Plants with increased nematode resistance

Abstract

To provide new plants exhibiting improved resistance to nematodes, seeds and parts of the plants, methods of making and using such seeds and plants, and new SmD1 alleles that result in modified SmD1 proteins associated with such improved resistance to nematodes.SOLUTION: Provided are plants comprising SmD1 alleles encoding SmD1 proteins having at least 90% amino acid sequence identity to a particular sequence, wherein the SmD1 proteins comprise missense mutations resulting in modified SmD1 proteins that confer enhanced nematode resistance.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to novel plants that exhibit improved resistance to nematodes. The present invention also relates to seeds and parts of said plants. The present invention further relates to methods for making and using such seeds and plants. The present invention also relates to novel SmD1 alleles that result in modified SmD1 proteins associated with such improved resistance to nematodes. [Background technology]

[0002] Epiphytic endoparasitic nematodes, such as root-knot nematodes (RKN; Meloidogyne spp.) and cyst nematodes (CN; Heterodera spp. and Globodera spp.), cause significant damage to many agricultural crops. The nematodes spend most of their life cycle within plant roots, inducing the formation of multinucleate hypertrophied feeding cells called giant cells and syncytia, respectively. These giant cells are surrounded by smaller dividing cells and form new organs within the roots known as nodules or root clubs, which act as metabolic sinks for the nematodes throughout their lifespan. This leads to severe abnormalities in the function of the plant root system, significantly reducing the plant's nutrient uptake efficiency and ultimately affecting yield (Singh et al., 2013; Mejias et al., 2019).

[0003] Controlling nematodes to prevent yield losses typically relies on crop management and rotation, the use of nematicides, and plant genetics. However, many nematicide solutions have been withdrawn from the market. Furthermore, their use has been significantly reduced to address concerns about human health, food safety (e.g., regarding residues in crop harvests), and environmental sustainability (e.g., protecting soil organisms). Furthermore, some nematode species are able to overcome the very few existing solutions that are based on plant genetics. For example, many Meloidogyne species (e.g., M. enterolobii, M. incognita, M. arenaria, and M. javanica) can overcome resistance in tomato and pepper genotypes that harbor the Mi-1.2 and N resistance genes, which are widely used for nematode management (Kiewnick et al., 2009). As a result, there is a need for alternative strategies to further improve nematode control in plants, particularly tomato plants. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Mejias J., et al.,A root-knot nematode effector targets the spliceosomal plant machinery facilitating the giant cells formation.,Abstract Book,JEDNs 2019,May 28, 2019,p.34, OC-22 Summary of the Invention [Means for solving the problem]

[0005] The present invention solves the need to provide new plants that exhibit high resistance to nematodes, especially nematodes of the genus Meloidogyne.

[0006] In a first embodiment, the present invention provides a plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance.

[0007] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to any one of amino acid positions 1-108 of SEQ ID NO:1.

[0008] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO:1.

[0009] In a further embodiment, the modified SmD1 protein comprises a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO:1.

[0010] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.

[0011] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a selfed, dihaploid or hybrid plant.

[0012] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a rootstock.

[0013] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant comprises two copies of said SmD1 allele.

[0014] In a further embodiment, the modified SmD1 protein confers improved resistance to nematodes of the genus Meloidogyne, preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii and Meloidogyne javanica.

[0015] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is Solanum lycopersicum.

[0016] In a further embodiment, the modified SmD1 protein has the amino acid sequence of SEQ ID NO:2.

[0017] In a further embodiment, the SmD1 allele is available from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.

[0018] In a further embodiment, the present invention provides a plant part according to any of the preceding embodiments, wherein said plant part comprises said SmD1 allele.

[0019] In a further embodiment, the present invention provides a seed bearing the plant or plant part of any of the preceding embodiments.

[0020] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified SmD1 allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; The present invention provides a method for improving nematode resistance in plants, comprising:

[0021] It has been shown that the use of SmD1 alleles that produce modified SmD1 proteins leads to increased tolerance to nematodes.It has been demonstrated that missense mutations prevent the recognition of the SmD1 protein by nematode effectors, while maintaining the necessary activity of the modified SmD1 protein in plants, thereby improving the plant's ability to cope with pests.The present invention can therefore be used in future breeding programs to improve plant resistance to nematode pests. [Brief explanation of the drawings]

[0022] [Figure 1-1]FIG. 1: Sequence alignment and percent identity matrix of the SmD1 amino acid sequences of the present invention encoded by Arabidopsis thaliana (AT4G02840.1 (SEQ ID NO: 4) and AT3G07590.1 (SEQ ID NO: 5)), Nicotiana benthamiana (NbS00005390g0012.1 (SEQ ID NO: 6), NbS00006569g0006.1 (SEQ ID NO: 7) and NbS00054309g0007.1 (SEQ ID NO: 8)), and Solanum lycopersicum (Solyc09g064660.2.1 (SEQ ID NO: 1) and Solyc06g084310.2.1 (SEQ ID NO: 3)), as well as Glycine max (Glycine max). max) (Glyma.02G096000.1 (SEQ ID NO: 9)), pepper (Capsicum annuum) (CA06g26820 (SEQ ID NO: 10) and Capana06g000068 (SEQ ID NO: 11)), Japanese pumpkin (Cucurbita moschata) (CmoCh02G018520.T 1 (SEQ ID NO: 12)), melon (Cucumis melo) (MELO3C018220.2.1 (SEQ ID NO: 13)), cucumber (Cucumis sativus) (Cs.gyl 4.3.1.022189.T1 (SEQ ID NO: 14)), watermelon (Citrillus lanatus) (Cla023415_T (SEQ ID NO: 15)), Solanum habrochaites (Sh.LYI Orthologous sequences from the SmD1 alleles of 01.2.1.003421 J1 (SEQ ID NO: 16) and Solatium pennellii (Sopen09g026350.1 (SEQ ID NO: 17)). Sequence alignments and percent identity matrices were calculated using the software Clustal Omega (Sievers et al., 2011). [Figure 1-2]FIG. 1 (continued) shows sequence alignments and percent identity matrices of the SmD1 amino acid sequences of the present invention encoded by Arabidopsis thaliana (AT4G02840.1 (SEQ ID NO: 4) and AT3G07590.1 (SEQ ID NO: 5)), Nicotiana benthamiana (NbS00005390g0012.1 (SEQ ID NO: 6), NbS00006569g0006.1 (SEQ ID NO: 7) and NbS00054309g0007.1 (SEQ ID NO: 8)), and Solanum lycopersicum (Solyc09g064660.2.1 (SEQ ID NO: 1) and Solyc06g084310.2.1 (SEQ ID NO: 3)), as well as sequences of the SmD1 amino acid sequences of the present invention encoded by Glycine max (Glycine max). max) (Glyma.02G096000.1 (SEQ ID NO: 9)), pepper (Capsicum annuum) (CA06g26820 (SEQ ID NO: 10) and Capana06g000068 (SEQ ID NO: 11)), Japanese pumpkin (Cucurbita moschata) (CmoCh02G018520.T 1 (SEQ ID NO: 12)), melon (Cucumis melo) (MELO3C018220.2.1 (SEQ ID NO: 13)), cucumber (Cucumis sativus) (Cs.gyl 4.3.1.022189.T1 (SEQ ID NO: 14)), watermelon (Citrillus lanatus) (Cla023415_T (SEQ ID NO: 15)), Solanum habrochaites (Sh.LYI Orthologous sequences from the SmD1 alleles of 01.2.1.003421 J1 (SEQ ID NO: 16) and Solatium pennellii (Sopen09g026350.1 (SEQ ID NO: 17)). Sequence alignments and percent identity matrices were calculated using the software Clustal Omega (Sievers et al., 2011). [Figure 2]Figure 2: Assessment of the level of susceptibility to nematodes in Arabidopsis (A), Nicotiana benthamiana (B), and tomato (C) plants with impaired SmD1 gene expression versus their respective control plants. (D) Assessment of the plant root system in SmD1-silenced tomato plants. (A) 40 plants were used for each genotype, and statistical analysis of the results was performed using Student's t-test (P<0.05). (B) 12 plants were used for each treatment, and statistical analysis of the results was performed using the Mann-Whitney test (a=5%). (C) 18-20 plants were used for each genotype, and statistical analysis of the results was performed using the Mann-Whitney test (a=5%). [Figure 3] Figure 3: Assessment of the plant root system (A) and the susceptibility level to nematodes of tomato plants carrying a missense mutation in the SmD1b gene (B). Statistical analysis of the results was performed using the Mann-Whitney test (a = 1%). DETAILED DESCRIPTION OF THE INVENTION

[0023] A brief description of arrays SEQ ID NO: 1: Amino acid sequence encoded by the SmD1b gene Solyc09g064660.2.1 SEQ ID NO: 2: Modified amino acid sequence containing a T14I missense mutation at position 14 of SEQ ID NO: 1 SEQ ID NO: 3: Amino acid sequence encoded by the SmD1a gene Solyc06g084310.2.1 SEQ ID NO: 4: Amino acid sequence encoded by the SmD1b gene AT4G02840.1 SEQ ID NO: 5: Amino acid sequence encoded by the SmD1a gene AT3G07590.1 SEQ ID NO: 6: Amino acid sequence encoded by the SmD1 gene NbS00005390g0012.1 SEQ ID NO: 7: Amino acid sequence encoded by the SmD1 gene NbS00006569g0006.1 SEQ ID NO: 8: Amino acid sequence encoded by SmD1 gene NbS00054309g0007.1 SEQ ID NO: 9: Amino acid sequence encoded by the SmD1 gene Glyma.02G096000.1 SEQ ID NO: 10: Amino acid sequence encoded by SmD1 gene CA06g26820 SEQ ID NO: 11: Amino acid sequence encoded by the SmD1 gene Capana06g000068 SEQ ID NO: 12: Amino acid sequence encoded by the SmD1 gene CmoCh02G018520.T1 SEQ ID NO: 13: Amino acid sequence encoded by SmD1 gene MELO3C018220.2.1 SEQ ID NO: 14: Amino acid sequence encoded by the SmD1 gene Cs.gy14.3.1.022189.T1 SEQ ID NO: 15: Amino acid sequence encoded by SmD1 gene Cla023415_T SEQ ID NO: 16: Amino acid sequence encoded by the SmD1 gene Sh.LY101.2.1.003421.T1 SEQ ID NO: 17: Amino acid sequence encoded by the SmD1 gene Sopen09g026350.1 SEQ ID NO: 18: Nucleic acid sequence encoding SEQ ID NO: 1 SEQ ID NO: 19: Nucleic acid sequence encoding SEQ ID NO: 2 SEQ ID NO: 20: Genomic sequence of the Solyc09g064660.2.1 SmD1b gene SEQ ID NO: 21: Genomic sequence of modified Solyc09g064660.2.1 SmD1b gene SEQ ID NO: 22 / 23: Primer pair amplifying the Solyc09g064660.2.1 gene region SEQ ID NO: 24: Genomic sequence encoding SEQ ID NO: 3 SEQ ID NO: 25: Genomic sequence encoding SEQ ID NO: 4 SEQ ID NO: 26: Genomic sequence encoding SEQ ID NO: 5 SEQ ID NO: 27: Genomic sequence encoding SEQ ID NO: 9 SEQ ID NO: 28: Genomic sequence encoding SEQ ID NO: 10 SEQ ID NO: 29: Genomic sequence encoding SEQ ID NO: 11 SEQ ID NO: 30: Genomic sequence encoding SEQ ID NO: 12 SEQ ID NO: 31: Genomic sequence encoding SEQ ID NO: 13 SEQ ID NO: 32: Genomic sequence encoding SEQ ID NO: 14 SEQ ID NO: 33: Genomic sequence encoding SEQ ID NO: 15 SEQ ID NO: 34: Genomic sequence encoding SEQ ID NO: 16 SEQ ID NO: 35: Genomic sequence encoding SEQ ID NO: 17

[0024] definition The technical terms and expressions used within the scope of this application should generally be given the meanings commonly applied to them in the relevant art of plant breeding and cultivation, unless otherwise indicated herein below.

[0025] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "plant" includes one or more plants, and reference to a "cell" includes mixtures of cells, tissues, and the like.

[0026] As used herein, the term "about," when referring to a value or amount of mass, weight, time, volume, concentration, or percentage, is meant to include variations from the specified amount of, in some embodiments, ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1%, as such variations are appropriate for the practice of the methods of the present disclosure.

[0027] A "cultivated" plant, within the scope of the present invention, is understood to refer to a plant that is no longer in its natural state but has been developed and domesticated by human care for agricultural use and / or human consumption, excluding wild accessions. By way of example, in an embodiment, a "cultivated plant" is a hybrid plant. Alternatively, or in addition, a "cultivated tomato" plant according to the present invention is capable of growing yellow, orange, or red fruit. Alternatively, or in addition, the cultivated tomato plant is a Solanum lycopersicum plant.

[0028] Within the scope of the present invention, "allele" is understood to refer to alternative or variant forms of various genetic units related to the same or different forms of genes, which are located at the same locus on homologous chromosomes and therefore are alternative in genetic traits. Such alternative or variant forms may be the result of single nucleotide polymorphisms, insertions, inversions, translocations, or deletions, or may be the result of gene regulation caused, for example, by chemical or structural modifications, transcriptional regulation, or post-translational modification / regulation. In diploid cells or organisms, the two alleles of a given gene or genetic element typically occupy corresponding loci on a pair of homologous chromosomes. In the context of the present invention, alternative or variant alleles of the SmD1 gene encode modified SmD1 proteins containing missense mutations associated with improved nematode resistance phenotypes. Alternative or variant alleles of the SmD1 gene are defined relative to the wild-type SmD1 gene. For example, the wild-type SmD1b gene SEQ ID NO: 20 encodes the wild-type SmD1b protein of SEQ ID NO: 1. Correspondingly, the mutant SmD1b allele of SEQ ID NO:21 encodes the modified SmD1b protein of SEQ ID NO:2.

[0029] Relatively, the term "enhanced nematode resistance" is understood herein to mean that a plant according to the present invention, comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, for example, wherein said SmD1 protein comprises a missense mutation, exhibits increased nematode resistance compared to a plant not having said allele. Within the scope of the present invention, a plant with "enhanced nematode resistance" is understood to mean a plant that has statistically significantly higher nematode resistance (e.g., shows a significantly reduced number of egg masses, as described in the Examples) compared to a control plant using a Mann-Whitney test (α=1, 2.5, or 5%) or a Student's test (P<0.05).

[0030] In the context of nematode resistance, the term "moderately resistant" refers to a plant that contains an allele according to the present invention and that exhibits a statistically significant difference in the number of nodules and / or the number of egg masses when compared to a susceptible control plant (Tomato Reference Genome-HEINZ) that has the wild-type corresponding allele.

[0031] A "control plant" within the scope of the present invention can be a plant with the same genetic background as a plant of a cultivar containing the present invention, where the control plant does not carry the allele of the present invention associated with improved nematode resistance. The control plant can be a plant belonging to the same plant variety and not containing the allele of the present invention. The control plant is grown for the same period and under the same conditions as the plant of the cultivar of the present invention. In this specification, plant variety is understood according to the definition of UPOV. Thus, the control plant can be a near-isogenic line, an inbred line or a hybrid, where the control plant has the same genetic background as the plant of the present invention, but the control plant does not carry any of the alleles of the present invention associated with improved nematode resistance. In a preferred embodiment, the "control plant" is a "control tomato plant".

[0032] The term "trait" refers to a characteristic or phenotype. In the context of the present invention, a nematode resistance trait is an improved nematode resistance trait. A trait can be inherited in a dominant or recessive manner, or in a partially dominant or partially dominant manner. A trait can be monogenic or polygenic, or can result from the interaction of one or more genes with the environment. A plant can be homozygous or heterozygous for a trait.

[0033] The terms "hybrid," "hybrid plant," and "hybrid progeny" refer to individuals produced from genetically different parents (e.g., genetically heterozygous or near-heterozygous individuals).

[0034] The term "inbred" refers to a genetically homozygous or near-homozygous population. Inbred strains are obtained, for example, through several cycles of brother / sister breeding or selfing, or in dihaploid production.

[0035] The term "diploid line" refers to a stable inbred line derived from a separate culture. Some pollen grains (haploids) grown in a particular medium and environment can develop embryos containing n chromosomes. These embryos are then "doubled" to contain 2n chromosomes. The progeny of these embryos are called "diploids" and essentially no longer segregate (are stable).

[0036] The terms "cultivar" or "variety" refer to a horticulturally derived variety that is distinct from a natural variety. In some embodiments of the invention, the cultivar or variety is commercially available.

[0037] The term "rootstock" refers to a plant used as a recipient for a cutting. Typically, the rootstock plant and the cutting are of different genotypes. In an embodiment, a plant of the present invention is used as a rootstock plant.

[0038] The term "genetically fixed" refers to a genetic element that has been stably integrated into the genome of a plant that does not normally contain the genetic element. If genetically fixed, the genetic element can be easily and predictably transmitted to other plants by sexual crossing.

[0039] The term "plant" or "plant part" hereinafter refers to a plant part, organ or tissue obtainable from a (e.g. tomato) plant according to the invention, including but not limited to leaves, stems, roots, flowers or inflorescences, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, meristematic tissue sections, callus tissue, seeds, cuttings, cell or tissue cultures, or any other part or product of the plant which, when grown into a plant that produces fruit, still exhibits the nematode resistance trait according to the invention.

[0040] A "plant" is any plant at any stage of development.

[0041] A "plant seed" is a seed that develops into a plant as described in any of the embodiments.

[0042] A "plant cell" is the structural and physiological unit of a plant, comprising a protoplast and a cell wall. Plant cells can be in the form of isolated single cells or cultured cells, or can be part of a more highly organized unit, such as a plant tissue, a plant organ, or a whole plant.

[0043] "Plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, embryo stocks, embryo sacs, zygotes, and embryos at various stages of development.

[0044] A "plant organ" is a distinct, visually structured differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.

[0045] As used herein, "plant tissue" means a group of plant cells organized into a structural and functional unit. Any plant tissue in a plant or in culture is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into a structural and / or functional unit. Use of this term in conjunction with or without any specific type of plant tissue listed above or encompassed by this definition is not intended to exclude any other type of plant tissue.

[0046] As used herein, the term "breeding" and its grammatical variations refer to any process of producing offspring individuals. Breeding can be sexual or asexual, or any combination thereof. Exemplary, non-limiting types of breeding include crossing, selfing, derivative production of doubled haploids, and combinations thereof.

[0047] As used herein, the phrase "established breeding population" refers to a collection of potential breeding partners generated by and / or used as parents in a breeding program, e.g., a commercial breeding program. Members of an established breeding population are typically well characterized genetically and / or phenotypically. For example, some phenotypic traits of interest may be evaluated, for example, under different environmental conditions, in multiple locations, and / or at different times. Alternatively or additionally, one or more genetic loci associated with the expression of the phenotypic trait may be identified, and one or more members of the breeding population may be genotyped for the one or more genetic loci and for one or more genetic markers associated with the one or more genetic loci.

[0048] As used herein, the phrase "diploid individual" refers to an individual having two sets of chromosomes, typically one from each of its two parents. However, it is understood that in some embodiments, a diploid individual may inherit its "maternal" and "paternal" sets of chromosomes from the same single organism, for example, when a plant self-pollinates to produce subsequent generations of the plant.

[0049] Within the scope of the present invention, "homozygous" is understood to refer to the same allele at one or more corresponding loci in homologous chromosomes. In the context of the present invention, a plant containing two identical copies of a particular allele at a particular locus, for example, an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance, is homozygous at the corresponding locus.

[0050] Within the scope of the present invention, "heterozygous" is understood to refer to different alleles at one or more corresponding loci in homologous chromosomes. In the context of the present invention, a tomato plant containing one copy of a specific allele at a specific locus, for example, an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance, is heterozygous at the corresponding locus.

