assessed by the Clinical evaluation of subjects may include primary patient outcomes including forced vital capacity (FVC). , forced expiratory volume in 1 second (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), maximum expiratory flow rate ( PEF), maximum expiratory flow rate during coughing, left ventricular ejection fraction (LVEF), left ventricular diameter shortening fraction (LVFS) Change from baseline in NSAA, change from baseline in Performance Change from baseline in the PUL score and Br Brooke Upper Extremity Scale score (Brooke score) Change from baseline in grip strength, pinch strength, and cardiac MRI Changes in muscle fibrosis score, muscle fat and fibrosis in the biceps evaluated by MRI, and dilation Leg strength measurement using a namometer, 6-minute walking test, 10-minute walking test, 3D walking record Changes in gait analysis by utrophin via quantitative imaging of immunostained biopsy sections To measure changes in membrane staining and the combination of fiber size and fetal myosin positivity This may include monitoring changes in regenerating fibers (via muscle biopsy) due to the , Mazzone E et al, North Star Ambulatory A ssessment,6-minute walk test and timed i tems in ambulant boys with Duchenne musc ular dystrophy. Neuromuscular Disorders 20(2010)712-716.;Abdelrahim Abdrabou Sad ek,et al,Evaluation of cardiac functions in children with Duchenne Muscular Dyst rophy:A prospective case-control study. Electron Physician(2017)Nov;9(11):5732-5 739;Magrath,P.et al,Cardiac MRI biomarke rs for Duchenne muscular dystrophy. BIOM ARKERS IN MEDICINE(2018)VOL.12,NO.11.;Pa ne,M.et al,Upper limb function in Duchen ne muscular dystrophy:24 month longitudi nal data. PLoS One.2018 Jun 20;13(6):e01 Please refer to 99223. [Example]
[0252] 6.1 Example 1 - Micro-dystrophin (DM) for Insertion of Cis Plasmid D) Construction of gene expression cassettes. DMD construct with similar backbone: 5'-ABD-H1-R1-R2-R3-H 3-R24-H4-CR-3' (Figure 1). The four constructs differed in promoter length. One lacks the C-terminus (RGX-DYS3) and the other lacks an intron (R GX-DYS1), and one with a truncated muscle-specific promoter (RGX-DYS4). All were cloned into a Cis plasmid flanked by ITRs. All coding DNA sequences are codon optimized and CpG removed.
[0253] 6.1.1. Recombinant Engineering of RGX-DYS1 and RGX-DYS2 Transgenes Briefly, as shown in Figure 1A, the N-terminus-ABD1-H1-R1-R2-R3-H RGX-DYS1 and RGX-D, encoding 3-R24-H4-CR-CT-C terminus Human codon optimization and CpG deletion of the YS2 microdystrophin construct The peptide sequences were synthesized by GeneArt Gene Synthesis (Invitrogen) The desired amine was synthesized using a cyclohexanediamine ester (Thermo Fisher Scientific, Waltham, MA). The C-terminus was determined using the following two primers: 5′: TGA CTC GAG AGG CCT A AT AAA GAG C (SEQ ID NO: 43), 3': CCT TGG AGA CTG TGG AGA GGT G (SEQ ID NO: 44) by site-directed mutagenesis. RGX containing VH4 intron sequence (see Section 6.1.4 below) To generate -DYS2, the nucleotide sequence encoding microdystrophin was The fragment containing the AAV ITRs, origin of replication, and antibiotic resistance was inserted into a backbone plasmid. The RGX-DYS2 plasmid construct was generated by covalent ligation of the RGX-DYS2 fragments. This revealed an extra cytosine (C) at the 5' splice site of the intron. Therefore, the extra C nucleotide was removed by site-directed mutagenesis. The resulting construct, RGX-DYS2, contains the VH4 intron. Site-directed mutagenesis was used to remove the VH4 intron, resulting in RGX-DYS1.
[0254] 6.1.2. Recombinant Engineering of RGX-DYS3 and RGX-DYS4 Transgenes Construct RGX-DYS3 (Figure 1A) was synthesized using RGX-DYS1 and R The GX-DYS2 construct encodes microdystrophin but lacks the CT domain. This construct was engineered to not contain a VH4 site at the 5' end of the construct. Contains throne.
[0255] RGX-DYS4 (Figure 1A) encodes the minimal SPc promoter but not the full-length SPc5-12 promoter. RGX- linked to the 5-12 promoter (SEQ ID NO: 40; see Section 6.1.3) A cassette encoding microdystrophin and a VH4 intron similar to DYS2 was inserted. Contains.
[0256] 6.1.3. RGX-DYS5 Recombination Construct RGX-DYS5 (Figure 1A) contains a 140 amino acid long C-terminal domain ( a truncated C-terminal domain having the amino acid sequence of SEQ ID NO: 83, DYS5 (SEQ ID NO: 1), which contains the dystrobrevin binding site but not the dystrobrevin binding site. engineered to encode a gene named microdystrophin (amino acid sequence of No. 79) The plasmid contains a human codon-optimized and CpG-depleted version of the microdystrophy gene. A DYS5 transgene, a synthetic muscle promoter (e.g., spc5-12), and a small promoter A (A) signal sequence is encoded and is flanked by ITRs (nucleotides of SEQ ID NO: 82). octide sequence).
[0257] Plasmid RGX-DYS5 is a long-range clone of the DYS1 plasmid RGX-DYS1. by replacing the C-terminus of the nucleotide with the C-terminal tail of the intermediate length version. In short, Integrated DNA Technologies , the C-terminus of the intermediate version flanked by EcoRV and NheI sites, and RGX-DYS The gBlock-DMD-1.5 tail containing the 17-bp overlapping sequence of one plasmid was combined. The source plasmid RGX-DYS1 was digested with the restriction enzymes NheI and EcoRV (Ne The DNA was digested with gBlock-DMD1.5 (England Biolabs) and then The tail was then in-fusion ligated. Enzymatic digestion and subsequent sequencing were performed. The final plasmid, RGX-DYS5, was confirmed by PCR.
[0258] The length and expression of the protein were confirmed by Western blot. Myoblast cell line C2C12 cells were transfected with different plasmids on day 4 of differentiation. Afterwards, cells were harvested in lysis buffer. 20 μg of cell lysates from each plasmid sample were The samples were loaded onto an SDS-PAGE gel. Micro-dystrophin protein bands were detected. To detect this, we used an antibody against dystrophin (1c7) (MANEX1011B, Dev The National Research and Developmental Studies Hybridoma Bank (NRIB) was used. Microdystrophin produced from the RGX-DYS5 plasmid (expressing DYS5) The protein band was significantly shorter than that of RGX-DYS1 (expressing DYS1) and DYS3 (Fig. 1B and C). In the experiment that generated Fig. 1B, the DYS3 transgene was driven by the ubiquitous CB promoter, whereas the DYS1 and DYS5 transgenes Expression was driven by a muscle-specific promoter. Consistent indicators of total protein recovery. As a control, α-actin protein was used (Fig. 1C).
[0259] To examine the packaging efficiency of RGX-DYS5, HEK293 cells were used. RGX-DYS5 was packaged into an AAV8 vector and cultured in a shake flask and affinity-transfected. The titer of the vector RGX-DYS5 was determined after purification. The average titer was determined based on these benchtops. In top production experiments, the AAV8 was higher than that packaged with RGX-DYS1, and This was equivalent to that of AAV8 packaged with X-DYS3 (data not shown).
[0260] 6.1.4. VH4 intron and minSPc5-12 promoter The VH4 introns of RGX-DYS2, RGX-DYS3, and RGX-DYS4 The immunoglobulin heavy chain variable region (SEQ ID NO: 41; GenBank accession number AB 019438.1) to assess the splicing efficiency and accuracy of the VH4 intron. The results were tested in vitro in C2C12 cells. First, the reverse transcription PCR products were sequenced. Sequencing was performed to determine whether the correct splicing events had occurred. RG X-DYS2 plasmid was transfected into C2C12 myoblasts, and the cells were cultured in differentiation medium. After culturing for 3 days, the cells were subjected to RNA extraction, cDNA synthesis, and PCR. The primers used were: Primer 1: GGC CCA CGA GCT ACC C GG AG (SEQ ID NO: 45), primer 2: CTT CCA GCA GAT CC The expected PCR product was gel purified and analyzed. The sequencing results showed accurate splicing events. The microdystrophin coding sequence was then transfected into a GFP reporter vector. - The function of the VH4 intron was tested using a construct in which the VH4 intron was replaced with the coding sequence of a protein. In addition, we investigated the effect of VH4 intron-containing or -free SPs on differentiated C2C12 cells. An AAV8 vector containing the GFP gene driven by the c5-12 promoter was used. Various doses were tested. Images were taken and analyzed using Cytation 5 Cell Imaging. g Quantification was performed using a Multi-Mode Reader. Quantification and image data were All showed that the VH4 intron increased GFP expression by approximately 5-fold (Fig. 2A-F and and Figure 3).
