Polymerase chain reaction primers and probes for mycobacterium tuberculosis

Abstract

The present invention provides novel primers and sloppy molecular beacons and molecular beacon probes for amplifying segments of different genes in MycobacteriumTuberculosis to identify the presence of M. tuberculosis DNA and / or to identify resistance to anti-tuberculosis drugs.SOLUTION: Oligonucleotide sets are provided for amplifying a portion of an M. tuberculosis region selected from the group consisting of rpoB, gyrA, gyrB, inhA promoter, rrs, eis promoter, embB, katG, dosR, IS6110, and IS1081 genes.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 062,351, filed October 10, 2014, the disclosure of which is incorporated herein by reference.

[0002] Federal Interests The invention disclosed herein was made at least in part with government support under grant numbers U01AI082174 and R01AI080653 from the National Institutes of Health. Accordingly, the United States Government may have certain rights in this invention.

[0003] FIELD OF THE INVENTION The present invention relates to novel primers and sloppy molecular beacon (SMB) and molecular beacon (MB) probes for amplifying and detecting different gene segments in Mycobacterium Tuberculosis to identify the presence of Mycobacterium tuberculosis DNA and to identify resistance to anti-tuberculosis drugs. [Background technology]

[0004] Tuberculosis (TB) was declared a global emergency nearly 20 years ago (WHO Global Tuberculosis Report 2013). Although the rate of new TB cases is declining worldwide, achieving the Millennium Development Goal target of a 50% reduction in disease by 2015 remains difficult (WHO Global Tuberculosis Report 2013). The increasing incidence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) TB poses a serious threat to these reduction targets (WHO Global Tuberculosis Report 2013). MDR TB is defined as TB resistance to treatment with at least rifampicin and isoniazid, while XDR TB is defined as MDR TB that is additionally resistant to treatment with fluoroquinolones and the injectable drugs amikacin, kanamycin, and capreomycin. Patients with drug-resistant TB are best identified as quickly as possible so that appropriate infection control and treatment can be initiated promptly (Boehme, CC, et.al, 2011, Lancet 377:1495-1505).

[0005] Traditional phenotypic methods can take weeks to months to fully reveal drug resistance patterns in Mycobacterium tuberculosis (Mtb) due to the bacterium's very slow growth (Heifets, L., et al., J Clin Microbiol 38:1227-1230; Kim, SJ, 2005, Eur Respir J 25:564-569; and PT, K., and K. GP., 1985, Public Health Mycobacteriology: A Guide for Level III Laboratory. Center for Disease Control, US Department of Health and Human Services, Atlanta, Georgia.). Molecular tests promise more rapid detection of drug resistance. Mtb does not naturally contain drug resistance plasmids; therefore, molecular tests are performed on chromosomal DNA. Genotypic assays are relatively easy to design because the Mtb genome has fairly high sequence conservation. Virtually all drug-susceptible clinical Mtb isolates have identical DNA sequences in the drug resistance target, except for a few easily identified "natural polymorphisms." Any deviation from the wild-type sequence in the drug resistance target gene indicates the presence of drug resistance to the corresponding drug. Genotypic assays are more rapid and sensitive than phenotypic assays because the DNA target can be amplified by PCR. Biohazards can be minimized by early destruction of infectious organisms.

[0006] The genetic targets responsible for most cases of drug resistance in TB are now known. Real-time PCR is the most sensitive, rapid, and robust method for detecting bacterial mutations. Virtually all other mutation detection methods, including PCR-MS, microarrays, miniarrays, and next-generation sequencing, require nucleic acid amplification as the first step in the detection process. In contrast, real-time PCR allows sample amplification, detection, and analysis to be performed entirely in a single well. No tubes need to be opened, and no complex fluidics is required. However, no one has been able to develop a general methodology for drug resistance testing that is simple and robust enough to be performed outside of a reference laboratory. Therefore, novel primers and probes are needed to detect M.tb and its drug resistance to the most commonly used first- and second-line drugs. Summary of the Invention

[0007] The present invention relates to primers, probes and related uses in M.tb and M.tb drug resistance.

[0008] In one aspect, the present invention provides an isolated oligonucleotide or primer set for amplifying a portion of an M. tuberculosis region selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, the katG gene, the dosR gene, the IS6110 gene, and the IS1081 gene. The set includes a pair of forward and reverse primers specific to the portion, each primer having a sequence substantially identical to an oligonucleotide sequence selected from those set forth in Tables 1A and 1B below. Thus, each primer has a sequence substantially complementary to the complement of an oligonucleotide sequence selected from those set forth in the tables. In some embodiments, the sequences of the primers are identical to an oligonucleotide sequence selected from those set forth in Tables 1A and 1B.

[0009] In a second aspect, the present invention provides an isolated nucleic acid having a sequence substantially identical to a sequence selected from those set forth in Table 2. In some embodiments, the nucleic acid comprises one of the sequences selected from those set forth in Table 2. The nucleic acid can be labeled, for example, with a fluorophore and a quencher at each of the two termini, or with a fluorophore attached to an internal nucleotide of the probe. Examples of fluorophores include fluorescein, cyanine 5, or Texas Red® and TAMRA. Examples of quenchers include BHQ1, BHQ2, and DABCYL. The present invention provides a kit comprising one or more of the above oligonucleotide sets and nucleic acids, which may further comprise a DNA polymerase, extension nucleotides, and a buffer.

[0010] In a third aspect, the present invention features a method for detecting drug resistance in M. tuberculosis. The method includes amplifying a first nucleic acid target sequence with a first primer pair to generate a first amplicon, wherein (i) the first primer pair is specific for a portion of a region selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, and the katG gene, and (ii) each primer has a sequence substantially identical to an oligonucleotide sequence selected from those set forth in Tables 1A and 1B, and detecting a mutation in the first amplicon. The presence of the mutation indicates drug resistance. In the method, the detecting step can be performed by a variety of known nucleic acid detection techniques, including, for example, sequencing-based techniques and techniques based on nucleic acid or peptide nucleic acid probe hybridization.

[0011] In one embodiment, the detecting step is carried out by a process including: (i) contacting the first amplicon with a first probe specific to the mutation under hybridization-promoting conditions to form a probe-target hybrid; (ii) performing melting temperature (Tm) analysis to determine a test Tm value for the probe-target hybrid; and (iii) comparing the test Tm value with a predetermined reference Tm value. If the test Tm value differs from the predetermined reference Tm value, it indicates the presence of a mutation. For example, a shift in the test Tm value of at least 3 (e.g., 3, 4, or 5) standard deviations from the predetermined reference Tm value indicates the presence of a mutation. Conversely, a shift in the test Tm value of less than 3 standard deviations from the predetermined reference Tm value indicates the absence of a mutation. Herein, the predetermined reference Tm value can be the average of wild-type Tm values. In one example, if the predetermined reference Tm value is lower than the predetermined reference Tm value, for example, by at least 3 standard deviations, it indicates the presence of a mutation. Otherwise, a test Tm value that is equal to or greater than the predetermined reference Tm value, for example, by 3 standard deviations, indicates the absence of a mutation.

[0012] The method can further include amplifying a second nucleic acid target sequence with a second primer pair to generate a second amplicon, the second primer pair being specific to a portion of a second region selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, and the katG gene. In some embodiments, the first region is the rss gene or the eis promoter. For example, the first region can be the rss gene and the second region can be the eis promoter. The two regions can be amplified independently or in the same reaction system using techniques such as nested PCR. In this case, the mutation can be A1401G or C1402T in the rrs gene. The mutation can be within the eis promoter region queried by the eis primer sequence.

[0013] The above method allows for the detection of resistance to drugs selected from the group consisting of isoniazid, rifampicin, amikacin, kanamycin, capreomycin, ethambutol, and fluoroquinolone drugs. The primer pair can be one selected from those listed in Table 1A and Table 1B. The probe can have a sequence substantially identical or completely identical to one selected from those listed in Table 2.

[0014] In a fourth aspect, the present invention provides a method for detecting the presence of Mycobacterium tuberculosis in a test sample, e.g., from a subject. The method includes contacting the test sample with a first primer pair under conditions conducive to an amplification reaction to obtain a first amplicon, and detecting the presence of the amplicon, thereby detecting the presence of Mycobacterium tuberculosis in the test sample. The first primer pair can be an oligonucleotide set for amplifying a portion of a region of M. tuberculosis selected from the group consisting of the gyrB gene, the inhA promoter, the eis promoter, the embB gene, the katG gene, the dosR gene, the IS6110 gene, and the IS1081 gene. Each primer of the first primer pair has a sequence that can be substantially identical to an oligonucleotide sequence selected from those set forth in Table 1B. The method can further include contacting the test sample or the amplicon generated by the first primer pair with a second primer pair under conditions conducive to an amplification reaction to obtain a second amplicon, and detecting the presence of the second amplicon, wherein the presence of both the first amplicon and the second amplicon indicates the presence of Mycobacterium tuberculosis in the test sample.