[0051] A "dominant" allele is understood within the scope of the present invention to refer to an allele which determines the phenotype when present in the heterozygous or homozygous state.

[0052] A "recessive" allele refers to an allele that determines a phenotype only when present in the homozygous state.

[0053] A "missense mutation" is understood to refer to a point mutation in which the change of a single nucleotide results in a codon encoding a different amino acid.

[0054] "Backcrossing" is understood within the scope of the present invention to refer to a process in which hybrid offspring are repeatedly crossed with one of the original parents. Different recurrent parents may be used in subsequent backcrosses.

[0055] A "locus" is understood within the scope of the present invention to refer to a region on a chromosome that contains a gene or any other genetic element or factor that contributes to a trait.

[0056] As used herein, a "marker locus" refers to a region on a chromosome that is present in an individual's genome and contains a nucleotide or polynucleotide sequence associated with one or more loci of interest, which may include genes or any other genetic determinants or factors that contribute to a trait. A "marker locus" also refers to a region on a chromosome that contains a polynucleotide sequence that is complementary to a genomic sequence, such as the sequence of a nucleic acid used as a probe.

[0057] As used herein, the phrases "sexual mating" and "sexual reproduction" in relation to the subject matter of the present disclosure refer to the production of offspring by the fusion of gametes (e.g., by fertilization, such as the production of seeds by pollination in a plant). "Sexual mating" or "cross-fertilization," in some embodiments, is the fertilization of one individual by another (e.g., cross-pollination in a plant). The term "selfing," in some embodiments, refers to the production of seeds by self-fertilization or self-pollination, i.e., the pollen and ovules are from the same plant.

[0058] As used herein, the phrase "genetic marker" refers to a feature of an individual's genome (e.g., a nucleotide or polynucleotide sequence present in an individual's genome) associated with one or more loci of interest. In certain embodiments, a genetic marker is a locus that is polymorphic or occupied by a polymorphism in a population of interest, depending on the context. Genetic markers include, for example, single nucleotide polymorphisms (SNPs), indels (i.e., insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples. Genetic markers can be used, for example, to identify the location of loci containing alleles on chromosomes that contribute to variability in phenotypic traits. The phrase "genetic marker" can also refer to a polynucleotide sequence complementary to a genomic sequence, such as the sequence of a nucleic acid used as a probe.

[0059] A "genetic marker" can be physically located at a chromosomal location within or outside the locus to which it is associated (i.e., intragenic or extragenic, respectively). In other words, genetic markers are typically used when the location on the chromosome of a gene or functional mutation corresponding to the locus of interest, e.g., within a regulatory element external to the gene, has not been identified and there is a non-zero recombination rate between the genetic marker and the locus of interest; however, the presently disclosed subject matter can also use genetic markers that are physically within the boundaries of the locus (e.g., within the genomic sequence corresponding to the gene, such as, but not limited to, a polymorphism within an intron or exon of the gene). In certain embodiments of the presently disclosed subject matter, the one or more genetic markers include 1 to 10 markers; in certain embodiments, the one or more genetic markers include more than 10 genetic markers.

[0060] As used herein, the term "genotype" refers to the genetic makeup of a cell or organism. An individual's "genotype for a set of genetic markers" includes the particular alleles for one or more genetic marker loci present in the individual's haplotype. As is known in the art, a genotype can be associated with a single locus or multiple loci, regardless of whether the loci are related or unrelated and / or linked or unlinked. In certain embodiments, an individual's genotype is associated with one or more genes that are related in that one or more of the genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in certain embodiments, the genotype includes a profile of one or more alleles present in the individual at one or more loci of a quantitative trait. In certain embodiments, the genotype is expressed in terms of a haplotype (defined herein below).

[0061] As used herein, the term "germline" refers to the totality of the genotypes of a population or other population (e.g., a species). The term "germline" can also refer to plant material, e.g., a group of plants that serve as a repository of various alleles. The phrase "adapted germplasm" refers, for example, to plant material with proven genetic superiority for a given environmental or geographic region, while the phrases "non-adapted germplasm," "original germplasm," and "foreign germplasm" refer, for example, to plant material with unknown or unproven genetic value for a given environmental or geographic region; thus, the phrase "non-adapted germplasm," in some embodiments, refers to plant material that is not part of an established breeding population and has no known relationship to members of an established breeding population.

[0062] As used herein, the phrase "nucleic acid" refers to any physical chain of monomeric units that can correspond to a chain of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases that are not typical of biological RNA or DNA, such as 2'-O-methylated oligonucleotides), etc. In certain embodiments, a nucleic acid can be single-stranded, double-stranded, multi-stranded, or a combination thereof. Unless otherwise indicated, specific nucleic acid sequences of the presently disclosed subject matter optionally include or encode complementary sequences in addition to any sequences explicitly indicated.

[0063] As used herein, the term "plurality" refers to two or more. Thus, a "plurality of individuals" refers to at least two individuals. In some embodiments, the term "plurality" refers to more than half of the total. For example, in some embodiments, a "plurality of a population" refers to more than half of the members of the population.

[0064] As used herein, the term "progeny" refers to the offspring of a particular cross. Typically, progeny result from the breeding of two individuals, although some species (particularly some plants and hermaphrodite animals) can self-pollinate (i.e., the same plant serves as both male and female gamete donor). Progeny can be, for example, F1, F2, or any subsequent generation.

[0065] The term "recipient plant" is used herein to refer to a plant that will receive DNA obtained from a donor plant that contains a mutant allele for improved nematode resistance.

[0066] "Donor plant" is understood within the scope of the present invention to mean a plant that provides an alternative or mutant allele associated with improved nematode resistance.

[0067] As used herein, the phrase "qualitative trait" refers to a phenotypic trait controlled by one or several genes that exhibit a major phenotypic effect. Thus, qualitative traits are typically simply inherited. Examples in plants include, but are not limited to, flower color and some known disease resistances, such as resistance to fungal spot or tomato mosaic virus.

[0068] "Marker-assisted selection" is understood within the scope of the present invention to refer to the use of genetic markers to detect, for example, one or more nucleic acids from a plant, which nucleic acids are associated with a desired trait to identify plants that carry the gene for the desired (or undesirable) trait so that those plants can be used (or avoided) in selective breeding programs.

[0069] Single nucleotide polymorphisms (SNPs), which are mutations at a single site in DNA, are the most common type of genomic variation. A single nucleotide polymorphism (SNP) is a variation in DNA sequence that occurs when a single base (A, T, C, or G) in a genome (or other shared sequence) differs between members of a biological species or between paired chromosomes of an individual. For example, two sequenced DNA fragments, AAGCCTA and AAGCTTA, from different individuals contain a single base difference. In this case, there are two alleles: C and T. The basic principles of SNP arrays are the same as those of DNA microarrays. These are the combination of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of an SNP array are an array containing nucleic acid sequences (i.e., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets the hybridization signal.

[0070] The presence or absence of the desired allele can be determined by real-time PCR using double-stranded DNA dye or fluorescent reporter probe methods.

[0071] "PCR (Polymerase Chain Reaction)" is understood within the scope of the present invention to refer to a method for producing relatively large amounts of specific regions or subsets of genomic DNA, thereby allowing various analyses based on those regions.

[0072] "PCR primer" is understood within the scope of the present invention to refer to a relatively short piece of single-stranded DNA used in the PCR amplification of a specific region of DNA.

[0073] "Phenotype" is understood within the scope of the present invention to refer to the distinguishing characteristics of genetically controlled traits.

[0074] As used herein, the phrase "phenotypic trait" refers to the appearance or other detectable characteristics of an individual that result from the interaction of its genome, proteome and / or metabolome with the environment.

[0075] "Polymorphism" is understood within the scope of the present invention to refer to the occurrence of two or more different forms of a gene, genetic marker or inherited trait or a population of gene products that can be obtained, for example, by alternative splicing, DNA methylation, etc.

[0076] "Selective breeding" is understood within the scope of the present invention to refer to a breeding program that uses plants that have or exhibit desirable traits as parents.

[0077] A "test" plant is understood within the scope of the present invention to refer to a plant that is used to genetically characterize a trait in a test plant. Typically, the test plant is crossed with a "test" plant and the segregation ratio of the trait in the progeny of the cross is scored.

[0078] As used herein, "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cellular structure, thus allowing for the detection of the target molecule or structure. In particular, "probe" refers to a labeled DNA or RNA sequence that can be used to detect the presence and quantify a complementary sequence by molecular hybridization.

[0079] As used herein, the term "hybridizing" refers to conventional hybridization conditions, preferably those in which 5xSSPE, 1% SDS, and 1x Denhardt's solution are used as the solution, and / or the hybridization temperature is 35°C to 70°C, preferably 65°C. After hybridization, washing is preferably carried out first using 2xSSC, 1% SDS, followed by 0.2xSSC, at a temperature of 35°C to 75°C, particularly 45°C to 65°C, but particularly 59°C (for the definitions of SSPE, SSC, and Denhardt's solution, see the references in Sambrook et al.). High stringency hybridization conditions, such as those described in Sambrook et al. (supra), are particularly preferred. Particularly preferred stringent hybridization conditions exist, for example, when hybridization and washing are carried out at 65°C as indicated above. For example, non-stringent hybridization conditions are less preferred with hybridization and washing performed at 45°C, and even less preferred at 35°C.

[0080] According to the present invention, the term "position corresponding to said position X" (X is any number found in the respective context in this application) not only includes the respective positions in the SEQ ID NOs described below, but also any sequence corresponding to an SmD1 allele or encoding an SmD1 protein, where, after alignment with a reference SEQ ID NO, the respective positions may have different but corresponding numbers to those indicated for the reference SEQ ID NO. Alignment of SmD1 allele or SmD1 protein sequences can be performed in a practical manner by applying various alignment tools, for example by applying the tools described below.

[0081] "Sequence identity." The terms "identical" or "identity," with respect to two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below or by visual inspection. When the two sequences being compared to each other are of different lengths, sequence identity preferably relates to the percentage of nucleotide residues in the shorter sequence that are identical to the nucleotide residues in the longer sequence. As used herein, the percent identity / homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences (i.e., % identity = number of identical positions / total number of positions × 100). Comparison of sequences and determination of percent identity between two sequences can be performed using a mathematical algorithm, as described herein below. For example, sequence identity can be conventionally determined using a computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit utilizes the locus homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, to find the segment with the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has, for example, 95% identity with the reference sequence of the present invention, parameters are preferably adjusted so that the percentage of identity is calculated over the entire length of the reference sequence and so that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, so-called optional parameters are preferably left at their preset ("default") values.Deviations observed in the comparison between a given sequence and the above sequences of the present invention may be caused, for example, by additions, deletions, substitutions, insertions or recombinations. Such sequence comparisons may also be preferably carried out using the program "fasta20u66" (Version 2.0u66 by William R. Pearson and the University of Virginia, September 1998; W.R. Pearson (1990), Methods in Enzymology 183, 63-98, see also the appended examples and http: / / workbench.sdsc.edu / ). For this purpose, the "default" parameter settings may be used.

[0082] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "specifically hybridize" refers to the fact that when a particular nucleotide sequence is present in a complex mixture (e.g., whole cell) of DNA or RNA, the molecule binds, duplexes, or hybridizes to only that sequence under stringent conditions. "Substantially bind" refers to complementary hybridization between the probe nucleic acid and the target nucleic acid, and includes minor mismatches that can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.

[0083] "Stringent hybridization conditions" and "stringent hybridization wash conditions" for nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence-dependent and vary under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization can be found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, part I, chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be approximately 5° C. lower than the thermal melting point for the specific sequence at a defined ionic strength and pH. Typically, under "stringent conditions," a probe will hybridize to its target subsequence but to no other sequences.

[0084] The "thermal melting point" is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are those higher than the melting temperature (T m) is selected to be equal to 1. An example of stringent hybridization conditions for hybridization of complementary nucleic acids having more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide containing 1 mg heparin at 42°C, with hybridization occurring overnight. An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for approximately 15 minutes. An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see Sambrook, infra, for a description of SSC buffers). A high stringency wash is often preceded by a low stringency wash to remove background probe signal. For example, an example of a moderate stringency wash for a duplex of more than 100 nucleotides is 1x SSC at 45°C for 15 minutes. For example, an example of a low stringency wash for a duplex of more than 100 nucleotides is 4-6× SSC at 40°C for 15 minutes. For short probes (e.g., about 10-50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0 M Na ion at pH 7.0-8.3, typically about 0.01-1.0 M Na ion (or other salt), and a temperature typically of at least about 30°C. Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. Generally, a signal-to-noise ratio of 2x (or greater) that observed for an unrelated probe in a particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of nucleic acids are formed using the maximum codon degeneracy permitted by the genetic code.

[0085] Plants, seeds, fruits. In a first embodiment, the present invention provides a plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% or 91%, preferably 92%, 93% or 94%, more preferably 95%, 96% or 97%, and even more preferably 98% or 99% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance.

[0086] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to any one of amino acid positions 1-108 of SEQ ID NO:1.

[0087] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO:1.

[0088] In a further embodiment, the modified SmD1 protein comprises a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO:1.

[0089] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the SmD1 allele is an SmD1b allele.

[0090] In a further embodiment, the present invention provides a plant according to the preceding embodiment, wherein the SmD1 allele encoding the modified SmD1 protein is artificially generated. In a further embodiment, the present invention provides a plant according to the preceding embodiment, wherein the plant is not obtained essentially exclusively by biological processes.

[0091] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the SmD1 allele has at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% nucleic acid sequence identity to SEQ ID NO: 20.

[0092] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.

[0093] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a selfed, dihaploid or hybrid plant.

[0094] In another embodiment, the plant of the present invention is male sterile. In another embodiment, the plant of the present invention is cytoplasmic male sterile.

[0095] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a rootstock.

[0096] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant comprises two copies of said SmD1 allele.

[0097] In a further embodiment, the modified SmD1 protein confers moderate resistance to nematodes of the genus Meloidogyne, Heterodera and Globodera, preferably Meloidogyne, more preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii and Meloidogyne javanica.

[0098] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is Solanum lycopersicum.

[0099] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the modified SmD1 protein has the amino acid sequence of SEQ ID NO:2.

[0100] In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele comprises the nucleic acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21. In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele consists of the nucleic acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21.

[0101] In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele is available from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.

[0102] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein, when infested by nematodes, the number of females with egg masses is reduced by 25%, preferably by 50%, compared to a plant of the same cultivar that does not have the SmD1 allele.

[0103] In a further embodiment, there is provided a plant part, organ or tissue obtainable from a cultivated plant according to any of the preceding embodiments, preferably from a cultivated tomato plant, more preferably from a cultivated Solanum lycopersicum plant, including, but not limited to, a leaf, stem, root, flower or inflorescence, fruit, shoot, gametophyte, sporophyte, pollen, anther, microspore, egg cell, zygote, embryo, meristematic tissue part, callus tissue, seed, cutting, cell or tissue culture, or any other part or product of a plant which still exhibits the improved nematode resistance trait according to the present invention, particularly when grown into a fruit-bearing plant.

[0104] In a further embodiment, the present invention provides a fruit produced by a plant according to any of the preceding embodiments. In a further embodiment, the present invention provides a tomato fruit produced by a tomato plant according to any of the preceding embodiments.

[0105] In a further embodiment, the present invention provides a seed that will result in a plant of any of the preceding embodiments. In a further embodiment, the present invention provides a tomato seed that will result in a tomato plant according to any of the preceding embodiments.

[0106] Alleles, markers. The present invention further relates to mutant SmD1 alleles, preferably mutant SmD1b alleles, associated with a nematode resistance trait in plants. In a further embodiment, the present invention relates to a mutant SmD1 allele, the wild-type of which is SEQ ID NO: 20 and encodes the SmD1 protein of SEQ ID NO: 1, or the wild-type SmD1 allele encodes an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the mutant SmD1 allele encodes a modified SmD1 protein having a missense mutation that confers an improved nematode resistance phenotype. In a further embodiment, SEQ ID NO: 21 is a mutant SmD1 allele encoding the modified SmD1 protein of SEQ ID NO: 2. In a further embodiment, the tomato SmD1 allele of the present invention is located on chromosome 9. In a further embodiment of the invention, a tomato SmD1b allele of the invention is available, obtained, or derived from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a donor plant that is a descendant or ancestor thereof, comprising said SmD1b allele of the invention.

[0107] In a further embodiment, the present invention relates to an isolated nucleic acid sequence encoding SEQ ID NO: 1 or 2. In a further embodiment, the isolated nucleic acid sequence is SEQ ID NO: 18, 19, 20 or 21.

[0108] The present invention discloses a kit for detecting nematode resistance trait alleles in cultivated tomato plants, in particular cultivated Solanum lycopersicum plants, wherein said kit comprises one PCR oligonucleotide primer pair represented by the forward primer of SEQ ID NO: 22 and the reverse primer of SEQ ID NO: 23. This kit allows for the detection of the SmD1b allele of the present invention, wherein the resulting amplicons are sequenced and the T14I(A) allele of the present invention is detected. C T-->AT T codon) mutations are detected. In this context, the T14I mutation can be used as a SNP marker.

[0109] The present invention also discloses the use of the SNP markers according to the present invention for the diagnostic selection and / or genotyping of nematode resistance alleles in cultivated plants, particularly cultivated tomato plants, especially cultivated Solanum lycopersicum plants.

[0110] The present invention further discloses the use of the SNP markers according to the present invention for identifying the presence of nematode resistance alleles in plants, in particular cultivated tomato plants, in particular Solanum lycopersicum plants according to the present invention, and / or for monitoring the introgression of nematode resistance alleles in cultivated plants, in particular cultivated tomato plants, in particular Solanum lycopersicum plants according to the present invention, as described herein.

[0111] The present invention further discloses a polynucleotide (amplified product) obtainable in a PCR reaction with one oligonucleotide primer or a pair of PCR oligonucleotide primers of SEQ ID NO: 22 and SEQ ID NO: 23 that is statistically correlated and therefore co-segregates with the nematode resistance trait or with one of the disclosed markers, which corresponds to an amplified product obtainable in a PCR reaction with an equivalent primer or primer pair from Solanum lycopersicum accession 19TEP250122 deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, which contains the SmD1b allele of the present invention, or a descendant or ancestor thereof, provided that the respective allele is still present in the plant and / or can be considered an allele thereof.

[0112] Also contemplated herein are polynucleotides having at least 60%, particularly at least 65%, particularly at least 70%, particularly at least 75%, particularly at least 80%, particularly at least 85%, particularly at least 90%, particularly at least 95% sequence identity to the sequence of said amplification product and / or polynucleotide exhibiting a nucleotide sequence that hybridizes to the nucleotide sequence of said amplification product obtainable in the above PCR reaction.

[0113] The amplification products according to the present invention and as described herein above can then be used to generate or develop novel primers and / or probes that can be used to identify nematode resistance trait alleles.

[0114] The present invention therefore in one embodiment further relates to derivative markers, in particular derivative primers or probes, according to the present invention and developed by methods known in the art from the amplification products described herein above, which derivative markers are genetically linked to improved nematode resistance trait loci.

[0115] The present invention also relates to a method for identifying cultivated tomato plants, preferably cultivated Solanum lycopersicum plants, that exhibit improved nematode tolerance and that have at least one copy of an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein said SmD1 protein comprises a missense mutation that results in a modified SmD1 protein, the method comprising: a) obtaining a population of mutant plants; b) screening said population for the presence of said SmD1 allele Includes:

[0116] Breeding methods. In another embodiment, the present invention relates to a method of providing a cultivated plant, preferably a cultivated tomato plant, more preferably the cultivated plant Solanum lycopersicum, plant part or seed, said method comprising: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking an SmD1 allele of the present invention; b) obtaining progeny plants; and c) optionally selecting said progeny plants characterized as exhibiting improved nematode resistance. Includes:

[0117] In a further embodiment, the present invention provides a method for producing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) crossing a first plant according to any of the preceding embodiments, comprising at least one copy of an SmD1 allele of the present invention, with a plant of a second cultivar lacking said SmD1 allele; b) selecting progeny plants that exhibit improved nematode resistance; wherein the selection in step b) is carried out by detecting the presence of an SmD1 allele of the invention with the primer pair of SEQ ID NOs: 22 and 23, followed by sequencing the resulting amplicon.

