Bifidobacterium longum and use thereof for reducing trimethylamine oxides in blood and increasing the content of akkermansia muciniphila in intestines
Bifidobacterium longum LWHK1005 addresses the limitations of current probiotics by reducing trimethylamine oxide and increasing Akkermansia muciniphila, effectively preventing or treating cardiovascular and gastrointestinal diseases through its specific health benefits.
Patent Information
- Application Number
- JP2025064663
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-06
- Filing Date
- 2025-04-10
- Publication Date
- 2026-02-19
AI Technical Summary
Current probiotics, such as lactobacilli and bifidobacteria, have limited effects on treating both cardiovascular and gastrointestinal diseases, and there is a need for more effective strains that can reduce trimethylamine oxide in the blood and increase Akkermansia muciniphila content in the intestine.
The use of Bifidobacterium longum LWHK1005, deposited under DSM 35052, in a composition with pharmaceutically acceptable carriers, to reduce trimethylamine oxide in the blood and increase Akkermansia muciniphila content in the intestine, thereby preventing or treating cardiovascular and gastrointestinal diseases.
Bifidobacterium longum LWHK1005 effectively reduces trimethylamine oxide in the blood, enhances intestinal barrier function, improves immunity, reduces body weight and fat mass, suppresses inflammation, lowers blood glucose and lipids, and improves insulin resistance, while increasing Akkermansia muciniphila content.
Smart Images

Figure 2026028210000001_ABST
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to Bifidobacterium longum and uses thereof, and in particular to Bifidobacterium longum and its use for reducing trimethylamine oxide in the blood and increasing the content of Akkermansia muciniphila in the intestine. [Background technology]
[0002] Cardiovascular disease and digestive diseases are currently the most common diseases. Cardiovascular disease refers to diseases of the heart and blood vessels, and the cause of cardiovascular disease is usually atherosclerosis, which clogs blood vessels and reduces blood flow, causing symptoms such as palpitations, shortness of breath, and dizziness. Gastrointestinal diseases refer to symptoms and diseases of inflammation and ulcers that occur in the digestive organs, and new treatments are currently urgently needed.
[0003] Probiotics are active microorganisms that coexist with the host and, when properly ingested, can have a beneficial effect on the host's health. Traditional probiotics, such as lactobacilli and bifidobacteria, are widely used and are safe and well tolerated by the human body, but their effects on the human intestinal microorganisms are still limited, and there are significant differences in the effects and mechanisms of action between different strains.
[0004] Therefore, how to provide probiotics that can treat both cardiovascular and gastrointestinal diseases has become an improvement need in the prior art. Summary of the Invention [Problem to be solved by the invention]
[0005] One embodiment of the present disclosure provides Bifidobacterium longum LWHK1005, deposited at the German Collection of Microbiological and Cell Cultures DSMZ under accession number DSM 35052. [Means for solving the problem]
[0006] Another embodiment of the present disclosure provides a composition for reducing trimethylamine-N-oxide (TMAO) in the blood and increasing the content of Akkermansia muciniphila in the intestine, the composition comprising Bifidobacterium longum LWHK1005 and a pharmaceutically acceptable carrier.
[0007] In some embodiments, Bifidobacterium longum LWHK1005 is a probiotic.
[0008] In some embodiments, the carrier is selected from the group consisting of micro-crystalline cellulose (MCC), trehalose, maltodextrin, rice flour, magnesium stearate, inositol, dextrose, sucrose, and any combination thereof.
[0009] Another embodiment of the present disclosure provides use of Bifidobacterium longum LWHK1005 for the production of a drug or health food that reduces trimethylamine oxide in the blood and increases the content of Akkermansia muciniphila in the intestine.
[0010] In some embodiments, the strain is a live bacteria.
[0011] In some embodiments, reducing trimethylamine oxide in the blood prevents cardiovascular disease, chronic kidney disease, or a combination thereof.