[0015] In a fifth aspect, the present invention provides another method for detecting the presence of Mycobacterium tuberculosis in a test sample. The method includes contacting the test sample with a first molecular beacon probe under conditions conducive to hybridization to obtain a probe-target hybrid, and detecting the presence of the probe-target hybrid, thereby detecting the presence of Mycobacterium tuberculosis in the test sample. In the method, the first molecular beacon probe comprises a sequence substantially identical to one selected from those set forth in Table 2. In one example, the first molecular beacon probe is selected from the group consisting of IS1081, dosR2, and IS6110 (SEQ ID NOs: 67-69).

[0016] The details of one or more embodiments of the invention are set forth in the specification below. Other features, objects, and advantages of the invention will become apparent from the specification and claims. [Brief explanation of the drawings]

[0017] [Figure 1] Figure 1 shows the detection of AMK and / or KAN resistance in 603 clinical DNA samples using SMB probes that generated three-point Tm profiles. Each of the three assay SMBs was tested against every M.tb DNA sample in a multiplex PCR reaction. Results for each sample are shown as a three-point Tm plot on the X-axis and the Tm value of each SMB shown on the Y-axis. Isolates are sorted from left to right as phenotypically susceptible and then resistant. A distinct Tm shift from at least one of the three probes can be seen in each resistant isolate. [Figure 2]Figures 2A, B, and C show the first derivative melting peak profiles of three SMB probes. Melting peak profiles of wild-type, mutant, and mixed DNA samples are shown for the rrs-1400 SMB probe (2A), the eis1 SMB probe (2B), and the eis2 SMB probe (2C). Each melting curve represents an individual strain. [Figure 3] Figure 3 shows the MIC values ​​of rrs and eis mutants and wild-type strains. The average MIC values ​​of rrs and eis mutants and wild-type strains against AMK and KAN are shown. Error bars represent ±1 standard deviation of the MIC values. eis-P indicates the eis gene promoter. DETAILED DESCRIPTION OF THE INVENTION

[0018] The present invention is based, at least in part, on the unexpected discovery of novel primers, SMB probes, and MB probes for amplifying fragments of 11 different genes in M.tb to identify M.tb DNA and the presence of resistance to antituberculosis drugs, such as isoniazid, rifampicin, amikacin, kanamycin, capreomycin, ethambutol, and fluoroquinolone class drugs.

[0019] Primers and probes Herein, primers that amplify the rpoB, gyrA, gyrB, and inhA promoter regions, the rrs and eis promoter regions, and the embB and katG genes enable sensitive amplification of drug resistance-inducing mutational hotspots in M.tb. The corresponding SMB probes target and identify these mutations that confer drug resistance to the most commonly used first- and second-line drugs. These primers can be used with very high efficiency in both symmetric and asymmetric PCR assays. The primer and probe sequences described herein have been used by the inventors to develop rapid and accurate molecular drug susceptibility testing assays for M.tb. Aside from their obvious utility in molecular diagnostic assays for M.tb, these primers can also be used to sequence target genes to identify resistance-inducing mutations in surveillance assays and other probe-based assays, enabling specific and sensitive identification of common drug resistance-inducing mutations in M.tb. Primer sequences amplifying the dosR, IS6110, and IS1081 genes allow for highly sensitive and specific identification of M.tb and can be used in any PCR assay format for highly specific and sensitive molecular diagnosis of tuberculosis. Listed in the table below are exemplary primers and probes of the invention.

[0020] [Table 1A]

[0021] [Table 1B]

[0022] [Table 2]

[0023] In Table 2, one or more probe sequences can be prepared in various detection formats, including dual-labeled probes, including liner probes, TaqMan probes, molecular beacon probes, and sloppy molecular beacon probes. A "sloppy" probe refers to a mismatch-tolerant probe. A mismatch-tolerant probe hybridizes to detectable signals of two or more target sequences at a detectable temperature in an assay, generating a detectable signal, and the various hybrids formed thereby will have different melting points. Liner, or random coil, single-stranded probes are generally mismatch-tolerant. An example of such a probe is a hairpin or linear probe with an internal fluorescent moiety that increases in fluorescence level upon hybridization to one or another target strand. See, for example, U.S. Patent Nos. 7,662,550 and 5,925,517, and U.S. Patent Application Publication No. 20130095479.

[0024] Preferably, the sloppy probe is a dual-labeled hairpin probe or molecular beacon probe, as described in U.S. Patent Nos. 7,662,550 and 5,925,517. These hairpin probes contain a target-binding sequence flanked by a pair of complementary arms. They can be DNA, RNA, or PNA, or a combination of all three nucleic acids. Furthermore, they may contain modified nucleotides and modified internucleotide linkages. They have a first fluorophore in one arm and a second fluorophore in the other, with the absorption spectrum of the second fluorophore substantially overlapping with the emission spectrum of the first fluorophore. Most preferably, such hairpin probes are "molecular beacon probes," which have a fluorophore in one arm and a quencher in the other arm, so that the probe is dark when free in solution. They can also be wavelength-shifting molecular beacon probes, for example, with multiple fluorophores in one arm and a quencher in the other arm that interact via fluorescence resonance energy transfer (FRET). The target binding sequence can be, for example, 12 to 50, or 25 to 50 nucleotides in length, and the hybridizing arm can be 4 to 10 or 4 to 6 (e.g., 5 or 6) nucleotides in length. Molecular beacon probes can be tethered to primers as described in U.S. Pat. Nos. 7,662,550 and 5,925,517 and WO 01 / 31062.

[0025] Thus, sloppy molecular beacon probes refer to a class of fluorescently labeled hairpin oligonucleotide hybridization probes. Such probes generate detectable signals in homogeneous assays, i.e., there is no need to separate target-hybridized probes from unbound probes. Thanks to their ability to bind to two or more mutations in a given target sequence, probes can be used in assays to detect the presence of one mutation or two or more mutations in a nucleic acid sequence segment of interest from among many possible mutations. Thus, probes can be used in two or more combinations in the same assay. Because they have different target-binding sequences, their relative affinities for different mutations differ. For example, a first probe can bind strongly to the wild-type sequence, moderately to the first allele, weakly to the second allele, and not at all to the third allele; whereas, a second probe can bind weakly to the wild-type sequence and the first mutation, and moderately to the second and third mutations. Additional sloppy probes may exhibit even more distinct binding patterns due to their different target-binding sequences. Thus, the fluorescence emission spectra from combinations of sloppy probes reveal different microbial strains or species, and genetic allelic variants or mutations.

[0026] Because sloppy probes reproducibly fluoresce at varying intensities after binding to different DNA sequences, combinations can be used in simple, rapid, and highly accurate nucleic acid amplification reaction assays (e.g., PCR-based assays) to identify, for example, multiple pathogens or mutations in a single reaction vessel. However, it will be understood that the assays can also be performed on samples suspected of containing directly detectable amounts of unamplified target nucleic acid. The identification assays are based on analyzing the spectra of a series of partially hybridizing sloppy signaling probes, such as sloppy molecular beacon probes, each labeled with a fluorophore that emits light at a different wavelength optimal for generating a "signature spectrum" of a species- or mutation-specific DNA sequence.

[0027] Multiplexing can be achieved using these probes, for example, by designing different allele-discriminating molecular beacon probes for each target and differentially labeling each probe. (See, e.g., U.S. Pat. Nos. 7,662,550 and 5,925,517, WO 01 / 31062, and Tyagi et al. (2000) Nature Biotechnology 18:1191-1196.) Mixtures of allele-discriminating probes, each containing multiple colored ants, expand the number of probe signatures. Therefore, all molecular beacon-target hybrids with unique melting temperatures will have corresponding unique signal intensities at distinct temperatures and probe and amplicon concentrations. Therefore, a limited number of sloppy probes can be used as probes to identify many different potential target sequences in real-time PCR reactions. The probes can be added to the amplification reaction mixture before, during, or after amplification. See U.S. Pat. No. 7,662,550.

[0028] The present invention further provides kits containing reagents for carrying out the above-described methods, including PCR and / or probe-target hybridization reactions. To this end, for the methods described herein, one or more reaction components, such as PCR primers, polymerase, and probes, can be provided in the form of a kit for use. In such kits, appropriate amounts of one or more reaction components are provided in one or more containers or carried on a substrate.