[0118] In a further embodiment, the invention relates to the method of any of the preceding embodiments, wherein the first plant in step a) is Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.

[0119] In another embodiment, the present invention provides a method of providing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking an SmD1 allele of the present invention; b) obtaining progeny cultivar plants; and c) optionally selecting said progeny plants, characterized in that in the case of nematode infestation, the number of females with egg masses is 25%, preferably 50% less than in plants of the same cultivar lacking said SmD1 allele. The present invention relates to a method comprising:

[0120] In a further embodiment, contemplated is the method of any of the preceding embodiments, wherein the first tomato plant in step a) is Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a descendant or ancestor thereof.

[0121] In another embodiment, there is provided a method for producing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) providing seeds of a plant according to any of the previous embodiments; b) germinating said seeds and growing mature, fertile plants therefrom; c) inducing self-pollination of the plants in a), allowing them to develop fruit, and harvesting fertile seeds therefrom; and d) growing plants from the seeds harvested in c) and selecting improved nematode-resistant plants. Methods including the following are considered:

[0122] A further embodiment of the present invention provides a method for providing a plant with improved nematode resistance by introducing into the plant a nucleotide sequence encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance. A further embodiment of the present invention provides a method for providing a tomato plant with improved nematode resistance by introducing into the tomato plant a nucleotide sequence encoding the SmD1 protein of SEQ ID NO: 2. A further embodiment of the present invention provides a method for providing a tomato plant with improved nematode resistance by introducing into the tomato plant a nucleotide sequence of SEQ ID NO: 19 or 21.

[0123] In a further embodiment, the present invention provides a method for improving nematode resistance in a plant, comprising the steps of: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified SmD1b allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; The present invention provides a method comprising:

[0124] Modified SmD1 alleles can also be introduced by mutagenesis, for example chemical mutagenesis (e.g., EMS mutagenesis). Alternatively, or subsequently, modified SmD1 alleles can be identified and / or introduced using the tiling technique.

[0125] Modified SmD1 alleles can also be introduced by targeted mutagenesis, such as homologous recombination, zinc finger nucleases, oligonucleotide-based mutagenesis, transcription activator-like effector nucleases (TALENs), the clustered regularly interspaced short palindromic repeat (CRISPR) system, or any alternative technique for editing the genome.

[0126] Alternatively, the modified SmD1b allele can also be introduced by transgenic or cis-genic methods via a nucleotide construct which may be contained in a vector.

[0127] use In another embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments, for growing the plant and producing and harvesting a crop and / or fruit.

[0128] In another embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, according to any of the preceding embodiments, for producing fruit for the fresh market or food processing.

[0129] In another embodiment, the present invention relates to the use of a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, plant part, or seed, according to any of the preceding embodiments, wherein the cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, plant part, or seed is Solanum lycopersicum accession 19TEP250122 deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a descendant or ancestor thereof.

[0130] In a further embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments for sowing in a field, greenhouse or plastic greenhouse. In a further embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments as a rootstock plant.

[0131] The present invention also relates to the use of nematode-resistant propagation material obtainable from a plant according to any of the preceding embodiments for growing a plant, wherein said nematode resistance may be assessed in standard assays, in particular the assay described in Example 4 below.

[0132] In a further embodiment, the present invention relates to the use of an SmD1 allele of the present invention to confer an improved nematode resistance trait to a plant lacking said allele.

[0133] The present invention further relates to the use of a plant according to any of the preceding embodiments for introgressing a nematode resistance trait into a plant lacking said trait.

[0134] Based on the description herein, a person skilled in the art who possesses Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019, under NCIMB accession number 43529, or a descendant or ancestor thereof, which contains one copy of the SmD1 allele of the present invention as described herein, can easily introduce the allele of the present invention into various types of other tomato plants using breeding techniques well known in the art. Alternatively, based on the description herein, including the disclosure of an SmD1 allele having a missense mutation that results in a modified SmD1 protein associated with a nematode tolerance phenotype, a person skilled in the art can easily reproduce the present invention using techniques well known in the art.

[0135] Seed deposit details Applicant deposited 2,500 seeds of Solanum lycopersicum accession 19TEP250122 with NCIMB on November 29, 2019, under NCIMB accession number 43529. The deposited seeds were obtained from a population segregating for the SmD1 allele of the present invention. Thus, 50% of the deposited seeds are homozygous for the mutant allele, 25% of the deposited seeds are heterozygous for the mutant allele, and 25% of the seeds are homozygous for the wild-type SmD1 allele.

[0136] The applicant requests that the deposited material shall be made available only to experts in accordance with Rule 32(1) EPC or corresponding national legislation or treaties (expert witness clause) until notice of grant of the patent has been published, or, if the application is refused, withdrawn or deemed withdrawn, for a period of 20 years from the filing date. [Example]

[0137] Example 1: Identification of the plant protein SmD1 as a target of nematode effectors In yeast two-hybrid experiments using the M. incognita effector MiEFF18 (Minc18636; Nguyen et al. 2018) as bait, we observed that the tomato plant protein SmD1 was a potential target of the nematode effector. This interaction was first demonstrated in tomato, where the SmD1 proteins are 100% identical to the two tomato SmD1 genes Sl06g084310.2.1 and Sl09g064660.2.1 (SEQ ID NOs: 1 and 3). The interaction was then verified in Arabidopsis thaliana with the SmD1b protein (SEQ ID NO: 4) from the Arabidopsis thaliana gene AT4G02840. The complemented SmD1 proteins and their corresponding genes are listed in Table 1.

[0138] [Table 1]

[0139] Yeast two-hybrid experiments showed that the portion of the SmD1 protein that interacts with the nematode effector is the first 108 amino acids. Figure 1 discloses an alignment of the SmD1 amino acid sequence, highlighting its high conservation among plant species.

[0140] Example 2A: Effect of the Arabidopsis smd1 mutation on nematode susceptibility To verify the role of the SmD1 gene in susceptibility to nematodes, Arabidopsis smd1a (AT3G07590) and smd1b (AT4G02840) mutant plants (Columbia background) were recovered ( Elvira-Matelot et al., 2016 ) and evaluated for their susceptibility level when subjected to the sweet potato root-knot nematode ( M. incognita ).

[0141] Arabidopsis smd1b mutants were found to be significantly less susceptible to M. incognita infection than wild-type Columbia plants or smd1a mutants (Fig. 2A), suggesting that AtSmD1b is primarily involved in the nematode susceptibility mechanism.

[0142] Example 2B: Effect of Nicotiana benthamiana SmD1 silencing on nematode susceptibility To confirm the important role of the SmD1 gene in susceptibility to nematodes, we generated SmD1-silenced Nicotiana benthamiana plants and assessed their susceptibility levels when subjected to M. incognita.

[0143] We again found that SmD1-silenced Nicotiana benthamiana plants were significantly less susceptible to M. incognita infection than control tobacco plants (Fig. 2B), suggesting that NbSmD1 is similarly involved in the nematode susceptibility mechanism.

[0144] Example 2C: Effect of tomato SmD1 silencing on nematode susceptibility Finally, the important role of SmD1 in nematode susceptibility was also confirmed in tomato. SmD1-silenced tomato plants were generated in the Saint-Pierre background and evaluated for their level of susceptibility when subjected to M. incognita. SmD1-silenced tomato plants were again found to be significantly less susceptible to M. incognita infection than control tomato plants (Figure 2C), suggesting that SmD1 is similarly involved in the nematode susceptibility mechanism.

[0145] However, tomato plants in which the SlSmD1 gene was silenced also exhibited commercially unfavorable phenotypes, including a significantly reduced root system (Figure 2D), overall dwarfism, and ultimately reduced fruit yield. Consequently, plants modified with nonsense or KO-type mutations in the SmD1 gene are likely to exhibit undesirable traits due to the lack of functional SmD1 protein in the plant, even though they are more resistant to nematodes.

[0146] Example 3: Identification of commercially relevant tomato SmD1b mutations To obtain tomato plants that exhibit high resistance to nematodes while maintaining the economic value of the crop, we generated mutants using EMS in the M82 background and screened them using the tilling approach to identify tomato plants with modified SmD1 genes resulting in missense mutations in the SmD1 protein. A tilling tomato line (line #123, 18TEP250123, homozygous for the mutation and the ancestral plant of the deposited line 19TEP250122, carrying the missense mutation at position 14 of SEQ ID NO: 1) was inoculated with M. incognita and egg-forming females. Six weeks after infection, root weights were measured and compared with those of the control M82 line #117 (18TEP250117, + / +, wild-type).

[0147] Analysis of root morphology and weight revealed a net increase in the root system of the #123 mutant line (Figure 3(A)). At the same time, the #123 mutant line showed a significant 50% reduction in the number of females forming egg masses (Mann-Whitney test, α = 2.5%) (Figure 3(B)).

[0148] To verify homozygosity of the mutation in SmD1b (Solyc09g064660), six plants from each line were genotyped using primers SlSmD1b-M82-F (ATTTTGAACAACCCCTGGCG (SEQ ID NO: 22)) and SlSmD1b-M82-R (ACTCTACGACCTCACCACTT (SEQ ID NO: 23)). Sequencing of the 420-bp amplicon revealed that all #117 plants had the wild-type SmD1b allele, while all #123 plants had a homozygous SmD1b mutant allele (ACT->ATT codon) resulting in a missense mutation (T14I).

[0149] [Table 2]

[0150] In conclusion, we found that a missense mutation in SmD1b (T14I) confers enhanced resistance to the root-knot nematode Meloidogyne incognita while preserving the function of the SmD1 protein in planta. Given the high degree of structural conservation of the SmD1 protein across plant species, we anticipate that a similar missense mutation in the orthologous SmD1b gene will result in an effect similar to that observed in the #123 mutant tomato line.

[0151] Example 4: Protocol for assessing nematode tolerance in tomato plants Meloidogyne incognita (Calissane strain) was propagated on tomato plants (Solanum lycopersicum cv St Pierre) in a greenhouse. Newly hatched second instar larvae (J2s) were collected as previously described ( Caillaud and Favery, 2016 ). Sterile tomato seeds (cv M82) were sown in soil mixed with sand (1:1); after 48 h at 4°C, samples were transferred to a growth chamber at 24°C with a 16-h photoperiod. Seven-day-old plantlets were individually transferred to small pots in soil / sand. One-month-old tomato seedlings were inoculated with 150 M. incognita J2s per plant. 6 weeks after infection, roots were harvested and stained with 0.5% eosin. The weights of egg-bearing females and roots were measured 6 weeks after infection.