[0012] In some embodiments, the strain increases the content of Akkermansia muciniphila in the intestine, thereby enhancing intestinal barrier function, improving immunity, reducing body weight, reducing fat mass, suppressing inflammation, lowering blood glucose levels, lowering blood lipids, suppressing fatty liver and steatohepatitis, improving insulin resistance, or a combination thereof.
[0013] In some embodiments, the drug or health food is in the form of a capsule, tablet, powder, or liquid.
[0014] In some embodiments, the drug or health food is prepared for oral administration. [Brief explanation of the drawings]
[0015] Various aspects of the present disclosure will become more readily understood from the following detailed description taken in conjunction with the accompanying drawings. It should be noted that, in accordance with standard industry practice, various features may not be drawn to scale. In fact, the dimensions of various features may be arbitrarily increased or decreased for clarity of discussion. To enable a clearer understanding of the above and other objects, features, advantages, and embodiments of the present disclosure, the accompanying drawings are described as follows:
[0016] [Figure 1] 1 shows the difference between different strains in reducing trimethylamine oxide (TMAO) according to one embodiment of the present disclosure. [Figure 2] FIG. 2 shows the changes in the content of Akkermansia muciniphila in the intestine caused by different bacterial strains according to one embodiment of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION
[0017] To make the description of the present disclosure more detailed and complete, the following provides illustrative descriptions of embodiments and specific examples of the present disclosure, but these are not the only ways to implement or use the specific examples of the present disclosure. The examples disclosed below may be combined with or substituted for each other when beneficial, and one example may be added to another example without further description or explanation. In the following description, numerous specific details are set forth in detail to enable readers to fully understand the following examples. However, the examples of the present disclosure can be implemented without these specific details.
[0018] As used herein, "a," "an," and "said" can generally refer to one or more, unless the context otherwise limits the use of the articles. It will be further understood that, as used herein, "comprises," "includes," "having," and similar terms refer to features, regions, integers, steps, operations, elements, and / or assemblies that are described therein, but do not exclude one or more other aforementioned or additional features, regions, integers, steps, operations, elements, assemblies, and / or combinations thereof.
[0019] Bifidobacterium longum (B. longum), also known as bifidobacteria, is a Gram-positive, catalase-negative bacillus present in the human gastrointestinal tract. It is an anaerobic bacterium and is thought to be one of the earliest bacteria present in the infant gastrointestinal tract.
[0020] The Bifidobacterium longum LWHK1005 strain disclosed herein has been deposited at the German Collection of Microbial and Cell Cultures (DSMZ) under accession number DSM 35052 and at the Bioresource Collection and Research Center (BCRC) of the Food Industry Development Research Institute, Taiwan Foundation under accession number BCRC 911220.
[0021] The disclosed Bifidobacterium longum LWHK1005 is an anaerobic bacterium isolated from the feces of a healthy human in Taiwan. The strain is rod-shaped with a Y-shaped branch and is approximately 4-8 microns in length. Live Bifidobacterium longum bacteria of the disclosed invention are cultured in MRS medium (dE Man, Rogosa, and Sharpe broth) under anaerobic conditions at 37°C. The 16S rRNA gene sequence is shown in SEQ ID NO:1.
[0022] In some specific embodiments of the present disclosure, the strain is administered to an individual orally or parenterally, hi some specific embodiments of the present disclosure, the strain is administered to an individual in an oral dosage form selected from the group consisting of a solution, a suspension, an emulsion, a powder, a tablet, a pill, a syrup, a lozenge, a tablet, a chewing gum, and a capsule.
[0023] In some embodiments, pharmaceutically acceptable carriers include water, alcohols, glycols, preserving agents, antioxidants, solvents, emulsifiers, suspending agents, decomposers, binding agents, excipients, stabilizing agents, chelating agents, diluents, gelling agents, preservatives, lubricants, absorption enhancers, active agents, humectants, odor absorbers, fragrances, pH adjusting agents, occlusive agents, emollients, thickeners, solubilizing agents, and the like. These include, but are not limited to, agents, penetration enhancers, anti-irritants, colorants, propellants, surfactants, and other similar or compatible carriers of the present invention.