[0029] The kit also includes additional materials for carrying out the method. In some embodiments, the kit includes some or all of the reagents and materials for carrying out the method using the primers and / or probes of the present invention. Some or all of the components of the kit can be provided in a container separate from the container containing the primers and / or probes of the present invention. Examples of additional components of the kit include, but are not limited to, one or more different polymerases, one or more control reagents (e.g., probes or PCR primers or control templates), and buffers for the reaction (1X or concentrated form). The kit also includes one or more of the following components: a support, a termination, modification, or digestion reagent, an osmolyte, and equipment for detection.

[0030] The reaction components used can be provided in various forms. For example, the components (e.g., enzymes, probes, and / or primers) can be suspended in aqueous solution or as freeze-dried or lyophilized powders, pellets, or beads. In the latter case, the components, when reconstituted, form a complete mixture of components used in the assay. The kits of the present invention can be provided at any suitable temperature. For example, for storage of kits containing protein components (e.g., enzymes) in liquid form, it is preferred to provide and maintain them at 0°C or below, preferably -20°C or below, or in other frozen states.

[0031] The kits or systems of the present invention may include any combination of the components described herein in amounts sufficient for at least one assay. In some applications, one or more reaction components may be provided in pre-measured, single-use amounts in individual, typically disposable, tubes or equivalent containers. In such a setup, PCR reactions can be performed by adding the target nucleic acid or a sample / cell containing the target nucleic acid directly to the individual tubes. The amounts of components included in the kit can be any suitable amount and will depend on the target market for the product. The containers in which the components are provided can be any common container capable of holding the provided form, such as microcentrifuge tubes, ampoules, bottles, or integral test devices such as fluidic devices, cartridges, lateral flow, or other similar devices.

[0032] The kit can also include packaging materials for holding the container or combination of containers. Typical packaging materials for such kits and systems include solid matrices (e.g., glass, plastic, paper, foil, microparticles, etc.) that hold the reaction components or detection probes in any of a variety of configurations (e.g., vials, microtiter plate wells, microarrays, etc.). The kit can further include instructions recorded in a specific form for use of the components.

[0033] definition Nucleic acid refers to a DNA molecule (e.g., but not limited to, cDNA or genomic DNA), an RNA molecule (e.g., but not limited to, mRNA), or a DNA or RNA analog. DNA or RNA analogs can be synthesized from nucleotide analogs. A nucleic acid molecule can be single-stranded or double-stranded. An "isolated" nucleic acid is a nucleic acid whose structure is not identical to the structure of any naturally occurring nucleic acid or to the structure of any fragment of naturally occurring genomic nucleic acid. Thus, the term covers, for example, (a) DNA having the sequence of a portion of a naturally occurring genomic DNA molecule but not flanked by both coding sequences that flank that portion of the molecule in the genome of the naturally occurring organism; (b) a nucleic acid incorporated into a vector or prokaryotic or eukaryotic genomic DNA such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) another molecule, such as a cDNA, genomic fragment, PCR-generated fragment, or restriction fragment; and (d) a recombinant nucleic acid sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein.

[0034] As used herein, the term "target nucleic acid" or "target" refers to a nucleic acid containing a target nucleic acid sequence of interest. Target nucleic acids can be single-stranded or double-stranded, and are often double-stranded DNA. A "target nucleic acid sequence," "target sequence," or "target region" refers to a specific sequence that includes all or part of a single-stranded nucleic acid sequence. The target sequence may be within a nucleic acid template or within the genome of a cell, and may be in any form of single-stranded or double-stranded nucleic acid. The template may be a purified or isolated nucleic acid, or it may be non-purified or non-isolated.

[0035] "Complementary" sequences, as used herein, may include or be formed entirely of Watson-Crick base pairs (e.g., AT / U and CG), non-Watson-Crick base pairs, and / or base pairs formed from non-natural and modified nucleotides, so long as the above requirements regarding their ability to hybridize are met. A full complement or fully complementary shall mean 100% (perfect) complementary or substantially complementary base pairing between the nucleotides or nucleotide analogs of a nucleic acid molecule.

[0036] "Substantially complementary" means that the nucleic acid or oligonucleotide has a sequence comprising at least 10 contiguous bases that are at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, and 100%) identical to at least 10 contiguous bases of a target nucleic acid sequence, such that the nucleic acid or oligonucleotide can hybridize or anneal to the target nucleic acid sequence under, for example, annealing conditions of a PCR reaction or probe-target hybridization conditions. Complementarity between sequences can represent the number of base mismatches in each set of at least 10 contiguous bases compared. The term "substantially identical" means that a first nucleic acid is at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, and 100%) complementary to a second nucleic acid such that the first nucleic acid is substantially complementary to or hybridizes with the complement of the second nucleic acid under PCR annealing or probe-target hybridization conditions.

[0037] "Hybridization" or "hybridizing" or "hybridize" or "anneal" refers to the ability of fully or partially complementary nucleic acid strands to come together under specific hybridization conditions in a parallel or preferably non-parallel orientation to form a stable double-stranded structure or region (sometimes called a "hybrid" or "duplex" or "stem") in which the two constituent strands are linked by hydrogen bonds. Hydrogen bonds are typically formed between adenine and thymine or uracil (A and T or U) or cysteine ​​and guanine (C and D), although other base pairs may also be formed (e.g., Adams et al., The Biochemistry of the Nucleic Acids, 11th ed., 1992).

[0038] "Nucleic acid duplex," "duplex," "stem," "nucleic acid hybrid," or "hybrid" refers to a stable nucleic acid structure containing two strands, hydrogen-bonded regions, such as RNA:RNA, RNA:DNA, and DNA:DNA double-stranded molecules and their analogs. Such structures can be detected by known means, for example, using labeled probes, substrates coated with optically active probes sensitive to changes in mass on their surface (U.S. Pat. No. 6,060,237), or binding agents (U.S. Pat. No. 5,994,056).

[0039] As used herein, the term "amplification" and its variants include any process for generating multiple copies or complements of at least a portion of a polynucleotide, said polynucleotide typically referred to as a "template." A template polynucleotide may be single-stranded or double-stranded. A template may also be a purified or isolated nucleic acid, or an unpurified or unisolated nucleic acid. Amplification of a given template can result in the generation of a population of polynucleotide amplification products, the population referred to as an "amplicon." Amplicon polynucleotides can be single-stranded or double-stranded, or a mixture of both. Typically, the template will include a target sequence, and the resulting amplicon will include polynucleotides having sequences that are either substantially identical or substantially complementary to the target sequence. In some embodiments, the polynucleotides of a particular amplicon are substantially identical or substantially complementary to each other; or, in some embodiments, the polynucleotides within a given amplicon can have different nucleotide sequences from each other. Amplification can proceed linearly or exponentially and can involve repeated and sequential replication of a given template to form two or more amplification products. Some typical amplification reactions involve continuous and repeated cycles of template-based nucleic acid synthesis, resulting in the formation of multiple daughter polynucleotides that contain at least a portion of the template's nucleotide sequence and share at least some nucleic acid sequence identity (or complementarity) with the template. In some embodiments, each step of nucleic acid synthesis, sometimes referred to as a "cycle" of amplification, involves generating a free 3' end (e.g., by cleaving one strand of dsDNA), thereby generating a primer and a primer extension step; optionally, an additional denaturation step can be included, in which the template is partially or completely denatured. In some embodiments, one round of amplification involves a given number of repetitions of a single cycle of amplification.For example, a round of amplification can include 5, 10, 15, 20, 25, 30, 35, 40, 50, or more repetitions of a particular cycle. In one exemplary embodiment, amplification includes any reaction in which a particular polynucleotide template is subjected to two successive cycles of nucleic acid synthesis. Synthesis can include template-dependent nucleic acid synthesis.

[0040] The amplification of the present invention may also include isothermal amplification. The term "isothermal" means that the reaction is carried out at a substantially constant temperature, i.e., without changing the reaction temperature at which the nucleic acid polymerization reaction occurs. The isothermal temperature of an isothermal amplification reaction depends on the strand-displacing nucleic acid polymerase used in the reaction. Generally, the isothermal temperature is below the melting temperature (Tm; the temperature at which half of the double strands in the mixture are single-stranded and denatured) of the typical reaction product, i.e., generally 90°C or less, usually between about 20°C and 75°C, preferably between 30°C and 60°C, or more preferably about 37°C.