[0152] References ·Caillaud and Favery,2016,In vivo imaging of microtubule tissue in dividing giant cells.In Plant Cell Division:Methods and Protocols,Methods in Molecular Biology,Marie-Cecile Caillaud(ed.),Springer Science+Business Media New York,vol.1370,DOI 10.1007 / 978-1-4939-3142-2_11. ·Elvira-Matelot et al.,2016,The nuclear ribonucleoprotein SmD1 interplays with splicing,RNA quality control,and posttranscriptional gene silencing in Arabidopsis,The Plant Cell 28(2),DOI:10.1105 / tpc.15.01045. · Kiewnick et al., 2009, Effects of the Mi-1 and the N root-knot nematode-resistance gene on infection and reproduction of Meloidogyne enterolobii on tomato and pepper cultivars, J. Nematol. 41(2), pages 134-139. · Mejias et al., 2019, Plant proteins and processes targeted by parasitic nematode effectors, Front. Plant Sci. July 2019 10:970, doi:10.3389 / fpls.2019.00970, eCollection 2019. · Nguyen et al., 2018, A root-knot nematode small glycine and cysteine-rich secreted effector, MiSGCR1, is involved in plant parasitism. New Phytol., 217:687-699. Doi:10.1111 / nph.14837. · Sievers et al., 2011, Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega, Mol. Syst. Biol. 2011;7:539. https: / / www.ebi.ac.uk / Tools / msa / clustalo / · Singh et al., 2013, Plant-parasitic nematodes of potential phytosanitary importance, their main hosts and reported yield losses, EPPO Bulletin 43(2), pages 334-374. 〔Sequence Listing〕 SEQUENCE LISTING <110> SYNGENTA CROP PROTECTION AG National Institute for Agricultural Research, FOOD and the ENVIRONMENT UNIVERSITY OF THE FRENCH RIVIERA NATIONAL CENTER FOR SCIENTIFIC RESEARCH <120> Plants with improved nematode resistance <130> X2G-1155 <160> 35 <170> PatentIn version 3.5 <210> 1 <211> 114 <212> PRT <213> Solanum lycopersicum <400> 1 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Met Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 2 <211> 114 <212> PRT <213> Solanum lycopersicum <400> 2 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Ile Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Met Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 3 <211> 114 <212> PRT <213> Solanum lycopersicum <400> 3 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Met Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 4 <211> 116 <212> PRT <213> Arabidopsis thaliana <400> 4 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Ile Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Leu Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Asp Thr Pro Arg Ile Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Ile Pro Ala Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly 100 105 110 Arg Gly Gly Arg 115 <210> 5 <211> 114 <212> PRT <213> Arabidopsis thaliana <400> 5 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Thr Val Lys Met Ser Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Leu Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Asp Thr Pro Arg Val Lys Pro Lys Lys Pro Val Ala Gly Lys 85 90 95 Ala Val Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 6 <211> 114 <212> PRT <213> Nicotiana benthamiana <400> 6 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Leu Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 7 <211> 114 <212> PRT <213> Nicotiana benthamiana <400> 7 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 8 <211> 114 <212> PRT <213> Nicotiana benthamiana <400> 8 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 9 <211> 116 <212> PRT <213> Glycine max <400> 9 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Ile Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Ile Ser Met Asn Thr His Leu Lys Thr Val Lys Leu Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Lys Ile Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Gly Gly Arg 115 <210> 10 <211> 119 <212> PRT <213> Capsicum annuum <400> 10 Met Val Leu Thr Phe Asn Phe Val Cys Arg Phe Leu Met Lys Leu Asn 1 5 10 15 Asn Glu Thr Val Ser Ile Glu Leu Lys Asn Gly Thr Val Val His Gly 20 25 30 Thr Ile Thr Gly Val Asp Val Ser Met Asn Thr His Leu Lys Ala Val 35 40 45 Lys Ile Thr Leu Lys Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser 50 55 60 Val Arg Gly Asn Asn Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn 65 70 75 80 Leu Glu Thr Leu Leu Val Glu Asp Thr Pro Arg Val Lys Pro Lys Lys 85 90 95 Pro Thr Ala Gly Lys Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly 100 105 110 Arg Gly Arg Gly Arg Gly Arg 115 <210> 11 <211> 114 <212> PRT <213> Capsicum annuum <400> 11 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Asp Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 12 <211> 114 <212> PRT <213> Cucurbita moschata <400> 12 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Ile Ser Met Asn Thr His Leu Lys Ala Val Lys Leu Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Met Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 13 <211> 107 <212> PRT <213> Cucumis melo <400> 13 Met Lys Leu Asn Asn Glu Thr Val Ser Ile Glu Leu Lys Asn Gly Thr 1 5 10 15 Val Val His Gly Thr Ile Thr Gly Val Asp Ile Ser Met Asn Thr His 20 25 30 Leu Lys Ala Val Lys Leu Thr Leu Lys Gly Lys Asn Pro Val Thr Met 35 40 45 Asp His Leu Ser Val Arg Gly Asn Asn Ile Arg Tyr Tyr Ile Leu Pro 50 55 60 Asp Ser Leu Asn Leu Glu Thr Leu Leu Val Glu Glu Thr Pro Arg Val 65 70 75 80 Lys Pro Lys Lys Pro Thr Ala Gly Arg Pro Leu Gly Arg Gly Arg Gly 85 90 95 Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 <210> 14 <211> 114 <212> PRT <213> Cucumis sativus <400> 14 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Ile Ser Met Asn Thr His Leu Lys Ala Val Lys Leu Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Met Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Arg 85 90 95 Pro Leu Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 15 <211> 107 <212> PRT <213> Citrullus lanatus <400> 15 Met Lys Leu Asn Asn Glu Thr Val Ser Ile Glu Leu Lys Asn Gly Thr 1 5 10 15 Val Val His Gly Thr Ile Thr Gly Val Asp Ile Ser Met Asn Thr His 20 25 30 Leu Lys Ala Val Lys Leu Thr Leu Lys Gly Lys Asn Pro Val Thr Met 35 40 45 Asp His Leu Ser Val Arg Gly Asn Asn Ile Arg Tyr Tyr Ile Leu Pro 50 55 60 Asp Ser Leu Asn Leu Glu Thr Leu Leu Val Glu Glu Thr Pro Arg Val 65 70 75 80 Lys Pro Lys Lys Pro Thr Ala Gly Arg Pro Leu Gly Arg Gly Arg Gly 85 90 95 Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 <210> 16 <211> 114 <212> PRT <213> Solanum habrochaites <400> 16 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Met Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 17 <211> 114 <212> PRT <213> Solanum pennellii <400> 17 Met Lys Leu Val Arg Phe Leu Met Lys Leu Asn Asn Glu Thr Val Ser 1 5 10 15 Ile Glu Leu Lys Asn Gly Thr Val Val His Gly Thr Ile Thr Gly Val 20 25 30 Asp Val Ser Met Asn Thr His Leu Lys Ala Val Lys Ile Thr Leu Lys 35 40 45 Gly Lys Asn Pro Val Thr Leu Asp His Leu Ser Val Arg Gly Asn Asn 50 55 60 Ile Arg Tyr Tyr Ile Leu Pro Asp Ser Leu Asn Leu Glu Thr Leu Leu 65 70 75 80 Val Glu Glu Thr Pro Arg Val Lys Pro Lys Lys Pro Thr Ala Gly Lys 85 90 95 Pro Met Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg 100 105 110 Gly Arg <210> 18 <211> 345 <212> DNA <213> Solanum lycopersicum <400> 18 atgaagctcg tcagattttt gatgaagctg aacaacgaga ctgtctcaat tgagctcaaa 60 aacggcaccg ttgttcatgg aaccattaca ggtgtggatg ttagcatgaa cacacatctg 120 aaggctgtca aaattacgct aaaaggaaag aatccagtga cattggatca cctgagtgtg 180 aggggtaaca acatccgtta ttacatcctc cctgacagct taaatcttga gacgttactg 240 gtggaagaaa cacctagggt gaagccaaag aagccaacag ctggaaagcc tatgggacgt 300 ggtcgtgggc gcggtcgtgg gcgtggacgt ggtcgaggcc gctaa 345 <210> 19 <211> 345 <212> DNA <213> Solanum lycopersicum <400> 19 atgaagctcg tcagattttt gatgaagctg aacaacgaga ttgtctcaat tgagctcaaa 60 aacggcaccg ttgttcatgg aaccattaca ggtgtggatg ttagcatgaa cacacatctg 120 aaggctgtca aaattacgct aaaaggaaag aatccagtga cattggatca cctgagtgtg 180 aggggtaaca acatccgtta ttacatcctc cctgacagct taaatcttga gacgttactg 240 gtggaagaaa cacctagggt gaagccaaag aagccaacag ctggaaagcc tatgggacgt 300 ggtcgtgggc gcggtcgtgg gcgtggacgt ggtcgaggcc gctaa 345 <210> 20 <211> 4172 <212> DNA <213> Solanum lycopersicum <400> 20 tcttatattc ttagcattaa atagtgtgag acgacggccc acgtttagtc caatggacgt 60 tcccagacga ggkatataat aagacatcac ttgtgtattt tgaacaaccc ctggcgctcc 120 ttgccctaaa ctaaagccct agattagtgt gttttcaatt tcttcagcaa gcaacaatga 180 agctcgtcag gttcatgcga tatcttcatt tttttgagtt tcttttccag tgagcttagc 240 aatggattta actttacctt tttgtgcaga tttttgatga agctgaacaa cgagactgtc 360. tcaattgagc tcaaaaacgg caccgttgtt catggaacca ttacaggtca ccctccttat ctttctttct ttcttagcta tgtaatttct tag tgtgaattat ataatgtgtt tgtatgaatt tcaagttatt tggaagtgtc gctaactgaa ctacaacaac aacataata ttccacaagt ggtgaggtcg tagtagttaa gaggttcttt ccaatagatt ttcatgctta aataagcat ttccaaacaa ttttataaag gatatacaaa aattagtgct catgacagac aagtgaggtt ttgctcaagt ggttgagcac tggtaggttg aggttttggg tcagaaaat agatcggaaa ctattgatcc ttctaggctc ctgggggtgg ggtggaaaaa cggagcagca acaacaacga aaccaagttg ctaaactatc tttggtttat gcctcaagtt aagttagttt ggtaactgca atagtttact tcactctcct tcacttccac tgtgagtcac 840 father cgtaaatgca ttgaagctag ggctgagaag ctatagaaag fathergtggt aactcgtctc aatctgtcta ctcctctcac tgcccttctg aatttgttat cttcttatcc 960 tctctgattc acacgtatta tctctacttc aatccttcaa ctatgaagtt cctttgaaat accaatagga attcattctc aagtgcagag ctattctgc ctatcatcac tgtaatttat gtctagactc tagatcactg tagttcatct ctgtcaatgc atttactgta ctctgggcca father catcacttgt tcgctttttt tgtagctgta aaagttggat tattacacaa ctcgaagaaa tttgaagtgt cactataata attcagcaat tccttcagtg aattagtatg catttaaata caactgtgat gtctcaatcc caactagtt ggtttgtcta tatgagtgtt ctctatttgt tctgctttat tcggaccatt tcattaattc acagttcgta tactgaatac aaatctctat attackaac aaaacaaaaa actaagaaat tatgggagtg aacatgggat tcttatcatc tttttgtcat tttcttaata tttttcttaa gttaacccca atcatatatt 1500 ctttgctttg aaacttaaac tatgtttggc tggggtggaa aaaagaagct taagagcaat 1560 ggaagtaaga ggttaagagt taatttcgtt ctaagtaaaaa aaggcatata aagcaaatgt 1620 agatgggttg tgtatccttt tatgtggatt tttcagtata tctgaatttt aatggaaaaa 1680 ggaaatgtat ctgtcttact tctgttccat ccataccaaa caacctgaac tacagcgctt 1740 ctatccactt aagggaggaa aattactgaa taaccaattc accacacataag gggaaagtaa 1800 attagtgacc aatgcttcac ttaagggagg tagatcagta gaatctgtct tgacttaata 1860 ttgagatagt agtattttct aatacttcta aattttcacg ggttaatgtc accattaatt 1920 tgatacatca gtagaaagta taaatggtat ttcttatact gctaatattt tcaatgttgt 1980 gtaattag cctgagataa gtttaaacat agtaacatgg tcaattggat tcatttagtc 2040 gtaccgaact tttttgaaac tgtggtgttg tttctttcgt tgatgttgta agaccttcat 2100 tatcattttg tcaatagaat aggtcgataa tgtaatgatc ttcagaaatt taagtctgca 2160 catggctcca catcattatg ccaccattgc tctcaggtcc ctacaagtgg aacattctat 2220 gctggaatca tttggtccaa gagctctctt attttctatg caaaaccatg ttgtctttat 2280 ccctttgttt ccaaagatga gcattagttg ctcatctcgg caaatgtaac actaattgac 2340 aaatattaaa ttttatctgt ataaaatttt gattacctag ttgttgctat acgggtaact 2400 tataacactt gttagttgat tatatgagca taaaccatgt tgcctccact tgtttgtgga 2460 ttttcattgt ctatgtgagg cgtgagtaag ttcttatttc ccagctcgag cttaacttcc 2520 aggtacttag gtcagaaagc gtacgacacg tctagttcta taggctggtt gcatttgata 2580 tttgagcatg tagaactagc gcaaagagtg agaagtaagt ggctatatga tgttgtgtac 2640 tctgacttt gctgtgcaat gttaactaat cttaaattca actagatgag gagctaaagc 2700 tgtgtcgaac tactgttatt cactatgcat gaatacttga gcttatgcta gcgtgcgatc 2760 aacttatagc ttattatgtt gtacccaagt tttatgaaaa cagcacctag tgttgcgttt 2820 ataattctta tctgttgttg taatcttgtt gtgaatgtta tctgtattca ttgtactata 2880 gatttttac aattgaggag tagccattta tcccttattt cttttggtg ctcccatgat 2940 atacctctat gcattgaaga taggtgtcat tcatagaatg atcgaacatc atatctttag 3000 gtaggcgtc tgctttttgg tatacatata caggcgtgct ttgtgcctac atttaaaaa 3060 ataataattg ctttatcctc taaaaaagat catcatactg tagcttcttt gtctggctgt 3120 agagatgcct tagcaaactt agataggctt cttatggcaa gtgccagggc ttgtgctggt 3180 tgcatcaaaa atgtcaaatt tgcatggaaa atagctacta tgtattgcag agtttatctc 3240 tgttctagat aactatagta gtcaaaagta gatattttgt cctgttctca tattttgagg 3300 catagcattt tcctttctct gttggttgtc ctttccatgc ttttgacttt tattccttga 3360 ggggttgctt atacttacag aaaattgcta gatataatag ggatatagaa atttgtattc 3420 gagcatatca gtatgtgttt tgatattaac taggcacagc ggctatttca tctgtctcct 3480 tattgaagtt gctaaattga gagctgtgag ttaaagtttc taaaggcagt tacattttta 3540 caggtgtgga tgttagcatg aacacacatc tgaaggctgt caaaattacg ctaaaaggaa 3600 agaatccagt gacattggat cacctgagtg tgaggggtaa caacatccgt tattacatcc 3660 tccctgacag cttaaatctt gagacgttac tggtggaaga aacacctagg gtgaagccaa 3720 agaagccaac agctggtatt gttaaggact acgttcagat gtttttgtgc attgtcggtg 3780 tatggtaaaa tttccttatt acttggacat ccttctaata cgctcttgct ttgattgttc 3840 cccttcagga aagcctatgg gacgtggtcg tgggcgcggt cgtgggcgtg gacgtggtcg 3900 aggccgctaa atgcattccg gctggtctat ttttttgcag tcttgcctat gtaaacatgt 3960 gtacggattg atagatttgc tgttagtttt tatcctgtag aaaaaagatg gatctcatgc 4020 aacaatttat tttggatctt tgaagtcagg agcatgttat ctcgttgcat catattgtct 4080 gctaacatta atttcgtttc ccgttcaatt tagtcacctt atgcatgttt tgagagttga 4140 gtcacattta gtgtcgattg agaatttagc tc 4172 <210> 21 <211> 4172 <212> DNA <213> Solanum lycopersicum <400> 21 tcttatattc ttagcattaa atagtgtgag acgacggccc acgtttagtc caatggacgt 60 tcccagacga ggcatataat aagacatcac ttgtgtattt tgaacaaccc ctggcgctcc 120 ttgccctaaa ctaaagccct agattagtgt gttttcaatt tcttcagcaa gcaacaatga 180 agctcgtcag gttcatgcga tatcttcatt tttttgagtt tcttttccag tgagcttagc 240 aatggattta actttacctt tttgtgcaga tttttgatga agctgaacaa cgagattgtc 360. tcaattgagc tcaaaaacgg caccgttgtt catggaacca ttacaggtca ccctccttat ctttctttct ttcttagcta tgtaatttct tag tgtgaattat ataatgtgtt tgtatgaatt tcaagttatt tggaagtgtc gctaactgaa ctacaacaac aacataata ttccacaagt ggtgaggtcg tagtagttaa gaggttcttt ccaatagatt ttcatgctta aataagcat ttccaaacaa ttttataaag gatatacaaa aattagtgct catgacagac aagtgaggtt ttgctcaagt ggttgagcac tggtaggttg aggttttggg tcagaaaat agatcggaaa ctattgatcc ttctaggctc ctgggggtgg ggtggaaaaa cggagcagca acaacaacga aaccaagttg ctaaactatc tttggtttat gcctcaagtt aagtgttt ggtaactgca atagtttact tcactctcct tcacttccac tgtgagtcac 840 tatgtatatc cgtaaatgca ttgaagctag ggctgagaag ctatagaaag tatatgtggt 900 aactcgtctc aatctgtcta ctcctctcac tgcccttctg aatttgttat cttcttatcc 960 tctctgattc acacgtatta tctctacttc aatccttcaa ctatgaagtt cctttgaaat 1020 accaatagga attcattctc aagtgcagag ctatttctgc ctatcatcac tgtaatttat 1080 gtctagactc tagatcactg tagttcatct ctgtcaatgc atttactgta ctctgggcca 1140 ataaaaataa catcacttgt tcgctttttt tgtagctgta aaagttggat tattacacaa 1200 ctcgaagaaa tttgaagtgt cactataata attcagcaat tccttcagtg aattagtatg 1260 catttaaata caactgtgat gtctcaatcc caaactagtt ggtttgtcta tatgagtgtt 1320 ctctatttgt tctgctttat tcggaccatt tcattaattc acagttcgta tactgaatac 1380 aaatctctat attataaaac aaaacaaaaa actaagaaat tatgggagtg aacatgggat 1440 tcttatcatc tttttgtcat tttcttaata tttttcttaa gttaacccca atcatatatt 1500 ctttgctttg aaacttaaac tatgtttggc tggggtggaa aaaagaagct taagagcaat 1560 ggaagtaaga ggttaagagt taatttcgtt ctaagtaaaaa aaggcatata aagcaaatgt 1620 agatgggttg tgtatccttt tatgtggatt tttcagtata tctgaatttt aatggaaaaa 1680 ggaaatgtat ctgtcttact tctgttccat ccataccaaa caacctgaac tacagcgctt 1740 ctatccactt aagggaggaa aattactgaa taaccaattc accacacataag gggaaagtaa 1800 attagtgacc aatgcttcac ttaagggagg tagatcagta gaatctgtct tgacttaata 1860 ttgagatagt agtattttct aatacttcta aattttcacg ggttaatgtc accattaatt 1920 tgatacatca gtagaaagta taaatggtat ttcttatact gctaatattt tcaatgttgt 1980 gtaatattag cctgagataa gtttaaacat agtaacatgg tcaattggat tcatttagtc 2040 gtaccgaact tttttgaaac tgtggtgttg tttctttcgt tgatgttgta agaccttcat 2100 tatcattttg tcaatagaat aggtcgataa tgtaatgatc ttcagaaatt taagtctgca 2160 catggctcca catcattatg ccaccattgc tctcaggtcc ctacaagtgg aacattctat 2220 gctggaatca tttggtccaa gagctctctt attttctatg caaaaccatg ttgtctttat 2280 ccctttgttt ccaaagatga gcattagttg ctcatctcgg caaatgtaac actaattgac 2340 aaatattaaa ttttatctgt ataaaatttt gattacctag ttgttgctat acgggtaact 2400 tataacactt gttagttgat tatatgagca taaaccatgt tgcctccact tgtttgtgga 2460 ttttcattgt ctatgtgagg cgtgagtaag ttcttatttc ccagctcgag cttaacttcc 2520 aggtacttag gtcagaaagc gtacgacacg tctagttcta taggctggtt gcatttgata 2580 tttgagcatg tagaactagc gcaaagagtg agaagtaagt ggctatatga tgttgtgtac 2640 tctgacttt gctgtgcaat gttaactaat cttaaattca actagatgag gagctaaagc 2700 tgtgtcgaac tactgttatt cactatgcat gaatacttga gcttatgcta gcgtgcgatc 2760 aacttatagc ttattatgtt gtacccaagt tttatgaaaa cagcacctag tgttgcgttt 2820 ataattctta tctgttgttg taatcttgtt gtgaatgtta tctgtattca ttgtactata 2880 gatttttac aattgaggag tagccattta tcccttattt cttttggtg ctcccatgat 2940 atacctctat gcattgaaga taggtgtcat tcatagaatg atcgaacatc atatctttag 3000 gtaggcgtc tgctttttgg tatacatata caggcgtgct ttgtgcctac atttaaaaa 3060 ataataattg ctttatcctc taaaaaagat catcatactg tagcttcttt gtctggctgt 3120 agagatgcct tagcaaactt agataggctt cttatggcaa gtgccagggc ttgtgctggt 3180 tgcatcaaaa atgtcaaatt tgcatggaaa atagctacta tgtattgcag agtttatctc 3240 tgttctagat aactatagta gtcaaaagta gatattttgt cctgttctca tattttgagg 3300 catagcattt tcctttctct gttggttgtc ctttccatgc ttttgacttt tattccttga 3360 ggggttgctt atacttacag aaaattgcta gatataatag ggatatagaa atttgtattc 3420 gagcatatca gtatgtgttt tgatattaac taggcacagc ggctatttca tctgtctcct 3480 tattgaagtt gctaaattga gagctgtgag ttaaagtttc taaaggcagt tacattttta 3540 caggtgtgga tgttagcatg aacacacatc tgaaggctgt caaaattacg ctaaaaggaa 3600 agaatccagt gacattggat cacctgagtg tgaggggtaa caacatccgt tattacatcc 3660 tccctgacag cttaaatctt gagacgttac tggtggaaga aacacctagg gtgaagccaa 3720 agaagccaac agctggtatt gttaaggact acgttcagat gtttttgtgc attgtcggtg 3780 tatggtaaaa tttccttatt acttggacat ccttctaata cgctcttgct ttgattgttc 3840 cccttcagga aagcctatgg gacgtggtcg tgggcgcggt cgtgggcgtg gacgtggtcg 3900 aggccgctaa atgcattccg gctggtctat ttttttgcag tcttgcctat gtaaacatgt 3960 gtacggattg atagatttgc tgttagtttt tatcctgtag aaaaaagatg gatctcatgc 4020 aacaatttat tttggatctt tgaagtcagg agcatgttat ctcgttgcat catattgtct 4080 gctaacatta atttcgtttc ccgttcaatt tagtcacctt atgcatgttt tgagagttga 4140 gtcacattta gtgtcgattg agaatttagc tc 4172 <210> 22 <211> 20 <212> DNA <213> Artificial sequence <400> 22 atttgaaca acccctggcg 20 <210> 23 <211> 20 <212> DNA <213> Artificial sequence <400> 23 actctacgac ctcaccactt 20 <210> 24 <211> 2935 <212> DNA <213> Solanum lycopersicum <400> 24 tccaatggat gaggcagccc atgtgctaat acgacgtcgt tatagtgttt