[0024] As used herein, the term "cardiovascular disease" refers to a disease of the heart or blood vessels, typically caused by atherosclerosis, which clogs blood vessels and reduces blood flow, resulting in a variety of symptoms, including palpitations, shortness of breath, cyanosis, dizziness, and fainting. Common cardiovascular diseases include, but are not limited to, coronary heart disease, stroke, heart failure, arrhythmia, and valvular heart disease. Once diagnosed, treatment options include medications and coronary artery surgery, such as balloon dilation, cardiac stenting, and coronary artery bypass surgery.
[0025] As used herein, the term "gastrointestinal diseases" includes inflammatory and ulcerative conditions and diseases that occur in the digestive tract, including, but not limited to, aphthous ulcers, Crohn's disease, atopic gastritis, verrucae gastritis, ulcerative colitis, celiac disease, regional ileitis, irritable bowel syndrome, inflammatory bowel disease, and gastrointestinal reflux disease.
[0026] As used herein, the term "subject" refers to a warm-blooded animal, such as a mammal, that is suffering from a particular disease, disorder, or condition, including, but not limited to, for example, a human, an orangutan, a chimpanzee, a mouse, a rat, a dog, a cow, a chicken, a pig, a goat, a sheep, and the like.
[0027] As used herein, the term "treatment" or "treating" includes, but is not limited to, alleviating symptoms, temporarily or permanently eliminating the cause of symptoms, preventing or slowing the onset of symptoms and progression of a disease, disorder, or ailment.
[0028] As used herein, the term "Akkermansia muciniphila" refers to a highly anaerobic, Gram-negative bacterium. It is one of the most abundant species in the human intestinal microbiome, accounting for 1-5% of the total bacterial population in the human intestinal tract. It decomposes mucin as its sole source of carbon, nitrogen, and energy, producing short-chain fatty acids (SCFAs) such as acetate and propionate. The first proven health benefit of Akkermansia muciniphila is the improvement of obesity. Obesity is a chronic, low-level inflammation associated with specific changes in the gut microbiota. In obese individuals, the abundance of Firmicutes significantly increases, while the abundance of Akkermansia muciniphila significantly decreases. Furthermore, the abundance of Akkermansia muciniphila was negatively correlated with body fat weight and impaired glucose tolerance. Akkermansia muciniphila can also improve indicators of metabolic syndrome. Akkermansia muciniphila can reduce metabolic abnormalities caused by a high-fat diet, such as increased fat mass, adipose tissue inflammation, and insulin resistance.
[0029] As used herein, the term "trimethylamine oxide," also known as trimethylamine-N-oxide (TMAO), is an N-oxide formed by trimethylamine. Its chemical formula is (CH3)3NO. It is a metabolite produced by anaerobic bacteria in the intestine and the human body, and has recently been considered an important factor in the development of cardiovascular disease. Trimethylamine oxide promotes macrophage accumulation in blood vessel walls, inhibits cholesterol recycling pathways, and increases platelet aggregation activity, leading to atherosclerosis and embolus formation, potentially increasing the risk of heart disease.
[0030] To further illustrate the use of Bifidobacterium longum of the present disclosure for reducing trimethylamine oxide in the blood and increasing Akkermansia muciniphila content in the intestines, several examples and experimental examples are listed below, but these are for illustrative purposes only and are not intended to limit the present disclosure. The scope of protection of the present disclosure should be determined by the appended claims.