[0261] 6.2 Example 2 - Expression of Micro-Dystrophin Vectors Using Differentiated C2C12 Cells In vitro potency assay Assaying the infectivity of AAV8-CAG-GFP vectors in HEK293 cells In vitro assay to test the efficacy of micro-dystrophin vectors The assay was developed using GFP-positive HEK293 cells 3 days after infection (1 x 10E5 vg / cell). Few cells were observed (data not shown), indicating that the AAV8 vector was not transfected into HEK293 cells. The AAV8-CAG-GFP vector was then used to infect C2C12 The ability to transduce myoblasts was also tested. Undifferentiated C2C12 myoblasts were transduced with AAV8- The cells were infected with CAG-GFP vector (1×10e6vg / cell) and then differentiated for 3 days. As with HEK293 cells, few GFP-positive cells were observed, and undifferentiated C2 C12 myoblasts were shown to be less susceptible to infection by rAAV8 (data not shown). C12 cells were cultured in differentiation medium (DMEM + 2% horse serum) for 3 days and then transfected with AAV8- Infectivity was tested in differentiated C2C12 cells by infecting them with CAG-GFP. Images were taken 3 days after infection and 3 days after differentiation. Many GFP-positive cells were visible. These results suggest that differentiated myotubes are sensitive to transduction with AAV8 vectors. This was suggested (Figure 4A-C).
[0262] After successful establishment of an in vitro infection system in muscle cells, microdystrophin vectors were The efficacy of the drug was assayed using the same production process, for example, several months apart. The two batches of vectors prepared (RGX-DYS1-RS and RGX-DYS1-03 The efficacy of ) was tested in differentiated C2C12 cells. The primary antibody used was human dystrophin Monoclonal antibody against IFN-γ (DSHB catalog number MANHINGE1A (6F1) 1)). Data were analyzed using JMP software. Test vector (R The relative efficacy of the reference control (RGX-DYS1-RS, 100%) was The infectivity of these two vectors was very similar, with 81.47% of the original value. This was shown to be the case (Figures 5A-H).
[0263] Recombinant A packaged with DYS1, DYS2, DYS3, or DYS4 vector A batch of AV was produced and its relative infectivity was assessed in differentiated muscle cells as an indicator of vector potency. The results were compared in the mouse muscle cell line C2C12 cells (Figure 6). C2C12 cells were seeded at 2 × 10E5 cells / well in a 6-well plate and lysed in a Dulbecco's modified The cells were cultured in modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS). On day 2, cells were cultured in differentiation medium (2% bovine serum supplemented with insulin (1 μg / ml)). After 3 days of differentiation, the cells were transfected with different DMD vectors at 2.5E4vg / cell. Three days after infection, infected cells were harvested and subjected to DNA extraction, followed by Q- PCR was performed using the DNeasy Blood and Tissue Kit (catalog DNA was extracted using an endogenous control (Glucan). Taqman assays were used for both endogenous (gon gene) and AAV vectors. The mouse glucagon gene served as a control to normalize the vector copy number. The sequences of the mouse glucagon primers and probe were as follows: Human-F (mouse): AAGGGACCTTTACCAGTGATGTG (SEQ ID NO: No. 47); Glucagon-Real-R (mouse): ACTTACTCTCGCCTTCCT CGG (SEQ ID NO: 48); Taqman mouse glucagon probe: FAM-CAGCA AAGGAATTCA-MGB (SEQ ID NO: 49). For the targeted AAV vector, The timer and probe were designed to recognize the micro-dys sequence and were as follows: Dys-CF:TGG GCC TGC TCC TGC ATG (SEQ ID NO: 50) ); Dys-CR: ATC TCA GGC TTG GCA AAC (SEQ ID NO: 51 );Dys-C-probe:FAM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 52). The copy number per diploid cell was calculated according to :
number
[0264] The DYS1-RS batch was considered as the reference control (set to 1.0) and all other vectors were used as the reference. Compared to the control (vector copy number / reference control (fold change)). As shown in Figure 6 , the infectivity of all AAV8 vectors is equivalent (50-150% infectivity is within the acceptable range), It was shown to be a vector of good quality.
[0265] Differentiated C2C12 cells were injected with various AAV8 vectors at two different doses (1e5vg / After infection with 5000 cells and 5e4vg / cell), the RNA of the microdystrophin gene was The expression level was determined. Cells transfected with the RGX-DYS3 vector expressed RG Micro-dystrophin mRNA expression in cells transfected with the X-DYS1 vector had 2-3 times higher microdystrophin mRNA levels compared to NA levels ( This difference is due to the presence of the VH4 intron in the RGX-DYS3-stabilized mRNA. This is thought to be due to the following.
[0266] 6.3 Example 3 - Gene Therapy Administration to the mdx Mouse Model 6.3.1 Test Method RGX-DYS1 was packaged into an AAV8 vector using HEK293 cells. The titer of the vector RGX-DYS1 was 4.6E13vg / ml. The RGX-DYS1 AAV8 vector was administered at a dose of 2E14vg / kg to 5-week-old mice. The drug was delivered systemically to mdx mice via tail vein injection (n=13). The mice were weighed periodically. Muscle grip strength was measured 5 weeks after treatment, and in vitro muscle contraction was measured 6 weeks after injection. Functional assays were performed and the results are shown in Table 11. [Table 11]
[0267] 6.3.2. Body and tissue weights Due to the pathogenesis of skeletal muscle degeneration and regeneration, mdx mice typically have a higher skeletal muscle density than wild-type mice. As can be seen from Figure 8, treatment with the RGX-DYS1 vector significantly increased body weight. In fact, the weight of treated mice was comparable to that of wild-type mice 2 weeks after treatment. there were.
[0268] Six weeks after injection, all mice were euthanized and the weights of various organs and muscles were measured. X-DYS1 treated mice showed improved organ and muscle function (soleus, quadriceps, and triceps) The weight of the tibialis anterior (TA) muscle was significantly reduced (Figures 9A and 9B).
[0269] Grip strength To measure grip strength, mice were allowed to acclimate to the testing room for approximately 10 minutes before the procedure began. The experimenter was blinded to the treatments, and the mice to be measured were handed over to the experimenter by another person. Gently place the mouse on the wire grid with its forelimbs so that only its front paws can grasp one of the horizontal bars. Both front legs were holding the same bar, and the body was parallel to the ground and facing the bar. After checking that the grid is parallel, move the mouse over the entire length of the grid until you release your grip. For acclimatization and testing, each animal was placed on a 5-day continuous To analyze the maximum grip strength of an individual mouse, one mouse was used. The best recorded value (maximum force) was calculated. Normalized muscle strength (kgf / kg) was calculated based on body weight. ) was calculated.
[0270] Grip strength measurements at 5 weeks post-treatment showed that treatment significantly improved RG compared to affected vehicle controls. It was revealed that the muscle strength of X-DYS1-treated mice was significantly increased (p≦0.001 ) (Figure 10).
[0271] 6.3.4. In vitro muscle strength Mice were anesthetized using ketamine and xylazine. The right hind limb of each mouse was anesthetized with ED. The L muscle was excised and placed in an oxygen bath (95% O, 5% CO) at 25°C containing Ringer's solution (pH 7.4). The muscles were immersed in O2. Non-fatiguing twitch contractions were used to condition the muscles to the optimal length for force production. The muscles were stimulated with electrodes to induce tetanic contractions, followed by a 2-minute rest interval. Each time, the stimulation frequency was increased by 20 Hz until the force reached a plateau (usually occurring around 250 Hz). , increased in steps of 30 or 50 Hz. Based on muscle mass, fiber length, and tissue density, Finally, specific muscle strength (kN / m2) was calculated based on the cross-sectional area of the muscle. Ta.
[0272] Vehicle mdx mice (n=13) were compared with healthy BL10 mice (historical data, n=14 ) showed a significant decrease in maximum muscle strength and specific muscle strength. Treatment of x mice resulted in significant increases in both maximum and specific strength at 6 weeks compared to vehicle controls. This resulted in significant improvements (Figure 11).