tttgaataac 60 cctggcgctc tttgccctaa acttgaggtc gtgttcgatc tgcgcttcga cttaagccct 120 agcgtctctt caatttcttc agcaacaatg aagctcgtta ggttcatgcg atacttcat 180 cttttgagtt tcttttccag tgtgcttagc aatggattta acttttacct ttttttgtgc 240 agattttga tgaagctgaa caacgagact gtctcaattg agctcaaaaa cggcaccgtt 300 gttcatggaa ccattacagg tcaccctccc tatctttctg tctatttctt tgttatctat 360 atttaggtat ttccctgtca agtctaaaat gaacaatctg aacgtatgta attgctgaat 420 tgctcgctcc aataggtaaa ttaagaatgt gcttgtataa aattcatttc ctgggttcac 480 aagttttttg gtagtgtcgc taactgaaag tctagttgct gggtggtata tggaagttgc 540 tgaactacaa caataacata ctacccagtg taattccaca agtggtgagg tcttgggaga 600 cagagtgttt gcaagcctta cccctacctc gtagtgttaa agaggctgtt tccaatagat 660 tctcatgttt aaataaacca tttccaaacc attttttaaa taaaggatat ataaaaataa 720 gtgctcatga cagacaagtg aggttttgct caagtagttg agcacttcca ccatcaacta 780 gtaggttgag ggtttgggtc agaggataga tgggaacact attgatcctt ctagtctcat 840 gggggtgggg tggaaaaatg gagcaacaac aacaacgaaa gcaagttgct aaactgtctt 900 tggtttatgc cacaagttaa gttagttcat agcgaatgtt aactgcaata gtttacttca 960 ctctccttca cttccactgt gagtaattat gtatgtccat aaatgcatgg agctaggact 1020 gagaggctat agaaagtata cgaggtaact cgtctcaatc tgtctactcc tctcactacc 1080 cttctgaata tgtcatcttc ttatcctctc tgattcacac gtattatctc tacttctgtc 1140 ctccttcaac tatgaagttc ctttcaaata ccaactggaa ttcattctca agtgcagagc 1200 tatttctgcc tatcatcact gtaatttatg tctacactct agagcaccgt agttcctctc 1260 agttaatgcg ttaattatac tctgccaata agaataacat ctctcattca ctttttgtgg 1320 ctataaaaat tggattatta cacaactgaa gaattttgaa gtgtcactat aataattcaa 1380 caattccttc aatgaatttg tatgcattta aatacaacta tgatgtctca atcccaaact 1440 agttggtatg tctatattag tgtcctatat ttgttctgct ttatttggac catttcatta 1500 attcacagtt cgtttactta aaatacaaat ctctatattg aaaaacaaaa caaacaaaaa 1560 aaaaagaaat tatgggagtg aacatgggat tcttatcatc tttttgtcat tttcttaata 1620 tttttcataa gttaactcca tagatatatt ctttgcctta aaacttaaac tatgtttgac 1680 tttggtggaa gtggcggcgt ttgcgaatgg ctatgtttag cgtggggggt ggaagtgata 1740 gtgtttgcga atgagtgtgt ttagcatggg ggttgaaggg taagtcaggg gtaaattagt 1800 aatttgaatt ttaagttggg agttgatgct ttaaagtaat atagatagat atagacaact 1860 actttatcat ctgcaagaaa atcatacagt agcttctttg tctggcagta gagatgcctt 1920 agcaaactta gataggcttc ttatggcaag ttgcatcgaa aatatcaaat tttgcaagga 1980 aaatagccat atatgtattg cagagtttat ctctgttcta gataactgta gtagtcaaaa 2040 gtaaaaattt gtcctgttct catattttga gacctatagc atttctcttt ttctgttggt 2100 tgtcctttcc atgcttttga ctgttattcc ttgaggggtt gcttatactt gcagaaaatt 2160 ggtagatata ttcgggatat agaaatatgt atttgagcat atcagtatgt gttttgatat 2220 taactaggca cagcggctat taaatctgtc tccttattga agttgctaga ttgagagctg 2280 tgagttatag cttctaaagg cagttacatt tttacaggtg tggatgttag catgaacaca 2340 catctgaagg ctgtcaaaat tacgctaaaa gggaagaatc cagtgacgct ggatcacctg 2400 agtgtgaggg gtaacaacat ccgttattac atcctccctg acagcttaaa tcttgagaca 2460 ctgctggtgg aagaaacacc tagggtgaag ccaaagaagc caacagctgg tattgtcata 2520 ttgttaagga ctatgttggg atttttttgt gccttgtggg tgtatggcta aatttcctta 2580 ttgcttggac atccttctta tatactcttc ctttgattgt tcctcttcag gaaagcctat 2640 gggacgtggt cgtgggcgcg gtcgtgggcg tggacgtggt cgaggccgct aaatgcattc 2700 cagctgctct taatttttgc agtgttgcct atgtaaacat gtgtacggat ggagagattt 2760 gctcttagtt tttcccagta gaaaaaagat ggatctcatg cacaatttat tttggatctt 2820 tgaagtcagg agcatgttat ctcgttgcat catattgtct gctaacgtta cttttgtatc 2880 gtgtacaatt atgttcttcc ttgtcaagtt actcaactaa attggtcact tcagc 2935 <210> 25 <211> 1860 <212> DNA <213> Arabidopsis thaliana <400> 25 attgctgctt ttcctcctcc cgctcttgct tcttgccatt gctgtttcga gctctcctca 60 aagccctaat tttctcctct tcttcttcat tctctcacca tgaagctcgt caggtatggt 120 ttctactcgg attctcttta tttcttcggt ttaattggaa tttgcttcga aattttgaga 180 tttctctttg ttttcatgct cttcgatgtt tgatttcgta tctggatttt ttcgcaggtt 240 tttgatgaaa ttgaacaacg aaacagtttc aatcgagctt aagaacggaa ccattgttca 300 tggaaccatt actggtacgc ttctcttaaa aacccagctc tattcgctgt ttagggtttt 360 gtgtaaaatc tacgatgctt acctgtaatc gatggttact cgcgtattca caaattctga 420 tggtgtagtt tgagtttagc tagtgtcttt cccctaataa tgctttgttg gtattaaccc 480 tagtgacact ggtcaagtca gatgcagatg agtacactag attttacttg aatcgaggtt 540 tatgagatag tttagttctt cttcaaactt tgatcaccca tgaggtagtt tactttctcc 600 tttgatggtt gtaaccaatg gagctctcga atttactaat tctgatgtgt aattctgtta 660 atagacctag aaatgcattg tgggtgttga atctctcttg tttgcaataa gtgaatgata 720 atggtggtct agtcagatgg agatgataca ttttattttg ctttatagtt gggtgtatga 780 gaatgcttag ttcttctggg agtgagttta gcacatgatt atatatgaga tagtttactt 840 tagtttccct ctttatcatt gtggacctct cttgttaaca aatcctgagg cttaattctg 900 ttattagtga tagtatctga agaagttaga gtttagctga gtcttaatta tttttttacc 960 tcgaaatgct ttgttggtaa ccctcttgtt agcaagaact gagtgatact tgtcgagtca 1020 gatgcagatg attagattta gcacatgaaa gtcactctta tctctttcct tgtaaagaaa 1080 atctctgatt tttcacagaa cagttaccgt gtggcttctt gtttcaactt ctcttttagt 1140 ctgattgatc taatacaagt ggtctctgct gttaatgttt ggtttggttt cctttttctg 1200 ccatcatctt gtttagaatg caattatcaa tcaactcact gactggtact atctacttgt 1260 gatgacttaa tgcaggtgta gatgttagca tgaacactca tttaaaagct gtgaaactca 1320 ctctgaaagg gaagaatcca gttacattag accacttaag tgtcagggga aacaacattc 1380 gctattatat tcttccggac agtttgaatc tggagacttt gctggttgaa gacactccaa 1440 gaatcaaacc caaaaagcca actgcaggta acaaaacatt tcttttttct gaactatgcc 1500 tttgtttttg tttttgtttt tgcttagact catctttcta ttgttctctt tggtatcagg 1560 taagattcca gcaggtcggg gacgtggtcg tggaagaggt cgtggacgtg gccgtggtgg 1620 tcgttaagca ttttgcagta atcaaaagtc tggtcctttt tggtttgtaa cagcaggatt 1680 gtaaaagatc tatcttgtag tgagatttgg tgtcactaag acaaattctt gttatctctt 1740 taagttttca tgaatttgag atttgaaacg ttattgccaa acatacatca ctcaatatgt 1800 tttattattg acttgatcac tttattacat agtctgataa aacgtgggga gttcgagaaa 1860 <210> 26 <211> 1082 <212> DNA <213> Arabidopsis thaliana <400> 26 acacctttcg ctgtttcctc gtcaatttct ttgtttggtt gttctttctt cgcatccaaa 60 gatgaagctc gtcaggtact gtttcgttct cagttcttct tttctttaga aaattcatgt 120 tgttcttaat cttagttagc tcctggcatg gaatccattc ccaatattga gcctgagctg 180 atttgtgtta tatggttttg attggatcga gtaggttttt gatgaagtta aacaatgaaa 240 ctgtgtctat cgagctgaag aatgggactg tggtccatgg aaccatcact ggtaagttct 300 tattgttagc ttccggtttc tttgtagctc ttctcatctt ttcttctctc tcgatttctc 360 cgttgctagg tcttatacaa gtcgcgatct gttcccttat tttcaattgg ccctaatcgc 420 gtccttgtga tcacatgaat aggttgagta aacacacagt tagagccagt agtcataaag 480 gtatatttat tgaagtttaa gcttgatgat ttgggcaggt gttgatgtga gcatgaacac 540 tcacttgaag acagtgaaga tgagcctgaa ggggaaaaac ccagtaacac ttgatcatct 600 tagcttgagg ggtaataata ttcgctacta cattcttcct gatagcttga acctcgagac 660 tttacttgtg gaagacactc ctagagttaa acctaagaag cctgttgctg gtactgcttc 720 attcattttt ggtgtttgta atattcgtct tcataagcta aaagacttct ttatcagtcc 780 atttattcgt tctctctttc tttcttcttt agggaaagct gttggacgcg gtcgcggacg 840 tggccgtggg cgtggtcgcg gcagaggtcg ttagatgtag cagcgctctg gaacatgttg 900 aaggtttgtg agtttaattt ttaggagaat gtacgagtta tgtaactagc aactctggca 960 aaggaagat ttgattgaga atagtatga ttgatgctct aggaggt tactttgtaa 1020 tggaattcca tggataca gatttggctt tacatgttat agagcatct acaagtagag 1080 at 1082 <210> 27 <211> 2315 <212> DNA <213> Glycine max <400> 27 agagaagta agatagaca atagattga aagtgaat tcaaattca aaatcacaaa 60 attgtcctt aaacccttac aaagaaccg cttctctc tgttcatctc tcccactc 120 acttttaattt ttttgccta aaaccctcgc taccgccgtg gtggccgccg aaggtaagtt 180 ttcatcttct ctgatctgca tcgtttt tgccttcta atttcttct tattattta 240 atttgtgcaa aagaaaatgt bag gttttgttttctgtatt gcttcacaga 300 aggagtag agagcgcaat cgagtcttca tctcgactc accatgaagc tcgtcaggtt 360 tttctctttc tttgttgcgt tatctgttaa ttgcgttttt atttttttt cattttctga 420 gatcaaagtc tataatata cgaacactgt atgagtaggt ttttaatgaa gttgaacaat 480 gaaaccgtgt caattgagct caagaatggc actattgttc atggcaccat tacaggttc 540 ttttctttct ctaatttttt cccccagtgt tgtacaagtg tagaaccatt tacaagcaac 600 atattagagt tgaattcagt gtagttcga gcttgattgt gaggcattta attatttgca 660 agggttctct ctactcttca ggtgattact gattagaata gattatactt cagtaccttc 720 aactttttag gcattttctt ggtctggtat gggtaaacat atataaaaga ccatctcatt 780 gggtcgcggg tttctattag catgaaagtg gagagggatt ggggatttgg cttccaaaat 840 taattttctt tggcagctga ataactacaa aggtttcctt tactgagtag ttcattctgg 900 gggtaatttg gagtataatt agactgtgct gctgtgtagg atgataattt tgagatactg 960 caatttctta tagttcttat aatggtatga gacaagctaa ctcagtgggc tttggatgat 1020 ggtttattct tgtattaagt ttttggcaga taatttgtgg ggaaatgatc ctttcctgga 1080 agatctcagg acctcaatca cctgtctact aagcttctca ctcaacaaat ttctcttctc 1140 atggctcagt atttcttga aatttcaact tttagaggaa cttgcatgat agtgaaacta 1200 ctgaactaga cttcctgacc atcttacact cttacaattt acagttttac ttgattctag 1260 tatatcttc cctagttcaa atagatcaat ttggattccc ccccacccac acccactcta 1320 agatgtaact ttaccattgt ttgattgaaa ttattgcaat caatctcttc cgtgaaattt 1380 cctattggac acccatctga gttgagtttg atccagccac gtgggtgtgt agataataaa 1440 tctttgattt agtcagtcct tttactatct tgcttctttc tagttgaact acaccagcaa 1500 ctttaagaga ggaagtctta gcttactgat tctgggactt ttgccacagg tgttgatatc 1560 agtatgaaca cacatttgaa aacagttaaa ctaactctga aagggaaaaa tccagtcact 1620 ctagatcatc tcagtgtgag gggtaacaac atccgttact atattcttcc tgacagcttg 1680 aatcttgaga ccttgctggt ggaagagaca cccaagatca aacccaagaa gccaactgct 1740 ggtactgttt atagtttgac tacaaaattt tcatccatac tcaattcact ctaattgttt 1800 cttggtgagt tccccaggtt ttaattttag catattttca ttacatttcc aggcaaacct 1860 ttgggacgtg gacgaggaag gggccgtggc cgtggtcgtg gtcgtggtgg tggccgttga 1920 tttgcacctt tcttcatttt tgtggcatgt ggttgtaagc tatgcagcaa gaatttctgg 1980 gtggttttag gaacttctac ggagcatatt ttttattcct gctattttct tgcaagagct 2040 tatcatgctt tagtgtacaa ccatcttcct tctgaaactg atgtaacatg aattacctat 2100 ctgctattgc cttatactag ttgttaatgg ggatctattc attgagcagt atgacaaatc 2160 gcccacgact ttggtcatac ataacacagt aaataggccc aagagttgcc taatgagttt 2220 gaactagatg atggattcc tgatggcaca tattgtgtta tttatttatt tacatgtatg 2280 aatggtattt cttaaacgtc ttatttttgt ttgct 2315 <210> 28 <211> 10500 <212> DNA <213> Capsicum annuum <400> 28 atggttttaa cctttaactt tgtgtgcaga ttttaatga agctgaacaa cgagacggtc 60 tcaattgagc tcaaaaatgg caccgttgtt catggaacta ttacaggtca ctctctctct 120 atctttctcg gtatatattt tggatagata cctgttctac acttacgtag tagctgaatt 180 gctcacgcct atatgtgaat taaagtatgt gcttgtatga atatgatttt ctgggtggag 240 aagttatttt aaattgctga taaccgaaag tgtagttgtt gggtgggata tgcaagttgc 300 taaacttgat ttgtaatgcc acacgttaaa ttagttcata gaagatgaat ggtaactgta 360 atagcttact tccagcgtgg gtcactatgt atgtctataa aatgcatgaa agctatgtag 420 agaagctatc aaaattatat gagttaacct gtctcgatct gtcttctccc ctctccgttc 480 ttctgaattt atgaatcttt tcccttctta tcctctctga tccgcacgtt ttgatacaag 540 ccaaacggcc atcttagcct ttgatgccat cgttcgaggc caacacatgg aaaatctgat 600 tttggaaact ttgaaggccc gagagtatgc acggggaagc cattgtgggc actcaatagg 660 gcaatcccgt gtgtgtaagg ttgcatgggg gcttgccttg atgcccgaga gctacaagtg 720 ttgaagtatc aaccatccac agttggagca ttgaagaggt gtccattcat tggtgtctta 780 acactccaag accgcccctt cattaagggt gtcttggtca ttttatgtcc ctccttgact 840 ccataggtgc ctctttcatt aagggtatgt tgttatttta tcttcatctt aggcttattt 900 ttcagcttag ttgtttattg atattgagag aactcatctc ttgagagagt gttataaccg 960 taactagggt agcacttagt gtgaaatcac tagtgttgca ttttggctag aaatgttggt 1020 gcttgaggag agtgtgttcc ctcttgtgtc tacgtaagag cttggtgttg attatatgag 1080 ttgtaggggt tttgacgttt gatacacgtc ttggttctta ggttcttgta taattttagg 1140 tcaagttact atcctttatt tattgcattg ttgttgtgtt tcgtatcttg tcttcattat 1200 ctcgtttctt tgtgttgctg cctcatttgt tgttatcttg ttttcagctt tgttcttgtg 1260 ttttgtggct gtttttagtg tcccgtactc gtctctgtat catttggtat gagagcaatg 1320 attgattttg ttccaataaa attaatcttg ggcttgttaa ctcgaaaatc acaaaaaaaa 1380 agtgttgaaa aattgaaaat ccaaaaagaa acattctgtc tcgtttttag tctttggtcg 1440 aaattttgaa cttagattta ggaggttttt atgtgttttg gttgtttcta gtgttagccc 1500 cttcattact aacactaaaa gagtctaaat ctaagtttgg agtcatttcc atgttcttgg 1560 aatttgaaga ttgttgttgt tgtggatttg agttgaacgt gtgttgttat tgaagatgtg 1620 ggcttgaaaa cgtgttgttg ttatagagtt caacgtgagc taaaagagac aaaaatcatt 1680 caatttggag ctcatttggt ttggttttca ttcttgaatg ttcttgttgt tcttgcttct 1740 tcatgttgtg ttgaagaaga atcctcaaag gaggttgttt gatctaaaaa tcaagtgaaa 1800 gaaagattgg tctttgtttg tcttggaaac attttcaaga caaaaaggtt tgacttgttt 1860 tgcacctttt tggcaagaca acctttttga ggggtttgtc tcctttcctc ttttgtcaat 1920 cttgaaaaat gctctttctc ctttttggca ataagtcttt ttgaaagtct tattgtccct 1980 ttccttcttt gtatacaaac aaagaccact ctcttttcac ttgattttct tgatcaaaca 2040 accattcttg aaaatttctt tccaacaaga tatgtagatg gtgaagaaca cctcctttga 2100 aattttggag ttctaggtgc acattggacc tccaaacatc aacaactatg cgttttcaag 2160 ttcaaatctt caacaacaca ttttcaagcc accaatcctc aaaaaacagc aactttcaaa 2220 ttccaagaac aactcgaaaa tggctcaaaa tttggatcta gactcactta gtgttagtga 2280 agaaggggct aatactagaa acaaccaaaa gtccaaaaca cataaaaatc tcataaatct 2340 aagatacaaa tttcagccaa gacaccaaaa atgggacaat ttttttttt ttgagatttt 2400 tagattttca acacttgttt ttttgtgatt cgcaagttaa caagccccag attgatttcg 2460 taggaacgaa atcaatcctt gcgctgatac caaatgataa cggatcgact acgaacacac 2520 aaaaacagcc aagaacaaca aggaaaaaccg agaacaagat acaacaaaaa caatggcagc 2580 agcaacaaca catgataatg gaaacaagac aacaaatgca ataagataaa gatagttagt 2640 ttgatatagg gagattacaa aacctaagaa ccaagatgtg tttcaaacgt caagacccct 2700 aaatcccgta atactaaca ccaaactctt atgtagactc aagagggacg tcaatctcct 2760 caagcaccaa cgtttctaag ccaaaatgca acacaagtga atccacactt aatatgccct 2820 aattacggtt tcactctctt tctctctaga gagaagactt gttctttcaa taatccatat 2880 caataatcaa ctaaggaaat aaaccctaaa atgttctact tatagtctat tacaaaagaa 2940 gataaaatga tcaaactatc cttaatgaga aaggggtgcc tatggagtgt caagacacca 3000 tgtgcaatct ctaaattacc cttaaagaag ggccagcctt ggtgtgtaaa ttagggggct 3060 gccttggagt gtgtaaagct cttcaaaaca cttcttcact tgtgctctca ggtagtcatt 3120 aaggcaagcc tccaagcaac cctccacaca cggaattgct ctcttgaatg ttcaaaacgg 3180 gtcctccatg catgctcttg tgtcctcgag gtgatcaaag cttgagtttt taagtgttgg 3240 cctccaagga tgtcatcaaa agctatgttg gccgtttggc tcgtatcatc ttcatcccac 3300 ttcaatcatt cttcgactct ggagctcctt tcaaattcca ttaggaattc attcgcaagt 3360 gcagagctat tctgcttgtc atccctgtaa tttatgcta tagcattgta attcctctct 3420 gttaatgtgt taattgcact ctgtttcaat ataaataata tctcttgttc agctttttgtg 3480 gttctacaag ttaaattgct acgcaatccg aagaaattga agtgttctat attcactata 3540 tataacaatt caacaatttc cttcataaga aatttttgc cagtactatg gacgcttatt 3600 gtaagctctc caactctgaa ataatacctt ttcaagaaac ggatgcaggg agacatggtc 3660 aggaaactcg agtcttcaat gaatctctac acatttatcc caaactagtt ggggtcacct 3720 ataagagtat cctaatttgt tgtgctttt tcagaccatt tcattaattc acacttcata 3780 tactgatata caaatctcta aattaaaaaa caaaaacata gaaattgtgg gagcgaacat 3840 aagattctta ttggagtatc ttttagtca ttttcttaat atttttcata agtttaacct 3900 caatccacat attatttgct ttaaaactta aaactatgtt aggtttgtgt tggaaaaaaa 3960 aacttaagag gaacggaagt agagaggaaa attaagagat aattctttgc aagtaagcag 4020 gaataggaag caaaagtgga taggttttgt attcttatat ctgaaatttt tcagtgtatc 4080 tgaaatttaa cttaaaaagg aaatgtttgt cttctgttcc aatcatacca aacaaccaga 4140 agtacaacgc ttctctccac ttaagggagg taaatcagtg aataacccgt actctaatga 4200 aggggaaagt aaatcagtaa atgaaaaatg cttcatttaa gggaggtgaa tccgtagaat 4260 ctctctcaac ttgagattga tatagtattt tctaatactt ctaagttttc acgggtaact 4320 gtcaccatat tttatacatc agtagaaaat ataaagattt tttgtacctc ttatattctt 4380 attatctct ttatgttgta tatattagc ctgagatgaa tttaaatgga gtaacatgat 4440 caacgaggat tcatatagcc gagtcaaact tgtttggaac tgaggtggtg tttcttctgt 4500 gtcgttgtaa gaccttcccc ataatttgt cgataaaatg ggttgataat gtaatgctct 4560 tcagaagttt aagttatctt gcacttggtt ccagatcatt atgccaccat tgttctcatt 4620 ccccacaagt gaaaagttct atgctggaag cattttggtcc aagagctttc ttaatttcta 4680 tgcaagaccc tactatcttc atccacttgt ttccaagatg tgcattagtt gctcttatcc 4740 cacaaatata gcattaattg gcaaaaccta tgttaaatg tcaatttctc tatataaaat 4800 tctgattacc ttgtttttgc tatactgtaa cttataatac ttgtatagtt gatcatataa 4860 gcaagattcc ttcacttgtt tgtggattgt ccttatctat gtgaggtgtg agcaagctat 4920 tatttcccag cttgaggtta aagttccagg tacttacggt cagaaagtcg acacatacaa 4980 gtgtagttat ataggctggt cgatatgata tttgggcatg tagaactatc caaaagagtg 5040 agaagtaagt ggcatatatg atatcgtgta ctccgacagt cactttttgtc atgcaatgtt 5100 actgatcata gattcaactg gacaagaagc taagttatgt ccaactcctg ttattcagtg 5160 agtatgtatg aatggtcgag cttaagcggg cacaaaatca acttgtagct ttacatgttg 5220 taccctggtt ttatgacaac aactcttaat gttgtattta taattcttttt ctgttgtcta 5280 atcttgttgt caatgctatt tatgttatc ttactgtatt ttttgtacaa ctgaggagta 5340 gcctcttatc ccttattttc ttttggtgc acccattagg tacctttgtg cattgaggat 5400 tgggtgtcat tcatagaaaa tcatatcttt aggtaggctt tctacattttt ggtatacttc 5460 ttatatacgg tcgtgctttg taccgaaaca ttttaaaat tagtaattac tttatcctcc 5520 aaaaaaaaca tctgtagctt ctttatctgg cagtagagat gctacttggc aaaattaggt 5580 aggcttctta tggaaagtgc cagggcttgt gctggttgca ggatgcatct gaaatgtcat 5640 tggccagaag ggcagcaaag ataagggaac accctttgct gctagctttc tccctttttc 5700 ttttcaccgt ccaaatccaa attgtggatc cttattgca tggatgcttg attgattgcc 5760 atctctacag aaatttcttt ctgttttaga taactagact ccaacaacaa cattcccaat 5820 gaaatttcac tacaaaatat accacatata gagacctaca tgcttccgac ttttatttcg 5880 tgtacggttg cttatgctaa cagaaaattg ctagatatat ttgggatata taaatttgtg 5940 ttcgagcatc agtatgtgtt ttgatattaa ctaggcacaa tggctattca atccgtctcc 6000 ttactgactt tactaaattg agagctgtga gttaatgttt ctaaagcgag ttatattttt 6060 aatatttata ggtgtggatg tgagcatgaa cacacacctg aaggctgtca aaattacgct 6120 aaaggggaag aatccagtga cgttggatca cctgagcgtg aggggtaaca acatccgtta 6180 ttacatcctc ccagacagct taaatcttga gacgctgctg gtggaagata cacccagggt 6240 gaagccaaag aagccaacag ctggtatgtt cagacgtttc tttttctttt tcctttgtaa 6300 ttgctaaaaa agtaatgttc agaagtattt ttatgcctcc tggctgtatg gttaaatttc 6360 cttgatgctt agacgtatac taatttcctc tttcttgat tcttctttct caggaaagcc 6420 tttgggacgt ggtcgtgggc gcggccgtgg acgtggacgt ggtcgaggcc gctaaatgca 6480 ttccagctac tcttattttt ttttttgcag tggtgtctat gtaaacatat atgtatggat 6540 ggagagactt gctcttagtt ttctagcaga aaagagattg atctaatgca acaatttatt 6600 ccggatcttt aaagtctgag cacgttattt cgtttcgcac gatatatggt gtactaacat 6660 ttctttcgta tctcattcaa cttattctg cctattcata tcactgaact gtgttggtca 6720 cttttgcatc tgcccatttg cattgtgccc ttcggtttt tcatacaaag tagttgttac 6780 ttttaagctg cttactggct taaccctatg aaactctaat aatgcccaca tttacttagt 6840 ttagtctata ataggaagta gtttgttaaa attaaaatg acagaagata gaaaaaggga 6900 aaaagaagca agatactact acgaactagt gttttgagtc tctcacatta ccagcctaca 6960 tttggatcaa attgggaatt ggaggaatca ttatgtggga tgatcgatac aagtttgaac 7020 ccgggcactt ttcatggatt tgaaactcca