[0041] The term "primer" or "primer oligonucleotide" refers to a nucleic acid or oligonucleotide strand that can hybridize to a template nucleic acid for nucleic acid synthesis and serve as a starting point for incorporation of an extension nucleotide, depending on the composition of the template nucleic acid. "Extension nucleotide" refers to any nucleotide (e.g., dNTP) and its analogs that can be incorporated into an extension product during amplification, i.e., DNA, RNA, or derivatives of DNA or RNA, which may contain a label. As used herein, the term "oligonucleotide" refers to a short polynucleotide, typically 300 or less in length (e.g., in the range of 5 to 150, preferably 10 to 100, more preferably 15 to 50). However, as used herein, the term is also meant to encompass longer or shorter polynucleotide chains. An "oligonucleotide" can hybridize to another polynucleotide, thereby serving as a probe for polynucleotide detection or a primer for polynucleotide chain elongation.

[0042] As used herein, the term "probe" refers to an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bond, usually through complementary base pairing, usually through hydrogen bond formation. Depending on the stringency of the hybridization conditions, a probe can bind to a target sequence lacking perfect complementarity. Any number of base pair mismatches may exist that would prevent hybridization of the target sequence with the single-stranded nucleic acids described herein. However, if the number of mutations is so great that hybridization does not occur even under the least stringent hybridization conditions, the sequence is not a complementary target sequence. A probe may be single-stranded or may be partially single-stranded and partially double-stranded. The stranding of a probe is determined by the structure, composition, and properties of the target sequence. A probe may be directly or indirectly labeled with a label, such as biotin, to which a streptavidin complex subsequently binds.

[0043] The term "detection probe" refers to an oligonucleotide having a sequence sufficiently complementary to a target sequence to form a probe:target hybrid stable for detection under stringent hybridization conditions. Probes are typically synthetic oligomers that may contain bases complementary to sequences outside the targeted region that do not prevent hybridization with the target nucleic acid under stringent hybridization conditions. Sequences that are not complementary to the target may be homopolymer tracts (e.g., poly-A or poly-T), promoter sequences, restriction endonuclease recognition sequences, or sequences that impart desired secondary or tertiary structures (e.g., catalytic sites or hairpin structures), or tag regions that can facilitate detection and / or amplification. "Stable" or "stable for detection" means that the temperature of the reaction mixture is at least 2°C below the melting temperature (Tm) of the nucleic acid duplex contained in the mixture, preferably at least 5°C below Tm, and even more preferably at least 10°C below Tm.

[0044] A "label" or "reporter molecule" is a chemical or biochemical moiety useful for labeling nucleic acids (including single nucleotides), polynucleotides, oligonucleotides, or protein ligands, such as amino acids or antibodies. Examples include fluorescers, chemiluminescers, quenchers, radionucleotides, enzymes, substrates, cofactors, inhibitors, magnetic particles, and other moieties known in the art. A label or reporter molecule is capable of producing a measurable signal and can be covalently or noncovalently attached to the oligonucleotide or nucleotide (e.g., non-natural nucleotide) or ligand.

[0045] As used herein, the term "contacting" and variants thereof, when used with respect to any set of components, includes any process whereby the contacted components are mixed in the same mixture (e.g., added to the same compartment or solution) and does not necessarily require actual physical contact between the listed components. The listed components can be contacted in any order and in any combination (or subcombination) and can include situations in which one or more listed components are subsequently removed from the mixture (possibly before the addition of other listed components). For example, "contacting A with B and C" includes any or all of the following situations: (i) A is mixed with C, and then B is added to the mixture; (ii) A and B are mixed into the mixture; B is removed from the mixture, and then C is added to the mixture; and (iii) A is added to a mixture of B and C. "Contacting" a target nucleic acid or cell with one or more reaction components, such as a polymerase, primer set, or probe, includes any or all of the following situations: (i) contacting the target or cell with a first component of a reaction mixture to form a mixture; subsequently, adding other components of the reaction mixture to the mixture in any order or combination; (ii) completely forming the reaction mixture prior to mixing with the target or cell.

[0046] As used herein, the term "mixture" refers to a combination of elements that are dispersed and in no particular order. A mixture is heterogeneous and cannot be spatially separated into its different substances. Examples of mixture elements include many different elements dissolved in the same aqueous solution, or many different elements that are not spatially distinguishable and are attached randomly or in no particular order to a solid support. In other words, a mixture is not addressable.

[0047] As used herein, the term "subject" refers to any living organism having a genome, preferably a living animal, e.g., a mammal, that is the object of diagnosis, treatment, observation, or experiment. Examples of subjects can be humans, livestock animals (beef and dairy cattle, sheep, poultry, pigs, etc.), or companion animals (dogs, cats, horses, etc.).

[0048] As used herein, the term "sample" refers to any biological fluid or tissue obtained from a living organism (e.g., a patient) or from a component of a living organism (e.g., blood). A sample can be any biological tissue, cell, or liquid. A sample can be a "clinical sample," which is a sample derived from a subject, such as a human patient or veterinary subject. Useful biological samples include, but are not limited to, whole blood, saliva, urine, synovial fluid, bone marrow, cerebrospinal fluid, vaginal mucus, cervical mucus, nasal secretions, saliva, semen, amniotic fluid, bronchoalveolar lavage fluid, and other cellular exudates from patients or subjects. Such samples may be further diluted with saline, buffer, or a physiologically acceptable diluent. Alternatively, such samples may be concentrated by conventional methods. A biological sample can also include sections of tissue, such as frozen sections taken for histological purposes. A biological sample can also be referred to as a "patient sample." A biological sample can also include substantially purified or isolated proteins, membrane preparations, or cell cultures.

[0049] The terms "determining," "measuring," "assessing," and "assaying" are used interchangeably and include both quantitative and qualitative measurements, including determining whether a property, trait, or characteristic is present. Assaying can be relative or absolute. Assessing the presence of a target includes determining the amount of target present, as well as determining whether it is present.

[0050] As used herein, the term "reference" value refers to a value that, when compared with an assay result, statistically correlates with a particular outcome. In a preferred embodiment, the reference value can be determined from a statistical analysis that analyzes the average of wild-type values. The reference value can also be a threshold score value or a cut-off score value. Generally, the reference value can be above (or below) a threshold at which one outcome is more likely, and below a threshold at which an alternative outcome is more likely.

[0051] As disclosed herein, a difference in values ​​indicates the presence or absence of a pathogen (e.g., Mycobacterium tuberculosis) or mutation. The phrase "difference" in level or value refers to the difference in a variable (e.g., Tm) of the analyte (e.g., probe-target hybrid) in a sample compared to a control or reference level or value. In one embodiment, a difference in value or level can be a statistically significant difference between the amount of analyte present in a sample compared to a control. For example, a difference can be statistically significant if the measured level of the analyte is outside of about 1.0, 2.0, 3.0, 4.0, or 5.0 standard deviations of the mean value of any control or reference group.

[0052] As disclosed herein, numerous ranges of values ​​are provided. Unless expressly stated otherwise, between the upper and lower limits of a range, it is understood that each intervening value, to the tenth of the unit of the lower limit, is also specifically disclosed. Each smaller range between any stated or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded; each range where either, neither, or both limits are included in the smaller range is also encompassed within the invention, subject to any specific excluded ranges in the stated range. When a stated range includes one or both limits, ranges excluding either or both of those included limits are also encompassed within the invention. The term "about" generally means plus or minus 10% of the stated numerical value. For example, "about 10%" would indicate a range of 9% to 11%, and "about 20%" would mean 18 to 22. Other meanings of "about" are apparent from the context, such as rounding, so for example, "about 1" would also mean 0.5 to 1.4.

[0053] Purpose Two separate SMB assays that rapidly and reliably identify M.tb mutants significantly associated with rifampin and fluoroquinolone (FQ) resistance have recently been described (Chakravorty, S., B. et al., 2011, J Clin Microbiol 49:932-940; Chakravorty, S., H. et al., 2012, J Clin Microbiol 50:2194-2202). The assays disclosed herein have the advantage of being in real-time PCR format, making them easy to use and immune to amplicon cross-contamination. Furthermore, the detection of mutations has been shown to be robust and suitable for high-throughput testing. The following examples demonstrate SMB TB drug resistance detection assay systems and add assays that enable the detection of resistance to AMK and KAN. The source of discrepancies between the assays disclosed herein and phenotypic susceptibility testing methods was also investigated. The results indicate that some of the most commonly used phenotypic methods may miss M.tb isolates with resistance-conferring mutations if the mutations only modestly increase the minimum inhibitory concentration (MIC) to KAN. A novel mutation in whiB7 associated with low-level KAN resistance was also discovered.