[0273] Cardiac function To measure blood pressure (BP), mice were sedated using 1.5% isofluorane. The level of anesthesia is constantly monitored, and the body temperature is maintained at 36.5 to 37.5°C. The heart rate is maintained at 450-550 beats per minute. A BP cuff is placed around the tail, and then the tail is Place the sensor assembly to non-invasively monitor BP during anesthesia. Ten consecutive measurements were performed. Qualitative and quantitative measurements of caudal BP were performed, including systolic, diastolic, and mean pressure. This can be done offline using analysis software, including the Wehling-Hehlen nricks et al,Human Molecular Genetics,20 05,Vol.14,No.14;Uaesoontrachoon et al,Hu man Molecular Genetics,2014,Vol.23,No.12 Please refer to.
[0274] To monitor ECG peaks and interval times in awake, freely moving mice, A wired telemetry device is used. The transmitter unit is implanted into the abdominal cavity of an anesthetized mouse. Two electrical leads are fixed in the lead II direction near the apex and right acromion for data recording. Each mouse was placed in a cage above an antenna receiver connected to a computer system. Unfiltered ECG data is collected for 10 seconds every hour for 35 days. To allow for recovery from surgery and ensure that the effects of anesthesia have subsided, The first 7 days of data will be discarded. Data waveforms and parameters will be processed in the DSI analysis package. The data was analyzed using ART 3.01 and Physiostat 4.01. The heart rate, ECG wave height, and interval time are determined by averaging the data. The raw ECG waveforms are reviewed by a trained observer.
[0275] Picrosirius red staining was performed to measure the degree of fibrosis in the hearts of the test mice. Briefly, at the end of the study, immediately after euthanasia, the myocardium was removed and stored for further processing. The hearts were sectioned and the paraffin sections were deparaffinized in xylene. The sections were then washed and stained with Weigert's hematoxylin for 8 minutes. After cleaning, add Picrosirius Red (0.5g Sirius Red F3B, saturated with picric acid) The sections were then stained with xylene three times and mounted in Permount. Using an Eclipse E800 (Nikon, Japan) microscope, Five digital images were taken for blinded analysis using Image J (NIH). cormorant.
[0276] Upon euthanasia of the animals, blood samples were collected by cardiac puncture and the collected serum was analyzed for muscle CK. Used to measure levels.
[0277] 6.4 Example 4 Vector Biodistribution Vehicle-treated and RGX-DYS1-treated mdx mice were sacrificed 6 weeks after treatment. Kill, Naica crystal di made by Stilla Technologies Using the GITAIL PCR system, various cells, including skeletal muscle, cardiac muscle, and hepatocytes, were analyzed. Vector copy number in tissues was assessed.
[0278] RGX-DYS1 via tail vein injection into 4-week-old male muscular dystrophic mdx mice Six weeks after injection, mice were sacrificed to obtain vector copy numbers. The tissues were subjected to total DNA extraction and ddPCR assay.
[0279] Total DNA was extracted from collected tissue using DNeasy Blood & Tissue K. The tissue was extracted with PBS and the DNA concentration was measured using a Nanodrop spectrophotometer. To determine the number of copies of the vector, Naica Crystal Digital PC Digital PCR was performed using the R system (Stilla technologies). Here, the dystrophin transgene and the endogenous control gene were simultaneously measured. To achieve this, we applied a two-color multiplex system. The lobes were labeled with FAM (6-carboxyfluorescein) dye and the endogenous control glucagon The probe was labeled with VIC fluorescent dye. Mouse glucagon primer and probe sequences The antibodies were as follows: Glucagon-Real-F (mouse): AAG GGA CCT TTA CCA GTG ATG TG (SEQ ID NO: X); Glucagon-R-(Matrix (Us): ACT TAC TCT CGC CTT CCT CGG; Taqman mouse Glucagon probe: VIC-CAG CAA AGG AAT TCA-MGB. A For the AV vector, primers and probes were used to recognize the C-terminus of the dystrophin gene. Designed to recognize: Dys-dd-F2:ACA GAT ACC TGT TCA AGC AAG TGG C (SEQ ID NO: 122); Dys-dd-R2:TCA A TC TCA GGC TTG GC (SEQ ID NO: 123); Dys-C-probe: F AM-CAA TAT TGA GCC ATC AGT C-MGB (SEQ ID NO: 12 4) The copy number of the delivery vector in a specific tissue per diploid cell is calculated as follows: Issued:
number
[0280] RGX-DYS1 administration resulted in the highest vector copy number in liver tissue (437± 78 copies / cell, n=13). Myocardium (23±9, n=13) and skeletal muscle (tibialis anterior (T A) 28±10 copies / cell, extensor digitorum longus (EDL) 23±11 copies / cell, diaphragm 2 8±29 copies / cell, triceps 49±22 copies / cell) and all showed significant vector distribution was shown (Figure 12).
[0281] 6.5 Example 5 - Recovery of nNOS-containing DAPCs Dystrophin-associated proteins are proteins that are involved in the synthesis of dystrophin along with dystrophin. They form a complex known as the DAPC complex, which acts as a bridge and transports Connects the actin cytoskeleton to the basement membrane through the extracellular matrix. Puccio, HM, et al, Dystrobrevin and dystr ophin:an interaction through coiled-coil motifs.(1997)Proc Natl Acad Sci USA 94: 12413-8. DAPC consists of several subcomplexes: dystroglycan, sarcoglycan It is composed of ATP, syntrophin, and syntrophin / dystrobrevin, and undergoes repeated cycles of contraction and relaxation. They are collectively involved in maintaining the integrity of fibers in the fibrous tissue and in cell signaling. In wild-type dystrophin, the β-dystroglycan binding site is located in hinge 4. and cysteine-rich (CR) domains. The WW domains of dystrophin are located in Requires the EF-hand domain to interact with beta-dystroglycan (Rentsch ler, S., et al. 1999, Biol Chem 380:431-42). RGX-DYS1 contains a C-terminal domain that contains dystrobrevin and syntrophin binding domains. One of the important functions of syntrophins is to Anchoring signaling proteins such as neuronal nitric oxide synthase (nNOS) to the sarcolemma Adams, ME, et al, 2000. Absence of α1-syntrophin leads to structurally aber rant neuromuscular synapses deficient in utrophin. J Cell Biol 150:1385-98. Therefore , expression of microdystrophin from RGX-DYS1 in the muscle of mdx mice , dystrobrevin, syntrophin, and nNOS are expected to be restored to the muscle membrane. do.
[0282] Immunity to dystrophin, nNOS, α1-syntrophin, and α-dystrobrevin Immunofluorescence staining was performed on cry-thin sections of treated and control gastrocnemius muscles. The reagents and antibodies used are listed in Tables 12 and 13. [Table 12]
[0283] Freshly isolated mouse tissue was immediately immersed in an isopentane / liquid nitrogen double bath. The tissue was then rapidly frozen and stored at -80°C. A few drops of OCT (optimal cutting temperature) compound were added. The tissue is secured to the cutting block by applying pressure to the tissue, and then the tissue is placed on the block in the desired cutting direction. The OCT and tissue were frozen in a cryostat (until the OCT solidified). The tissue was sliced into 4-6 pieces at 10 μm (tolerance: 8-10 μm). Sections were placed on each slide and stored at -80°C.
[0284] Remove the muscle cryosection slides from -80°C storage and place them at room temperature (RT) for 10 minutes. The tissue sections were then air-dried. Then, a mark was made around the tissue section with a PAP pen. If the antibody is derived from a single monoclonal antibody, two blocking steps are required. Pipette an appropriate amount of 1x MOM to cover the entire area circled with the PAP pen. Block the sample with PBS and incubate at room temperature for 1.5 hours. Aspirate the MOM. Then, the cells are blocked with 10% horse serum (in PBS) for 1 hour at room temperature. If the primary antibody is not derived from a mouse, use a pipette to cover the entire area circled with the PAP pen. Samples were diluted with 10% horse serum (in PBS) by adding an appropriate volume of PBS using a syringe. ) and then incubate at room temperature for 1 hour.