[0031] Example
[0032] Experimental group
[0033] In this study, 8-week-old C57BL / 6 female mice were randomly divided into one control group (Con) and six experimental groups. The experimental groups were daily gavaged with live Bifidobacterium longum strains (A1, A2, A3, A4, LWHK1005, and A6). The bacteria were administered at a concentration of 2 x 10 8 The cells were CFU and suspended in phosphate buffered solution (PBS) containing 2.5% glycerol. The control group received the same volume of PBS containing 2.5% glycerol daily by gavage. The gavage period was 6 weeks.
[0034] Example 1
[0035] To understand the differential function of different Bifidobacterium longum strains in suppressing trimethylamine oxide (TMAO) production in mice, we administered choline chloride (some bacteria can metabolize choline to TMA, which then enters the liver via the blood and is metabolized to TMAO) to mice and then measured the TMAO concentration in their blood. For the experimental procedure, different Bifidobacterium longum strains (A1, A2, A3, A4, LWHK1005, and A6) were administered daily by gavage for 6 weeks. The mice were then fasted for 12 hours, after which post-fasting blood samples (0-hour blood samples) were collected. Then, the mice were administered choline chloride (dissolved in water) at a dose of 400 mg / kg BW. After gavage for 4 hours, blood samples (4-hour blood samples) were collected. After separating plasma from the blood samples, the TMAO content in the samples was analyzed by liquid chromatography mass spectrometry (LC-MS).
[0036] The results are shown in Figure 1, which compares the blood TMAO concentrations of each group before (0 hours) and after (4 hours) choline chloride intake. Before choline chloride administration, blood TMAO concentrations were 10.427 ± 1.603 μM (mean ± SEM) in the control group, 12.730 ± 0.974 μM in the Bifidobacterium longum A1 group, 15.354 ± 1.909 μM in the Bifidobacterium longum A2 group, 15.193 ± 1.249 μM in the Bifidobacterium longum A3 group, 10.638 ± 0.884 μM in the Bifidobacterium longum A4 group, 15.646 ± 1.552 μM in the Bifidobacterium longum LWHK1005 group, and 12.808 ± 1.813 μM in the Bifidobacterium longum A6 group. Statistical analysis revealed no statistically significant differences between groups. Four hours after choline chloride administration, the blood TMAO concentrations were 121.968±1.089 μM in the control group, 114.568±3.662 μM in the Bifidobacterium longum A1 group, 111.051±6.838 μM in the Bifidobacterium longum A2 group, 115.674±2.677 μM in the Bifidobacterium longum A3 group, 111.164±2.056 μM in the Bifidobacterium longum LWHK1005 group, and 100.687±2.575 μM in the Bifidobacterium longum A6 group. After choline chloride administration to mice, the blood TMAO concentrations of mice in all groups increased significantly. However, after choline chloride administration to mice in the groups receiving Bifidobacterium longum LWHK1005 or A6 by gavage, the blood TMAO concentrations of mice in both groups were significantly lower than those of the control group (t-test, **: p<0.01).
[0037] Example 2
[0038] To compare the intestinal Akkermansia muciniphila content among different strains of Bifidobacterium longum, a next-generation probiotic, fecal samples were collected from mice after 6 weeks of tube administration of different Bifidobacterium longum strains (A1, A2, A3, A4, LWHK1005, and A6). DNA was extracted from the fecal samples and analyzed for Akkermansia muciniphila content using real-time polymerase chain reaction (RT-PCR) with a primer pair (SEQ ID NO:2 - forward primer CAGCACGTGAAGGTGGGGAC) and SEQ ID NO:3 - reverse primer CCTTGCGGTTGGCT TCAGAT) designed for the Akkermansia muciniphila ATCC BAA-835 strain.