tcaaattttt aactaaaaat tatgttgtta 7080 gtttcattta agatgggatt tatgttgttt atacaatttt taaatcaact gaatcgtttc 7140 attttcctta agtttgccaa actggctaaa agttgaatac tctactctaa aatattggat 7200 acaacttaaa tagcaggcta acatagtgca attgttacca ttaaaaagtg acccggccca 7260 catttagtcg attgggcctt tttacatcgc ccaaaatgaa taggcccatg tgctacgggc 7320 acatggagta cgaccgcgct tctgttggga gtctctggtt tttgaataaa ccctggcgct 7380 ccttgcccta aacgggaggc tgtatcggga gtatcttcaa tttctccagc aagaatgaag 7440 ctcgtcaggt tcactcgaaa tcttcaatta ttttttttca cagtgagttt agccattgat 7500 taaactttca actttgtgtg cagatttttg atgaagctca acaacgagac tgtctcaatt 7560 gagctcaaaa acggcaccgc tgttcatgga accattacag gtcactctct ctctatctct 7620 atctttctca catttttt tgcattttta ttctaatata tattttgtat agctgtattt 7680 acgtatttgg tgtgaccctt gtaaggctgt ataatccgaa gtgaataatt tgcacttatg 7740 taatagctga atttctcata cagtcacacc aatatgtaaa ttaaagaatg cgcttgtatg 7800 gatatgattt tctgggtaga taagttattt caaattgttg ctaactgaaa gtttagttgt 7860 tctgaaaaaa ggggagtcaa catatattat atttacataa aactaaaatt tttgacctag 7920 ctaaacagtg aagttttccg tcgaaggggt atcaaatgac acccctcgcc ataaggtggc 7980 tctgccactg gtaagtggta actgcaatag cttactcat tctcctttca cttccaccag 8040 tcactatgta agtctgtaaa tgcatggaat ctagggtaga gaagctataa agagtatatg 8100 aggtaatccg tctgatatca atcggtcttc ccctctctct gttcttctga atttccgaat 8160 cttctgaatt tccgaattcc tttcttatcc tctgattt gcacatttta tctccacttc 8220 aatccttctt caactatgaa gttcgtttga agtaccata ggaatttatt aagaagggac 8280 aggaagcaaa agtagatggg tgtctatcc ttctatctgg atttttagg gtactggaa 8340 tttgatggaa gagaaaatg tttgtctt acttctgtcc aaccttacca aacaaacaga 8400 agtacatctt ttctccactt acgggaggta aatcactgaa tggacatgct acccacttatgg 8460 tggagtata cagtaagtgg ccaatgcttc tctcattctc tgtcaataa aaagggacca 8520 atgcttcgct ttagggaggt agatcagtag aatctctctc aacttgagat tgagataca 8580 taatttatag tactctaaa ttttaacgggg taactacac cattacagta tactcagta 8640 ggaaatatga agactttg gtactgttta tggagtaca tggtccatga ggattcattt 8700 agccgacacg aacttgtttg gaactgaggt gtcgtttctt ttgttgttgt tgtaaaacct 8760 tcatcatcat tttgtctgat aaaattggtc gataatgaaa ttctcatgag aaatttaagt 8820 tatcttgcgc atggttcctg attattatgc caattgccac cattgttctt agttccctac 8880 aagcgacaag ttcttttatg ccggaattat ttggtccaag agctttctta ttttctatgc 8940 agaaccctgt tgtcttcatc ctgtcgtctc caagacgtgt gttagctgct ctaatcccca 9000 caaatgtaac attaattgac aaaacgtatg ttcagtgatc aatttcatct gtctacattt 9060 tgattaccta gttgttgcta caccgtaacc tatgccactt gtaatcgatt atgtaagcaa 9120 taaccatgat ggcttcactt atttatggat tgtctatgtg aggcatttgt aagctactat 9180 atcccagctt catgttaaag ttccagcctc caggtatttg ctatatttaa tgtttcttgt 9240 tcttagatca actggacaag gagctaagac tttttttttt tttttgggga taaccgtggt 9300 gtccgggcca tcttgcccgc acctcgacta atttcacggg atacttgcca cctcccacca 9360 gtcaccggtc accaacaaca tgtaccaggt aactttgtcc accaagacta gaacaaatgg 9420 aaagaaatca cctagtgttt gtctctgttg ggaattgaac ttgagacctc atggtgctca 9480 acccaacttc attgaaccac taggccacaa ctttgggtgc aacacgtagc gaagagttgt 9540 gtgcaactct tgttattcac caagtatgtt tgaatgcttg agcttaagtg ggtgtgaaat 9600 caacttatag cttattatgt tgtactcaag ttttacgaca acaccactta gtgttgcaag 9660 tataaggaaa tacgagcacg tttcgttgtg aaaagaagag aggtaataga agaaccaata 9720 attgttaccc tgcaaaacag gacatggacc atctaattta tgggtcctaa ttttgcgtgg 9780 aggcttagtt gatggccata tatgtattcc agaagtttta tctcttttct aaacgattag 9840 aatagttaaa acataaattt ttgtcatatc ctcctattta gagacctttt gcattttttt 9900 tctctgttgg ttgtcctttc tatgcttccg acttttattc cgtgaagggt tgcttatact 9960 aacagaaaat tgcttgatat atttgggaca cattaatatg tcttaagcat atcagtatgt 10020 gtttcgatgc taactaggca caatgtctat tacatccgtc tccttactat ttactaaatt 10080 gagagctatg agtttagttt ctaaagggag ttatattttt ataggtgtgg atgttagcat 10140 gaacacacac ctgaaggctg tcaaaattat gcttaaggga aagaatccag tgactttgga 10200 tcacctgagt gtgaggggta acaacatccg ttattacatt ctccctgaca gcttaaatct 10260 tgagacgctg ctggtggaag atacacctag ggtgaagcca aagaagccaa cagctggtat 10320 tgtcatattc ttaagggcta tgttcagatt gtttttgcgc cttctggctg tatggtttaa 10380 tttccttgat gcttggacat ccttctaata tcctcttcat ttgtttcttc ctcttcaggg 10440 aagcctttgg gacgtggtcg tgggcgcggt cgtgggcgtg gacgtggtcg aggccgttaa 10500 <210> 29 <211> 6572 <212> DNA <213> Capsicum annuum <400> 29 atgaagctcg tcaggtttat gcaatttctt caattttttt ttgtctctgt gagttttttt 60 ttccctagtg tgtgtagcca tggttttaac cttaacttt gtgtgcagat ttttaatgaa 120 gctgaacaac gagacggtct caattgagct caaaaatggc accgttgttc atggaactat 180 tacaggtcac tctctctcta tctttctcgg tatatatttt ggatagatac ctgtaaaatc 240 taagatgaac agtctacact tacgtagtag ctgaattgct cacgcctata tgtgaattaa 300 agtatgtgct tgtatgaata tgatttctg ggtggagaag ttattttaaa ttgctgataa 360 ccgaaagtgt agttgttggg tgggatatgc aagttgctaa acttgatttg taatgccaca 420 cttaaatta gttcatagaa gatgaatggt aactgtaata gcttacttcc agcgtgggtc 480 actatgtatg tctataaaat gcatgaaagc tatgtagaga agctatcaaa attatatgag 540 ttaacctgtc tcgatctgtc ttctcccctc tccgttcttc tgaatttatg aatcttttc 600 cttctttatcc tctctgatcc gcacgttttg atacaagcca aacggccatc ttagcctttg 660 atgccatcgt tcgaggccaa cacatggaaa atctgatttt ggaaactttg aaggccccgag 720 agtatgcacg gggaagccgt tgtgggcact caatagggca atcccgtgtg tgtaaggttg 780 catggggct tgccttgatg cccgagagct acaagtgttg aagtatcaac catccacagt 840 tggagcattg aagaggtgtc cattcattgg tgtcttaaca ctccaagacc gccccttcat 900 taagggtgtg ttggtcattt tatgtccctc cttgactcca taggtgcctc tttcattaag 960 ggtatgttgt tattttatct tcatcttagg cttatttttc agcttagttg tttatgata 1020 ttgagagaac tcatctcttg agagagtgtt ataaccgtaa ctagggtagc acttagtgtg 1080 aaatcactag tgttgcattt tggctagaaa tattggtgtt tgaggagagt gtgttccctc 1140 ttgtgtctac gtaagagctt ggtgttgatt atatgagttg taggggttt gacgtttgat 1200 acacgtcttg gttcttaggt tcttgtataa ttttaggtca agttactatc ctttatttat 1260 tgcattgttg ttgtgtttcg tatcttgtct tcattatctc gtttctttgt gttgctgcct 1320 catttgttgt tatcttgttt tcagctttgt tcttgtgttt cgtggctgtt tttagtgtcc 1380 cgtactcgtc tctgtatcat ttggtatgag agcaatgatt gattttgttc caataaaatt 1440 aatcttgggc ttgttaactc gaaaatcaca aaaaaaaagt gttgaaaaat tgaaaatcca 1500 aaaagaaaca ttctgtctcg tttttagtct ttggtcgaaa ttttgaactt agatttagga 1560 ggtttttatg tgttttggtt gtttctagtg ttagcccctt cattactaac actaaaagag 1620 tctaaatcta agtttggagt catttccatg ttcttggaat ttgaagattg ttgttgttgt 1680 ggatttgagt tgaacgtgtg ttgttattga agatgtgggc ttgaaaacgt gttgttgtta 1740 tagagttcaa cgtgagctaa aagagacaaa aatcattcaa tttggagctc atttggtttg 1800 gttttcattc ttgaatgttc ttgttgttct tgcttcttca tgttgtgttg aagaagaatc 1860 ctcaaaggag gttgtttgat ctaaaaatca agtgaaagaa agattggtct ttgtttgtct 1920 tggaaacatt ttcaagacaa aaaggtttga cttgttttgc acctttttgg caagacaacc 1980 tttttgaggg gtttgtctcc tttcctcttt tgtcaacctt gaaaaatgct ctttctcctt 2040 tttggcaata agtctttttg aaagtcttat tgtccctttc cttctttgta tacaaacaaa 2100 gaccactctc ttttcacttg attttcttga tcaaacaacc attcttgaaa atttctttcc 2160 aacaagatat gtagatggtg aagaacacct cctttgaaat tttggagttc taggtgcaca 2220 ttggacctcc aaacatcaac aactatgcgt tttcaagttc aaatcttcaa caacacattt 2280 tcaagccacc aatcctcaaa aaacagcaac tttcaaattc caagaacaac tcgaaaatgg 2340 ctcaaaattt ggatctagac tcacttagtg ttagtgaaga aggggctagt actagaaaca 2400 accaaaagtc aaaaacacat aaaaatctca taaatctaag atacaattt cagcagac 2460 accaaaaatg ggacaattt tttttttt gagattttta gatttcaac acttgttttt 2520 ttgtgattcg caagttaaca agccccagat tgatttcgta ggaacgaat caatccttgc 2580 gctgatacca atgataacg gatcgactac gaacacaaaacagccaa gaacacaa 2640 gaaaaccgag aaaagaac aaaaaaaaaaaaacaca tgataatga 2700 aaaaaaaatgcaat agataaa tagttagtttt gattaggga gattaaaa 2760 cctaagaacc aagatgtgtt tcaacgtca agaccccta atcccgtaat actacacc 2820 aaactcttat gtagactca gagggacgtc aatctcctca agcaccacg tttctaagcc 2880 aaaatgcaac acagtgaat ccacacttaa tatgcctaa ttacggttc actctctttc 2940 tcttagaga gagacttgt tctttcaata atccatatca atatcact aaggaaataa 3000 accctaaaat gttctactta tagtctatta caaaagaaga taaaatgatc aaactatcct 3060 taatgagaaa ggggtgccta tggagtgtca agacaccatg tgcaatctct aaattaccct 3120 taaagaaggg ccagccttgg tgtgtaaatt agggggctgc cttggagtgt gtaaagctct 3180 tcaaaacact tcttcacttg tgctctcagg tagtcattaa ggcaagcctc caagcaaccc 3240 tccacacacg gaattgctct cttgaatgtt caaaacgggt cctccatgca tgctcttgtg 3300 tcctcgaggt gatcaaagct tgagttttta agtgttggcc tccaaggatg tcatcaaaag 3360 ctatgttggc cgtttggatc gtatcatctt catcccactt caatcattct tcgactctgg 3420 agctcctttc aaattccatt aggaattcat tcgcaagtgc agagctattc tgcttgtcat 3480 ccctgtaatt tatgtctata gcattgtaat tcctctctgt taatgtgtta attgcactct 3540 gtttcaatat aaataatatc tcttgttcac cttttgtggt tctacaagtt aaattgctac 3600 acaatccgaa gaattgaag tgttctatat tcactatata taacaattca acaatttcct 3660 tcataagaaa tttttgcca gtactatgga cgcttattgt aagctctcca actctgaaat 3720 atacctttt siagaaacgg atgcaggg acatggtcag gaactcgag tcttcaatga 3780 atctctacac atttatccca aactagttgg ggtcacctat agagtatcc taatttgttg 3840 tgctttttc agaccatttc atttattcac acttcatata ctgatataca aatctctaaa 3900 ttaaaaaaaaaacataga aattgtggga gcgaactaa gattcttatt ggagtactt 3960 tttagtcatt ttcttatat tttgatag tttaacctca atccacatat tatttgcttt 4020 aaaacttaaa actagttag gtttgtgttg gaaaaaaaa cttaagagga acggagtag 4080 agaggaaat windowgata ttcttgcaa gtaagcagga atggagca aaagtgata 4140 ggttttgtat tcttatatct gaaattttc agtgtatctg aaatttaact taaaaaggaa 4200 atgtttgtct tctgttccaa tcataccaaa caaccagaag tacaacgctt ctctccactt 4260 aagggaggta aatcagtgaa taacccgtac tctaatgaag gggaaagtaa atcagtaaat 4320 gaaaaatgct tcatttaagg gaggtgaatc cgtagaatct ctctcaactt gagattgata 4380 tagtattttc tatacttct aagttttcac gggtaactgt caccatattt tatacatcag 4440 tagaaaatat aaagattttt tgtacctctt atattcttat tattatcttt atgttgtata 4500 atattagcct gagatgaatt taaatggagt aacatgatca acgaggattc atatagccga 4560 gtcaaacttg tttggaactg aggtggtgtt tcttctgtgt cgttgtaaga ccttccccat 4620 aatttgtcg ataaaatggg ttgataatgt aatgctcttc agaagtttaa gttatcttgc 4680 acttggttcc agatcattat gccaccattg ttctcattcc ccacaagtga aaagttctat 4740 gctggaagca tttggtccaa gagctttctt aatttctatg caagacccta ctatcttcat 4800 ccacttgttt ccaagatgtg cattagttgc tcttatccca caaatatagc attaattggc 4860 aaaacctatg ttaaatggtc aatttctcta tataaaattc tgattacctt gtttttgcta 4920 tactgtaact tataatactt gtatagttga tcatataagc aagattcctt cacttgtttg 4980 tggattgtcc ttatctatgt gaggtgtgag caagctatta tttcccagct tgaggttaaa 5040 gttccaggta cttacggtca gaaagtcgac acatcaagtg tagttatata ggctggtcga 5100 tatgatattt gggcatgtag aactatccaa aagagtgaga agtaagtggc atatatgata 5160 tcgtgtactc cgacagtcac ttttgtcatg caatgttact gatcatagat tcaactggac 5220 aagaagctaa gttatgtcca actcctgtta ttcagtgagt atgtatgaat ggtcgagctt 5280 aagcgggcac aaaatcaact tgtagcttta catgttgtac cctggtttta tgacaacaac 5340 tcttaatgtt gtatttataa ttcttttctg ttgtctaatc ttgttgtcaa tgctatttat 5400 gtttatctta ctgtattttt tgtacaactg aggagtagcc tcttatccct tattttcttt 5460 ttggtgcacc cattaggtac ctttgtgcat tgaggattgg gtgtcattca tagaaaatca 5520 tatctttagg taggctttct acattttggt atacttctta tatacggtcg tgctttgtac 5580 cgaaacattt ttaaaattag taattacttt atcctccaaa aaaaacatct gtagcttctt 5640 tatctggcag tagagatgct acttggcaaa attaggtagg cttcttatgg aaagtgccag 5700 ggcttgtgct ggttgcagga tgcatctgaa atgtcattgg ccagaagggc agcaaagata 5760 agggaacacc ctttgctgct agctttctcc ctttttcttt tcaccgtcca aatccaaatt 5820 gtggatcctt atttgcatgg atgcttaatt gattgccatc tctacagaaa tttctttctg 5880 ttttagataa ctagactcca acaacaacat tcccaatgaa atttcactac aaaatatacc 5940 acatatagag acctacatgc ttccgacttt tatttcgtgt acggttgctt atgctaacag 6000 aaaattgcta gatatatttg ggatatataa atttgtgttc gagcatcagt atgtgttttg attack ggcacaatgg ctattcaatc cgtctcctta ctgactttac taattgaga gctgtgagtt aatgtttcta aagcgagtta tatttttaat atttataggt gtggatgtga gcatgaacac acacctgaag gctgtcaaaa ttacgctaaa ggggaagaat ccagtgacgt tggatcacct gagcgtgagg ggtaacaaca tccgttatta catcctccca gacagcttaa atcttgagac gctgctggtg gaagatacac ccagggtgaa gccaaagaag ccaacagctg gtatgttcag acgtttcttt ttctttttcc tttgtaattg ctaaaaagt aatgttcaga agtattttta tgcctcctgg ctgtatggtt aaatttcctt gatgcttaga cgtatactaa tttcctcttt ctctgattct tctttctcag gaaagcctttt gggacgtggt cgtgggcgcg 6540. gccgtggacg tggacgtggt cgaggccgct aa 6572 <210> 30 <211> 2367 <212> DNA <213> Cucurbita moschata <400> 30 gtaatggttg tacctgtacg cgccagctgc agtattttct cataccaagc accccacttc 60 tttatttgtt tatttattat acgtaatttt ctttttcgtc cttttattct ttatattatc 120 atttatatcc acttattttc tccatttact tatcaggcgt accacatact tgaaattgta 180 caaatttccc ctcccgcctc ctttgtttgt ccgtgcttga aaccctacat tttgcaattc 240 ccccgccatc atgaagcttg ttaggtatgc tcttcttttt tcttactctg agcttctttt 300 ttctcgaact actcgttgtt tgatgtattt agtggtcgtt ttatgtttag aaacttggtt 360 ttgatgaatt cacaggtttt tgatgaagct caacaatgag acagtttcaa tcgagctgaa 420 aaatggaacc gttgtccatg gcaccatcac aggtttccat ttctctttca ctcactaact 480 cgcactgcat aaaaacttca ttaatcttgt taaaccctta aaccctagat ttacgaactt 540 actggcagag gttttttaaa ctttaacttc cattctgttt tcatctttgt acgccactat 600 attggaagtt gtagaatatc tcagtgcaaa gtgataattg gaatttggat tcttttgtca 660 atttagagtg gtttatgata taccacaagc cttctggctc ttgataacct tggaatacgt 720 agatgtttct cggcgacatt gctacaaact gggggtgaca acccaacttg ggaactttat 780 tttagcttct cttggggtgt tgaggcttct gtaagtaaga gactgcacaa acatcctgtc 840 tatcctgggg agattcataa cttatttaa ccaaaggact tttcagcttt agcaggttt 900 ggatagttca atgaaagtgg ttttagtgga gatacagttg gatgaatcaa tggatcctac 960 tactttgtct tggccagctt ctaattgaac cctattgatc ttttctgcaa aggcaatcca 1020 actaccaatt tctctattta aaagagccaa caagcactcc acaattatcc tccaatgtaa 1080 cctttggttt aggtttcata gcaaattctt gtggttccac cccatatgcc gaccatcacc 1140 tctcaccgtg accatttaag gagggcacta tttctctact tatagaagag ccaaacccca 1200 agacccaatg gaagggaagt ccaactccat ttcgatcaag tatcttatat cccccatccc 1260 cacaccccaa aaaaaaaaa aaaaagttgg tgattatgat gagattgcat tttgttgtgg 1320 acacctccta tccagcttcc acttgatgta ttttctatg tgctgctggt tctgaaacta 1380 attattgttg tcttttctta caactgtttt tatggaagag ttctactcaa tgtcatagtt 1440 ttgctggtc acaccttctg ttgtaggatt tcacttgaaa ctataaataa gtgtcaatat 1500 atacaatatg cttgaataac ataccttgca gtgcattatg acttggccta attgaataag 1560 ggtcatgtaa ataacaaatg acttggagag aatggattca agccatgttg gttacctact 1620 taggattat tatcctatga cttaccttgg caacagaata taggggtc agtcagttgt 1680 cgcaggttgg atctgaaatg aatggatatg aaaaaaaatg aaaaataaaa acctatcttg 1740 cacttacagc ttgtgaaatt tgtttggcct aatatgttga agcatctaaa ttacgctcta 1800 cgttcctgtt ttctataatt tatttctaaa acatgctcag atgagtatta ttattatttt 1860 ttttttaaaa aagaacaatg acggcatgaa cttgatgtag aagctcttac tctttttgct 1920 taaaaccaag cattggtcaa ggttagaagt cattgacggg ctgattttct tgtatcactt 1980 aggtgtggat atcagcatga atacacattt gaaggctgta aagcttactc taaaggggaa 2040 aaatccagtt accatggatc atttaagtgt gaggggaaac aacatcagat attatattct 2100 acctgacagc ttgaatcttg agactttact tgttgaagag acacccaggg tcaagcccaa 2160 gaaaccaact gcaggtatgc gctgtctttg cattttgcct gtactttatg gtgttttctg 2220 aaagtcaaat tgtttatact gaatcgtatg ccacccagtg tcaaatatgt tgcttatgta 2280 tttccccatt cttttgcaac tatagggaag cctttggggc gtggacgagg acgaggccgt 2340 gggcgtggtc gtggtcgtgg acgctag 2367 <210> 31 <211> 3599 <212> DNA <213> Melo Mustache <400> 31 cttcattttc ttcaatctat tagaaacaaa gaaagaaaga aaggaaagaa atagggacaa 60 ccgcagcaat ctcccaattt cctctccccc gcttctgttg tttgaaaccc tacattcttc 120 ctttctctc caatcatgaa gcttgttagg tatcttcttc tctttttcta ttttgccct 180 ctttttttc tcgatctaca tccaaatgac gtttttcgtt ttcaaaatct tggttttcat 240 acaggtttt gatgaagctc aacaatgaga ctgtctcaat cgagctcaaa aatggaactg 300 ttgtccatgg aactatcaca ggtctttcta cctctctttc attaaatctt cttaaaccct 360 agatttacca actttgcggc tgaggggttt ttaacttcca acttctcttc tattttcttc 420 tttgaacttc actgtattgg aatttgtaca acatttcagt atgttccccc agtgtacaac 480 tctcactact attgctttcg tctcatttcc atttcccgac cttttaaagc taactaaaat 540 gttctctatc ccgctcccat tttaattta aaaaattagt attcaactca tgggttgctt 600 aggagaaatt aagttccttg tcttctggac gtttggagga tgagatgttt ttctctgtat 660 tgtttttatt tttattattt tcataataat ttgaactttt gattactgtc tctactgatg 720 ctgaataagc attctatttc atgacatatc tgtagattta aacaaatgtt taaaatatcc 780 tacaatttat tctttcccgt ttgatttgat ggaattgttt cgtgaattta cttcttcttt 840 cttttttttt tttttttttt ttgaaatgga aacaaaacaa gtatttatac ttatacaatc 900 atcttgaact gtttctcacc tgcactagaa tgatgttacg ttagtctgat taaacatgaa 960 cttctgctga atcccagcat ttttggactc ggcagcccat atgccattct ttggttaatt 1020 atatgtgtgt gtttttaatt ttgttttgca taagagactg cgcaataact gaagaagaag 1080 caacttgtaa cttgaactgt tcccagtggt agaaacatag tcaattgagc agtagcaaat 1140 tatctttgtt tgtagccttt gtcctcctac actgcctcta acaacttgaa ctattcttaa 1200 ccttccctgg aatagcaata acttaatctt gattaatcaa aacttcttct gaactccatt 1260 atttttgggt tccgtatccc attggccatt cttatatgaa ttttaccct tttttatctt 1320 ttggtgagag actatgttac aagtgaagca aaaattctaa cctagggtaa tcttcgtgct 1380 ggtggagaaa acctgggagc tataaaaaaa agagccttcc gataaaagtt aaatcatgtt 1440 cataagtaga ctgtaattac aacacattat cttctatttg aaaaaccatc gtaaaaatgt 1500 gtatggtaca ctattaaaaa tatattctaa aatagatatt tttcctctca aaatattcgt 1560 agaagtagta gtgcagattt tatcctacat ctaacccatc aggctgtgaa tgttttaaaa 1620 aataatcgtc acccaagcta gttaggcaaa agataaacca gttttgttga aaatgaaaaa 1680 cgatgctcta tagacaaaag gacagtggag gtaaaggtaa ttttgggatt ccccatttga 1740 ataatagagg aacaaaccag gggagacaac ccagcttggg aacttttttt agattctctt 1800 ggggggttga ggcttctatt agtagccaac ctcacaaaca tcttaacctt cctaggggtg 1860 cccaacatcc aaactgattt gactttacaa atgcatattt tgctttagca aggtctcaga 1920 gagtttagtg aaggtgatct tagaggagaa acaatttaat gaatcaatga attttacctc 1980 tatgtcttgg ccagcttctg attgaaaagt atcgatcttt cctataaagg ctatccaact 2040 ttccaatttc tctgtgagaa gagccaacaa gcattccaca attattcccc aagactatcc 2100 atggttttgg tttcatcgtc gtttctggtt ctagatggca accatcactt tttgcaacta 2160 tttaagaagt agcgcattat ttctttactt actaaaagag ccaaccaatg gaaaggaagt 2220 ccagctccat tttaatgggt gacttaggat tcgatgaatt atgattagtt tgcatttgtgt 2280 tgttgacaac ccctataca tcttccactc aatgtatttt gctatgctgc tgctactgaa 2340 actagttatt taccggcaga gttttcacga ctcattattt tagttggtta cctctttgtgt 2400 tggaggattt cagttgagat tgtacgcaat gttttaaaag gctaaaggca gcctcttcca 2460 aagttgtaag tctctttggt taaaaatact ttaccaagta ttgctgggca acacttgata 2520 atcaggtaaa agtaatata aaaaaaaaaa ggaaaaatca ctcttcccaa tttccaccta 2580 gacaaaaatt ctaaaatgat atctttaact ttactaatat tatttgattg acttatccca 2640 gaaattat atcgtgacaa actaatatta ttcaataaac tattacaaag aggtgtaagt 2700 ctatgcatgc aatatgcttg ataacctaca ttgcacttta ccttgtgaaa tcttgttttc 2760 gactatgata cattaatcaa tgatttgttt taaaaaactc gatgaaattt catgaactta 2820 aagtagaagt acgcactctt ttctcttaaa acctaagtat tggtcaaggt tagaagtcgc 2880 tgatgggttg atttgagtg gttttcttgt attacttagg tgtcgatatc