[0285] Dilute the primary antibody in 2% horse serum (PBS) and incubate the sample at room temperature for 1-2 hours. Then, add an appropriate amount of PBS to cover the entire area circled with the PAP pen. Wash the slides with 1X PBS by incubating at room temperature for 3 minutes. The secondary antibody (CY3, Alexa Fluor 6000) was added to the wells and then aspirated. This was repeated 3-4 times. uor 594 or 488 conjugated antibody) diluted in 2% horse serum in PBS, The slides were incubated at room temperature for 1 hour. The slides were then washed with 1X PBS 3-4 times at room temperature. Washed for 3 minutes. Counterstaining with DAPI to reveal nuclei was performed using 1x DAPI diluted in PBS. The slides were incubated at room temperature for 5-8 minutes. After DAPI staining, Wash the slides in 1x PBS for 3 min at room temperature, then apply 1-2 drops of antifade mounting medium per slide. After mounting, the slides were air-dried at room temperature and protected from light. A mirror was used to analyze the fluorescence and take an image. [Table 13]
[0286] As shown in Figure 14, except for some revertant mutant fibers, the dystrophin The proteins and investigated DAPC proteins were obtained from mdx mice treated with RGX-DYS1. All of these were absent in muscle. Systemic delivery of RGX-DYS1 effectively suppressed dystrophin expression. Efficiently restores α1-syntrophin, α-dystrobrevin, and β-dystroglycan and nNOS were immobilized on the sarcolemma (Table 14). In both cases, nNOS expression in the muscle membrane was significantly increased compared to the untreated control group. In conclusion, RGX-DYS1 microdystrophin significantly restored the in vivo In ivo, dystrophin-associated protein complexes, including nNOS, are restored to the sarcolemma. I was able to do that. [Table 14]
[0287] 6.6 Example 6 - Gene Therapy Administration to mdx Mouse Model In vivo expression of AAV8-RGX-DYS3 and AAV8-RGX-DYS5 vectors The study was conducted on 13 male C57BL / 10ScSn-Dmdmdx / J(mdx) mice. All vectors were administered to 5-week-old mdx mice via the tail vein at a dose of 2E14vg / kg. The mice were delivered systemically via intravenous injection (Group 1, AAV8-RGX-DYS3, n = 5; Group 2, AAV8-RGX-DYS3, n = 5). Group 2, AAV8-RGX-DYS5, n=5f or mdx negative (untreated) control, (n=3). The body weight of the animals on the day of administration ranged from 15.9 g to 22.0 g. Six weeks after administration, blood was collected for serum, and the animals were euthanized and necropsied for tissue collection. Major skeletal muscles including gastrocnemius (Gas), tibialis anterior (TA), diaphragm, triceps, and quadriceps Muscles, heart, liver, and major organs were collected and rapidly frozen in an isopentane / liquid nitrogen double bath. The sample was placed in a cryotube that had been cooled to room temperature.
[0288] The body weight of each animal was recorded twice a week, and the mean body weight change for each group was calculated. All animals, except for one (3-135-012), gained weight over the seven weeks, as expected. [Table 15]
[0289] Mdx mice have a pathology of skeletal muscle degeneration and regeneration, and are typically more severe than wild-type mice. As can be seen in Table 15, the RGX-DYS3 or RGX-DYS5 vector Mdx mice treated with thiamin showed a significant decrease in body weight compared to untreated mdx mice. was significantly smaller.
[0290] 6.7 Example 7 - Micro-dystrophin (μ-Dys) in Treated mdx Mice Assessment of protein expression 6.7.1 Comparison of μ-Dys Expression by Western Blot, mRNA Expression, and DNA Vector copy number. The data and samples described in this example related to the RGX-DYS1 experiments were obtained from the following: Obtained after the treatment described in section 6.3 (administered AAV8-RGX-DYS1) Mice transfected with AAV8-RGX-DYS3 and AAV8-RGX-DYS5 (n=13). The data and samples below from experiments on treated animals are described in Section 6.6 above. The mice were acquired after the treatment described above (n=5 per treatment group). It was carried out at.
[0291] Microdystrophin protein expression in gastrocnemius muscles collected from treated mdx mice Briefly, 20–30 mg of tissue was analyzed by Western blot. Protein lysis buffer (15% SDS, 75 mM Tri-HCl pH 6.8, protease inhibitor The cells were homogenized in 20% glycerol, 5% beta-mercaptoethanol ( Bead Mill homogenizer Bead Ruptor 12,SKU :19050A, OMNI International). After homogenization, the sample The mixture was spun down at maximum speed for 5 minutes at room temperature, and the supernatant was subjected to protein quantification. The purified stock supernatant was analyzed using the Qubit Protein Assay Kit (Cat. No. Q33211, T Quantification was performed using the HermoFisher Scientific. Calculate the total protein concentration of the stock supernatant and then add 20 μg of the stock supernatant to SDS-P Western blots were performed using a primary anti-dystrophin antibody (MANE) X1011B(1C7), Developmental Studies Hybrid The secondary antibody used was a 1:1000 dilution of 1000% IgG from the Yamaguchi Cancer Center. Anti-mouse IgG2a horseradish peroxidase (HRP) conjugate (Thermo Fisher Scientific, Catalog No. 62-6520). Anti-α1-actin served as a loading control in each lane of the gel. For actin blots, rabbit polyclonal anti-α1-actin antibody (PA5-78715 , Thermo Fisher) at a dilution of 1:10,000, and a secondary goat anti-rabbit antibody. Gy antibody (Thermo Fisher Scientific, catalog number 31460 ) was used at 1:20,000. Protein signals were analyzed using ECL Prime Wes Detect using Tern Blotting Detection Reagent ( Following the manufacturer's instructions; AMERSHAM, RPN2232), Image Lab Quantification was performed by densitometry guided by software (Bio-Rad) Ta.
[0292] The Western blot results (Figure 15) revealed several findings: Therefore, the estimated size of each μ-dystrophin protein was consistent with the observed migration on the gel. For example, the RGX-DYS1 μ-dystrophin protein is 148 kDa. However, the size of the RGX-DYS5 and RGX-DYS3 proteins is 142 kD each. Second, the band intensities were similar to those of proteins present in gastrocnemius muscle tissue. The long version of μ-dystrophin, RGX-DYS1 vector, The vector showed the strongest transgene expression, followed by the intermediate version RGX-DYS5 and the short version This was followed by a newer version, RGX-DYS3 (Figures 15 and 16A). The difference in μ-dystrophin expression levels between the tracts was due to the AAV vector genome level. Protein stability of μ-dystrophin constructs with varying length or length This is thought to be due to one of the following.
[0293] To elucidate the genome copy number per cell, perform the following steps as previously described in section 6.4 (Example 4). Using the method described above, ddPCR was performed to detect the AAV-μ-dys vector in these tissues. As shown in Figure 16B, the genome copy number was examined. The tissues that were reached were indeed RGX-DYS5 (17±4 gc / cell) and RGX-DYS3 ( 16±5gc / cell) vector genome copy number than the tissues delivered with the vector (50 ±14 gc / cell) (values were normalized to glucagon genome copies). Relative μ-dystrophin expression was compared with vector copy number as shown in Figure 16C. In contrast, the RGX-DYS1-treated muscles (1.33 ± 0.39) and the RGX-DYS5-treated muscles (1.33 ± 0.39) The relative μ-dystrophin expression in treated muscles (1.774±0.40) was all R than GX-DYS3-treated muscles (0.77 ± 0.22, p < 0.05, n = 3–5). These data support the results of the RGX-DYS1 and RGX-DYS3 vectors. The long version of μ-dystrophin (with a C-terminus) generated by In vo, it was shown to improve the stability of the μ-dystrophin protein in muscle cells. is doing.
[0294] Furthermore, μ-dystrophy in skeletal muscle of untreated wild-type B6 and mdx mice mRNA expression of dystrophin and wild-type (WT) dystrophin was compared with that of treated mice. Measured using dPCR. RNeasy Fibrous Tissue Mini Total RNA was extracted from muscle tissue using a kit (REF 74704, Qiagen). Extracted and subjected to high-capacity cDNA reverse transcription. cDNA was synthesized using the Ref 4374966, Appl by Thermo Fisher Scientific (Ied Biosystems). RNA concentration was measured using a Nanodrop spectrophotometer. was measured. Digital PCR (Naica Crystal Digital PCR system, Stilla Technologies) to develop μ-dystrophy dystrophin, WT-dystrophin, and the endogenous control glyceraldehyde 3-phosphate dehydrogenase The mRNA copy number of GAPDH was measured. The primers and probes (mm01216951_m1, Thermo Fisher Scientific) r Scientific) (Biodistribution study in Section 6.4 (Example 4) above) ), and mouse GAPDH (mm99999915_g1, Ther The ion exchangers (Fisher Scientific) were commercially available. As shown, the relative WT-dystrophin transcript in naive B6 mice was 1 ± 0.6 4, and WT-dystrophin mRNA expression in mdx mice was 1.55 ± 0. 77 (p=0.15, n=4). Relative μ-dystrophin in treated animals mRNA levels were as follows: RGX-DYS1-treated muscle 22.66 ± 11.6 (p < 0.01, n = 5); RGX-DYS5 treatment 16.83 ± 11.07 (p = 0.06, n =3) and RGX-DYS3-treated muscles 11.87 ± 7.90 (p < 0.05, n = 4). Based on this data, the RGX-DYS1 group, the RGX-DYS5 group, and the RGX-DYS3 group In all cases, delivery of the μ-dystrophin vector resulted in significantly higher than wild-type levels. Furthermore, it was shown that the mu-dystrophin transcript was generated in the nucleus of the nucleus, which was in turn involved in GAPDH normalization. In addition, μ-dystrophin mRNA copy number was calculated based on the AAV vector genome copy number per cell. WT-dystrophin mRNA was normalized to the number of genome copies per cell (2 copies). As shown in Figure 17B, all groups were normalized to a genome-wide average of 1000 cells / cell. The mRNA expression levels were essentially the same (n=3-5, p>0.05). and the muscle-specific Spc5-12 promoter, which drives expression of an AAV-μ-dystrophin transgene. The promoter is as strong as the native dystrophin promoter in mouse skeletal muscle cells. Something has been shown.