[0054] As disclosed herein, the multiplexed SMB PCR and melt assay accurately identified mutations in the rrs gene and eis promoter associated with resistance to AMK and / or KAN. The assay did not generate false resistance calls when tested against NTM, Gram-positive, and Gram-negative bacteria. Most cases of hetero-resistance, if present, were also detected by the assay. Unlike the MTBDRsl platform, the assay can be performed in a closed real-time PCR system and is easily adaptable for high-throughput testing, as all assay steps are performed in 384-well plates. The SMB assay also avoids potential problems associated with alternative methods of mutation detection. High-resolution melt curve analysis requires the ability to detect subtle changes in the melt curve (Yadav, R., S., et al., 2012, J Appl Microbiol 113:856-862). Other post-PCR melt-based molecular assays must detect mutations by deciphering complex fluorescent profiles (Rice, JE, et al., 2012. Nucleic Acids Res 40:e164). In contrast, the SMB assay produces clear, easily identifiable Tm peaks and distinct Tm shifts, identifying mutations of interest. Individual Tm values ​​can also be used to cluster samples with the same genotype.

[0055] As disclosed herein, the assay was tested on a panel of 603 clinical samples representing both new and unresolved retreatment cases of TB to evaluate the relationship of target mutations with the susceptibility patterns of clinical isolates. It was observed that 100% of isolates harboring the rrs A1401G mutation had a strong correlation with high-level resistance to both AMK and KAN. However, eis promoter mutations only resulted in moderate-to-low-level KAN resistance and no resistance to AMK, consistent with previous studies (Campbell, PJ, et al., 2011, Antimicrob Agents Chemother 55:2032-2041; Zaunbrecher, MA, et al., 2009, Proc Natl Acad Sci USA 106:20004-20009). This study also demonstrated that the LJ absolute concentration method for susceptibility testing does not adequately detect moderate-to-low-level KAN resistance. In fact, nearly two-thirds of samples with eis promoter mutations were detected as KAN-susceptible in LJ medium. However, all but one sample with an eis promoter mutation was detected as KAN-resistant by the MGIT method. Two such isolates contained the eis C(-12)T mutation. These mutants were also resistant to KAN when tested by MYCOTB, exhibiting a KAN MIC of 5 μg / ml. Previous studies have suggested that clinical isolates with the C(-12)T mutation are not correlated with KAN resistance (Zaunbrecher (2009)) or only weakly correlated (Campbell, 2011; Hoshide, M., L. et al., 2014, J Clin Microbiol 52:1322-1329). These studies likely overlooked the association between this mutation and low-level KAN resistance due to the testing methods used to establish phenotypic susceptibility. These results suggest that the MGIT or MYCOTB method should be preferred for testing phenotypic resistance to KAN.They also highlight the power of genotypic resistance testing to detect mutations that cause low-level resistance and would be missed by phenotypic testing alone, as disclosed herein (Rigouts, L., M. et al., 2013, J Clin Microbiol 51:2641-2645; Sirgel, FA, et al., 2012, Microb Drug Resist 18:193-197; and Van Deun, A., et al., 2013, J Clin Microbiol 51:2633-2640).

[0056] This set of studies included one sample that was a mixture of rrs wild-type and rrs C1402T mutant strains. This sample was susceptible to both AMK and KAN in LJ medium. Isolates carrying the C1402T mutation have been reported to be susceptible to AMK but resistant to KAN (Maus, C.E., et al., 2005, Antimicrob Agents Chemother 49:3192-3197). In this particular case, repeated susceptibility testing using LJ medium indicated susceptibility to KAN, likely due to hetero-resistance of the sample. Here, the SMB assay clearly detected the presence of both wild-type and mutant DNA forms and thus served as a better predictor of potential resistance than phenotypic assays.

[0057] The incidence of rrs1484 mutations in clinical strains resistant to AMK or KAN is very low (Georghiou, SB, et al., 2012, PLoS One 7:e33275), and its clinical significance is controversial. Another version of the assay targeting the rrs1484 codon failed to detect any mutations in any of the 603 isolates and in an additional 259 isolates from the New Jersey-New York area, which included 33 AMK- and KAN-resistant isolates. In this expanded set of studies, the absence of any rrs1484 mutations was confirmed by Sanger sequencing (data not shown). Given the extremely low prevalence of rrs1484 mutations, this codon is unlikely to provide significant value in predicting aminoglycoside resistance. Therefore, it is recommended that molecular assays for aminoglycoside resistance target only codons 1401–1402 of the rrs gene.

[0058] Twenty-two AMK- or KAN-resistant samples were found to have wild-type sequences in the rrs gene and eis promoter region. A recent study identified a 5'UTR whiB7 mutation in a single clinical strain with unexplained KAN resistance, suggesting a possible association between mutations in the 5'UTR of the whiB7 mutation and KAN resistance (Reeves, A.Z., et al., 2013, Antimicrob Agents Chemother 57:1857-1865). Several novel 5'UTR whiB7 mutations and deletions that appear to be associated with KAN resistance have also been identified. No suitable, universal biomarkers have been identified that could explain KAN and AMK resistance in the remaining 15-20% of clinical strains with wild-type rrs and eis promoter regions. Samples containing wild-type rrs gene and eis promoter DNA mixed with trace amounts of mutant targets from KAN- or AMK-resistant subpopulations could also explain the remaining discrepancies between phenotypic resistance tests and the SMB assay disclosed herein. However, extensive investigation of heteroresistance is beyond the scope of this study. Several recent studies suggest that the PPE60 and Rv3168 genes may be involved in unexplained KAN resistance, although this remains to be confirmed in clinical settings (Farhat, MR, et al., 2013. Nat Genet 45:1183-1189; Zhang, H., et al., 2013, Nat Genet 45:1255-1260).

[0059] In summary, a highly sensitive and specific assay was developed for the detection of AMK and KAN resistance in M.tb and demonstrated its efficacy in clinical isolates with a high prevalence of MDR and XDR TB. The results indicate that the rrs A1401G mutation encodes high-level cross-resistance to both AMK and KAN, while the eis promoter mutation encodes moderate-to-low-level KAN resistance, consistent with previous functional genomic studies (Zaunbrecher 2009). Comparing the performance of the assay disclosed herein with three different phenotypic susceptibility testing methods in solid and liquid media revealed that low-to-moderate KAN resistance caused by the eis promoter mutation was largely overlooked by LJ-based susceptibility testing. These results strongly demonstrate the value of genotypic testing for detecting aminoglycoside resistance, and the results reveal the specific utility of the SMB-based assay disclosed herein. [Example]

[0060] Example 1 This example describes the materials and methods used in Examples 2-7 below.

[0061] DNA sample M.tb test samples consisted of DNA isolated from a series of 603 isolates cultured from 503 patients enrolled in a natural history study of MDR tuberculosis (NCT00341601 clinicaltrials.gov) at National Masan Hospital in Gangwon, Republic of Korea. Two cohorts were tested: Cohort A consisted of untreated newly suspected TB cases (158 samples), and Cohort B consisted of re-treated TB cases (445 samples). Fresh saliva samples were collected from each patient at the start of treatment and cultured for M.tb. In a subset of patients, repeated saliva samples were collected at months 1, 4, and 6 of treatment and also cultured for M.tb. Non-tuberculosis mycobacteria (NTM) and Gram-positive and Gram-negative bacterial test samples were collected from the New Jersey Medical School (NJMS) DNA repository as previously described (Chakravorty, S., 2012. J Clin Microbiol 50:2194-2202).

[0062] Phenotypic drug susceptibility testing Phenotypic drug susceptibility testing was performed on all 603 isolates at the International Tuberculosis Research Center (ITRC) in Korea using the absolute concentration method on LJ medium to determine susceptibility to AMK and KAN using a critical concentration of 40 μg / ml (the standard concentration used when testing isolates during 2012) for both antibiotics (Jnawali, HN, 2013, Diagn Microbiol Infect Dis 76:187-196). MICs for AMK and KAN for 173 / 603 samples were also assessed using TREK Sensititre® MYCOTB MIC plates ("MYCOTB"; TREK Diagnostic Systems, Cleveland, Ohio, USA) as previously described (Lee, J., 2014, Antimicrob Agents Chemother 58:11-18). For 560 / 603 samples, resistance to KAN was also assessed using the Mycobacterial Growth Indicator Tube (MGIT) system (Becton Dickinson, Franklin Lakes, NJ, USA) at a critical concentration of 2.5 μg / ml. For samples with phenotypic susceptibility test results that were inconsistent with the Sanger sequencing results of the target gene, the phenotypic susceptibility test was repeated to confirm the initial findings. When the MGIT and LJ susceptibility test results showed discrepancies, both assays were repeated to confirm or correct the initial findings.