[0039] After six weeks of daily gavage administration of different Bifidobacterium longum strains (A1, A2, A3, A4, LWHK1005, and A6), the contents of Akkermansia muciniphila in fecal samples from mice were analyzed to determine whether Akkermansia muciniphila in the intestine was altered by the administration of different Bifidobacterium longum strains. The analysis results are shown in Figure 2. Compared with the control group, the Akkermansia muciniphila content in the Bifidobacterium longum A1 group was 1.078 ± 0.055 times (Mean ± SEM), the Bifidobacterium longum A2 group was 1.406 ± 0.56 times, the Bifidobacterium longum A3 group was 2.651 ± 0.846 times, the Bifidobacterium longum A4 group was 0.818 ± 0.17 times, the Bifidobacterium longum LWHK1005 group was 2.812 ± 0.686 times, and the Bifidobacterium longum A6 group was 1.312 ± 0.203 times. In the group receiving Bifidobacterium longum LWHK1005 by tube, the content of Akkermansia muciniphila in fecal samples was significantly higher than in the control group (t-test, *:p<0.05). In the groups receiving Bifidobacterium longum A2 and A3 by tube, statistical analysis showed no statistical difference, but the content of Akkermansia muciniphila tended to be significantly higher than in the control group.
[0040] However, not all Bifidobacterium longum strains were able to increase the content of Akkermansia muciniphila. For example, the content of Akkermansia muciniphila in Bifidobacterium longum A1 and A4 was the same as that in the control group.
[0041] The Bifidobacterium longum LWHK1005 disclosed herein inhibits MTAO while increasing the content of Akkermansia muciniphila, and also reduces trimethylamine oxide in the blood and increases the content of Akkermansia muciniphila in the intestines, thereby having the effects of preventing or treating cardiovascular diseases and digestive diseases.
[0042] Although the present disclosure has been disclosed in the above embodiments, the present disclosure is not limited thereto, and a person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present disclosure, and therefore, the protection scope of the present disclosure should be determined by the appended claims.
Claims
1. Bifidobacterium longum LWHK1005, deposited at the German Collection of Microbiological and Cell Cultures DSMZ under accession number DSM 35052.
2. A composition for reducing trimethylamine oxide in the blood and increasing the content of Akkermansia muciniphila in the intestines, Bifidobacterium longum LWHK1005 according to claim 1; a pharmaceutically acceptable carrier; and A composition comprising:
3. The composition according to claim 2, wherein the Bifidobacterium longum LWHK1005 is a live bacterium.
4. 3. The composition of claim 2, wherein the carrier is selected from the group consisting of microcrystalline cellulose, trehalose, maltodextrin, rice flour, magnesium stearate, inositol, dextrose, sucrose, and any combination thereof.
5. 2. Use of Bifidobacterium longum LWHK1005 according to claim 1 for the manufacture of a drug or health food that reduces trimethylamine oxide in the blood and increases the content of Akkermansia muciniphila in the intestines.
6. The use according to claim 5, wherein the strain is a live bacterium.
7. The use according to claim 5, wherein cardiovascular disease, chronic kidney disease, or a combination thereof is prevented by reducing trimethylamine oxide in the blood.
8. The use of claim 5, wherein the strain increases the content of Akkermansia muciniphila in the intestine, thereby enhancing intestinal barrier function, enhancing immunity, reducing body weight, reducing fat mass, suppressing inflammation, lowering blood glucose levels, lowering blood lipids, suppressing fatty liver and steatohepatitis, improving insulin resistance, or a combination thereof.
9. The use according to claim 5, wherein the drug or health food is in the form of a capsule, tablet, powder, or liquid.
10. The use according to claim 5, wherein the drug or health food is prepared for oral administration.
Citation Information
Patent Citations
Bifidobacterium longum CCFM1216 for reducing plasma TMAO and relieving and preventing atherosclerosis and application of bifidobacterium longum CCFM1216
CN114410531A
Bifidobacterium longum for reducing levels of plasma trimethylamine oxide and cecum trimethylamine and application of bifidobacterium longum
CN114410532A
Bifidobacterium longum subsp. Longum for relieving pathological characteristics of mouse with chronic kidney disease and application thereof
CN118222440A