[0295] 6.7.2 μ-Dystrophin Expression and Dystrophin by Immunofluorescence (IF) Staining Assembly of the associated protein complex (DAPC) Next, immunofluorescence (IF) staining was performed to examine the expression of dystrophin and other proteins in the gastrocnemius muscles of different groups. Also includes dystrobrevin, β-dystroglycan, syntrophin, and nNos The expression of dystrophin-associated protein complexes was examined. IF staining protocol and application The antibodies used were as previously described in Section 6.5 above (Example 5). As shown, dystrophin protein and the investigated DAPC proteins were significantly increased in the untreated All three were absent in mdx muscle, but were strongly present in wild-type B6 muscle. In the treated group, μ-dystrophin protein was expressed in nearly 100% of muscle fibers. There was no distinction between the different treatment groups. The three treatment groups showed significant differences in dystrobrevin expression on the fascia. A very similar pattern was observed, showing recovery of the β-dystroglycan staining. Muscles from the GX-DYS1 treatment group showed more uniform and stronger β-dystroglycan staining (expression). showed.
[0296] More dramatic differences between treatment groups were observed in syntrophin staining. Expression of μ-dystrophin was significantly higher in the RGX-DYS1 group, which contains the longer μ-dystrophin. RGX-DYS5 and RGX-DYS3 were enhanced by RGX-DYS1 and RGX-DYS2, respectively (Figures 18 and 19). A). The same trend was further demonstrated by Western blot analysis of muscle lysates (Figure 1 9B). Western blots for syntrophin were performed on skeletal muscle tissue lysates (treatment Three gastrocnemius tissues, one gastrocnemius and two triceps, were obtained from the mdx and untreated groups, respectively. B6 mice). Polyclonal anti-syntrophin antibody (Abcam, ab111 87) was used at a dilution of 1:10,000 and incubated at room temperature for 1 hour. Rabbit monoclonal antibody against nin (ab68167, Abcam) diluted 1:5000 Secondary goat anti-rabbit antibody (Thermo Fisher Scientific) was applied. fic, Catalog No. A-10685) was applied. The ratio of actinin expression to endogenous control actinin expression was 0.84 ± 0.22 compared with the mdx group. , 4.56±0.76 (n=3, p<0.001 by one-way ANOVA). The ratios in the X-DYS1 and RGX-DYS5 groups were 2.72 ± 0.97 (n =3, p<0.05, compared with the mdx group) and 1.35±0.03 (Figure 19C). Furthermore, the level of syntrophin expression in skeletal muscle was measured by Western blot analysis. Extracts were tested using Mem-Per Plus Membrane Protein Extract. Traction Kit (catalog no. 89842, Thermo Fisher Scientific) Total skeletal muscle protein was extracted using the gastrocnemius muscle of each of the treated and untreated mdx groups. Tissues, and quadriceps muscles of B6 mice. 20 μg of total membrane protein was loaded in each lane. The polyclonal anti-syntrophin antibody (Abcam, ab11) was used (Fig. 19D). 187) was used at a dilution of 1:10,000 and incubated overnight at 4°C. A polyclonal anti-actin antibody (PA5-78715, Thermo Fisher Scientific) was used as a control. ) was applied at a 1:10,000 dilution and incubated overnight at 4°C. In contrast to the total lysate Western experiment, which showed the highest syntrophin expression levels, Total membrane protein Western blots showed that RGX-DYS1 The highest relative syntrophin expression was observed in the α-glucan group (0.81±0.26, n=3), B6_WT group (0.6623±0.05, n=3), RGX-DYS3 group (0.59±0 0.08), followed by the mdx group (0.32±0.07, n=3). μ-dystrophin produced by the μ-dystrophin vector is expressed in myocardial synthons. It is possible to restore fin expression, and the long version of RGX-DYS1 outperforms the short version. It was found that the ability of the RGX-DYS3 to anchor syntrophin to the fascia was superior to that of the RGX-DYS3. was clearly shown.
[0297] nNOS Western blots were similarly prepared using muscle tissue (gastrocnemius tissue / mdx group, and quadriceps / B6 group). Mem-Per Plus Membrane Pro Protein Extraction Kit (Cat. No. 89842, Thermo Scientific) Total muscle membrane protein was extracted using a 20 μg / ml PBS (S. Each lane of the DS-PAGE gel was loaded with a primary antibody against nNOS (SC- 5302, Santa Cruz Biotechnology) at 1:500. , polyclonal anti-actin (PA5-78715, Thermo Fisher) The secondary goat anti-mouse IgG antibody HRP (62-652) was applied at a dilution of 1:10,000. 0, ThermoFisher) was applied. A significant difference was observed between the images of the RGX-DYS1 and RGX-DYS3 groups (Figure 20A). However, Western blot results showed that RGX-DYS1 and RGX-DYS3 No significant difference was observed between the RG and untreated mdx groups (Fig. 20B-C). It was shown that the restoration of nNOS by the X-DYS1 vector was low.
[0298] Overall, the RGX-DYS1, RGX-DYS3, and RGX-DYS5 vectors All deliveries in mdx mice resulted in robust μ-dystrophin expression and dystrophin This resulted in the recovery of the DAPC-associated protein complex. S1 vector promotes the restoration of DAPCs, particularly syntrophins and β-dystroglycan Although the RGX-DYS1 vector had little ability to restore nNOS to membrane DAPCs, , but was visible by IF staining.
[0299] 6.8 Example 8 - Transduction of Satellite Cells with RGX-DYS1 Vectors and Muscular Dysfunction Roffee Muscle Regeneration Relaxation Skeletal muscle stem cells, or satellite cells (SCs), are normally quiescent and reside within the basement membrane of muscle fibers. Located between the sarcolemma and the sarcolemma. The myogenic program of SCs is activated during growth and after muscle injury. SCs can self-renew to maintain their pool and / or differentiate to form myoblasts. The adeno-associated virus (AAV) vector induces differentiated muscle fiber formation. Because transduction is well known, satellite cells can be transformed by AAV vectors. Because satellite cells are small and have very little cytoplasm, these cells It is technically difficult to study transgene expression in vivo. We investigated whether AAV can transform satellite cells using RNAscope. State-of-the-art in s that simultaneously amplify signals and suppress background noise It is an in situ hybridization (ISH) technique that detects intact gene expression of single molecules. RNAscope multiplexing allows direct visualization at single-cell resolution in a wide range of tissues. In the X-ray fluorescence analysis, AAV μ-dystrophy cells labeled with the fluorescent dye Opal 570 (red) were Muscle satellite cell marker pa labeled with Finn probe and fluorescent dye Opal 520 (green) x7 was used. RNAscope multi-sample analysis of AAV transgene and Pax7 mRNA expression. Multiplex fluorescence analysis is a part of the Advanced Cell Diagnostics Institute c (Newark, CA). Issue Mini Kit (Qiagen Cat. No. 74704) was used to Total RNA was extracted from the skeletal muscle and purified using High-Capacity cDNA Regenerator. Use the ELISA Transcription Kit with RNAse inhibitors to generate cDNA A was synthesized (Applied Biosystems catalog number 4374966). Digital PCR (Naica Crystal Digital PCR system) μ-dystrophin mRNA was obtained using the Stilla Technologies The absolute copy numbers of the endogenous control GAPDH mRNA were measured. The primers and probe for mouse pax7 were the same as those described above. and probe set (TaqMan™ MGB probes, Applied Bio systems catalog number 4316034) were purchased commercially.
[0300] As shown in Figures 21A-B, red (left panel, Figure 21A) indicates μ-dystrophin. Signals (either mRNA expression or the presence of the AAV genome) are indicated; green indicates pax The blue color of DAPI staining (left and right panels) indicates 7+ satellite cells (indicated by arrows in Figures 21A-B). Figure 21A-B) shows nuclear staining. Co-localization of green, red, and blue (white arrows) indicates myocardial satellite cells. Transduction of AAV-DMD vector into green and blue cells (white arrows with black lines) indicates satellite cells without AAV transduction. μ-dystrophin-transduced satellite cells The cells were counted and the transduction rate of satellite cells was calculated. In the transplanted skeletal muscle, the transduction rate of satellite cells was 23±1.5% (FIG. 21C). This allows for the transduction of myofibers with AAV vectors, albeit at a much lower rate than in mature myofibers. It was shown that muscle satellite cells can be transduced.