[0063] DNA preparation and sequencing DNA for SMB assay testing and Sanger sequencing was prepared from the cultured isolates by boiling a loopful of culture in 200 μl of Instagene Matrix resin (Bio-Rad Laboratories, Hercules, California, USA) in the presence of 0.1% Triton X100 for 10–15 min. The supernatant was collected after centrifugation and quantified using a Nanodrop microvolume spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). For Sanger sequencing, two different fragments of the rrs gene (nucleotides 420–980 and 1293–1537), as well as the upstream eis coding region and the entire eis promoter, were amplified using 0.5 μM forward and reverse primers, 1X PCR buffer, 250 mM dNTPs, 2.5 mM MgCl2, and 0.03 U / μl AmpliTaq Gold DNA polymerase enzyme (Applied Biosystems, Foster City, California, USA) according to the following parameters: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 s, 58–60°C for 30 s, and 70°C for 10–30 s, depending on amplicon size. The eis promoter region and rrs gene fragments were amplified as previously described (10, 33). For a subset of samples, a 538-bp fragment from the whiB7 gene, including 412 bp of the 5' untranslated region and 126 bp from the ORF, was amplified and sequenced using primers whiB7F 5'aaacgcgcaggtcagaaaat 3' and whiB7R 5'cagtgtcttggctacctcga 3' (SEQ ID NOs:70 and 71). Additionally, a 275-bp fragment from the whiB7 gene, including nearly the entire whiB7 ORF, was also amplified using primers whiB7-ingene-F 5'GTCGGTACTGACAGTCCCC 3' and whiB7-ingene-R 5'ATGCAACAGCATCCTTGCG 3' (SEQ ID NOs:72 and 73).PCR products were subjected to bidirectional sequencing using gene-specific forward and reverse primers on a 3130XL Genetic Analyzer (Applied Bio-systems, Foster City, California, USA) using the BigDye Terminator, version 3.1, cycle sequencing kit (Applied Biosystems) according to the manufacturer's instructions.

[0064] Assay molecular beacons and primers The SMB assay targeted M.tb mutations at codons 1401 and 1402 of the rrs gene and mutations along the promoter region of the eis gene. A 113-bp fragment (nucleotides 1335 to 1451) was amplified from the rrs gene using primers AMG-F (5'-GCTAGTAATCGCAGATCAGCAACGCTGC-3', SEQ ID NO: 51) and AMG-R (5'-CCTCCCGAGGGTTAGGCCACT-3', SEQ ID NO: 52). A 98-bp fragment encompassing the promoter region and the first five codons of the eis gene (nucleotides -81 to -17) was amplified using primers eis-F (5'-CACAGGGTCACAGTCACAGAATC-3', SEQ ID NO: 18) and eis-R (5'-GCATCGCGTGATCCTTTGCCAGAC-3', SEQ ID NO: 53). The rrs primers were designed specifically for the Mycobacterium genus, and the eis primers were designed specifically for the M.tb complex. One SMB probe, rrs-1400 (5'-6 carboxyfluorescein- cacg accgcccgtcacgtcatgaaagtcggt cgtg -BHQ1-3', SEQ ID NO: 59) and two SMB probes eis-1 (5'-Cyanine5- caggcg gtcgtaatattcacgtgcacctggccgc cgcctg -BHQ2-3', SEQ ID NO: 16) and eis-2 (5'-TexasRed- ctcgcggcatatgccacagtcggattctctgac gcgag The SMBs (SEQ ID NO: 61) and the '-BHQ2-3' (SEQ ID NO: 61) (the sequences underlined represent the stem portion of the SMB and BHQ represents the black hole quencher) were targeted to the rrs gene and eis promoter region, respectively. The rrs probe was designed to be complementary to the antisense strand, and the eis probe was designed to be complementary to the sense strand. The SMBs were designed using the in silico DNA folding program http: / / mfold.rna.albany.edu / ?q_mfold / dna-folding-form, and the probe-target hybrid folding program http: / / mfold.rna.albany.edu / ?q_DINAMelt / Two-state-melting was used to predict possible probe-target hybrid structures and melting temperatures (Tm). Probes were designed to generate the maximum Tm difference between the wild-type and mutant sequences in each target region to enable unambiguous mutation identification. Primers were obtained from Sigma Aldrich (St. Louis, Missouri, USA), and the SMB probe was obtained from Biosearch Technologies (Novato, California, USA).

[0065] Assay procedure All samples were independently coded and randomly distributed to ensure assay validation was performed in a blinded manner. The assay was tested at both the ITRC in Masan, Korea, and at New Jersey Medical School (NJMS), Rutgers, Newark, New Jersey. Upon completion of testing for all 603 samples, the samples were decoded, and PCR results were compared with corresponding sequencing and phenotypic drug susceptibility test results. Results obtained at each site were also compared. Assay results were not reported to treating physicians or used to guide any treatment decisions. PCR was performed in 384-well plates using a Roche Light Cycler 480 II real-time PCR system (Roche Diagnostics Co., Indianapolis, Indiana, USA). The 20-μl reaction volume contained 100 nM forward primer and 1 μM reverse primer for the rrs gene and 1 μM forward primer and 50 nM reverse primer for the eis promoter region, 1 ng / μl of rrs-1400 and eis-1 probes and 0.8 ng / μl of eis-2 probe, 4 mM MgCl, 250 mM deoxynucleoside triphosphates (dNTPs), 1× PCR buffer, 8% glycerol, 0.06 U / μl of Platinum® TfiExo(-) DNA polymerase (Life Technologies, Grand Island, New York, USA), and 2 to 5 ng of sample DNA or an equal volume of water. PCR was performed with the following steps: enzyme activation at 95°C for 2 minutes, followed by 50 cycles of denaturation at 95°C for 10 seconds and combined annealing and extension at 67°C for 30 seconds. After the PCR cycles, post-PCR Tm analysis was performed by denaturing at 95°C for 2 minutes, cooling to 45°C, and gradually heating to 85°C, with continuous monitoring of fluorescence during the process at a rate of one data point per degree. Tm values ​​were determined at the end of the reaction using Tm calling software (Light Cycler 480 software).However, each Tm was also verified by a trained observer before final identification of the Tm value was made. Samples showing a clear double peak for any probe corresponding to the wild-type and mutant Tms were considered to indicate heterologous resistance. A no-template control using sterile water instead of DNA as the template was used as a DNA-negative control, and a DNA-positive control using 1 ng of genomic DNA from M.tb H37Rv as the template was also included on each assay plate.

[0066] Human Subject Approval This study was approved by the National Masan Hospital, NIAID, and Rutgers (formerly UMDNJ) institutional review boards, and all subjects provided informed consent (Rutgers IRB protocol number 0120090104).

[0067] Example 2. Identification of Tm values ​​associated with wild-type and mutant sequences The SMB-based assay disclosed herein detected resistance to AMK and KAN by searching for mutations in the M.tb rrs gene and eis promoter, which are known to be associated with resistance. The assay consists of a PCR step followed by Tm analysis in the presence of SMB probes complementary to portions of the rrs and eis target amplicons. We first evaluated the assay's ability to identify target mutations with artificial oligonucleotides by sequencing DNA templates from selected wild-type and mutant M.tb strains (data not shown). Wild-type sequences were identified by the presence of Tm values ​​within 1°C of the known mean value of the wild-type target. Mutant sequences were identified by a Tm shift of at least 5 standard deviations from the mean wild-type Tm value. The assay's ability to detect the most common mutations associated with AMK and KAN resistance was subsequently evaluated in clinical DNA samples. Testing was performed on a panel of 603 clinical samples, consisting of 487 samples with wild-type sequences and 116 samples with mutations in the assay target. Five of these samples contained a mixture of wild-type and mutant DNA as detected by Sanger sequencing. The SMB assay accurately identified 115 / 116 (99%) mutant or mixed (heterogeneous samples containing both mutant and wild-type DNA) samples as mutant or mixed and 487 / 487 (100%) pure wild-type samples as wild-type. Only one mixed sample (as shown by Sanger sequencing) was identified as a wild-type sample by the assay disclosed herein. The Tm values ​​generated by each SMB probe across wild-type and mutant targets were highly reproducible. For the wild-type target, the rrs-1400, eis-1, and eis-2 probes showed mean Tm values ​​of 70.1°C ± 0.15, 63.9°C ± 0.19, and 69°C ± 0.23, respectively (Table 3). For the Tm targets of the A1401G and C1402T mutants, the mutations resulted in a decrease in the Tm values ​​of 3.9°C (±0.17) and 5.6°C (±0.21) in probe rrs-1400, respectively (Table 3).Similarly, the eis-1 and eis-2 probes reliably detected a range of mutations in the eis promoter region as mutations by generating decreases in Tm values ​​of 4.3°C to 6.5°C compared to the expected wild-type Tm value (Table 3). PCR assays performed in two different laboratories at Rutgers and the ITRC were in perfect agreement for all samples detected as wild-type and mutant, as well as mixtures.