agcatgaata 2940 cgcatttgaa ggctgtgaag cttactctaa agggaaaaaa tccagttacc atggatcatt 3000 taagtgtgag aggtaacaac atcagatatt atatcctacc tgacagcttg aatcttgaaa 3060 ctttacttgt tgaagagaca cccagggtca agcccaagaa accaactgca ggtttgtgtt 3120 cttgcattct ggcctgtact ttatggtcat tttctgtggc aagtccaatt gtttatactg 3180 aatcatatca tttgctactc attatcaaat gtattgctta tgcatttcta cactctactc 3240 caactacagg aaggcctttg ggacgtggac gagggcgcgg ccgtgggcgt ggtcgtggac 3300 gtggacgcta gatttgatgc agtttcaatt tttgagacct gtagtgtaaa cacttgcatt 3360 gtagggaaag attatgaatt ttgggacacg aaaaagtggt attgcaattc actgttcaat 3420 ctcgtatgta gtttattaca atgctattcg gttgtttttc atatgataga tgtagccttg 3480 ctatgtttcc tggtgcttgg gatctgttaa tggtttgctc taatatcatc acaatgataa 3540 atcgagtatg tctctatctc gttttttact tttaatccca atagatttgg tagtcatgc 3599 <210> 32 <211> 3302 <212> DNA <213> Cucumis sativus <400> 32 cctctccccc gcttcgttgt ttgaaaccct acattcttcc tttcctctc aatcatgaag 60 cttgttaggt atcttcttct cttttcttat tttgccctc ttttcttct cgatctacat 120 ccaaatgccg tttttcattt ctgaaatctt cgttttcata caggttttg atgaagctca 180 acaatgagac tgtctctatc gagctcaaaa atggaactgt tgtccatgga accatcacag 240 gtctttctgc ttctctttct ttaaatcttg ttaaacccta gatttaccaa ctttgcggct 300 cagggttctt taacttccaa cttctgttct atttctttct ttgaacttca ctgcgttgga 360 atttgtacaa catttcagta tgttcaccag tgtacgactc tcactactat tgctttcgtc 420 tcacttccat ctcccgacct ttgaaagcta acggaagggt tctttatccc gctcccattt 480 ttaattttaa aaattagtat tcaacttatg agttgcttac ggcaaattaa attccttgtc 540 ttctggacgt tgggaggatg agatgttttt ctctctattg tttttatttt tattattttc 600 attttcaaaa taatttgaac ttttgattac tctctactga tgctgaatat gcattctatt 660 tcatgatata tttgtagatt taaacaaatg tttaaaatgt cccgtcattt tttcatggaa 720 tgactcctac aattcattct ttcccatttg atttgatgga attgtttttt caaccaagtg 780 aatatacttt tttttttttt gaaacggaaa caaaccaagt gaatatactt ctacaattaa 840 cttgaggtga gaaacctgca ctagaatgat gttactatag tctgattaag catgaacttc 900 tgctgaaccc cagcattttt ggactcggta gcccatatgc cattctttgg ttaattgtat 960 gtgtgttttt aaatttgttt tgcataagag actatgcaat aactgaaaga gaagcaactt 1020 gtaactgaac tgtgcccagt ggtggaaaca tagtcaattg agcagtcgca aattatatgc 1080 gccttgtcc tcctacactg cctctaacta catgaactat ttttaacctt ccctggaata 1140 gcaataactt agttttgatt aatcttcttc tgagttccat tagttttggg ttctgtagac 1200 cattagccat tcttacatga atttttaccc ttttttatct tctgatgaga gactatgtta 1260 caagtgaagc aaaaagtcta acctaggttt aatcttgggg ggagaaaacc ctaggagcta 1320 taaaaaaaag agccttctga taaaagttaa atcatattca ttagtagact gtaactacaa 1380 cagattatct tctatttgaa aaaccatcgt aaaaatgtgt atggtacact attaaaaata 1440 gaatctaaga tagatacttt ttctctcaaa atatttatag aagtagtagt gcagatttta 1500 ttttacatcc aactcatcag gctgtgaatg tttgaaaaa taattgtaac ccaagctagt 1560 taggcaaaag ataaaccagt ttgttgaaaa tgaaagacca tcctctatag acaaaaggat 1620 agtggagata aaggtaattt tgggattacc cattggaata atagaggaac aaaccagggg 1680 agacaaccca gtttgggaat ttttttctag attctcttgg ggggttgagg tttctattag 1740 tagccaacct cacaaacatg ttaaccttcc taggggtgtc aaacatccaa actgatttga 1800 ctttacaaag gcgttttcag ctttagcaag gtctgagaga gtttagtgaa ggtgatctta 1860 gaggacaaac aatttaatga atcaatggat tctacttcta tgtcttggtc agcttctaat 1920 tgaaaggtat cgaactttcc tataaagtca atccaacttt ccaatttccc tgtgaaaaga 1980 gccaacaagc attccacagt tatcccccaa gactacctat ggttttggtt tcattgtcgt 2040 tgtttctggt tctagatgat cacttttcac aactgtttaa gaagtagcac atcatttctc 2100 tacttacaaa aagagctgac caatggaagg gaagtccgac tctattttaa tgggtgactt 2160 actgatttgg tgaattatga ctagtttgca ttttgctgtt gacaaccccc tatacatctt 2220 ccacttaatg tatttttcta cgctgctggt actgaaacta gttatttacc ggcagagttt 2280 ttttttcaca aggagttgta acagaagagt tgagactctt gtcataactt atgactcata 2340 attttagttg gttacctctt ttgttggagg atttcagttg agattatacg caatgtttta 2400 aaaggctaaa ggcagcctct tccagcatag ccccaaggtg aggtgttatg agttgtaagt 2460 ctctttggtt aaaaatattt taccaaatat tgttaggcaa cacttaataa tcatgtaaaa 2520 gttaataaaa agaaaaaagg aaaatcactc gtcccaattt ccacctagac agaagttcta 2580 aaatgatatc tttaacttta ctaatattat ttgattgact tctcctagaa atattagatt 2640 gcgacaaact aatattattc aataaaatta ttacaaagag gtgtaagtct ctatctatgc 2700 aatatgcttg atgacctaca ttgcactttg cgttgtgaaa tcttgttttc gactatgata 2760 tgttaatcaa tgatttgttt taaaaaaatt caatgacatt tcatgaactt aaagtagaag 2820 tacgcactct tttctcttaa aacctaagta ttggtcaagg ttagaagtcg ctgatgggtt 2880 gattttgagt gttttctttg tattacttag gtgtggatat cagcatgaat acgcatttga 2940 aggctgtgaa gctaactcta aagggaaaaa atccagttac catggatcat ttaagtgtga 3000 gaggtaacaa catcagatat tatatcctac ctgacagctt gaatcttgaa actttacttg 3060 ttgaagagac acccagggtc aagcccaaga aaccaactgc aggtttgtgt tcttgcattc 3120 tggcctgtac tttatggtca ttttctgctg caagtccaat tgtttatact gaatcatatc 3180 atttgctact cattatcaaa tgtattgctt atgcatttct acactatgct ccaactacag 3240 ggaggcctt ggggcgggga cgagggcgcg gccgtggacg tggtcgtgga cgtggacgct 3300 of 3302 <210> 33 <211> 3151 <212> DNA <213> Citrillus lanatus <400> 33 atgaagctca acaatgagac tgtctcaatc gagctcaaaa atggaactgt tgtccacggc 60 actatcacag gtctctctaa ctctctttct taaatcttgt taaaccctag atttaccaac tttgcggccg tggtttttct cccaacttcc aacttccaac ttccaacttc caacttccat tccattttct tctttgaact tcactgtatt agaagttgta gaatttca gtatgtccgc 300. 300. 300. 300. 300. 300. 300. 300. 300. 300 360. gctaactgaa gggttctggc aagcgtgcac ttggagaacc accttcccac tcccattttt aagtttaaaa attagtatta tcatcaattc ttttaaaagt aaattagtat tgaactcatg ggttgcttac gtgaattaa atccttgtct tttgggtgtt gggaggatga gacattttct ctgtatattt tttattgtat tatttaat tatcataaca atttgaacta ttgattgctg tctactgatg ctgaatca attctatttc atgacatatc aacaaatgct 660. TAGATTCC TCTCACATTTT TGATTTAATG TCTTCTACAA TGCCTTCTTT CCCCCTTGTT ctgtagggaa tgtttcttaa accaagtgaa tatacttaaa ctttaacttg tactgttttt 720 tatctgcact agaatgatat tagcttagtc tgattaaaca ttaacttctg ctgaacccca 780 gcatttttgg gataaggact acccaataaa tgaaagagag gcaacttata acttgaactg 840 tgcccactgc ccagtggtgg aaacatcaat tgaacgcaaa taacctttat tcgtcattag 900 ccttcatcct cgtacactac ctctatcacc atcacctata acttgaactg tttttcatct 960 gccctagaat ggcattaact tagtctgatt aaacaaaaat tctgcctaac tccattgttt 1020 tttggttctg tagcccatat tccattcttt tgtgaattgc gactattttc ttttcttgtg 1080 aaagagtatg gtacaactaa aagagaagct aaaagactaa tctagggtag cctagggaat 1140 ggtagagaaa accctgccca tggagctata gaagatgtgc cttccaataa gagttaaatc 1200 atattcataa gaggactcta attacaatag aatatcttgt atttgaaaaa ctattgtaaa 1260 aatgtgtgtg gtacactgtt acaaatagaa tctaaaatag atattttt cccttaaaaa 1320 aattgtagaa gcacaatcc gaagatttt atctcacat ataagccacc aggctgtcga 1380 ctgcttccaa aaatgaccgt siaccaagct agataggcaa aagataacc atttttgttg 1440 aaaatgaaag accatchctct acagaaaaaa ggacagtgga ggtaaggta atttttgggat 1500 tccccgttgg ataacagag gaacaacca ggggagagaa cccagttttgg gaaccttttt 1560 tgagcttgtc ttgggatgtt gaggtcttcc taggcgtgtc aaacttccaa actgatttaa 1620 ccgaaggcgt ttgagcttt agcaggtct cagagagtttt agtaggtga ttgagaa 1680 gagacaattg aatgaatca tggttctac ctctatgtct tcgacagctt ctattgac 1740 tgtaacattc tttcctatga aggcaatcca actgacatt tcttatga aggagcaac 1800 aagcactcca cattatccc ccaaaattac ctaggatat ggttttggtt tcattgtcta 1860 tttttctggt ttgacccat agatgccac catcactttt cataactatt taagatgtag 1920 ggcattattt cttacttct gtaaataatcc aatggaaggg aagtccaatt ccattttaat 1980 gggtgcctta ggatttggtg aattatgatt atattgcatt ttgttgtaga caaaccct 2040 ctatacctct ttgttggag gactttagtt tagattaata gccatgtttt ataggctaa 2100 aggcagtcct ctggaagaga cgaggtgtag cctcatggtg ttatgaagca ttaagtctca 2160 aatttgatta atcttttttt accaagtatt gctaaacaa acttaataat catgttaaag 2220 ttaaaagaaa aaaagaaaaa tcactctcc caatttccac ctggacaaaa attctaaaat 2280 gatatctttt acctcactac tattatccga ttgacttatc ctagaaattt tagactgtga 2340 caaataata ttattcgaca attackaca agaggtgta agcctcaata ccttttgaaa 2400 acatggcta taaatagtg tctctatata tgcaatgc ttgatgacct atattgcact 2460 tatgccttgt gaaatcttga ttttgactga agcatctaag ttactttacc tgtttcatct 2520 gtgttcgaca aattattct aagacattct ctagcgctac ttagatgaat atcattgagc 2580 aacactacat cattgcatct gcaagtgtag atgtagtaat tttcaatgat attacgttca 2640 ttaattcttt gtttcaattc aatgacactg catcaactta aagtagaagt atgtactctt 2700 tttctcttaa aacctaagta ttggtcgagg ttagaagtca catatggttg attttgagcg 2760 gtttttcttg tattacttag gtgtggatat cagcatgaat acacatttga aggctgtgaa 2820 acttactcta aaggggaaaa atccagttac catggatcat ttaagtgtga ggggtaacaa 2880 catcagatat tatattctac ccgacagctt gaatcttgag actttacttg ttgaagagac 2940 acccagggtc aagcccaaga aaccaactgc aggtatgtcc tgtccttgca ttctggcatg 3000 tactttagtc aaattgttta tactgaatca tatgctatcc attatcaaat gtgttgctta 3060 tgcatttcta cactctactc caactacagg gagacctttg ggacgtggac gaggacgtgg 3120 ccgtgggcgt ggtcgtgggc gtggacgcta g 3151 <210> 34 <211> 3913 <212> DNA <213> Solanum habrochaites <400> 34 acgtttagtc caatggatga ggcagcccat gtgctaatgc gacgtcgtta tagtgttttt 60 tgaataaccc tggcgctctt tgccctaaac ctgaggtcgt gttcgatctg cgcttcgact 120 taagccctag tgtctcttca atttcttcag caacaatgaa gctcgttagg ttcatgcgat 180 atcttcattt tttgagtttc ttttccagtg tgcttagcaa tggatttaac ttttaccttt 240 tttgtgcaga tttttgatga agctgaacaa cgagactgtc tcaattgagc tcaaaaacgg 300 caccgttgtt catggaacca ttacaggtca ccctccctct ctttctgtct atttctttat 360 tagctatatt taggtatttc cctgtcaagt ctaaaatgaa caatctgcac gtatgtaatt 420 gctgaattgc tcgctccaat aggtaaatag aatgtgcttg tataaaattc atttcctggg 480 ttgacaagtt ttttggtagt gtcgctaact gaaagtctag ttgctgggtg gtatatggaa 540 gttgctgaac tacaacaaca atatactacc cagtgtaatt ccacaagtgg tgaggtcttg 600 ggagacagag tgtttgcctt acccctacct cgtagtgttt aagtgactgt ttccaataga 660 ttctcatgtt taaataaagc atttccaaac cattttttta ataaaggata tataaaaata 720 agtgctcatg acagacaagt gaggttttgc tcaagtggtt gagcacttcc accgtcaact 780 agtaggttga gggtttgggt cagaggatag atgggaacac tattgatcct tctaggctcc 840 tgggggtggg gtggaaaaaa cggagcaaca acaacaacga aagcaagttg ctaaactgtc 900 tttggtttat gccacaagtt aagttagttc atagcgaatg ttaactgcaa tagtttactt 960 cactctcctt cacttccact gtgagtcact atgtatgtcc ataaatgcat ggaagctagg 1020 actgagaggc tatagaaagt atacgaggta acccgtctca atctgctac tcctctcact 1080 gcccttctga atatgtctct gattcacacg tattatctct actttgtcc tccttcact 1140 atgaagttcc ttcaatc cattggaat tcattctca gtgcagagct atttctgcct 1200 atcatcactg taatttatgt ctatactcta accgtagttc ctctcagtta atgcgttaat 1260 tatactctgc ttcaataaga atacatctc tcgttcactt ttgtgctc taaaaattgg 1320 attackacac aactcgaaga attttgaagt gtcactataa attacaca attccttcaa 1380 tgaatttgta tgcatttaa taaactatga tgtctcaatc ccaactagt tgtatgtct 1440 atattagtgt cctatattg ttctgctt tttggaccat ttcattaatt cacagttcgt 1500 atactgaaa tacaatttc tattattgaa aaaaaaaaaaaaaaga attatggga 1560 gtgaacatgg gattcttatc atctttttgt cattttctta atattttgtc ataagttaac 1620 cccattgata tattctttgc cttaaaactt aaactatgtt tgactggggt ggaagtgggg 1680 cgtttgcgaa aggctatgtt tagcgtgggg gttggaagtg gtagtgtttg cgaatgagtg 1740 tgtttagcgt gggggctgaa gggtaagtca ggggtaaatt agtaatttga cttttaagtt 1800 aggagttgct ttaaagtaat atagatagat atagataatt actttatcct ctgcaagaaa 1860 atcgtacagt agcttcttta tctggcagta gagatgcctt agcaaactta gataagcttc 1920 ttatggcaag tgccagggct tgtgctggtt gcatcgaaaa tgtcaaattt tgcaaggaaa 1980 atagccatat atgtattgca gagtttatct ctattctaga taactgtagt agtcaaaagt 2040 aaatttttgt cctgttctca tattttgaga cctatagcat ttctcttttt ctgttggttg 2100 tcctttccat gcttttgact gttattcctt gaggggttgc ttatacttac agaaaattgg 2160 tagatatatt cgggatatag aaatatgtat ttgagcatat cagtatgtgt tttgatatta 2220 actaggcaca gcggctatta aatctgtctc cttattgaag ttgctagatt gagagctgtg 2280 agttatagct tctaaaggca gttacattt tacaggtgtg gatgttagca tgaacacaca 2340 tctgaaggct gtcaaaatta cgctaaaagg gaagaatcca gtgacgctgg atcacctgag 2400 tgtgaggggt aacaacatcc gttattacat cctccctgac agcttaaatc ttgagacgct 2460 gctggtggaa gaacaccta gggtgaagcc aaagaagcca acagctggta ttgtcatatt 2520 gttaaggact atgttgggat tttttgtgc cttgtgggtg tatggctaaa tttccttatt 2580 gcttggacat ccttctaata tattcttcct ttgattgttc ctcttcagga aagcctatgg 2640 gacgtggtcg tgggcgcggt cgtgggcgcg gacgtggtcg tggccgctaa atgcattcca 2700 gctgctctta ttttttgcag tgttgcctat gtaaacatgt gtacggatgg agagatttgc 2760 tcttagtttt tcccagtaga aaaaagatgg atctcatgca caatttattt tgtatctttg 2820 aagtcaggag catgttatct cgttgcatca tattgtctgc taacattact ttcgtatcgt 2880 gttcaatttt gttctgcctt gtcaagttac tcaactaaat tggtcacttt agcatctata 2940 ctctgaatag agtggcatag aattatattt ggaccaaatt gggaattgag ataaatgatg 3000 atcggtgtgg tataaggatt gaaatccagg aatcgttgaa actcccatca aattgggttt 3060 tttaacttgt aaagtataaa acattcacaa atctttggaa gtccagcaaa attgaagcct 3120 cggtattatt tttgggttcc accgtcaaag ttgtgaaatt attccatgtt ttagtttttg 3180 taacaacaag cgagttttta attaaatgaa aatgagatac tctatcagat gttgatatgg 3240 ctatttatgt aacttttcga tactcaaatc aatcgggccc attccttcta tcttaattcc 3300 tcttctggta tataaaaata gagaagcaaa tcatctcgag agctgcaaac gaaaaccctc 3360 atcggcacaa ggtgcttgtg gtctctttca atggcgaaga ataactcgtt gaagtcgacc 3420 gcagtggtat tcggagccct agcatttggg tggctggcga ttgagcttgc tttcaaacca 3480 tggcttgata aagcccgagc ttccatggac aagtctgacc catctcgcga ccccgacgat 3540 caaagttcag aaactggcaa gtctcaggtc gatgttgatc cgaacaactg atttgatttt 3600 tgggttctaa accccaaaat ccaaatatat gtgcttgaat tttacttcat aataaataat 3660 tatgacttgt taatttctgt ttttcctcag tttctagccg tccctgtatt ttattttgtt 3720 ggttaaagtg aaagaaaaaa aaaagaattg gtagaagtttt aatacaattc aagaggtaag 3780 ttcaagataa ttgttccgtt tttatgtttc tgtccatttg tatttgtata aaatgatatt 3840 ttgacattta acgtgttgct gttgattat catataaaaa tttgtctaca caaatgagaa 3900 tgagaaagag ggc 3913 <210> 35 <211> 4290 <212> DNA <213> Solanum brunellii <400> 35 60. tgatttttat aattttacat acatagatac ctaagaggtg ctattattct father gcattaaata gtgtgagacg cggcccacgt ttagtccaat ggacgttccc agacgaggcg father catcacttgt gttttttaa caacccctgg cgctccttgc cctaactaa agccctagat tagtgtgttt tcaatttctt cagcaagcaa caatgaagct cgtcaggttc atgcgatatc ttcatttttt ttgagtttct tttccagtga gcttagcaat ggattttaac tttacttttt tgtgcagatt tttgatgaag ctgaacaacg agactgtctc 420. aattgagctc aaaaacggca ccgttgttca tggaaccatt acaggtcacc ctccttatct ttctttcttt gctaaattga acaatgtaat ttctcaagcc aatatgtga ttaaataatg tgtttgtatg aatttcaagt tatttggaag tgtcgctaac tgaactacaa caacaacata aatattccac aagtggtgag gtcgtaggt taaagaggtt ctttccaata gattttcatg cttaaataaa gcatttccaa acaatttttg taaaggatat acaaaaatta gtgctcatga 660 cagacaagtg aggttttgct caagtggttg agcactggta ggttgagggt ttgggtcaga 720 ggatagatcg gaacactatt gatccttcta agctcctagg ggtggggtgg aaaaacggag 780 cagcaacaac aacgaaacca agttgctaaa ctatctttgg tttatgccac gagttaagtt 840 agttggtaa ctgcaatagt ttacttcact ctccttcact tccgctgtga gtcactatgt 900 atgtccatga atgcatcgaa gctagggctg agaagctata gaaagtatat gtggtaactc 960 gtctcaatct gtctactcct ctcactgccc ttctgaattt gttatcttct tatcctctct 1020 gattcacacg tattatctct acttcagtcc ttcaactatg aagttccttt caaataccaa 1080 taggaattca ttctcaagtg cagagctatt tctacctatc atcactgtaa tttatgcta 1140 gactctagat cactgtagtt catctctgtc aatgcattta ctgtactctg ggtcaataaa 1200 aaacatca ctcgttccct ttttgtag ctctaaagt tggatta cacaactcga 1260 agaaatttga agtgtcacta taatattag tatgcattta atacaactg tgatgtctca 1320 atcccaaact agttggttg tctatatgag tgttcttat tttctctgct ttattcggac 1380 cattcatta attcacagtt cgtatactga aaatacaat ctctaatta aaaaaaaaa 1440 caaaaaacta agaattatg ggagtgaaca tgggattctt atcatcttt tgtcattttc 1500 ttaatattc tcttaatta acccattca tatattctt gctttgaac ttaaactatg 1560 tttggctggg gtgaaaaaa gaagcttaag aggaatggaa gtaagaggtt agagttaat 1620 ttcgttctaa gtaaaaaagg gattaaagc aaatgtagat gggttgtgta tccttctatg 1680 tggattttc agtttatctg aattttgatg gaaaaaggaa atgtatttgt cttattctg 1740 ttccagccat accaacaac ctgaactaca tcgctttat acacatagg gaggaaaatc 1800 actgaataac caatacacca cataacggga aagtaaatca gtgaccaatg cttcactaa 1860 gggaggtaga tcagaagaat ctgtcttgac ttcatattga gatagtagaa tttgtaatac 1920 ttctaaattt tcacgggtaa ctgtcaccat taatttgata catcagtaga aagtataaag 1980 aatttttggt acttttatac tgctaatatt ttcaatgttg tgtaatatta gcctgagata 2040 agtttaaaca gagtaacatg gtcaatggga ttcatttagt cggaccgaac atttttgaaa 2100 ctgtggtgtt gtttctttcg ttgatgttgt aagaccttca ttatcatttt gtcaatagaa 2160 taggtcgata atgtaatgat cttcagaaat ttaagtctgc acatggttcc acatcattat 2220 gccaccattg ttctcaggtc cctacaagtg aaacattcta tgctgggaatc atttggtcca 2280 agagctcttt tattttctat gcaaaaccat gttgtcttta tcctttgtt tccaaagatg 2340 tgcattagtt gctcatctca gcaaatgtaa cactaattga caaaacctac gttcaatatt 2400 aaattttatc tgtaaaat tttgattacc tagttgttgg tatacgggta acttataaca 2460 cttgttagtt gattatatga gcaaaaacca tgttgcctcc acttgtttgt ggattttcat 2520 tgtctatgtg aggcgtgagt aagttcttat ttcccagctc gagcttaagt tccaggtact 2580 taggtcagaa agagtacgac acgtcaagtt ctataggctg gttgcatttg atatttgagc 2640 atgtagaact agcgcaaaga gtgagaagta agtggctata tgatgttgtg tactctgact 2700 tttgctgtgc aatgttaact aatcttaaat tcaactagat gaggagctaa agttgtgtcg 2760 aacaactatt attcactatg catgaatact tgagcttatg cgagcgtgcg atcaacttat 2820 agcttattat gttgtaccca agttttatga aaacaacacc tagtgttgcg tttataattc 2880 ttatccgttg ttgtaatctt gttgtgaatg ttctatgtaa ttcattgtac tatagatttt 2940 ttaccattga ggagtagcca tttatccctt atttctttt ggtgctccca tgatatacct 3000 ctatgcattg agataagtg tcattcattg atgatcgaa catcatatct ttaggtaggc 3060 gttctgcttt ttggtatact tatacaggcg tgctttgtgc ctacatttaa aaaaataata 3120 attgctttat cctctaaaaa agatcatcat actgtagctt ctttgtctgg ctgtagagat 3180 gccttagcaa acttagatcg gcttcttatg gcaagtgcca gggcttgtgc tggttgcatc 3240 gaaaatgtca aatttgcatg gaaaatagcc actatgtatt gcagagttta tctctgttct 3300 agatacttt agtaggcaga agtagatatt ttgtcctgtt ctcatatttt gagacctata 3360 gcattttcca tgcttttgac ttttattct tgaggttg cttatacttg cagaaaattg 3420 ctagatatca gtagtgtt tgatattac taggcacatc gctattaca tctgtctcct 3480 tattgaagtt gctaaattga gagctgtgag ttaagttttc taaggcagt tacatttta 3540 caggtgtgga tgttagcatg aacacacatc tgaggctgt caaattacg ctaaaaggga 3600 agaatccagt gacgttggat cacctgagtg tgaggggtaa caacatccgt tattacatcc 3660 tccctgacag cttaaatctt gagacgttac tggtggaaga aacacctagg gtgaagccaa 3720 agaagccaac agctggtatt gttaaggact acgttcagat gttttgtgc attgtgggtg 3780 tatggttaaa ttgcctttt gcttggacat ccttctaata cgctcttgct ttgattgttc 3840 ctcttcagga aagcctatgg gacgtggtcg tgggcgcggt cgtgggcgtg gacgtggtcg 3900 aggccgctaa atgcattcca gctggtctat ttttttgcag tcttgcctat gtaaacatgt 3960 gtacggattg atagatttgc tcttagtttt tatcctgtag aaaaaagatg gatctcatgc 4020 aacaatttat tttggatctt tgaagtcagg agcatgttat ctcgttgcat catattgtct 4080 gctaacatta attcgtttc gcgttcaatt tagtcacctt atgcatgttt tgagagttga 4140 gtcacattta atgtcgattg agaattcagc tccttcttat gaattatact tcttatagga 4200 aatagccttc tttggtgtga ctcggagggg gaatattgtt cctcttactt ccccttttag 4260 tctgtttcaa aaaaaatgtc actttcttct 4290