[0301] Next, the total number of pax7+ satellite cells was counted in the RNAscope image. It was examined whether the numbers were similar in the different treatment groups. As shown in Figure 21D, the untreated The PAX7-positive cell count per image in mdx was 39.12 ± 15.14. The positive cell counts in wild-type B6 mice and DMD vector-treated mice were 1.5 and 2.5, respectively. 1.87±3.23 (counts in 8 images, one-way ANOVA p<0.0001) and and 14.66 ± 5.91 (counts in 12 images, p < 0.000 by one-way ANOVA) 1) The increase in satellite cell numbers in untreated mdx muscles was consistent with the increase in satellite cell numbers in dystrophic muscles. Delivery of μ-dystrophin with the RGX-DYS1 vector has been shown to reverse this disease. The condition was reversed and muscle regeneration was eased.
[0302] In addition to analysis by RNAscope technology, total muscle RNA was extracted and cDNA analyzed. RNeasy® Fibrous Tissue Mini Kit was used. Total RNA was extracted from skeletal muscle using Qiagen (Cat. No. 74704). High-capacity cDNA Reverse Transcript cDNA was synthesized using the Applied Chromatography Kit with RNAse inhibitors. d Biosystems catalog number 4374966). Mouse pax7-specific primer Samples were subjected to ddPCR analysis using a set of primers and probes (commercially available: mm01354484_m1 Pax7 and Thermo Fisher Sci, respectively. entific; and Applied Biosystems' TaqMan™ M GB probe, Cat. No. 4316034). Mouse GAPDH primers and probes The RNA and cDNA inputs were normalized using a set of digital PCR (Nai ca Crystal Digital PCR system, Stilla tec hnologies) to express μ-dystrophin mRNA and the endogenous control GAPD The absolute copy number of H mRNA was measured. Pax7 mRNA copy number and GAPDH m The RNA copy number ratios were compared between groups (Fig. 21E). As expected, the ratios in mdx mice were significantly higher than those in mdx mice. The relative expression of pax7 in the WT-B6 mice was 7.56±3.14, which was significantly higher than that in the WT-B6 mice. The results were significantly higher than those of the control group (1±0.68, n=5, p<0.001 by one-way ANOVA). Relative pax7 expression was significantly reduced in the group treated with the μ-dystrophin vector. RGX-DYS5: 4.40±1.50 (n=3, p=0.06), RGX-D 3.12 ± 0.74 (n = 5, p < 0.01) in the YS3 group and 2 in the RGX-DYS1 group. 98±0.68 (n=5, p<0.01). pax7 mRNA expression by ddPCR The decrease in dystrophic muscle is consistent with the findings of RNAscope technology. One of the therapeutic mechanisms mediated by the μ-dystrophin vector of the present invention is the slowing down of muscle regeneration. This further proves that it is due to harmony.
[0303] 6.9 Example 9 - Construction of additional microdystrophin (DMD) gene expression cassettes Construction Potentially further improve μ-dystrophin function and reduce overall transgene size (kB Several additional μ-dystrophin constructs were engineered to reduce RGX-DYS6 (SEQ ID NO: 91) showed efficient packaging. Approximately 50 amino acids of the cysteine-rich domain were removed (truncated CR, sequence In RGX-DYS7 (SEQ ID NO: 92), the AAV genome was shortened. The constructs were used as scaffolds for recombinant engineering to characterize the nNOS anchoring spectrum. The repeat domains R16 and R17 (SEQ ID NOs: 86 and 87) are separated into the R2 and R24 regions. RGX-DYS8 (SEQ ID NO: 93) is an nNOS anchoring domain. It is similar to RGX-DYS7 in that R16 and R17 are inserted, but the C-terminal domain The CT was removed to reduce the size of the AAV vector.
[0304] All μ-dystrophin Cis plasmids were packaged into AAV8 vectors and transfected. Transfect differentiated C2C12 myotubes with the vector as described in Section 6.2 (Example 2). (2×10 5 Five days after infection, the cells were harvested and incubated with anti-dystrophin The primary antibody (MANEX1011B (1C7)) was used as described herein. The μ-dystrophin protein was detected by stain blot analysis. The method is similar to that described in Section 6.7 (Example 7). As such, AAV vectors carrying different versions of μ-dystrophin have different The length of the μ-dystrophin protein was inherited as expected. There were two notable findings: 1) Generally, the long version of μ-dystrophy The protein had a stronger band (Fig. 23A-B). μ-dystrophin mRNA expression levels (Fig. 23C) correlated with protein expression levels. This was due to the strong band produced by the longer version of μ-dystrophin. This is not due to increased mRNA expression, but rather to increased protein stability. 2) μ-dystrophin RGX-DYS6 is particularly stable compared to other dystrophin genes. The deletion of 50 amino acids in the CR domain affected the stability of μ-dystrophin. I reasoned that this would give
[0305] Although the present invention will be described in detail with reference to specific embodiments thereof, functionally equivalent variations are also contemplated. It will be understood that any of the forms shown and described herein are within the scope of the present invention. Various modifications of the present invention, in addition to those described above, will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims. Those skilled in the art will be able to derive the benefits of the invention described herein using no more than routine experimentation. Many equivalents to the specific embodiments will be recognized or identified. Equivalents are intended to be encompassed by the following claims.
[0306] All publications, patents, and patent applications mentioned herein are the property of their respective owners. All patents or patent applications are specifically and individually indicated to be incorporated by reference in their entireties. and the like, are incorporated herein by reference.
[0307] The discussion herein is provided to better understand the nature of the challenges facing the technology. are provided for the purpose of clarity and should not be construed as admissions of prior art in any way. The citation of any document herein should not be construed as an endorsement of the document to which this application pertains. Nothing herein is to be construed as an admission that any content constitutes "prior art."
[0308] All references cited herein, including patent applications and publications, are the property of their respective respective publications. The entire publication or patent or patent application is incorporated by reference for all purposes. and are hereby incorporated by reference in their entirety for all purposes as if specifically and individually indicated. The present invention is not limited to the above-mentioned modifications and variations, and is incorporated herein by reference in its entirety. Many modifications and variations can be made without departing from the spirit and scope of the invention. The illustrative embodiments are provided by way of example only, and the invention is defined by the appended claims. The scope of this patent is limited only to the claims in the present application, including all equivalents to which such claims are entitled. .
Claims
1. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein. , the microdystrophin protein comprises, from amino terminus to carboxy terminus: ABD Dystrophy arranged in -H1-R1-R2-R3-H3-R24-H4-CR-CT and comprising or consisting of the dystrophin domain, wherein the ABD is the dystrophin ABD. H1 is the dystrophin-binding domain, H2 is the hinge 1 region of dystrophin, and R3 is the dystrophin-binding domain. R1 is the spectrin 1 domain of strophin, and R2 is the spectrin 2 domain of dystrophin. R3 is the spectrin 3 region of dystrophin, and H3 is the dystrophin R24 is the spectrin 24 region of dystrophin; H 4 is the hinge 4 region of dystrophin, and CR is the cysteine-rich region of dystrophin. CT is the C-terminal region of dystrophin or its β-dystroglycan binding portion; C containing the terminal region or the α1-syntrophin binding site or the dystrobrevin binding site The nucleic acid composition, which is a portion of a terminal region.
2. (1) Microdystrophin having the amino acid sequence of SEQ ID NO: 1, 79, or 91 Nucleic acid sequences encoding proteins, or sequences that are at least 90%, 95%, or or a nucleic acid sequence that is 98% identical, or a therapeutically functional microdystrophin protein. or (2) SEQ ID NO: 20, 81 or a reverse complement thereof encoding the nucleic acid sequence of ... 100 nucleic acid sequences, or at least 90%, 95%, or 98% thereof comprising or consisting of nucleic acid sequences that are identical to each other, or their reverse complements, 1. The nucleic acid sequence encodes a therapeutically functional microdystrophin protein. The nucleic acid composition according to claim 1.