[0068] The assay results allowed us to clearly separate 603 samples into wild-type and mutant Tm clusters based on their individual three-point Tm patterns (Figure 1). The assay correctly identified the mutation in all 75 samples containing only the A1401G mutation (Table 3, Figure 2, panel A). Three of the four samples containing a mixture of A1401G and wild-type sequences were also detected as mixed wild-type / mutant based on the presence of a double Tm peak. The only sample containing a mixture of C1402T mutation and wild-type DNA was also identified by the presence of a double Tm peak from a sample with a mutant Tm specific to the C1402T mutation (Table 3, Figure 2, panel A). The 32 samples containing mutations in the eis promoter region contained five different polymorphisms (at positions -8, -10, -12, -14, and -37). All of these mutations were successfully detected by one of the eis SMBs (Table 3, Figure 2, panels B and C). Four samples with mutations in both the rrs gene and the eis promoter region were also correctly detected as double mutants (Table 3). Sequencing of the rrs gene did not identify any of the samples with codon 1484 mutations, despite their drug sensitivity patterns.

[0069] Identification of amikacin resistance In this example, the performance of molecular assays was evaluated by comparing them with phenotypic drug susceptibility test results. The apparent performance of genotypic drug susceptibility tests can vary depending on the mutations selected for inclusion in the test and the phenotypic assay used as the gold standard (Kim, SJ 2005 Eur Respir J 25:564-569; Rigouts, L., et al., 2013 J Clin Microbiol 51:2641-2645; and Van Deun, A., et al., 2013 J Clin Microbiol 51:2633-2640). Considering the LJ-based drug susceptibility testing method as the gold standard (performed on all 603 test samples), the rrs SMB Tm signature of the A1401G mutation classified 82 / 90 AMK-resistant samples as resistant (91.1% sensitivity; 95% CI, 82.8% to 96.8%). The wild-type Tm classified 512 / 513 of the AMK-susceptible samples as susceptible. Only one of the 513 AMK-susceptible isolates was identified as a mixture of wild-type and C1402T mutant DNA by the SMB assay disclosed herein due to the presence of a distinct doublet peak generated by the rrs SMB probe, corresponding to the wild-type Tm and the specific C1402T mutant Tm (Figure 2, panel A). This was also confirmed by Sanger sequencing. Because previous studies have shown that the C1402T mutation does not encode AMK resistance (24), the specific Tm corresponding to the C1402T mutation can be considered an indicator of AMK susceptibility. This consideration led to the assay disclosed herein correctly detecting all 513 / 513 AMK-susceptible samples, resulting in 100% specificity (95% CI, 99-100%). Including Tm values ​​characteristic of mutations in the eis promoter region in the analysis did not increase the sensitivity of detecting AMK resistance, but the specificity decreased from 100% to 93.8% (95% CI, 91.2 to 95.6%).These results are consistent with previous reports suggesting that eis promoter mutations are not associated with AMK resistance as revealed by LJ drug susceptibility testing (Campbell 2011 and Zaunbrecher 2009).

[0070] Example 4. Identification of Kanamycin Resistance The assay's performance in detecting KAN resistance was also evaluated using LJ-based drug susceptibility testing as the gold standard for all 603 samples. Using Tm values ​​generated by the rrs SMB disclosed herein, typical of either the A1401G or C1402T mutation, to define resistance, the assay detected 82 / 106 samples as KAN-resistant (sensitivity 77.4%; 95% CI 68.0-84.7%). Conversely, using the rrs SMB Tm characteristic of the wild-type target to define susceptibility, 496 / 497 KAN-susceptible samples were identified as susceptible (Table 4) (specificity 99.8%; 95% CI, 98.7-100%). When two eis SMB Tm values ​​characteristic of mutations in the eis promoter region were added to the definition of resistance, 11 additional KAN-resistant samples were classified as resistant, increasing the sensitivity for detecting KAN resistance from 77.4% to 87.7% (95% CI, 79.5-93%). However, because 21 KAN-susceptible samples with eis promoter mutations were "falsely" detected as currently KAN-resistant, specificity decreased from 99.8% to 95.6% (95% CI, 93.3 to 97.1%) (Table 4).

[0071] Next, we performed a similar analysis using MGIT-based drug susceptibility test results as the gold standard for the 506 samples for which MGIT results were available. This subset included all samples with only eis promoter mutations. Comparison of assay results with the MGIT-based gold standard helped reveal eis mutants with discordant KAN resistance in LJ medium. Using only MGIT and the rrs SMB Tm values ​​characteristic of the A1401G or C1402T mutation as the gold standard to reveal KAN resistance, only 63 / 113 KAN-resistant samples were identified as resistant by the SMB assay (susceptibility 55.8%; 95% CI, 46.1 to 65%). Conversely, using the rrs SMB Tm values ​​characteristic of the wild-type target to reveal susceptibility identified 445 / 447 samples as KAN-susceptible (susceptibility 99.8%; 95% CI, 98.5 to 100%; Table 4). Unlike the case of the LJ-based susceptibility test, including the Tm value characteristic of the eis promoter mutation in this case increased the sensitivity of the resistance test from 55.8% to 82.3%, with the specificity of the assay for KAN resistance remaining very high at 99.5% (95% CI, 98.2 to 100%). Thus, based on the MGIT-based susceptibility test, the eis assay allowed the detection of 29 additional KAN-resistant samples without affecting specificity (Table 4).

[0072] Example 5. Relationship between mutations detected by this assay and Mic The discrepancy between the resistance revealed by the assay disclosed herein and the resistance revealed by the two phenotypic susceptibility testing methods disclosed herein was primarily related to isolates with eis promoter mutations. Previous studies have shown that eis promoter mutations cause relatively low-level KAN resistance, while rss gene mutations result in high-level resistance to AMK, KAN, and CAP (Campbell 2011; Du, Q., et al., 2013, Diagn Microbiol Infect Dis 77:138-142; Georghiou 2012; and Zaunbrecher 2009). An additional finding was the discrepancy between susceptibility test results based on LJ versus MGIT. MIC testing was performed to more carefully explore the relationship between rrs and eis promoter mutations and their susceptibility patterns in the LJ and MGIT systems. Samples that were either susceptible to both AMK and KAN (and wild-type in both target regions) or selected to represent the most common mutation types in the two target genes (rrs A1401G and eis G(-10)A, C(-14)T, and G(-37)T) were tested by the MYCOTB method to determine their MICs. Additional isolates known to be wild-type in both assay targets were also tested as controls. AMK MICs for isolates with only eis promoter mutations (no rrs mutations) were observed to range between 0.25 μg / ml and 2 μg / ml, with the majority of samples showing MICs between 0.5 μg / ml and 1 μg / ml (Figure 3). Only one eis promoter mutant had an AMK MIC of 4 μg / ml. Control isolates without eis promoter or rrs mutations had MICs between 0.25 μg / ml and 0.5 μg / ml. Thus, the AMK MICs of isolates carrying either wild-type or mutant eis promoter sequences overlapped substantially.In contrast, most KAN MICs for the same eis promoter mutants ranged from 5 μg / ml to 20 μg / ml, with one isolate exhibiting an MIC of 40 μg / ml (Figure 3). Only two eis promoter mutants had a low MIC of 2.5 μg / ml. Isolates with wild-type eis promoter sequences exhibited MICs between 0.6 μg / ml and 2.5 μg / ml, which were 2- to 30-fold lower than the average MICs of the eis promoter mutants (Figure 3). Thus, in contrast to the situation with AMK, the KAN MICs of wild-type isolates barely overlapped with those of the eis promoter mutants. These results strongly suggest that eis promoter mutants should be considered to have low- to medium-level KAN resistance, even if resistance is not detected by LJ- or MGIT-based susceptibility testing.

[0073] Example 6. Assay specificity for bacteria other than M.tb The analytical specificity of this assay was tested against 121 clinical strains of nontuberculous mycobacteria (NTM), representing 18 species and 26 species, as well as a panel of 18 species of Gram-positive and Gram-negative bacteria obtained from the ATCC repository (Manassas, Virginia, USA). The rrs region targeted by this assay is highly conserved among different NTM species. Therefore, the rrs assay generated a Tm of 70°C for all NTM tested, as expected based on sequence homology, except for M. xenopi, which did not generate any Tm (identical to the Tm generated in the presence of wild-type M.tb DNA). NTM species that generate Tm values ​​identical to aminoglycoside-susceptible M.tb are not expected to cause false resistance test results. When M.tb DNA from the rrs mutant AMK and KAN-resistant strains was mixed with a 10- to 20-fold excess of NTM DNA, a clear double Tm peak was generated by the assay, corresponding to the mutant Tm value from the M.tb target and the wild-type Tm value from the NTM sequence (data not shown), indicating that resistance-associated rrs mutations can be detected in M.tb by this assay even in the presence of a large background of NTM DNA. 7 No apparent melting curves were generated by the eis probe in the presence of any NTM species tested, even when a genome-equivalent amount of DNA was added to the PCR assay. Neither Gram-positive nor Gram-negative bacteria generated Tm values ​​for either the rrs or eis SMB; therefore, they did not cause any false resistance calls to be generated by the assay.