Claims

1. A plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance.

2. The plant of claim 1, wherein the modified SmD1 protein comprises a missense mutation at a position corresponding to any one of amino acid positions 1 to 108 of SEQ ID NO:

1.

3. 3. The plant of claim 1 or 2, wherein the modified SmD1 protein comprises a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO:

1.

4. The plant of any one of claims 1 to 3, wherein the modified SmD1 protein comprises a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO:

1.

5. The plant according to any one of claims 1 to 4, wherein the SmD1 allele is obtained by mutagenesis.

6. The plant according to any one of claims 1 to 5, wherein the plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.

7. The plant of claim 6 , wherein the plant is a selfed, dihaploid, or hybrid plant.

8. The plant according to claim 6 or 7, wherein the plant is a rootstock.

9. The plant of any one of claims 1 to 8, wherein the plant comprises two copies of the SmD1 allele.

10. 10. The plant according to any one of claims 1 to 9, wherein the modified SmD1 protein confers improved resistance to nematodes of Meloidogyne species, preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii and Meloidogyne javanica.

11. The plant according to any one of claims 1 to 10, wherein the plant is Solanum lycopersicum.

12. The plant of claim 11, wherein the modified SmD1 protein has the amino acid sequence of SEQ ID NO:

2.

13. 13. The Solanum lycopersicum plant of claim 12, wherein the SmD1 allele is obtained from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.

14. A plant part of the plant according to any one of claims 1 to 13, comprising the SmD1 allele.

15. A seed produced from the plant according to any one of claims 1 to 14.

16. 1. A method for improving nematode resistance in plants, comprising: a) obtaining a population of mutant plants; b) selecting mutant plants containing modified SmD1 alleles encoding SmD1 proteins with missense mutations in their amino acid sequences; A method comprising:

17. 1. A method for identifying a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, that exhibits improved nematode tolerance and has at least one copy of an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO:1, wherein said SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein: a) obtaining a population of mutant plants; b) screening said population for the presence of said SmD1 allele A method comprising:

18. A kit for detecting the nematode resistance trait SmD1 allele in cultivated tomato plants, particularly cultivated Solanum lycopersicum plants, the kit comprising one PCR oligonucleotide primer pair represented by a forward primer of SEQ ID NO: 22 and a reverse primer of SEQ ID NO: 23.

Images