3. (1) The nucleic acid sequence encoding the CT domain is the nucleic acid sequence of SEQ ID NO: 35, or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or A reference nucleotide sequence comprising or consisting of the reverse complement of these nucleotides lacking the CT domain sequence. The α1-synthesis of the microdystrophin protein compared to chromostrophin or increase binding to fin and / or dystrobrevin or encode the CT domain. the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 70, or at least 90% thereof; or comprising a nucleic acid sequence that is 95% or 98% identical to the nucleic acid sequence, or the reverse complement thereof; and a reference microdystrophin that lacks the CT domain sequence. The microdystrophin protein is α1-syntrophin and / or dystrophy protein. The nucleic acid sequence encoding the minimal CT domain or which increases binding to the bin is SEQ ID NO: 80 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto. a reference microdisk consisting of the CT domain sequence, or the reverse complement thereof, lacking the CT domain sequence; Compared to strophin, the microdystrophin protein α1-syntrophin or (2) the nucleic acid encoding the CT domain has the sequence Encoding the amino acid sequence of SEQ ID NO: 16 or 83, or the amino acid sequence of SEQ ID NO: 84 The nucleic acid composition of claim 1 or 2, comprising:
4. An insert linked to the 5' end of the nucleic acid sequence encoding the microdystrophin protein. A nucleic acid composition comprising a nucleic acid sequence containing a thrombin (I), The protein has the following structure from amino to carboxy terminus: ABD-H1-R1-R2-R3-H or comprising a dystrophin domain arranged in the following order: 3-R24-H4-CR wherein ABD is the actin-binding domain of dystrophin and H1 consists of R1 is the hinge 1 region of dystrophin, and R2 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R3 is the dystrophin H3 is the spectrin 3 region, H4 is the hinge 3 region of dystrophin, and R24 is H4 is the spectrin 24 region of dystrophin, and H4 is the hinge 4 region of dystrophin. wherein CR is a cysteine-rich region of dystrophin.
5. (1) Encoding a microdystrophin protein having the amino acid sequence of SEQ ID NO: 2 or a nucleic acid sequence at least 90%, 95% or 98% identical thereto or the reverse complement thereof, or (2) the nucleic acid sequence of SEQ ID NO:
21. or a nucleic acid sequence at least 90%, 95% or 98% identical thereto, or their reverse complements, and said nucleic acid is therapeutically functional. The nucleic acid composition of claim 4, which encodes a dystrophin.
6. (1) The nucleic acid sequence encoding the CR domain is the nucleic acid sequence of SEQ ID NO: 34 or 69. or nucleic acid sequences at least 90%, 95% or 98% identical thereto. or their reverse complements, and said microdystrophin protein compared to a reference microdystrophin protein lacking (2) increase the binding of the CR domain to β-dystroglycan; The nucleic acid sequence to be loaded is the nucleic acid sequence of SEQ ID NO: 100 or 109, or or their reverse sequences. a reference microdisk comprising or consisting of a complementary strand and lacking said CR domain sequence; The microdystrophin binding to β-dystroglycan is significantly increased compared to the dystrophin protein. or (2) the nucleic acid sequence encoding the CR domain has the sequence A CR domain comprising or consisting of the amino acid sequence of No. 15 or No. 90 is The nucleic acid composition according to any one of claims 1 to 5.
7. The nucleic acid sequence encoding ABD is SEQ ID NO: 22 or 57, or SEQ ID NO: 22 or At least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity the nucleic acid sequence encoding H1 is SEQ ID NO: 24 or 59, or the sequence At least 75%, at least 80%, at least 85% of No. 24 or No. 59 , at least 90%, at least 95%, at least 98% or at least 99% and the nucleic acid sequence encoding R1 is SEQ ID NO: 26 or 61. or at least 75%, at least 80%, at least at least 85%, at least 90%, at least 95%, at least 98% or less The nucleic acid sequence encoding R2 is SEQ ID NO: 27 or 62, or at least 75% relative to SEQ ID NO: 27 or 62, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or a sequence having at least 99% identity thereto, wherein the nucleic acid sequence encoding R3 is SEQ ID NO: 29 or 64, or at least 75% of SEQ ID NO: 29 or 64 , at least 80%, at least 85%, at least 90%, at least 95%, and encoding H2, which comprises a sequence having 98% or at least 99% identity with The nucleic acid sequence is SEQ ID NO: 38, or at least 50% of SEQ ID NO: 38, 60%, at least 70%, at least 75%, at least 80%, at least 85%, At least 90%, at least 95%, at least 98% or at least 99% identical the nucleic acid sequence encoding H3 comprises a sequence having the same identity as SEQ ID NO: 30 or 65, or at least 75%, at least 80%, or at least At least 85%, at least 90%, at least 95%, at least 98% or at least The nucleic acid sequence encoding R24 is SEQ ID NO: 32, which has 99% identity to the sequence of SEQ ID NO:
32. or 67, or at least 75% relative to SEQ ID NO: 32 or 67, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or a sequence having at least 99% identity thereto, wherein the nucleic acid sequence encoding H4 is SEQ ID NO: 33 or 68, or at least 75% of SEQ ID NO: 33 or 68 , at least 80%, at least 85%, at least 90%, at least 95%, at least and a sequence having 98% or at least 99% identity with the CR. The nucleic acid sequence is SEQ ID NO: 34, 69, 100 or 109, or SEQ ID NO: 34, 69, At least 75%, at least 80%, or at least 85% of 100 or 109 , at least 90%, at least 95%, at least 98% or at least 99% If present, the nucleic acid sequence encoding CT is SEQ ID NO: 3 5, 70 or 80, or at least 75 relative to SEQ ID NO: 35, 70 or 80 %, at least 80%, at least 85%, at least 90%, at least 95%, at least and optionally a sequence having at least 98% or at least 99% identity to the , I nucleic acid sequence was linked to the 5' end of the nucleic acid sequence encoding microdystrophin , a nucleic acid sequence of SEQ ID NO: 41, or at least 75% to SEQ ID NO: 41, 80%, at least 85%, at least 90%, at least 95%, at least 98% or a sequence having at least 99% identity with the sequence of any one of claims 1 to 6. The nucleic acid composition described above.
8. The nucleic acid sequence encoding ABD consists of SEQ ID NO: 22 or 57, and encodes H1 The nucleic acid sequence consists of SEQ ID NO: 24 or 59, and the nucleic acid sequence encoding R1 consists of SEQ ID NO: 2 6 or 61, and the nucleic acid sequence encoding R2 consists of SEQ ID NO: 27 or 62 The nucleic acid sequence encoding R3 consists of SEQ ID NO: 29 or 64, and the nucleic acid sequence encoding H2 consists of SEQ ID NO: 29 or 64. the nucleic acid sequence consists of SEQ ID NO: 38, and the nucleic acid sequence encoding H3 consists of SEQ ID NO: 30 or 6 5, the nucleic acid sequence encoding H4 consists of SEQ ID NO: 33 or 68, and R24 the nucleic acid sequence encoding the CR consists of SEQ ID NO: 32 or 67, I consists of SEQ ID NO: 34, 69, 100 or 109, I consists of SEQ ID NO: 41, and and / or the nucleic acid sequence encoding CT consists of SEQ ID NO: 35, 70 or 80. Item 8. The nucleic acid composition according to any one of Items 1 to 7.
9. The micro-dystrophin protein has, from amino terminus to carboxy terminus: ABD -L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT or ABD-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H comprising or consisting of dystrophin sequences located at 4-CR, 10. The method according to claim 1, wherein L1, L2, L3, and L4 are linkers. Nucleic acid composition of.
10. The nucleic acid sequence encoding L1 comprises or is derived from SEQ ID NO: 23 or 58. and the nucleic acid sequence encoding L2 comprises SEQ ID NO: 25 or 60, or wherein the nucleic acid sequence encoding L3 comprises or is SEQ ID NO: 28 or 63. The nucleic acid sequence encoding L4 is also set forth in SEQ ID NOs: 31, 36, 37, 66, and 71.
10. The nucleic acid according to any one of claims 1 to 9, comprising or consisting of: composition.
11. A nucleic acid composition comprising a nucleic acid sequence encoding a micro-dystrophin protein. , the microdystrophin protein comprises, from amino terminus to carboxy terminus: ABD Dystrophy arranged in -H1-R1-R2-R16-R17-R24-H4-CR and a dystrophin ABD comprising or consisting of the dystrophin ABD domain. H1 is the dystrophin-binding domain, H2 is the hinge 1 region of dystrophin, and R3 is the dystrophin-binding domain. R1 is the spectrin 1 domain of dystrophin, and R2 is the spectrin 2 domain of dystrophin. R16 is the spectrin 16 region of dystrophin, and R17 is the dystrophin R24 is the spectrin 17 region of dystrophin, and R25 is the spectrin 24 region of dystrophin. H4 is the hinge 4 region of dystrophin, and CR is the sequence of dystrophin. The nucleic acid composition is a stain-rich region.