[0074] Example 7. Additional Genetic Causes of AMK and KAN Resistance The study in this example included 22 samples resistant to AMK and / or KAN but possessing wild-type rrs genes and eis promoter sequences. Recent studies have suggested that mutations in the 5' untranslated region (UTR) of the whiB7 gene cause aminoglycoside resistance in M.tb. To determine whether whiB7 mutations could be responsible for some of the phenotypically resistant but assay-sensitive isolates, all 22 samples were sequenced in a 412-bp region upstream of the whiB7 gene start site, as well as a portion of the whiB7 open reading frame. As a control set, 30 randomly selected total-susceptible isolates were also sequenced. Of the 22 discordant isolates, 6 isolates from 3 patients showed mutations in the whiB7 5'UTR region. Considering the transcription start site as +1, one sample had a cytosine deletion at position +138 of the 5'UTR, two samples from one patient contained an A-to-G mutation at position +237, and the remaining three samples from only one patient showed an A-to-G mutation at position +237 (Table 5) (Reeves, AZ, 2013, 57:1857-1865). Three samples from only one patient failed to generate any amplification from the 5'UTR after repeated PCR attempts, despite functional positive PCR controls. This suggested the presence of a large deletion in the 5'UTR region, as a 275-bp fragment could be easily amplified from within the whiB7 ORF for all three samples. All samples with whiB7 mutations were resistant only to KAN, consistent with the presumed mechanism of whiB7 action via upregulation of the eis gene (Reeves 2013). The KAN MICs for these isolates were also low at 5 μg / ml, the same as those observed for the eis promoter mutant strains. None of the 30 control samples susceptible to aminoglycosides had any mutations in the 5'UTR of the whiB7 gene. Further studies are needed to confirm the relationship between these mutations and deletions in the 5'UTR of the whiB7 gene that confer aminoglycoside resistance.However, the absence of such mutations in sensitive strains implies that they may have some role in aminoglycoside resistance, and further assays could target these mutations to improve sensitivity for detecting low-level KAN resistance.

[0075] [Table 3]

[0076] SD represents the + / - standard deviation of the Tm values ​​of each probe from different clinical samples, and dTm represents the Tm difference between the wild-type and mutant sequences of each probe.

[0077] SD: standard deviation, dTm: delta Tm Probe numbers 1, 2 and 3 correspond to the rrs-1400, eis-1 and eis-2 probes, respectively.

[0078] [Table 4]

[0079] LJ and MGIT mean susceptibility testing by the LJ ratio and MGIT methods, respectively.

[0080] [Table 5]

[0081] LJ and MGIT mean susceptibility testing by the LJ ratio and MGIT methods, respectively.

[0082] ND: undetermined, NM: no mutation, R: resistant, S: susceptible.

[0083] The foregoing examples of preferred embodiments should be considered illustrative rather than limiting of the invention as defined by the claims. As will be readily appreciated, many variations and combinations of the features described above can be utilized without departing from the invention as set forth in the claims. Such variations are not to be considered a departure from the scope of the invention, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference in their entirety.

Claims

1. 1. A set of oligonucleotides for amplifying a portion of a region of M. tuberculosis selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, the katG gene, the dosR gene, the IS6110 gene, and the IS1081 gene, an oligonucleotide set comprising a pair of forward and reverse primers specific to said portion, each primer having a sequence substantially identical to an oligonucleotide sequence selected from those set forth in Table 1A and Table 1B.

2. 2. The oligonucleotide set of claim 1, wherein the sequences are identical to the oligonucleotide sequences selected from those set forth in Table 1A and Table 1B.

3. An isolated nucleic acid comprising a sequence substantially identical to a sequence selected from those set forth in Table 2.

4. 4. The nucleic acid of claim 3, comprising one sequence selected from those listed in Table 2.

5. The nucleic acid of claim 3 or 4, wherein the nucleic acid is labeled.

6. The nucleic acid of claim 5, wherein the nucleic acid is labeled with a fluorophore and a quencher at each of the two ends.

7. 7. The nucleic acid of claim 6, wherein the fluorophore is fluorescein, cyanine 5, or Texas Red® or TAMRA.

8. The nucleic acid of claim 6, wherein the quencher is BHQ1, BHQ2, or DABCYL.

9. A kit comprising the oligonucleotide set according to claim 1 or 2 or the nucleic acid according to any one of claims 3 to 8.

10. 10. The kit of claim 9, further comprising a DNA polymerase, extension nucleotides, and a buffer.

11. amplifying a first nucleic acid target sequence with a first primer pair to generate a first amplicon; and detecting a mutation in the first amplicon; the first primer pair is specific to a portion of a region selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, and the katG gene, each primer having a sequence substantially identical to an oligonucleotide sequence selected from those set forth in Table 1A and Table 1B; the presence of said mutation is indicative of drug resistance; Methods for detecting drug resistance in M. tuberculosis.

12. The method of claim 11 , wherein the detecting step is performed by sequencing.

13. The detecting step comprises: contacting said first amplicon with a first probe specific for said mutation under conditions conducive to hybridization to form a probe-target hybrid; performing a melting temperature (Tm) analysis to determine a test Tm value for the probe-target hybrid; and comparing the test Tm value with a predetermined reference Tm value; If the test Tm value differs from the predetermined reference Tm value, it indicates the presence of a mutation. The method according to claim 11, wherein the method is carried out by the process of

14. 14. The method of claim 13, wherein the test Tm value is less than the predetermined reference Tm value, indicating the presence of a mutation.

15. further comprising amplifying a second nucleic acid target sequence with a second primer pair to generate a second amplicon; the second primer pair is specific to a portion of a second region selected from the group consisting of the rpoB gene, the gyrA gene, the gyrB gene, the inhA promoter, the rrs gene, the eis promoter, the embB gene, and the katG gene; The method according to any one of claims 11 to 14.

16. 16. The method of claim 15, wherein the first region is the rss gene or the eis promoter.

17. 17. The method of claim 16, wherein the first region is the rss gene.

18. 18. The method of claim 17, wherein the second region is the eis promoter.

19. 17. The method of claim 16, wherein the mutation is A1401G or C1402T in the rrs gene.

20. 18. The method of claim 17, wherein the mutation is within the eis promoter region queried by the eis primer sequence.

21. 21. The method of any one of claims 11 to 20, wherein the resistance is to a drug selected from the group consisting of isoniazid, rifampicin, fluoroquinolone drugs, amikacin, kanamycin, capreomycin, and ethambutol.

22. The method according to any one of claims 11 to 21, wherein the primer pair is one selected from those set forth in Table 1A and Table 1B.

23. 23. The method of any one of claims 13 to 22, wherein the probe comprises a sequence that is substantially identical or completely identical to one selected from those set forth in Table 2.

24. contacting the test sample with a first primer pair under conditions conducive to an amplification reaction to obtain a first amplicon; and detecting the presence of said amplicon, thereby detecting the presence of Mycobacterium tuberculosis in said test sample; the first primer pair is an oligonucleotide set for amplifying a portion of a region of M. tuberculosis selected from the group consisting of gyrB gene, inhA promoter, eis promoter, embB gene, katG gene, dosR gene, IS6110 gene, and IS1081 gene; each primer of the first primer pair has a sequence substantially identical to an oligonucleotide sequence selected from those set forth in Table 1B; A method for detecting the presence of M. tuberculosis in a test sample.

25. 25. The method of claim 24, wherein the primer pair is one selected from those listed in Table 1B.

26. contacting the test sample with a second primer pair under conditions conducive to an amplification reaction to obtain a second amplicon; and detecting the presence of said second amplicon; the presence of both the first amplicon and the second amplicon indicates the presence of Mycobacterium tuberculosis in the test sample.

26. The method of claim 24 or 25.

27. contacting the test sample with a first molecular beacon probe under conditions conducive to a hybridization reaction to obtain a probe-target hybrid; and detecting the presence of said probe-target hybrids, thereby detecting the presence of Mycobacterium tuberculosis in the test sample; the first molecular beacon probe comprises a sequence substantially identical to one selected from those set forth in Table 2; A method for detecting the presence of M. tuberculosis in a test sample.

28. 27. The method of claim 26, wherein the first molecular beacon probe is selected from the group consisting of SEQ ID NOs: 67-69.

Images