12. The CR domain may contain an α1-syntrophin binding site and / or a dystrophin binding site at the C-terminal end. and further comprising a nucleotide sequence encoding a CT domain containing a robrevin binding site. Item 12. The nucleic acid composition according to Item 11.
13. (1) A microdystrophin protein having the amino acid sequence of SEQ ID NO: 92 or 93. a nucleic acid sequence encoding a protein, or at least 90%, 95% or 98% identical to a nucleic acid sequence, or their reverse complements, or (2) SEQ ID NO: No. 102 or 103, or at least 90%, 95% thereto or a nucleic acid sequence that is 98% identical to, or a reverse complement thereof, wherein the nucleic acid encodes a therapeutically functional dystrophin.
13. The nucleic acid composition according to 12.
14. linked to the 5' end of the nucleic acid sequence encoding the micro-dystrophin protein and optionally, further comprising an intron (I), wherein I is a sequence encoding said microdystrophin coding sequence. a human immunoglobulin heavy chain variable region (VH) 4 intron (VH) located 5' to the VH sequence; 4) or SV40 intron or chimeric intron, 14. A nucleic acid composition according to any one of claims 13.
15. the nucleic acid is operable with a nucleic acid sequence encoding the micro-dystrophin protein a transcriptional regulatory element linked to the The nucleic acid composition according to any one of claims 1 to 14, which is a nucleic acid vector comprising:
16. The promoter according to claim 15, wherein the promoter is SPc5-12 or a transcriptionally active portion thereof. The nucleic acid composition described above.
17. The nucleic acid comprises, from 5' to 3': (i) AAV ITR - transcriptional regulatory element - N-terminus; The amino acids are arranged in the order ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT from the C-terminus to the C-terminus. Nucleic acid sequence encoding the micro-dystrophin domain - polyadenylation sequence - AAV ITR; (ii) AAV ITR—transcriptional regulatory element—A from N-terminus to C-terminus Microdisks arranged in BD-H1-R1-R2-R3-H3-R24-H4-CR Nucleic acid sequence encoding the strophin domain - polyadenylation sequence - AAV ITR; iii) AAV ITR - transcriptional regulatory element - ABD-H1-R1 from N-terminus to C-terminus Microdystrophy located in -R2-R16-R17-R24-H4-CR-CT a nucleic acid sequence encoding the fin domain - polyadenylation sequence - AAV ITR; or iv) AAV ITR - transcriptional regulatory element - ABD-H1-R1- from N-terminus to C-terminus Microdystrophin arranged at R2-R16-R17-R24-H4-CR AAV vector containing a nucleic acid sequence encoding the main sequence, a polyadenylation sequence, and AAV ITRs. and the AAV ITRs optionally comprise a transnucleotide sequence of an AAV2 ITR. The nucleic acid composition according to any one of claims 1 to 16, wherein R is R.
18. The nucleotide sequence is codon-optimized and / or CpG-sequence-removed.
18. A nucleic acid composition according to any one of items 1 to 17.
19. The nucleic acid sequence of SEQ ID NO: 53, 54, 55, 56, 82, 104, 105, or 106 The nucleic acid composition according to any one of claims 1 to 18, comprising
20. 20. An rAA comprising an expression cassette comprising the nucleic acid composition of any one of claims 1 to 19. V particle.
21. The capsid protein is at least 9% identical to SEQ ID NO: 77 (AAV8 capsid). 5% identical to the amino acid sequence of SEQ ID NO: 77; Has an amino acid sequence that is at least 95% identical to that of No. 78 (AAV9 capsid) 21. The rAAV particle of claim 20, having the amino acid sequence of SEQ ID NO:
78.
22. A therapeutically effective amount of the rAAV particles of claim 20 or 21 and a pharmaceutically acceptable carrier. and a carrier.
23. 22. A method for delivering a transgene to a cell, comprising: the method comprising contacting the cells with rAAV particles, wherein the cells are contacted with the vector. 。
24. For treating a dystrophinopathy in a human subject in need thereof. A pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of claim 20 or 21. and optionally, the rAAV particles are delivered to the circulation, muscle tissue, or CNS of the subject. The pharmaceutical composition is formulated for administration to a
25. Methods of treating a dystrophinopathy in a human subject in need thereof And, A pharmaceutical composition comprising a therapeutically effective amount of the rAAV particles of claim 20 or 21. administering to a subject, said administering causing said microdistribution to a muscle or CNS of said subject. The method results in the delivery of a strophin protein.
26. The dystrophinopathy is DMD, BMD, X-linked dilated cardiomyopathy, or 26. The method of claim 24 or 25, wherein the subject is a female DMD or BMD carrier. The pharmaceutical composition or method described above.
27. From amino terminus to carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H 4-CR-CT dystrophin domains comprising or consisting of , where ABD is the actin-binding domain of dystrophin and H1 is the dystrophin-binding domain. R1 is the hinge 1 region of dystrophin, R2 is the spectrin 1 region of dystrophin, and R3 is the spectrin 1 region of dystrophin. R2 is the spectrin 2 region of dystrophin, and R3 is the spectrin 3 region of dystrophin. H3 is the hinge 3 region of dystrophin, and R24 is the dystrophin CR is the cysteine-rich region of dystrophin. and CT contains an α1-syntrophin binding site or a dystrobrevin binding site. Microdystrophin protein, which is at least a portion of the C-terminal region of dystrophin quality.
28. A compound comprising or consisting of the amino acid sequence of SEQ ID NO: 1, 79, or 91. The microdystrophin protein according to claim 27.
29. From amino terminus to carboxy terminus: ABD-H1-R1-R2-R16-R17-R24 -H4-CR-located dystrophin domain, where ABD is the actin-binding domain of dystrophin and H1 is the dystrophin R1 is the hinge 1 region of dystrophin, R2 is the spectrin 1 region of dystrophin, and R3 is the spectrin 1 region of dystrophin. is the spectrin 2 region of dystrophin, and R16 is the spectrin 2 region of dystrophin. R17 is the spectrin 17 region of dystrophin, and R24 is the spectrin 16 region of dystrophin. is the spectrin 24 region of dystrophin, and CR is the cysteine region of dystrophin. The microdystrophin protein is a cytoplasmic region of the dystrophin gene.
30. From amino terminus to carboxy terminus: ABD-H1-R1-R2-R16-R17-R24 -H4-CR-CT dystrophin domain or where CT is an α1-syntrophin binding site or a dystrobrevin binding site 30. The microphone of claim 29, wherein the microphone is at least a portion of the C-terminal region of dystrophin comprising: dystrophin protein.
31. Claim 2, comprising or consisting of the amino acid sequence of SEQ ID NO: 92 or 93 31. The microdystrophin protein according to claim 9 or 30.
32. Methods of treating a dystrophinopathy in a human subject in need thereof a therapeutically effective amount of the claimed compound is administered to the circulation, muscle tissue and / or cerebrospinal fluid of said human subject; By delivering the micro-dystrophin protein according to any one of claims 27 to 31. The method comprising:
33. A pharmaceutical composition for the treatment of a dystrophinopathy in a human subject, comprising: a therapeutically effective agent formulated for delivery to the circulation, muscle tissue, and / or cerebrospinal fluid of a subject; A method for producing a microdystrophin protein comprising administering to a subject a sufficient amount of the microdystrophin protein according to any one of claims 27 to 31. The pharmaceutical composition.
34. 1. A method for producing a recombinant AAV, comprising: (a) culturing a host cell, said host cell comprising: (i) an artificial genome comprising a cis expression cassette, wherein the cis expression cassette is 20. The artificial genome comprising the nucleic acid composition according to any one of claims 17 to 19. (ii) a trans expression cassette lacking AAV ITRs, wherein the trans expression cassette is expressed by the host cell in culture. It drives expression of AAV rep and capsid proteins in the cells and transfects the rep and capsid proteins. The AA operably linked to expression control elements that provide p and cap proteins. the trans expression cassette encoding V rep and capsid proteins; (iii) Replication and packaging of the artificial genome by the AAV capsid proteins. containing sufficient adenoviral helper functions to allow replication of the The culturing, (b) recovering the recombinant AAV encapsidated with the artificial genome from the cell culture. To do The method comprising:
35. a. An artificial genome comprising a cis expression cassette, said cis expression cassette comprising: Item 20. The artificial genome comprising the nucleic acid composition according to any one of Items 17 to 19. b. A trans expression cassette lacking AAV ITRs, wherein the trans expression cassette is introduced into said host cells in culture. It drives expression of AAV rep and capsid proteins in trans. the AAV operably linked to expression control elements that provide a cap protein and the trans expression cassette encoding the rep and capsid proteins; and c. Replication and packaging of the artificial genome by the AAV capsid proteins. Sufficient adenovirus helper function to enable A host cell comprising: