Compositions for regulating SOD-1 expression

Abstract

Compositions and methods are provided for reducing the expression of soluble superoxide dismutase 1 (SOD-1) mRNA and protein in animals. Antisense compounds and methods for reducing SOD-1 mRNA and protein expression are provided. Such methods, compounds, and compositions are useful for treating, preventing, or ameliorating SOD-1-related diseases, disorders, and conditions, including amyotrophic sclerosis (ALS).

Description

[Technical Field]

[0001] Sequence Listing This application is filed with an electronic Sequence Listing, which is provided as a file entitled BIOL0240WOSEQ_ST25.pdf, 320 Kb in size, created on March 30, 2015. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] FIELD OF THE INVENTION Compositions and methods are provided for reducing the expression of soluble superoxide dismutase 1 (SOD-1) mRNA and protein in an animal. Such methods are useful for treating, preventing, or ameliorating neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), by inhibiting SOD-1 expression in the animal. [Background technology]

[0003] The soluble SOD-1 enzyme (also known as Cu / Zn superoxide dismutase) is one of the superoxide dismutases that provides protection from oxidative damage to biomolecules by catalyzing the dismutation of superoxide to hydrogen peroxide (H2O2) (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). Superoxide anion (O2-) is a potentially harmful cellular by-product produced primarily by errors in oxidative phosphorylation in mitochondria (Turrens, J. Physiol. 2003, 552, 335-344).

[0004] Mutations in the SOD-1 gene are associated with dominantly inherited amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease), a disorder characterized by selective degeneration of upper and lower motor neurons (Rowland, N. Engl. J. Med. 2001, 344, 1688-1700). There is strong genetic linkage between familial ALS and missense mutations in the SOD1 gene (Rosen, Nature, 1993, 362, 59-62). The toxicity of mutant SOD1 results from reduced nuclear protection from active enzyme (loss of function in the nucleus) due to early misfolding (gain of function), a process that may be involved in ALS pathogenesis (Sau, Hum. Mol. Genet. 2007, 16, 1604-1618).

[0005] ALS is a devastating, progressive neurodegenerative disease that affects as many as 30,000 Americans at any given time. The progressive degeneration of motor neurons in ALS ultimately leads to their death. As motor neurons die, the brain loses its ability to initiate and control muscle movement. Voluntary muscle activity is progressively affected, and patients in the later stages of the disease can become completely paralyzed.

[0006] There are currently no acceptable options for treating such neurodegenerative diseases, and therefore it is an object of the present invention to provide methods for treating such diseases. Summary of the Invention

[0007] The present invention provides methods, compounds, and compositions for modulating the expression of soluble superoxide dismutase 1 (SOD-1) mRNA and protein. In certain embodiments, compounds useful for modulating the expression of SOD-1 mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds The compound is a modified oligonucleotide.

[0008] In certain embodiments, the modulation can be performed in cells or tissues. In certain embodiments, the cells or tissues are in animals. In certain embodiments, the animals are humans. In certain embodiments, the SOD-1 mRNA level is reduced. In certain embodiments, the SOD-1 protein level is reduced. Such reduction can occur in a time-dependent or dose-dependent manner.

[0009] Also provided are methods, compounds, and compositions useful for preventing, treating, and ameliorating diseases, disorders, and conditions. In certain embodiments, the SOD-1-related diseases, disorders, and conditions are neurodegenerative diseases. In certain embodiments, the neurodegenerative diseases, disorders, and conditions include amyotrophic lateral sclerosis (ALS).

[0010] The above-mentioned diseases, disorders, and conditions may have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for the development of ALS include aging, personal or family history, or genetic predisposition. However, the majority of ALS cases are sporadic and have no known risk factors. Certain symptoms and outcomes associated with the development of ALS include, but are not limited to, muscle fasciculations, spasms, stiff, rigid muscles (spasticity), muscle weakness affecting the arms or legs, slurred speech and nasal voice, difficulty walking, difficulty chewing or swallowing (dysphagia), difficulty speaking or speaking (dysarthria), weakness or atrophy, spasticity, exaggerated reflexes (hyperreflexia), and the presence of Babinski's sign. As ALS progresses, symptoms and outcomes include weakness of other limbs, possibly with twitching, muscle spasms, and exaggerated and more rapid reflexes; problems with chewing, swallowing, and breathing; drooling may occur; and ultimately paralysis and death.

[0011] In certain embodiments, the method of treatment comprises administering an SOD-1 antisense compound to an individual in need thereof. In certain embodiments, the method of treatment comprises administering an SOD-1 modified oligonucleotide to an individual in need thereof. DETAILED DESCRIPTION OF THE INVENTION

[0012] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting of the claimed invention. As used herein, the use of the singular includes the plural unless expressly stated otherwise. The use of "or" herein means "and / or" unless expressly stated otherwise. Additionally, the use of "and" herein means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms, such as "includes" and "included," is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components comprising two or more subunits, unless expressly stated otherwise. Furthermore, all sequences described herein are written in 5' to 3' order unless expressly stated otherwise.

[0013] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Documents or portions of documents cited in this disclosure, including but not limited to patents, patent applications, patent application publications, papers, books, treaties, and related sequence information that can be obtained from databases such as GENBANK accession numbers and the National Center for Biotechnology Information (NCBI), as well as other data referred to throughout the disclosure of this specification, are expressly incorporated herein in their entirety as discussed herein.

[0014] definition Unless specific definitions are provided, the terminology used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry and the procedures and techniques described herein are those well known and commonly used in the art. Standard techniques may be used for chemical syntheses and chemical analyses.

[0015] Unless otherwise indicated, the following terms have the following meanings:

[0016] "2'-deoxynucleoside" (also referred to as 2'-deoxyribonucleoside) refers to a nucleoside containing a 2'-H-furanosyl sugar moiety found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, 2'-deoxynucleosides may contain modified nucleobases or may contain RNA nucleobases (e.g., uracil).

[0017] "2'-deoxyribose sugar" refers to the 2'-H-furanosyl sugar moiety found in naturally occurring deoxyribonucleic acid (DNA).

[0018] "2'-O-Methoxyethyl" (also referred to as 2'-MOE and 2'-OCHCH-OCH and MOE and 2'-O-methoxyethylribose) refers to an O-methoxy-ethyl modification at the 2' position of the furanose ring. A 2'-O-methoxyethylribose modified sugar is a modified sugar.

[0019] "2'-O-methoxyethyl ribose modified nucleoside" (also referred to as 2'-MOE nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0020] "2'-substituted nucleoside" means a nucleoside that includes a substituent other than H or OH at the 2' position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0021] "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0022] "About" means within ±10% of a given value. For example, a reference to "a compound that achieves at least about 50% inhibition of SOD-1" implies that SOD-1 levels are inhibited within a range of 45% to 55%. "Concurrent administration" refers to the co-administration of two pharmaceutical agents in any manner such that both pharmacological effects are experienced in a patient simultaneously. Concurrent administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition or the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents do not have to be experienced simultaneously. The effects need only overlap over a period of time; they need not be coextensive in time.

[0023] "Administering" means giving a pharmaceutical agent to an animal, including, but not limited to, administration by a medical professional and self-administration.

[0024] "Amelioration" refers to the lessening, slowing, halting, or reversal of at least one indicator of the severity of a condition or disease. The severity of the indicator may be determined by subjective or objective measures known to those skilled in the art.

[0025] "Animal" refers to humans and non-human animals, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0026] "Antibody" refers to a molecule characterized by some specific reaction with an antigen, each defined in relation to the other. Antibody can refer to an intact antibody molecule or any fragment or region thereof, such as the heavy chain, light chain, Fab region, and Fc region.

[0027] "Antisense activity" means any detectable or measurable activity attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid.

[0028] "Antisense compounds" refer to oligomeric compounds capable of hybridizing to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupancy-based compounds.

[0029] "Antisense inhibition" refers to a reduction in the level of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid compared to the level of the target nucleic acid in the absence of the antisense compound.

[0030] "Antisense mechanisms" refers to any mechanism involving hybridization of a compound with a target nucleic acid, where the result or effect of said hybridization is target degradation or target occupancy, with a concomitant cessation of cellular machinery involved, for example, in transcription or splicing.

[0031] "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

[0032] "Base complementarity" refers to the ability of the nucleobases of an oligonucleotide to undergo precise base pairing (i.e., hybridization) with corresponding nucleobases in a target nucleic acid, mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between the corresponding nucleobases.

[0033] "Bicyclic sugar" means a furanose ring modified by bridging two atoms. A bicyclic sugar is a modified sugar.

[0034] "Bicyclic nucleic acid" or "BNA" refers to a nucleoside or nucleotide in which the furanose portion of the nucleoside or nucleotide contains a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

[0035] "Cap structure" or "terminal cap moiety" means a chemical modification incorporated at either end of an antisense compound.

[0036] "cEt" or "constrained ethyl" or "cEt modified sugar" means a bicyclic nucleoside having a sugar moiety that includes a bridge connecting the 4'-carbon and the 2'-carbon of the formula: 4'-CH(CH3)-O-2'. A cEt modified sugar is a modified sugar.

[0037] "cEt-modified nucleoside" means a bicyclic nucleoside having a sugar moiety that includes a bridge connecting the 4'-carbon and the 2'-carbon of the formula: 4'-CH(CH3)-O-2'. An Et-modified sugar is a modified sugar.

[0038] A "chemically distinct region" refers to a region of an antisense compound that is chemically distinct in some way from another region of the same antisense compound, e.g., a region having 2'-O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides that do not have 2'-O-methoxyethyl modifications.

[0039] By "chimeric antisense compound" is meant an antisense compound having at least two chemically distinct regions, each region having multiple subunits.

[0040] "Co-administration" refers to the administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition or in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered by the same route of administration or by different routes of administration. Co-administration includes simultaneous or sequential administration.

[0041] "Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0042] It will be understood that "comprise", "comprises" and "comprising" imply the inclusion of a stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements.

[0043] "Contiguous nucleobases" means nucleobases that are immediately adjacent to each other.

[0044] "Design" or "designed to" refers to the process of engineering an oligomeric compound that will specifically hybridize with a selected nucleic acid molecule.

[0045] "Diluent" means an ingredient in a composition that has no pharmacological activity, but is pharmacologically necessary or desirable. For example, in an injected drug, the diluent may be a liquid, such as saline.

[0046] "Dose" refers to a specified amount of a pharmaceutical agent given in a single administration or over a specified period of time. In certain embodiments, a dose can be administered as one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume that is not easily accommodated by a single injection, so two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion or continuous infusion over an extended period of time. A dose can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

[0047] An "effective amount," in the context of modulating activity or treating or preventing a condition, means the administration to a subject in need of such modulation, treatment, or prevention, either in a single dose or as part of a series, of an amount of pharmaceutical agent effective to modulate that effect, or to treat or prevent, or ameliorate, that condition. Effective amounts may vary from individual to individual, depending on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, an assessment of the individual's medical condition, and other relevant factors.

[0048] "Efficacy" means the ability to produce a desired effect.

[0049] "Expression" involves the translation of genetically coded information into structures present in and operating within a cell. This term includes all functions that convert a protein into a structure, including, but not limited to, transcription products and translation products.

[0050] "Fully complementary" or "100% complementary" means that each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the target nucleic acid is the second nucleic acid.

[0051] "Gapmer" refers to a chimeric antisense compound in which an inner region having multiple nucleosides that support RNase H cleavage is separated from outer regions having one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from one or more of the nucleosides comprising the outer regions. The inner region can be referred to as the "gap," and the outer regions can be referred to as "wings."

[0052] "Gap-narrowed" refers to a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2'-deoxyribonucleosides located between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

[0053] "Gap-widened" refers to a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides located between and immediately adjacent to 5' and 3' wing segments, each having from 1 to 6 nucleosides.

[0054] "Hybridization" refers to the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and target nucleic acids. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0055] "Identifying an animal having an SOD-1-related disorder" means identifying an animal that has been diagnosed with or is predisposed to developing an SOD-1-related disorder. Individuals predisposed to developing an SOD-1-related disorder include those with one or more risk factors for developing an SOD-1-related disorder, such as increasing age, a personal or family history, or having a genetic predisposition to one or more SOD-1-related disorders. Such identification can be accomplished in any manner, such as by evaluating the individual's medical history and standard clinical tests or evaluations, such as genetic testing.

[0056] "Immediately adjacent" means that there are no intervening elements between the immediately adjacent elements.

[0057] "Individual" means a human or non-human animal selected for treatment or therapy.

[0058] "Inhibiting SOD-1" means reducing the level or expression of SOD-1 mRNA and / or protein. In certain embodiments, the level of SOD-1 mRNA and / or protein is inhibited in the presence of an antisense compound targeting SOD-1, such as a modified oligonucleotide targeting SOD-1, compared to the level of SOD-1 mRNA expression and / or protein in the absence of the SOD-1 antisense compound, such as a modified oligonucleotide.

[0059] "Inhibiting expression or activity" refers to reducing or blocking expression or activity, and does not necessarily However, this does not indicate a complete elimination of expression or activity.

[0060] "Internucleoside linkage" refers to the chemical bond between nucleosides.

[0061] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside bond.

[0062] A "mismatch" or "non-complementary nucleobase" refers to an instance where a nucleobase of a first nucleic acid is not able to pair with the corresponding nucleobase of a second or target nucleic acid.

[0063] "Hybrid backbone" means an internucleoside linkage pattern that includes at least two different internucleoside linkages. For example, an oligonucleotide with a hybrid backbone can include at least one phosphodiester linkage and at least one phosphorothioate linkage.

[0064] A "modified internucleoside linkage" refers to a substitution or any alteration from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).

[0065] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0066] "Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or a modified nucleobase.

[0067] "Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and / or modified nucleobase.

[0068] "Modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0069] By "modified sugar" is meant a substitution and / or some alteration from a natural sugar moiety.

[0070] "Monomer" refers to a unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0071] "Motif" means the pattern of unmodified and modified nucleosides in an antisense compound.

[0072] By "natural sugar moiety" is meant a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0073] "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0074] "Non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise support hybridization.

[0075] "Nucleic acid" refers to a molecule composed of monomeric nucleotides, including, but not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0076] "Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0077] "Nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, a complementary nucleobase refers to a nucleobase of an antisense compound that can base pair with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound can hydrogen bond with a nucleobase at a certain position of a target nucleic acid, the hydrogen bond position between the oligonucleotide and the target nucleic acid is considered to be complementary in this nucleobase pairing.

[0078] "Nucleobase sequence" means the order of contiguous nucleobases, independent of sugar, linkage, and / or nucleobase modifications.

[0079] "Nucleoside" means a nucleobase linked to a sugar.

[0080] "Nucleoside mimetic" includes structures used to replace sugars or sugars and bases (but not necessarily linkages) at one or more positions in an oligomeric compound, such as morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., nucleoside mimetics having non-furanose sugar units. Nucleotide mimetics include structures used to replace nucleosides and linkages at one or more positions in an oligomeric compound, such as peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkages). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic, but is intended to refer to replacement of only the sugar unit (furanose ring). The tetrahydropyranyl ring provided herein illustrates one example of a sugar surrogate in which the furanose sugar group is replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for the sugar, nucleobase, and / or internucleoside linkage. Typically, the mimetic is substituted for the sugar or sugar-internucleoside linkage combination, while the nucleobase is maintained for hybridization to a selected target.

[0081] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0082] "Off-target effect" refers to an unwanted or adverse biological effect associated with the modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0083] By "oligomeric compound" or "oligomer" is meant a polymer of linked monomeric subunits that is capable of hybridizing to at least a region of a nucleic acid molecule.

[0084] "Oligonucleotide" means a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[0085] "Parenteral administration" means administration by injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, or intracranial, e.g., intrathecal or intraventricular, administration.

[0086] "Peptide" refers to a molecule formed by linking at least two amino acids with an amide bond. As used herein, peptide refers to, but is not limited to, polypeptides and proteins.

[0087] "Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, a modified oligonucleotide that targets SOD-1 is a pharmaceutical agent.

[0088] "Pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include a modified oligonucleotide and a sterile aqueous solution.

[0089] "Pharmaceutically acceptable derivatives" include pharmacologically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

[0090] "Pharmacologically acceptable salt" means a physiologically and pharmaceutically acceptable salt of an antisense compound, i.e., a salt that retains the desired biological activity of the parent oligonucleotide and does not impart undesired toxicological effects thereto.

[0091] "Phosphorothioate linkage" means an internucleoside linkage in which the phosphodiester bond has been modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0092] "Portion" refers to a predetermined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a predetermined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a predetermined number of contiguous nucleobases of an antisense compound.

[0093] "Prevent" or "prevention" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of minutes to days, a period of weeks to months, or indefinitely.

[0094] "Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., a drug) by the action of endogenous enzymes or other chemicals and / or conditions within the body or cells thereof.

[0095] A "prophylactically effective amount" refers to an amount of a pharmaceutical agent that confers a prophylactic or preventative benefit on an animal.

[0096] A "region" is defined as a portion of a target nucleic acid that has at least one distinguishable structure, function, or characteristic.

[0097] "Ribonucleotide" means a nucleotide having a hydroxyl at the 2' position of the sugar moiety of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

[0098] "Salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0099] A "segment" is defined as a smaller portion or subportion of a region within the target nucleic acid.

[0100] "Shortened" or "truncated" forms of the oligonucleotide SOD-1ght herein have one, two or more nucleosides missing.

[0101] "Side effects" means physiological responses resulting from treatment other than the desired effect. In certain embodiments, side effects include, but are not limited to, injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, and myopathy.

[0102] "Single-stranded oligonucleotide" means an oligonucleotide that is not hybridized to a complementary strand.

[0103] As used herein, a "site" is defined as a unique nucleobase position within a target nucleic acid.

[0104] "Slowing progression" means a decrease in the progression of the disease.

[0105] "SOD-1" refers to the mammalian gene soluble superoxide dismutase 1 (SOD-1), including the human gene soluble superoxide dismutase 1 (SOD-1).

[0106] "SOD-1-associated disease" means any disease associated with any SOD-1 nucleic acid or its expression product. Such diseases can include neurodegenerative diseases. Such neurodegenerative diseases can include amyotrophic lateral sclerosis (ALS).

[0107] By "SOD-1 mRNA" is meant any messenger RNA expression product of a DNA sequence encoding SOD-1.

[0108] "SOD-1 nucleic acid" refers to any nucleic acid encoding SOD-1. For example, in certain embodiments, SOD-1 nucleic acids include DNA sequences encoding SOD-1, RNA sequences transcribed from DNA encoding SOD-1 (including genomic DNA containing introns and exons), and mRNA sequences encoding SOD-1. "SOD-1 mRNA" refers to mRNA encoding the SOD-1 protein.

[0109] By "SOD-1 protein" is meant the polypeptide expression product of an SOD-1 nucleic acid.

[0110] "Specifically hybridizable" refers to an antisense compound that has a sufficient degree of complementarity between the oligonucleotide and the target nucleic acid to induce the desired effect while having minimal or no effect on non-target nucleic acids under conditions where specific binding is desired, i.e., physiological conditions in the case of in vivo assays or therapeutic treatments.

[0111] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to only a small number of other sequences.

[0112] "Subject" means a human or non-human animal selected for treatment or therapy.

[0113] "Sugar chemical motif" refers to a pattern of sugar modifications that includes at least two different sugar modifications. For example, an oligonucleotide with a mixed backbone can include at least one 2'-O-methoxyethyl modified nucleoside, one cEt modified nucleoside, and / or one 2'-deoxynucleoside.

[0114] "Target" refers to a protein whose modulation is desired.

[0115] "Target gene" refers to a gene that encodes a target.

[0116] "Targeting" or "targeted" refers to the process of designing and selecting an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0117] The terms "target nucleic acid," "target RNA," and "target RNA transcript" and "nucleic acid target" all refer to a nucleic acid that can be targeted by an antisense nucleic acid.

[0118] "Target region" refers to a portion of a target nucleic acid that is targeted by one or more antisense nucleic acids.

[0119] "Target segment" refers to the sequence of nucleotides in a target nucleic acid that is targeted by an antisense compound. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0120] "Therapeutically effective amount" means an amount of a pharmaceutical agent that confers a therapeutic benefit on an individual.

[0121] "Treat" or "treating" or "treatment" refers to administering a composition to effect an alteration or amelioration of the disease or condition.

[0122] "Unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0123] "Unmodified nucleotide" means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., a β-D-ribonucleoside) or a DNA nucleotide (i.e., a β-D-deoxyribonucleoside).

[0124] "Wing segment" refers to multiple nucleosides modified to impart properties to the oligonucleotide, such as increased inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by endogenous nucleases.

[0125] Certain embodiments Certain embodiments provide methods, compounds, and compositions for inhibiting expression of SOD-1 mRNA and protein, and for reducing levels of SOD-1 mRNA and protein.

[0126] Certain embodiments provide antisense compounds targeted to an SOD-1 nucleic acid, which in certain embodiments is the sequence set forth in GENBANK Accession No. NM_000454.4 (incorporated herein as SEQ ID NO: 1), the sequence set forth in GENBANK Accession No. NT_011512.10 truncated from nucleotide 18693000 to nucleotide 18704000 (incorporated herein as SEQ ID NO: 2), or the sequence set forth in GENBANK Accession No. NW_001114168.1 truncated from nucleotide 2258000 to nucleotide 2271000 (incorporated herein as SEQ ID NO: 3).

[0127] Certain embodiments provide methods for treating, preventing, or ameliorating SOD-1-associated diseases, disorders, and conditions in individuals in need thereof. Methods for preparing medicaments for treating, preventing, or ameliorating SOD-1-associated diseases, disorders, and conditions are also contemplated. SOD-1-associated diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, SOD-1-associated diseases include amyotrophic lateral sclerosis (ALS).

[0128] Embodiment 1. A compound comprising: a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 118-1461.

[0129] Embodiment 2. A compound comprising: a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15, 21, 23, 47, 54, and 67, wherein at least one internucleoside linkage is a phosphodiester bond.

[0130] Embodiment 3. The compound of any one of the preceding embodiments, wherein the modified oligonucleotide has a hybrid backbone.

[0131] Embodiment 4. The compound of embodiment 3, wherein the hybrid backbone motif is any of the following: sosssssssssoooss, sooossssssssoss, sooosssssssssoss, soossssssssssooss, sooossssssssooss, sooossssssssssooss, sooosssssssssssooss, sooossssssssssssooos, soooosssssssssssooss, sooosssssssssssssooss, sososssssssssssssosos, and sooosssssssssssoooss, where: s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0132] Embodiment 5. The compound of any one of the preceding embodiments, wherein the modified oligonucleotide has any of the following sugar chemical motifs: ekddddddddekekee, kekeddddddddekek, eeeedddddddddkkee, eeeeddddddddekeke, eeeeddddddddkekee, eeeeddddddddkkeee, eeeeeddddddddkkee, eeeekddddddddkeee, eeeekdddddddkeeee, eeekddddddddkeeee, eeekkdddddddkkeee, eekkdddddddddkkee, eekkddddddddeeeee, eekkddddddddkkeee, ekekddddddddeeeee, ekekddddddddkekee, and kekeddddddddeeeee, where: e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar.

[0133] Embodiment 6. The compound of any one of the preceding embodiments, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO:1 or SEQ ID NO:2.

[0134] Embodiment 7. The compound of any one of the preceding embodiments, consisting of a single-stranded modified oligonucleotide.

[0135] Embodiment 8. The compound of any one of the preceding embodiments, wherein at least one internucleoside linkage is a modified internucleoside linkage.

[0136] Embodiment 9. The compound of embodiment 8, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0137] Embodiment 10 The compound of embodiment 9, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0138] Embodiment 11. The compound of any one of the preceding embodiments, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

[0139] Embodiment 12. The compound of any one of the preceding embodiments, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

[0140] Embodiment 13 The compound of any one of the preceding embodiments, wherein at least one nucleoside comprises a modified nucleobase.

[0141] Embodiment 14. The compound of embodiment 13, wherein the modified nucleobase is 5-methylcytosine.

[0142] Embodiment 15 The compound of any one of the preceding embodiments, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

[0143] Embodiment 16 The compound of embodiment 15, wherein the at least one modified sugar is a bicyclic sugar.

[0144] Embodiment 17. The bicyclic sugar comprises a chemical linkage 4'-CH2-N(R)-O-2' bridge between the 2' and 4' positions of the sugar, where R is independently H, C1-C 12 17. The compound of embodiment 16, comprising a substituted or unsubstituted alkyl, or protecting group.

[0145] Embodiment 18. The bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C 12 18. The compound of embodiment 17, comprising a substituted or unsubstituted alkyl, or protecting group.

[0146] Embodiment 19 The compound of embodiment 15, wherein at least one modified sugar comprises a 2'-O-methoxyethyl group.

[0147] Embodiment 20 The compound of embodiment 15, wherein the modified sugar comprises a 2'-O(CH2)2-OCH3 group.

[0148] Embodiment 21. The modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0149] Embodiment 22. The modified oligonucleotide comprises: a gap segment consisting of nine linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0150] Embodiment 23. The modified oligonucleotide comprises: a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0151] Embodiment 24. The modified oligonucleotide comprises: a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of four linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0152] Embodiment 25. The modified oligonucleotide comprises: a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of seven linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0153] Embodiment 26. The modified oligonucleotide comprises: a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of six linked nucleosides; and a 3' wing segment consisting of six linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0154] Embodiment 27. The modified oligonucleotide comprises: a gap segment consisting of nine linked deoxynucleosides; a 5' wing segment consisting of six linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0155] Embodiment 28. The compound of any one of the preceding embodiments, wherein the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides.

[0156] Embodiment 29. A compound consisting of a modified oligonucleotide according to the following formula:

[0157] [ka]

[0158] Embodiment 30. A compound consisting of a modified oligonucleotide according to the following formula:

[0159] [ka]

[0160] Embodiment 31. A compound consisting of a modified oligonucleotide according to the following formula:

[0161] [ka]

[0162] Embodiment 32. A compound consisting of a modified oligonucleotide according to the following formula:

[0163] [ka]

[0164] Embodiment 33. A compound consisting of a modified oligonucleotide according to the following formula:

[0165] [ka]

[0166] Embodiment 34. A compound consisting of a modified oligonucleotide according to the following formula:

[0167] [ka]

[0168] Embodiment 35. A compound consisting of a modified oligonucleotide according to the following formula:

[0169] [ka]

[0170] Embodiment 36. A compound consisting of a modified oligonucleotide according to the following formula:

[0171] [ka]

[0172] Embodiment 37. A compound consisting of a modified oligonucleotide according to the following formula: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0173] Embodiment 38. A compound consisting of a modified oligonucleotide according to the following formula: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0174] Embodiment 39. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0175] Embodiment 40. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0176] Embodiment 41. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0177] Embodiment 42. A compound consisting of a modified oligonucleotide according to the following formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0178] Embodiment 43. A compound consisting of a modified oligonucleotide according to the following formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0179] Embodiment 44. A compound consisting of a modified oligonucleotide according to the following formula: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0180] Embodiment 45. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCeo Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Ges mCes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0181] Embodiment 46. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Ges mCeo Aeo mCeo Ges mCes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0182] Embodiment 47. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Geo mCes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0183] Embodiment 48. A compound consisting of a modified oligonucleotide according to the following formula: Aes mCeo Aeo mCeo mCes Tds Tds mCds Ads mCds Tds Gds Gds Tds mCds mCeo Aeo Teo Tes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0184] Embodiment 49. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCeo Aes mCe, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0185] Embodiment 50. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tes mCds mCds mCds Ads Ads Tds Tds Ads mCeo Aeo mCeo mCes Aes mCe, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0186] Embodiment 51. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Aes mCeo Aeo mCeo mCes Aes mCe, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0187] Embodiment 52. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aeo Tes mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCes Aes mCe, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0188] Embodiment 53. A compound consisting of a modified oligonucleotide according to the following formula: Ges Teo mCeo Geo mCes mCds mCds Tds Tds mCds Ads Gds mCds Ads mCds Geo mCeo Aeo mCes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0189] Embodiment 54. A compound consisting of a modified oligonucleotide according to the following formula: Tes mCeo Geo mCeo mCes mCds Tds Tds mCds Ads Gds mCds Ads mCds Gds mCeo Aeo mCeo Aes mCe, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0190] Embodiment 55. A compound consisting of a modified oligonucleotide according to the following formula: Ges Aes Aes Aes Tes Tds Gds Ads Tds Gds Ads Tds Gds mCds mCds mCes Tes Ges mCes Ae, where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d=2'-deoxyribose sugar, and s = phosphorothioate internucleoside linkage.

[0191] Embodiment 56. A composition comprising a compound according to any one of the preceding embodiments or a salt thereof and at least one pharmaceutically acceptable carrier or diluent.

[0192] Embodiment 57 A method comprising administering to an animal a compound or composition according to any one of the preceding embodiments.

[0193] Embodiment 58 The method of embodiment 57, wherein the animal is a human.

[0194] Embodiment 59. The method of embodiment 57, wherein administration of the compound prevents, treats, ameliorates, or slows the progression of an SOD-1-associated disease.

[0195] Embodiment 60. The method of embodiment 59, wherein the SOD-1-related disease is a neurodegenerative disease.

[0196] Embodiment 61. The method of embodiment 60, wherein the SOD-1-related disease is ALS.

[0197] Embodiment 62 Use of a compound or composition according to any one of the preceding embodiments for the manufacture of a medicament for the treatment of a neurodegenerative disorder.

[0198] Embodiment 63 Use of a compound or composition according to any one of the preceding embodiments for the manufacture of a medicament for the treatment of ALS.

[0199] Embodiment 64. The compound or composition of any one of the preceding embodiments, wherein the modified oligonucleotide does not have the nucleobase sequence of SEQ ID NO: 21.

[0200] Embodiment 65. The compound or composition of any one of the preceding embodiments, wherein the modified oligonucleotide does not have the nucleobase sequence of any of SEQ ID NOs: 21-118.

[0201] Embodiment 66. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of 12 to 30 linked nucleosides and comprising a stretch of at least 12 consecutive nucleobases complementary to an equal number of nucleobases among nucleotides 665 to 684 of SEQ ID NO: 1, wherein the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

[0202] Embodiment 67. The compound of embodiment 66, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO:1.

[0203] Embodiment 68. The compound of embodiment 66, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

[0204] Embodiment 69. The compound of any one of embodiments 66-68, wherein at least one internucleoside linkage is a modified internucleoside linkage.

[0205] Embodiment 70 The compound of embodiment 69, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0206] Embodiment 71 The compound of embodiment 70, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0207] Embodiment 72. The compound of embodiments 66-69, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

[0208] Embodiment 73. The compound according to embodiments 66-71 and 72-73, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

[0209] Embodiment 74. The compound of embodiments 66-73, wherein at least one nucleoside comprises a modified nucleobase.

[0210] Embodiment 75. The nucleic acid of embodiment 74, wherein the modified nucleobase is 5-methylcytosine. compound.

[0211] Embodiment 76. The compound of any one of embodiments 66-75, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

[0212] Embodiment 77 The compound of embodiment 76, wherein the at least one modified sugar is a bicyclic sugar.

[0213] Embodiment 78. The bicyclic sugar is a 4'-CH(R)-O-2' bridge, wherein R is independently H, C1-C 12 78. The compound of embodiment 77, comprising a substituted or unsubstituted alkyl, or protecting group.

[0214] Embodiment 79. A compound according to embodiment 78, wherein R is methyl.

[0215] Embodiment 80. A compound according to embodiment 78, wherein R is H.

[0216] Embodiment 81 The compound of embodiment 76, wherein the at least one modified sugar comprises a 2'-O-methoxyethyl group.

[0217] Antisense Compounds Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, modified oligonucleotides, and siRNA. Oligomeric compounds can be "antisense" to a target nucleic acid, which means that the oligomeric compound can undergo hybridization to a target nucleic acid through hydrogen bonding.

[0218] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5'→3' direction, comprises the reverse complement of a target segment of a target nucleic acid to which the antisense compound is targeted. In certain such embodiments, an oligonucleotide has a nucleobase sequence that, when written in the 5'→3' direction, comprises the reverse complement of a target segment of a target nucleic acid to which the oligonucleotide is targeted.

[0219] In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 12 to 30 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 12 to 25 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 12 to 22 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 14 to 20 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 15 to 25 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 18 to 22 subunits in length. In certain embodiments, antisense compounds targeting SOD-1 nucleic acids are 19 to 21 subunits in length. In certain embodiments, the antisense compounds have a length of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 linked subunits.

[0220] In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 12 subunits in length. Antisense compounds targeted to SOD-1 nucleic acids are 13 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 14 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 15 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 16 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 17 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 18 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 19 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 20 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 21 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 22 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 23 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 24 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 25 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 26 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 27 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 28 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 29 subunits in length. In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids are 30 subunits in length.In certain embodiments, the antisense compound targeted to an SOD-1 nucleic acid has a length of 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or in a range defined by any two of the foregoing values. In certain embodiments, the antisense compound is a modified oligonucleotide and the linked subunits are nucleosides.

[0221] In certain embodiments, oligonucleotides targeting SOD-1 nucleic acids may be truncated or truncated. For example, one subunit may be deleted from the 5' end (5' truncation) or the 3' end (3' truncation). In truncated or truncated antisense compounds targeting SOD-1 nucleic acids, two subunits may be deleted from the 5' end of the antisense compound, or two subunits may be deleted from the 3' end of the antisense compound. Alternatively, the deleted nucleosides may be scattered throughout the antisense compound, for example, an antisense compound may have one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.

[0222] When one additional subunit is present in an extended antisense compound, the additional subunit can be at the 5'-end or the 3'-end of the antisense compound. When two or more additional subunits are present, the additional subunits can be adjacent to one another, e.g., two subunits can be added to the 5'-end (5'-addition) or the 3'-end (3'-addition) of an antisense compound. Alternatively, the additional subunits can be interspersed throughout the antisense compound, e.g., one subunit can be added to the 5'-end and one subunit can be added to the 3'-end of an antisense compound.

[0223] The length of antisense compounds, such as modified oligonucleotides, can be increased or decreased, and / or mismatched bases can be introduced, without eliminating activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length in an oocyte injection model for their ability to induce cleavage of target RNA. 25 nucleobase-long oligonucleotides with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to direct specific cleavage of target mRNA, although not as effectively as oligonucleotides containing no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase antisense oligonucleotides (including those with one or three mismatches).

[0224] Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide showed potent antitumor activity in vivo.

[0225] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 nucleobase and 42 nucleobase oligonucleotides composed of two or three of the tandem oligonucleotide sequences, in a rabbit reticulocyte assay for their ability to terminate translation of human DHFR. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lower degree than either the 28 nucleobase or 42 nucleobase oligonucleotides.

[0226] Antisense compound motif In certain embodiments, antisense compounds targeted to SOD-1 nucleic acids have chemically modified subunits arranged in a pattern or motif that confers properties to the antisense compounds, such as high inhibitory activity, high binding affinity for the target nucleic acid, or resistance to degradation by in vivo nucleases.

[0227] Chimeric antisense compounds typically contain at least one region modified to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of the chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0228] Antisense compounds with gapmer motifs are considered chimeric antisense compounds. In gapmers, an inner region with multiple nucleotides that support RNase H cleavage is located between outer regions with multiple nucleotides that are chemically different from the nucleosides of the inner region. In oligonucleotides with gapmer motifs, the gap segment generally serves as a substrate for endonuclease cleavage, while the wing segments contain modified nucleosides. In certain embodiments, the regions of gapmers are distinguished by the type of sugar moiety that makes up each distinct region. The types of sugar moieties used to distinguish the regions of a gapmer can, in some embodiments, include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include 2'-MOE and 2'-O-CH, among others), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides can include those having a 4'-(CH)O-2' bridge (where n=1 or n=2) and a 4'-CH-O-CH-2'). In certain embodiments, the wings can include several modified sugar moieties, including, for example, 2'-MOE. In certain embodiments, the wings can include several modified and unmodified sugar moieties. In certain embodiments, the wings can include various combinations of 2'-MOE nucleosides and 2'-deoxynucleosides.

[0229] The different regions may each contain uniform sugar moieties, different sugar moieties, or alternating sugar moieties. The wing-gap-wing motif is often described as "XYZ," where "X" represents the length of the 5'-wing, "Y" represents the length of the gap, and "Z" represents the length of the 3'-wing. "X" and "Z" may contain uniform sugar moieties, different sugar moieties, or alternating sugar moieties. In certain embodiments, "X" and "Y" may contain one or more 2'-deoxynucleosides. "Y" may contain a 2'-deoxynucleoside. A gapmer, described herein as "XYZ," has a configuration in which the gap is positioned immediately adjacent to each of the 5'-wing and 3'-wing. Thus, there are no intervening nucleotides between the 5'-wing and the gap, or between the gap and the 3'-wing. Any of the antisense compounds described herein may contain a gapmer motif. In certain embodiments, "X" and "Z" are the same, and in other embodiments, "X" and "Z" are different.

[0230] In certain embodiments, gapmers provided herein include 20-mers, for example, having a 5-10-5 motif.

[0231] In certain embodiments, gapmers provided herein include 19-mers, eg, having a 5-9-5 motif.

[0232] In certain embodiments, gapmers provided herein include 18-mers, for example, having a 5-8-5 motif.

[0233] In certain embodiments, gapmers provided herein include 18-mers, for example, with a 4-8-5 motif.

[0234] In certain embodiments, gapmers provided herein include 18-mers, for example, having a 5-8-7 motif.

[0235] In certain embodiments, gapmers provided herein include 18-mers, for example, having a 6-8-6 motif.

[0236] In certain embodiments, gapmers provided herein include 18-mers, for example, having a 6-8-5 motif.

[0237] In certain embodiments, the modified oligonucleotide contains at least one 2'-O-methoxyethyl modified nucleoside, at least one cEt modified nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the modified oligonucleotide has any of the following sugar chemical motifs: ekddddddddekekee kekeddddddddekek eeeedddddddddkkee eeeeddddddddekeke eeeeddddddddkekee eeeeddddddddkkeee eeeeeddddddddkkee eeeekddddddddkeee eeeekdddddddkeeee eeekddddddddkeeee eeekkdddddddkkeee eekkdddddddddkkee eekkddddddddeeeee eekkddddddddkkeee ekekddddddddeeeee ekekddddddddkekee kekeddddddddeeeee where: e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar.

[0238] Target nucleic acids, target regions and nucleotide sequences Nucleotide sequences encoding SOD-1 include, but are not limited to, GENBANK Accession No. NM_000454.4 (incorporated herein as SEQ ID NO:1), GENBANK Accession No. NT_011512.10 truncated from nucleotide 18693000 to nucleotide 18704000 (incorporated herein as SEQ ID NO:2), and the complement of GENBANK Accession No. NW_001114168.1 truncated from nucleotide 2258000 to nucleotide 2271000 (incorporated herein as SEQ ID NO:3).

[0239] It is understood that the sequences shown in each SEQ ID NO in the examples provided herein are independent of any modifications to the sugar moiety, internucleoside linkage, or nucleobase. Thus, antisense compounds defined by SEQ ID NO can independently contain one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase. Antisense compounds described by Isis number (Isis No) represent combinations of nucleobase sequences and motifs.

[0240] In certain embodiments, the target region is a structurally defined region of the target nucleic acid. For example, the target region can include 3'UTR, 5'UTR, exon, intron, exon / intron junction, coding region, translation initiation region, translation termination region, or other distinct nucleic acid region. In the case of SOD-1, the structurally defined region can be obtained from a sequence database such as NCBI by accession number, and such information is incorporated herein by reference. In certain embodiments, the target region can include the sequence from the 5' target site of one target segment within the target region to the 3' target site of another target segment within the target region.

[0241] Targeting comprises determining at least one target segment that antisense compound hybridizes to produce desired effect.In certain embodiments, said desired effect is the reduction of mRNA target nucleic acid level.In certain embodiments, said desired effect is the reduction of the protein level that target nucleic acid encodes or the reduction of the phenotypic changes associated with target nucleic acid.

[0242] A target region may contain one or more target segments. Multiple target segments within a target region may overlap. Alternatively, multiple target segments may not overlap. In certain embodiments, target segments within a target region are about 3. In certain embodiments, target segments within a target region are separated by 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or by approximately, or less than, or about, or less than, or a range defined by any two of the aforementioned values. In certain embodiments, target segments within a target region are separated by 5 or less, or about 5 or less nucleotides on the target nucleic acid. In certain embodiments, the target segments are contiguous. Target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein are contemplated.

[0243] Suitable target segments can be found in any of the 5'UTR, coding region, 3'UTR, intron, exon, or exon / intron junction.The target segment containing the start codon or stop codon is also suitable target segment.Suitable target segments can specifically exclude certain structurally distinct regions such as the start codon or stop codon.

[0244] The determination of suitable target segment can include comparing target nucleic acid sequence with other sequences in genome.For example, BLAST algorithm can be used to identify similar regions among various nucleic acids.This comparison can prevent the selection of antisense compound sequence that can nonspecifically hybridize with sequences other than the selected target nucleic acid (i.e., non-target sequence or off-target sequence).

[0245] Variation in the activity of antisense compounds (e.g., as defined by percent reduction in target nucleic acid levels) may occur within an active target region. In certain embodiments, a reduction in SOD-1 mRNA levels indicates inhibition of SOD-1 protein expression. A reduction in SOD-1 protein levels also indicates inhibition of target mRNA expression. A phenotypic change indicates inhibition of SOD-1 expression. An improvement in neurological function indicates inhibition of SOD-1 expression. An improvement in motor function indicates inhibition of SOD-1 expression.

[0246] Hybridization In some embodiments, hybridization occurs between the antisense compounds disclosed herein and SOD-1 nucleic acids. The most common hybridization mechanism involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[0247] Hybridization can occur under a variety of conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0248] Methods for determining whether a sequence is capable of specifically hybridizing to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are capable of specifically hybridizing to an SOD-1 nucleic acid.

[0249] Complementarity An antisense compound and a target nucleic acid are complementary to one another when a sufficient number of the nucleobases of the antisense compound are capable of hydrogen bonding with corresponding nucleobases of the target nucleic acid in a manner that produces the desired effect (e.g., antisense inhibition of the target nucleic acid, such as an SOD-1 nucleic acid).

[0250] Non-complementary nucleobases between an antisense compound and an SOD-1 nucleic acid may be present in the antisense This is acceptable as long as the compound is still able to specifically hybridize to the target nucleic acid. Additionally, antisense compounds may hybridize across one or more segments of an SOD-1 nucleic acid in a manner such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).

[0251] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary or at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to an SOD-1 nucleic acid, target region, target segment, or specified portion thereof. The percent complementarity between an antisense compound and a target nucleic acid can be determined using routine methods.

[0252] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to the target region and therefore will specifically hybridize would correspond to 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases, and need not be contiguous with each other or with complementary nucleobases. Thus, an 18-nucleobase-long antisense compound having four non-complementary nucleobases flanked by two regions that are completely complementary to the target nucleic acid would have a total complementarity of 77.8% to the target nucleic acid and would therefore be within the scope of the present invention. The percent complementarity of an antisense compound to a region of a target nucleic acid can be determined using BLAST (basic local alignment search tool) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403) known in the art. 410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Percent homology, percent sequence identity, or percent sequence complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489) using default settings.

[0253] In certain embodiments, the antisense compounds provided herein, or designated portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid or designated portion thereof. For example, an antisense compound can be fully complementary to an SOD-1 nucleic acid, or a target region, segment, or sequence thereof. As used herein, "fully complementary" means that each nucleobase of an antisense compound has the ability to precisely base pair with a corresponding nucleobase of a target nucleic acid. For example, a 20-nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases in length if a corresponding 20-nucleobase portion that is fully complementary to the antisense compound is present in the target nucleic acid. The term "fully complementary" can also be used in reference to designated portions of a first nucleic acid and / or a second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases in length. A 20 nucleobase portion of a 30 nucleobase oligonucleotide is perfectly complementary to a target sequence if the target sequence has a corresponding 20 nucleobase portion (each nucleobase being complementary to the 20 nucleobase portion of the antisense compound). At the same time, the entire 30 nucleobase antisense compound is complementary to the target sequence if the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence. It may or may not be perfectly complementary to the target sequence, depending on whether it is complementary to the target sequence.

[0254] The position of the non-complementary nucleobase may be at the 5'-end or 3'-end of the antisense compound. Alternatively, one or more non-complementary nucleobases may be located at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or discontinuous. In one embodiment, the non-complementary nucleobase is located within the wing segment of a gapmer oligonucleotide.

[0255] In certain embodiments, antisense compounds that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length or at most 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase with respect to a target nucleic acid, such as an SOD-1 nucleic acid, or specified portion thereof.

[0256] In certain embodiments, antisense compounds that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length or at most 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase with respect to a target nucleic acid, such as an SOD-1 nucleic acid, or specified portion thereof.

[0257] The antisense compounds provided herein also include those that are complementary to a portion of a target nucleic acid. As used herein, a "portion" refers to a predetermined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a predetermined number of contiguous nucleobases of an antisense compound. In certain embodiments, an antisense compound is complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 15 nucleobase portion of a target segment. Antisense compounds complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portion of a target segment, or a range defined by any two of these values, are also contemplated.

[0258] identity The antisense compounds provided herein can also have a certain percent identity with a compound represented by a specific nucleotide sequence, SEQ ID NO: or specific ISIS number, or a portion thereof.In this specification, an antisense compound is identical to the sequence disclosed herein if it has the same nucleic acid base pairing ability.For example, since both uracil and thymidine pair with adenine, RNA containing uracil instead of thymidine in the disclosed DNA sequence will be considered identical to the DNA sequence. The antisense compounds described herein are also contemplated as being truncated and extended, as well as compounds that have non-identical bases compared to the antisense compounds provided herein. The non-identical bases may be adjacent to each other or may be scattered throughout the antisense compound. The percent identity of an antisense compound is calculated according to the number of bases that have identical base pairings compared to the sequence to be compared.

[0259] In certain embodiments, the antisense compound or portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs or portions thereof disclosed herein.

[0260] In certain embodiments, a portion of the antisense compound is compared with the same length portion of the target nucleic acid.In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portion is compared with the same length portion of the target nucleic acid.

[0261] In certain embodiments, a portion of the oligonucleotide is compared with a portion of the target nucleic acid that has the same length. In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portions are compared with a portion of the target nucleic acid that has the same length.

[0262] qualification A nucleoside is a base-sugar combination. The nucleobase (also called base) portion of a nucleoside is usually a heterocyclic base moiety. A nucleotide is a nucleoside that further includes a phosphate group covalently linked to the sugar portion of the nucleoside. In the case of nucleosides containing a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed by covalently linking adjacent nucleosides to each other to form a linear polymer, the oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0263] Modifications of antisense compounds include substitutions or alterations of internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over natural forms because of desirable properties such as enhanced cellular uptake, higher affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

[0264] Chemically modified nucleosides can also be used to increase the binding affinity of shortened or truncated oligonucleotides for their target nucleic acids, and as a result, comparable results can often be obtained with shorter antisense compounds having such chemically modified nucleosides.

[0265] Modified internucleoside linkages The naturally occurring internucleoside linkage in RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified (i.e., non-naturally occurring) internucleoside linkages are often chosen over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as enhanced cellular uptake, higher affinity for nucleic acid targets, and increased stability in the presence of nucleases.

[0266] Oligonucleotides with modified internucleoside linkages contain nucleoside groups in which the phosphorus atom is retained. These include internucleoside linkages and internucleoside linkages that do not contain a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0267] In certain embodiments, the modified oligonucleotide targeting SOD-1 nucleic acid comprises one or more modified internucleoside linkages.In certain embodiments, the modified internucleoside linkages are scattered throughout the antisense compound.In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages.In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0268] In certain embodiments, modified oligonucleotides targeted to SOD-1 nucleic acids contain one or more phosphodiester internucleoside linkages. In certain embodiments, modified oligonucleotides targeted to SOD-1 nucleic acids contain at least one phosphorothioate internucleoside linkage and at least one phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the following hybrid backbone motif: sosssssssssoooss, sooossssssssoss, sooosssssssssoss, soossssssssssooss, sooossssssssooss, sooossssssssssooss, sooosssssssssssooss, sooossssssssssssooos, soooosssssssssssooss, sooosssssssssssssooss, sososssssssssssssosos, and sooosssssssssssoooss, where: s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0269] modified sugar moiety Antisense compounds of the present invention can optionally contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides may confer superior nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include the addition of substituents (5'-substituents, 2'-substituents, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs)), replacement of a ribosyl ring oxygen atom with S, N(R), or C(R1)(R2), where R, R1, and R2 are each independently H, C1-C2, or CI-C1. 12 Examples of chemically modified sugars include, but are not limited to, 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO2008 / 101157, published August 21, 2008, for other 5',2'-bis substituted nucleosides disclosed), or substitution of the ribosyl ring oxygen atom with S and further substitution at the 2' position (see U.S. Patent Application Publication US2005-0130923, published June 16, 2005), or alternatively 5'-substitution of BNAs (wherein LNAs are substituted with, for example, a 5'-methyl group or is substituted with a 5'-vinyl group, see PCT International Application WO2007 / 134181 (published November 22, 2007).

[0270] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH, 2'-OCHCH, 2'-OCHCHF, and 2'-O(CH)OCH substituents. The 2'-position substituent can be allyl, amino, azido, thio, O-allyl, O-C1-C2 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R l )-(CH2)2-N(R m )(R n ) can also be selected, in which case each R l , R m and R n are independently H or substituted or unsubstituted C1-C 10 It is alkyl.

[0271] As used herein, the term "bicyclic nucleoside" refers to a modified nucleoside containing a bicyclic sugar moiety. Examples of bicyclic nucleosides (BNAs) include, but are not limited to, nucleosides containing a bridge between the 4'-ribosyl ring atom and the 2'-ribosyl ring atom. In certain embodiments, the antisense compounds provided herein contain one or more BNA nucleosides, where the bridge comprises one of the following formulas: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' and 4'-CH(CHOCH3)-O-2' (and analogs thereof; see U.S. Patent No. 7,399,845, issued July 15, 2008); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; See PCT / US2008 / 068922, published as WO / 2009 / 006478 on January 8, 2009; 4'-CH2-N(OCH3)-2' (and analogs thereof; see PCT / US2008 / 064591, published as WO / 2008 / 150729 on December 11, 2008); 4'-CH2-ON(CH3)-2' (see U.S. Patent Application Publication US2004-0171570, published September 2, 2004); 4'-CH2-N(R)-O-2' (where R is H, C1-C 12 alkyl, or a protecting group) (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see PCT / US2008 / 066154, published Dec. 8, 2008 as WO2008 / 154401).

[0272] Additional bicyclic nucleosides have been reported in the published literature (e.g., Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Singh et al. al.,Chem.Commun.,1998,4,455-456;Koshkin et al., Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al. al.,J.Org.Chem.,1998,63,10035-10039;US Patent No. 7,399,845;US Patent No. 7,053,207;US Patent No. 7,0 No. 34,133; No. 6,794,499; No. 6,770,748; No. 6,670,461; No. 6,525,191; No. 6,268,490 No.; U.S. Patent Publication Nos. US2008-0039618; US2007-0287831; US2004-0171570; U.S. Patent Application Nos. 12 / 129,154; 61 / 099,844; 61 / 097,787; 61 / 086,231; 61 / 056,564; 61 / 026,998; 61 / 026,995 (See PCT International Application Nos. PCT / US2008 / 068922; PCT / US2008 / 066154; and PCT / US2008 / 064591.) Each of the bicyclic nucleosides described above can be prepared with one or more stereochemical sugar configurations, such as, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published March 25, 1999 as WO99 / 14226).

[0273] As used herein, a "monocyclic nucleoside" refers to a nucleoside that includes a modified sugar moiety that is not a bicyclic sugar moiety. In certain embodiments, the sugar moiety or sugar moiety analog of the nucleoside may be modified or substituted at any position.

[0274] As used herein, a "4'-2' bicyclic nucleoside" or "4'→2' bicyclic nucleoside" refers to a bicyclic nucleoside that includes a furanose ring that contains a bridge connecting two carbon atoms of the furanose ring, said bridge connecting the 2' and 4' carbon atoms of the sugar ring.

[0275] In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside includes, but is not limited to, compounds having at least one bridge between the 4' and 2' carbon atoms of the pentofuranosyl sugar moiety, including, but not limited to, a bridge such as -[C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(Ra )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, where x is 0, 1, or 2, n is 1, 2, 3, or 4, and each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl or a protecting group.

[0276] In certain embodiments, the bridge of the bicyclic sugar moiety is —[C(R a )(R b )] n-, -[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R b In certain embodiments, the bridges are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2'-, where each R is, independently of the others, H, a protecting group, or a C1-C 12 It is alkyl.

[0277] In certain embodiments, the bicyclic nucleosides are further defined by their isomeric configuration. For example, nucleosides containing a 4'-(CH2)-O-2' bridge may be in the α-L or β-D configuration. Previously, α-L-methyleneoxy (4'-CH2-O-2') BNAs have been incorporated into antisense oligonucleotides, which have demonstrated antisense activity (Frieden et al. al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0278] In certain embodiments, bicyclic nucleosides include those having a 4'→2' bridge, including, but not limited to, α-L-4'-(CH2)-O-2', β-D-4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', 4'-CH2-N(R)-O-2', 4'-CH(CH3)-O-2', 4'-CH2-S-2', 4'-CH2-N(R)-2', 4'-CH2-CH(CH3)-2', and 4'-(CH2)3-2', where R is H, a protecting group, or a C1-C 12 It is alkyl.

[0279] In certain embodiments, the bicyclic nucleoside has the formula

[0280] [ka]

[0281] [In the formula, Bx is a heterocyclic base moiety; -Q a -Q b -Q c - is -CH2-N(R c )-CH2-, -C(=O)-N(R c )-CH2-, -CH2-ON(R c )-, -CH2-N(R c )-O- or -N(R c )-O-CH2, R c is C1~C 12 an alkyl protecting group or an amino protecting group, and T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium.

[0282] In certain embodiments, the bicyclic nucleoside has the formula

[0283] [ka]

[0284] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium; Z a is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

[0285] In one embodiment, each substituent is independently selected from halogen, oxo, hydroxyl, OJ c , N.J. c J d , S.J. c , N3, OC(=X)J c , and N.J. e C(=X)NJ c J d wherein each J is mono- or polysubstituted with substituents independently selected from c , J d and J e are independently H, C1-C6 alkyl, or substituted C1-C6 alkyl, and X is O or NJ c is.

[0286] In certain embodiments, the bicyclic nucleoside has the formula

[0287] [ka]

[0288] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium; Z b is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, or substituted acyl (C(=O)-).

[0289] In certain embodiments, the bicyclic nucleoside has the formula

[0290] [ka]

[0291] and During the ceremony, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium; R d is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, each q a , q b , q c and q d are independently H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkynyl, hydroxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl.

[0292] In certain embodiments, the bicyclic nucleoside has the formula

[0293] [ka]

[0294] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium; q a , q b、 q e and q f are each independently hydrogen, halogen, C1 to C 12 Alkyl, substituted C1-C 12Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j , S.J. j , SOJ j , SO2J j , N.J. j J k , N3, CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , OC(=O)NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k Or Or, q e and q f together =C(q g )(q h ) and q g and q h are each independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl].

[0295] The synthesis and preparation of bicyclic nucleosides of adenine, cytosine, guanine, 5-methylcytosine, thymine, and uracil with a 4'-CH2-O-2' bridge have been described, along with their oligomerization and nucleic acid recognition properties (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98 / 39352 and WO 99 / 14226.

[0296] Various bicyclic nucleoside analogs with 4'→2' bridging groups, such as 4'-CH2-O-2' and 4'-CH2-S-2', have been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of oligodeoxyribonucleotide duplexes containing bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99 / 14226). Furthermore, the synthesis of 2'-amino-BNAs, novel conformationally restricted, high-affinity oligonucleotide analogs, has also been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Moreover, 2'-amino- and 2'-methylamino-BNAs have also been prepared, and the thermal stability of duplexes formed with these and complementary RNA and DNA strands has been reported.

[0297] In certain embodiments, the bicyclic nucleoside has the formula

[0298] [ka]

[0299] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support medium; each q i , q j , q k and q l are independently H, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C1-C 12 Alkoxyl, substituted C1-C12 Alkoxyl, OJ j , S.J. j , SOJ j , SO2J j , N.J. j J k , N3, CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , OC(=O)NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k and q i and q j or q l and q k together =C(q g )(q h ), where q g and q h are each independently H, halogen, C1-C 12 Alkyl or substituted C1-C 12 alkyl].

[0300] One carbocyclic bicyclic nucleoside with a 4'-(CH2)3-2' bridge and an alkenyl analog bridge 4'-CH=CH-CH2-2' has been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides have also been described, along with their oligomerization and biochemical studies (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0301] In certain embodiments, bicyclic nucleosides include those illustrated below: (A) α-L-methyleneoxy (4'-CH2-O-2') BNA, (B) β-D-methyleneoxy (4'-CH2-O-2') BNA, (C) ethyleneoxy (4'-(CH2)2-O-2') BNA, (D) aminooxy (4'-CH2-ON(R)-2') BNA, (E) oxyamino (4'-CH2-N(R)-O-2') BNA, (F) methyl (methyl) (R) methylene-amino (4'-CH-N(R)-2') BNAs, (I) methyl carbocyclic (4'-CH-CH(CH)-2') BNAs, (J) propylene carbocyclic (4'-(CH)-2') BNAs, and (K) vinyl BNAs.

[0302] [ka]

[0303] wherein Bx is a base moiety and R is independently H, a protecting group, C1-C6 alkyl, or C1-C6 alkoxy.

[0304] As used herein, the term "modified tetrahydropyran nucleoside" or "modified THP nucleoside" refers to a nucleoside in which the pentofuranosyl residue in a normal nucleoside is replaced with a six-membered tetrahydropyran "sugar," which may also be referred to as a sugar surrogate. Modified THP nucleosides include, but are not limited to, those referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), or fluoro-HNA (F-HNA), which have the tetrahydropyran ring system illustrated below.

[0305] [ka]

[0306] In certain embodiments, the formula

[0307] [ka]

[0308] [In the formula, Bx is a heterocyclic base moiety; T3 and T4 are each independently an internucleoside linking group linking a tetrahydropyran nucleoside analog to an oligomeric compound, or one of T3 and T4 is an internucleoside linking group linking a tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugated group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and one of R1 and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, where X is O, S or NJ1, and each J1, J2 and J3 independently is H or C1-C6 alkyl.

[0309] In certain embodiments, q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is fluoro and R2 is H, R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.

[0310] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligomeric compounds have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patent Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used herein, the term "morpholino" refers to a group having the following formula:

[0311] [ka]

[0312] means a sugar substitute having the formula:

[0313] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0314] Combinations of modifications are also provided, including, but not limited to, 2'-F-5'-methyl substituted nucleosides (see PCT International Application No. WO2008 / 101157, published August 21, 2008, for other 5',2'-bis substituted nucleosides disclosed), and substitution of the ribosyl ring oxygen atom with S and further substitution at the 2' position (see U.S. Patent Application Publication No. US2005-0130923, published June 16, 2005), or 5'-substitution of bicyclic nucleic acids (see PCT International Application No. WO2007 / 134181, published November 22, 2007, in which the 5' position of a 4'-CH2-O-2' bicyclic nucleoside is further substituted with a 5'-methyl or 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides have also been described, along with their oligomerization and biochemical studies (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0315] In certain embodiments, the antisense compounds comprise one or more modified cyclohexenyl nucleosides, which are nucleosides having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to, those described in the art (e.g., commonly assigned PCT Application Publication WO 2010 / 036696, published April 10, 2010; Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids, Research,2005,33(8),2452-2463;Robeyns et al.,Acta Crystallographica,Section F:Structural Biology and Crystallization Communications,2005,F61(6),585-586;Gu et al.,Tetrahedron,2004,60(9),2111-2123;Gu et al.,Oligonucleotides,2003,13(6),479-489;Wang et al. al.,J.Org.Chem.,2003,68,4499-4505;Verbeure et al.,Nucleic Acids Research,2001,29(24),4941-4947;Wang et al.,J.Org.Chem.,2001,66,8478-82;Wang et al. al.,Nucleosides,Nucleotides&Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; PCT Publication WO 06 / 047842; and PCT Publication WO 01 / 049687, the text of each of which is incorporated herein by reference in its entirety.) Certain modified cyclohexenyl nucleosides have the formula X:

[0316] [ka]

[0317] wherein, for each of said at least one cyclohexenyl nucleoside analog of Formula X, independently: Bx is a heterocyclic base moiety; T3 and T4 are each independently an internucleoside linking group that links a cyclohexenyl nucleoside analog to the antisense compound, or one of T3 and T4 is an internucleoside linking group that links a tetrahydropyran nucleoside analog to the antisense compound, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group; and q1, q2, q3, q4, q5, q6, q7, q8 and q9 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent].

[0318] Many other monocyclic, bicyclic, and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into the oligomeric compounds provided herein (see, e.g., review: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can be further substituted with a variety of additional substituents to further enhance activity.

[0319] As used herein, "2'-modified sugar" refers to a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include halides, such as, but not limited to, substituents selected from substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted aryl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modification includes, but is not limited to, O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n F, O(CH2) n ONH2, OCH2C(=O)N(H)CH 3、 and O(CH2) n ON[(CH2) n CH3]2, and the like, where n and m are from 1 to about 10. Other 2'-substituents are selected from C1 to C 12The nucleoside may also be selected from alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, poly-alkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic or pharmacodynamic properties of antisense compounds, and other substituents with similar properties. In certain embodiments, the modified nucleoside comprises a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitutions have been described as having improved binding affinity compared to unmodified nucleosides and other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides with 2'-MOE substituents have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0320] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside containing a sugar containing a substituent other than H or OH at the 2' position. 2'-modified nucleosides include bicyclic nucleosides in which a bridge connecting two carbon atoms of the sugar ring connects the 2' carbon to another carbon of the sugar ring, as well as nucleosides containing non-bridging 2' substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C2 10 Alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(R m )(R n), or O-CH2-C(=O)-N(R m )(R n )[where each R m and R n are independently H or substituted or unsubstituted C1-C 10 2'-modified nucleosides may further comprise other modifications, for example, at other positions on the sugar and / or at the nucleobase.

[0321] As used herein, "2'-F" refers to a nucleoside containing a sugar that contains a fluoro group at the 2' position of the sugar ring.

[0322] "2'-OMe" or "2'-OCH3," "2'-O-methyl," or "2'-methoxy" each refer to a nucleoside containing a sugar containing an -OCH3 group at the 2' position of the sugar ring.

[0323] As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-O-methoxyethyl" each refers to a nucleoside containing a sugar containing a -OCH2CH2OCH3 group at the 2' position of the sugar ring.

[0324] Methods for preparing modified sugars are well known to those of skill in the art. Representative U.S. patents that teach the preparation of such modified sugars include, but are not limited to, U.S. Pat. Nos. 4,981,957, 5,118,800, 5,319,080, 5,359,044, 5,393,878, 5,446,137, 5,466,786, 5,514,785, 5,519,134, 5,567,811, 5,576,427, 5,591,722, 5,597,909, 5,610,3 00, 5,627,053, 5,639,873, 5,646,265, 5,670,633, 5,700,920, 5,792,847 and 6,600,032, and International Application PCT / US2005 / 019219 (filed June 2, 2005), published as WO2005 / 121371 on December 22, 2005, each of which is incorporated herein by reference in its entirety.

[0325] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the nucleosides are modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0326] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0327] In certain embodiments, the antisense compound comprises one or more nucleosides having a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-O-2') bridging group. In certain embodiments, the (4'-CH(CH3)-O-2') modified nucleosides are arranged throughout the wings of the gapmer motif.

[0328] Compositions and methods for formulating pharmaceutical compositions The oligonucleotides may be mixed with pharmacologically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method of formulating the pharmaceutical composition depend on several criteria, including but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.

[0329] Antisense compounds targeted to SOD-1 nucleic acids can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmacologically acceptable diluent or carrier. Pharmacologically acceptable diluents include phosphate buffered saline (PBS). PBS is a suitable diluent for use in parenterally delivered compositions. Thus, in one embodiment, a pharmaceutical composition comprising an antisense compound targeted to SOD-1 nucleic acids and a pharmacologically acceptable diluent is used in the methods described herein. In certain embodiments, the pharmacologically acceptable diluent is PBS. In certain embodiments, wherein the antisense compound is a modified oligonucleotide.

[0330] Pharmaceutical compositions containing antisense compounds include any pharmacologically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that can (directly or indirectly) yield biologically active metabolites or residues thereof when administered to animals, including humans. Thus, for example, the present disclosure also relates to pharmacologically acceptable salts of antisense compounds, prodrugs, pharmacologically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmacologically acceptable salts include, but are not limited to, sodium and potassium salts.

[0331] Prodrugs may involve the incorporation of additional nucleosides at one or both ends of the antisense compound, which are cleaved by endogenous nucleases in the body to form the active antisense compound.

[0332] Conjugated antisense compounds Antisense compounds can be covalently linked with one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting oligonucleotide.Typical conjugate groups include cholesterol moieties and lipid moieties.Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes.

[0333] Antisense compounds can also be modified to enhance properties such as nuclease stability by incorporating one or more stabilizing groups, typically attached to one or both ends of the antisense compound. Stabilizing groups include cap structures. These terminal modifications protect antisense compounds with terminal nucleic acids from exonuclease degradation and may aid in intracellular delivery and / or localization. Caps can be present at the 5' end (5' cap) or 3' end (3' cap), or can be present at both ends. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Additional 3' and 5' stabilizing groups that can be used to cap one or both ends of an antisense compound to confer nuclease stability include those described in WO 03 / 004602 (published January 16, 2003).

[0334] Cell culture and antisense compound treatment The effect of antisense compounds on SOD-1 nucleic acid concentration, activity, or expression can be tested in vitro in a variety of cell types. Cell types used for such analyses are commercially available from commercial suppliers (e.g., American Type Culture Collection). Cells are available from various suppliers (e.g., Invitrogen Life Technologies, Carlsbad, CA) and are cultured using commercially available reagents according to the supplier's instructions (e.g., Invitrogen Life Technologies, Carlsbad, CA). Exemplary cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A431 cells, and SH-SY5Y cells.

[0335] In vitro testing of oligonucleotides Methods for treating cells with oligonucleotides are described herein, but these methods can be modified appropriately for treatment with other antisense compounds.

[0336] Cells can be treated with oligonucleotides when the cells reach approximately 60-80% confluence in culture.

[0337] One commonly used reagent for introducing oligonucleotides into cultured cells is the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of oligonucleotide and LIPOFECTIN concentrations, which can range from 2 to 12 μg / mL per 100 nM of oligonucleotide.

[0338] Another reagent used to deliver oligonucleotides to cultured cells is LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Oligonucleotides are mixed with LIPOFECTAMINE in OPTI-MEM1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired oligonucleotide concentration and LIPOFECTAMINE concentration, which can range from 2 to 12 μg / mL per 100 nM of oligonucleotide.

[0339] Another technique used to introduce oligonucleotides into cultured cells is electroporation.

[0340] Cells are treated with oligonucleotides by conventional methods. Cells can be harvested 16-24 hours after oligonucleotide treatment, at which time the RNA or protein levels of the target nucleic acid are measured by methods known in the art and described herein. Generally, when multiple replicate samples are treated, the data are expressed as the average of the replicate treatments.

[0341] The concentration of oligonucleotides used varies depending on the cell line. Methods for determining the optimal oligonucleotide concentration for a particular cell line are well known in the art. When transfecting with lipofectamine, oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM. When transfecting by electroporation, oligonucleotides are used at higher concentrations ranging from 625 nM to 20,000 nM.

[0342] RNA isolation RNA analysis can be performed on total cell RNA or poly(A)+mRNA.The method of isolating RNA is well known in the art.RNA is prepared by using the method well known in the art, for example, by using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocol.

[0343] Analysis of target levels or inhibition of expression The concentration or inhibition of expression of SOD-1 nucleic acid can be assayed by a variety of methods known in the art. For example, the concentration of target nucleic acid can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods for isolating RNA are well known in the art. Northern blot analysis is also a common method in the art. Quantitative real-time PCR can be conveniently achieved using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA, and used according to the manufacturer's instructions.

[0344] Quantitative real-time PCR analysis of target RNA levels Quantitation of target RNA levels was performed using the ABI PRISM 7600, 7700, or 7900 This can be achieved by quantitative real-time PCR using the Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Methods for quantitative real-time PCR are well known in the art.

[0345] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which generates complementary DNA (cDNA), which is then used as a substrate for real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are available from Invitrogen (Carlsbad, CA). The RT real-time PCR reaction is performed by methods known to those skilled in the art.

[0346] The amount of gene (or RNA) target obtained by real-time PCR is normalized using the expression level of a gene with constant expression, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real-time PCR simultaneously with the target, multiplexed, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). The method for quantifying RNA with RIBOGREEN is SOD-1 ght in Jones, LJ, et al. (Analytical Biochemistry, 1998, 265, 368-374). RIBOGREEN fluorescence is measured using a CYTOFLUOR4000 instrument (PE Applied Biosystems).

[0347] The probes and primers are designed to hybridize to SOD-1 nucleic acids. Methods for designing probes and primers for real-time PCR are well known in the art and can include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

[0348] Analysis of protein levels Antisense inhibition of SOD-1 nucleic acids can be assessed by measuring SOD-1 protein levels. SOD-1 protein levels can be assessed or quantified by various techniques well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (e.g., caspase activity assays), immunohistochemistry, immunocytochemistry, or fluorescence-activated cell sorting (FACS). Antibodies against targets can be identified and obtained from various sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared by conventional monoclonal or polyclonal antibody generation methods well known in the art. In certain embodiments, the compounds herein result in improved reduction of protein levels.

[0349] In vivo testing of antisense compounds Antisense compounds, e.g., modified oligonucleotides, are tested in animals to assess their ability to inhibit SOD-1 expression and produce phenotypic changes, such as improved motor function. In certain embodiments, motor function is measured in animals by gait initiation analysis, rotarod, grip strength, bar climbing, open field behavior, balance beam, and hind paw footprint tests. Testing can be performed in normal animals or experimental disease models. For administration to animals, oligonucleotides are formulated in a pharmacologically acceptable diluent, such as phosphate-buffered saline. Administration can be intraperitoneal, intravenous, or subcutaneous. Included are parenteral routes of administration such as intravenous administration. The dosage and frequency of administration of the oligonucleotide depend on several factors, including, but not limited to, the route of administration and the body weight of the animal. After a treatment period with the oligonucleotide, RNA is isolated from CNS tissue or CSF to measure changes in SOD-1 nucleic acid expression.

[0350] Certain Indications In certain embodiments, provided herein are methods, compounds, and compositions for treating an individual, comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk of developing a neurodegenerative disease, including but not limited to amyotrophic lateral sclerosis (ALS). In certain embodiments, the individual has been identified as having an SOD-1-associated disease. In certain embodiments, provided herein are methods for prophylactically reducing SOD-1 expression in an individual. Certain embodiments include treating an individual in need of treatment by administering to the individual a therapeutically effective amount of an antisense compound targeted to an SOD-1 nucleic acid.

[0351] In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to an SOD-1 nucleic acid is accompanied by monitoring SOD-1 levels in the individual to determine the individual's response to administration of the antisense compound, which can be used by a physician to determine the amount and duration of therapeutic intervention.

[0352] In certain embodiments, administration of an antisense compound targeted to an SOD-1 nucleic acid results in a reduction in SOD-1 expression of at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to an SOD-1 nucleic acid results in an improvement in motor function in an animal. In certain embodiments, administration of an SOD-1 antisense compound improves motor function by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or a range defined by any two of these values.

[0353] In certain embodiments, pharmaceutical compositions comprising antisense compounds targeted to SOD-1 are used in the preparation of medicaments for treating patients suffering from or susceptible to neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS).

[0354] Certain comparative compositions Antisense oligonucleotides targeting human SOD-1 have been described in previous publications (see WO 2005 / 040180, which is incorporated herein by reference in its entirety). The selection screen for new antisense compounds described herein utilizes throughout its entirety several oligonucleotides described in that publication (ISIS 333611, ISIS 146144, ISIS 146145, ISIS 150437, ISIS 150441, ISIS 150443, ISIS 150444, ISIS 150445, ISIS 150446, ISIS 150447, ISIS 150448, ISIS 150449, ISIS 150452, ISIS 150454, ISIS 150456, ISIS 150457, ISIS 150458, ISIS 150459, ISIS 150460, ISIS 150461, ISIS 150462, ISIS 150463, ISIS 150464, ISIS 150465, ISIS 150466, ISIS 150467, ISIS 150468, ISIS 150469 ...1, ISIS 150462, ISIS 150463, ISIS 150464, ISIS 150465, ISIS 150466, ISIS 150467, ISIS 150468, ISIS 150469, ISIS 150469, ISIS 150469 ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609-333617, ISIS 333619, ISIS 333620-333636, ISIS 333638, and ISIS 333640) were used as comparison compounds.

[0355] In a specific embodiment, ISIS 333611, a 5-10-5 MOE gapmer having the sequence (5' to 3') CCGTCGCCCTTCAGCACGCA (incorporated herein as SEQ ID NO: 21), in which each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1 to 5 and 16 to 20 (5' to 3') contains a 2'-O-methoxyethyl moiety, was used as a comparative compound. ISIS 333611 was selected as a comparative compound because it exhibits high levels of dose-dependent inhibition in various studies, as described in WO 2005 / 040180. In addition, a phase 1 human clinical trial using ISIS 333611 has been completed. See MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomized, first-in-man study," Lancet Neurol. (2013) 12(5):435-442. ISIS 333611 was therefore deemed to be a highly efficacious and potent compound with an acceptable safety profile (enough to have been tested in human patients).

[0356] In certain embodiments, the compounds described herein benefit from one or more improved properties compared to the antisense compounds described in WO 2005 / 040180. Some of these improved properties are demonstrated in the examples provided herein. In certain embodiments, the compounds described herein are more efficacious, potent, and / or better tolerated in various in vitro and in vivo assays than the comparative compounds described herein, including ISIS 333611. In certain embodiments, ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870, and ISIS 666867 are more efficacious and / or potent in various in vitro and in vivo assays than the comparative compounds described herein, including ISIS 333611. In certain embodiments, ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870, and ISIS 666867 are better tolerated in one or more animal tolerability assays than the comparative compounds described herein, including ISIS 333611. This is true even though 333611 is sufficiently well tolerated to be advanced into human clinical trials.

[0357] In certain embodiments, certain compounds described herein have an in vitro IC50 of less than 2 μM, less than 1.9 μM, less than 1.8 μM, less than 1.7 μM, less than 1.6 μM, less than 1.5 μM, less than 1.4 μM, less than 1.3 μM, less than 1.2 μM, less than 1.1 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, or less than 0.5 μM, less than 0.4 μM, less than 0.3 μM, less than 0.2 μM, when tested in human cells, e.g., when tested in HepG2 A431 or SH-SY5Y cell lines. It is less than 0.1 μM and therefore more potent than the comparative compounds (see, eg, Examples 6-11).

[0358] In certain embodiments, certain compounds described herein are more potent than comparative compounds due to their ability to inhibit SOD-1 expression in vivo, ie, they inhibit SOD-1 in the lumbar and cervical spinal cord by at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, e.g., in transgenic animal models.

[0359] In certain embodiments, certain compounds described herein are better tolerated than comparator compounds, as measured by reduced levels of microglial markers (e.g., IBA1), reduced levels of astrocyte markers (e.g., GFAP), and / or FOB scores in rats, mice, and / or monkeys. See, e.g., Examples 14, 15, 18, and 19.

[0360] ISIS666853 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666853 achieved 81% inhibition in the lumbar spinal cord and 74% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0361] For example, as described in Example 14 (below), in Sprague-Dawley rats, after 3 hours of treatment with 3 mg of oligonucleotide, ISIS 666853 achieved an FOB score of 0, whereas ISIS 333611 achieved an FOB score of 4. Levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in ISIS 666853-treated rats compared to ISIS 333611-treated rats.

[0362] For example, as described in Example 15 (below), ISIS 666853 exhibited EDs of 81.3 and 242.6 (respectively) in lumbar and cervical tissues of SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. 50 In transgenic rats treated with ISIS 333611, the highest concentration tested (3000 μg) did not achieve more than 55-65% inhibition of human SOD-1 mRNA, suggesting that the ED50 in lumbar and cervical tissues was not significant. 50 could not be calculated.

[0363] For example, as described in Example 16 (below), ISIS 666853 achieved 3-hour FOB scores of 0.0 and 0.5 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). ISIS 666853 achieved 8-week FOB scores of 0.0 and 0.0 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

[0364] For example, as described in Example 17 (below), in SOD-1 transgenic mice, ISIS 666853 exhibited EDs of 136 and 188 in lumbar and cortical tissues (respectively) when treated with an intracerebroventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide. 50 was achieved, whereas the ED achieved with ISIS333611 50 were 401 and 786 in lumbar and cortical tissues (respectively). Ta.

[0365] For example, as described in Example 18 (below), after 3 hours of treatment with 700 μg of oligonucleotide, C57bl6 mice achieved an FOB score of 1.25 with ISIS 666853, compared with an FOB score of 6.5 with ISIS 333611. The levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in mice treated with ISIS 666853 compared with mice treated with ISIS 333611.

[0366] ISIS666859 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666859 achieved 79% inhibition in the lumbar spinal cord and 64% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0367] For example, as described in Example 14 (below), in Sprague-Dawley rats, after 3 hours of treatment with 3 mg of oligonucleotide, ISIS 666859 achieved an FOB score of 1, whereas ISIS 333611 achieved an FOB score of 4. Levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in ISIS 666859-treated rats compared to ISIS 333611-treated rats.

[0368] For example, as described in Example 15 (below), ISIS 666859 exhibited EDs of 74.0 and 358.8 (respectively) in lumbar and cervical tissues of SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. 50In transgenic rats treated with ISIS 333611, the highest concentration tested (3000 μg) did not achieve more than 55-65% inhibition of human SOD-1 mRNA, suggesting that the ED50 in lumbar and cervical tissues was not significant. 50 could not be calculated.

[0369] For example, as described in Example 16 (below), ISIS 666859 achieved 3-hour FOB scores of 0.0 and 2.1 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). ISIS 666859 achieved 8-week FOB scores of 0.0 and 0.3 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

[0370] For example, as described in Example 17 (below), in SOD-1 transgenic mice, ISIS 666859 exhibited EDs of 10 and 20 in lumbar and cortical tissues (respectively) when treated with an intracerebroventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide. 50 was achieved, whereas the ED achieved with ISIS333611 50 were 401 and 786 in lumbar and cortical tissues (respectively).

[0371] For example, as described in Example 18 (below), after 3 hours of treatment with 700 μg of oligonucleotide, C57bl6 mice achieved an FOB score of 1.75 with ISIS 666859, whereas the FOB score achieved with ISIS 333611 was 6.5. The levels of microglial marker (IBA1) and astrocyte marker (GFAP) were also significantly higher in mice treated with ISIS 666859 than in mice treated with ISIS 333611. 11-treated mice.

[0372] ISIS666919 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666919 achieved 76% inhibition in the lumbar spinal cord and 68% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0373] For example, as described in Example 14 (below), in Sprague-Dawley rats, after 3 hours of treatment with 3 mg of oligonucleotide, ISIS 666919 achieved an FOB score of 2, whereas ISIS 333611 achieved an FOB score of 4. Levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in ISIS 666919-treated rats compared to ISIS 333611-treated rats.

[0374] For example, as described in Example 15 (below), ISIS 666919 exhibited EDs of 104.1 and 613.5 (respectively) in lumbar and cervical tissues of SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. 50 In transgenic rats treated with ISIS 333611, the highest concentration tested (3000 μg) did not achieve more than 55-65% inhibition of human SOD-1 mRNA, suggesting that the ED50 in lumbar and cervical tissues was not significant. 50 could not be calculated.

[0375] For example, as described in Example 16 (below), ISIS 666919 achieved 3-hour FOB scores of 1.3 and 3.5 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). ISIS 666919 achieved 8-week FOB scores of 0.0 and 0.1 (respectively) at doses of 1 mg and 3 mg, whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

[0376] For example, as described in Example 17 (below), ISIS 666919 produced an EDTA of 168 in lumbar tissue in SOD-1 transgenic mice when treated with an intracerebroventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide. 50 was achieved, whereas ED in lumbar tissues was achieved with ISIS 333611. 50 was 401.

[0377] For example, as described in Example 18 (below), after 3 hours of treatment with 700 μg of oligonucleotide, C57bl6 mice achieved an FOB score of 6.5 with ISIS 333611, compared with 0.0 with ISIS 666919. The levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in mice treated with ISIS 666919 compared with mice treated with ISIS 333611.

[0378] ISIS666921 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 66621 achieved 71% inhibition in the lumbar spinal cord and 65% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0379] For example, as described in Example 14 (below), in Sprague-Dawley rats, after 3 hours of treatment with 3 mg of oligonucleotide, ISIS 666921 achieved an FOB score of 2, whereas ISIS 333611 achieved an FOB score of 4. Levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in ISIS 666919-treated rats compared to ISIS 333611-treated rats.

[0380] ISIS666922 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666922 achieved 67% inhibition in the lumbar spinal cord and 62% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0381] For example, as described in Example 14 (below), in Sprague-Dawley rats, after 3 hours of treatment with 3 mg of oligonucleotide, ISIS 666922 achieved an FOB score of 3, whereas ISIS 333611 achieved an FOB score of 4. Levels of the microglial marker (IBA1) and the astrocyte marker (GFAP) were also reduced in rats treated with ISIS 666919 compared to rats treated with ISIS 333611.

[0382] ISIS666869 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / ml oligonucleotide solution diluted in PBS (final dose of 500 μg) was administered, ISIS 666869 achieved 82% inhibition in the lumbar spinal cord and 81% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0383] ISIS666870 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666870 achieved 76% inhibition in the lumbar spinal cord and 68% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0384] For example, as described in Example 15 (below), ISIS 666870 exhibited EDs of 139.4 and 1111 (respectively) in lumbar and cervical tissues of SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. 50 In transgenic rats treated with ISIS 333611, the highest concentration tested (3000 μg) did not achieve more than 55-65% inhibition of human SOD-1 mRNA, suggesting that the ED50 in lumbar and cervical tissues was not significant. 50 could not be calculated.

[0385] For example, as described in Example 17 (below), in SOD-1 transgenic mice, ISIS 666870 showed EDTA values ​​of 148 and 409 in lumbar and cortical tissues (respectively) when treated with an intracerebroventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide. 50 was achieved, whereas the ED achieved with ISIS333611 50 were 401 and 786 in lumbar and cortical tissues (respectively).

[0386] For example, as described in Example 18 (below), after 3 hours of treatment with 700 μg of oligonucleotide, C57bl6 mice achieved an FOB score of 4.75 with ISIS 666870, whereas ISIS 333611 achieved an FOB score of 6.5.

[0387] ISIS666867 For example, as described in Example 12 (below), when 30 μL of a 16.67 mg / mL solution of the oligonucleotide diluted in PBS (final dose of 500 μg) was administered, ISIS 666867 achieved 59% inhibition in the lumbar spinal cord and 48% inhibition in the cervical spinal cord of an SOD-1 transgenic rat model, whereas ISIS 333611 achieved 51% inhibition in the lumbar spinal cord and 47% inhibition in the cervical spinal cord.

[0388] Certain compositions 1.ISIS666853 In certain embodiments, ISIS 666853 is a 5-10-5 MOE gapmer having the sequence (5' to 3') CAGGATACATTTCTACAGCT (incorporated herein as SEQ ID NO: 725), wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside. The internucleoside bond between nucleosides 2-3, 4-5, 16-17, and 18-19 is a phosphodiester bond, the internucleoside bond between nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 17-18, and 19-20 is a phosphorothioate bond, and each cytosine is a 5'-methylcytosine.

[0389] In certain embodiments, ISIS 666853 is described by the following chemical designation: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0390] In certain embodiments, ISIS 666853 is described by the following chemical structure:

[0391] [ka]

[0392] 2.ISIS666859 In certain embodiments, ISIS 666859 is a modified oligonucleotide having the 17-nucleoside nucleobase sequence (5' to 3') TTAATGTTTATCAGGAT (incorporated herein as SEQ ID NO: 1351), wherein each of nucleosides 1-4 and 15-17 is a 2'-O-methoxyethyl ribose nucleoside, each of nucleosides 13 and 14 is a cEt-modified nucleoside, and Each of nucleosides 5 to 12 is a 2'-deoxyribonucleoside; the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, and 14 to 15 are phosphodiester linkages; the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages; and each cytosine is a 5'-methylcytosine.

[0393] In certain embodiments, ISIS 666859 is described by the following chemical designation: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0394] In certain embodiments, ISIS 666859 is described by the following chemical structure:

[0395] [ka]

[0396] 3.ISIS666919 In certain embodiments, ISIS 666919 is a modified oligonucleotide having the 17-nucleoside nucleobase sequence (5' to 3') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), wherein each of nucleosides 1-4 and 16-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 14 and 15 is a cEt-modified nucleoside, and Each of nucleosides 5 to 13 is a 2'-deoxyribonucleoside; the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, and 14 to 15 are phosphodiester linkages; the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate linkages; and each cytosine is a 5'-methylcytosine.

[0397] In certain embodiments, ISIS 666919 is described by the following chemical designation: Can be: Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0398] In certain embodiments, ISIS 666919 is described by the following chemical structure:

[0399] [ka]

[0400] 4.ISIS666921 In certain embodiments, ISIS 666921 is a modified oligonucleotide having the 17-nucleoside nucleobase sequence (5' to 3') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), wherein each of nucleosides 1-5 and 16-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 14-15 is a cEt-modified nucleoside, and each of nucleosides 6-13 is a 2'-deoxyribonucleoside. wherein the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, and 14-15 are phosphodiester linkages, the internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 15-16, and 16-17 are phosphorothioate linkages, and each cytosine is a 5'-methylcytosine.

[0401] In certain embodiments, ISIS 666921 is described by the following chemical designation: Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0402] In certain embodiments, ISIS 666921 is described by the following chemical structure:

[0403] [ka]

[0404] 5.ISIS666922 In certain embodiments, ISIS 666922 is a modified oligonucleotide having the 17-nucleoside nucleobase sequence (5' to 3') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), wherein each of nucleosides 1-4 and 15-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 5 and 14 is a cEt-modified nucleoside, and Each of nucleosides 6 to 13 is a 2'-deoxyribonucleoside; the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, and 14 to 15 are phosphodiester linkages; the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate linkages; and each cytosine is a 5'-methylcytosine.

[0405] In certain embodiments, ISIS 666922 is described by the following chemical designation: Ges Geo Aeo Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0406] In certain embodiments, ISIS 666922 is described by the following chemical structure:

[0407] [ka]

[0408] 6.ISIS666869 In certain embodiments, ISIS 666869 is a modified oligonucleotide having the 17-nucleoside nucleobase sequence (5' to 3') AGTGTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), wherein each of nucleosides 1, 3, 14, and 16-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, and each of nucleosides 2, 4, 13, and 15 is a cEt-modified nucleoside. , each of nucleosides 5 to 12 is a 2'-deoxyribonucleoside, the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, and 14 to 15 are phosphodiester linkages, the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages, and each cytosine is a 5'-methylcytosine.

[0409] In certain embodiments, ISIS 666869 is described by the following chemical designation: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0410] In certain embodiments, ISIS 666869 is described by the following chemical structure:

[0411] [ka]

[0412] 7.ISIS666870 In certain embodiments, ISIS 666870 is a modified oligonucleotide having a 17-nucleoside nucleobase sequence (5' to 3') AGTGTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), wherein each of nucleosides 1, 3, 13-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 2 and 4 is a cEt-modified nucleoside, and Each of nucleosides 5-12 is a 2'-deoxyribonucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 13-14, and 14-15 are phosphodiester linkages, the internucleoside linkages between nucleosides 1-2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 15-16, and 16-17 are phosphorothioate linkages, and each cytosine is a 5'-methylcytosine.

[0413] In certain embodiments, ISIS 666870 is described by the following chemical designation: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0414] In certain embodiments, ISIS 666870 is described by the following chemical structure:

[0415] [ka]

[0416] 8.ISIS666867 In certain embodiments, ISIS 666867 is a modified oligonucleotide having a 17-nucleoside nucleobase sequence (5' to 3') AGTGTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), wherein each of nucleosides 1-2 and 13-17 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 3 and 4 is a cEt-modified nucleoside, each of nucleosides 5-12 is a 2'-deoxyribonucleoside, and the internucleoside linkages between nucleosides 2-3, 3-4, 13-14, and 14-15 are 2'-O-methoxyethyl ribose-modified nucleosides. The internucleoside bonds between nucleosides 1-2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 15-16, and 16-17 are phosphorothioate bonds, and each cytosine is a 5'-methylcytosine.

[0417] In certain embodiments, ISIS 666867 is described by the following chemical designation: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; where: A = adenine, mC = 5'-methylcytosine G = guanine, T=thymine; e = 2'-O-methoxyethyl ribose modified sugar; k=cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0418] In certain embodiments, ISIS 666867 is described by the following chemical structure:

[0419] [ka] [Example]

[0420] Non-Limiting Disclosure and Incorporation by Reference While certain compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples only serve to illustrate, and are not intended to limit, the compounds described herein. Each reference cited in this application is incorporated herein by reference in its entirety.

[0421] Example 1: Inhibition of human soluble superoxide dismutase 1 (SOD-1) in HepG2 cells by MOE gapmers Modified oligonucleotides targeting soluble superoxide dismutase 1 (SOD-1) nucleic acids were designed and their effects on SOD-1 mRNA were tested in vitro. The following oligonucleotides were previously disclosed in WO 2005 / 040180: ISIS146144, ISIS146145, ISIS150437, ISIS150441, ISIS150443, ISIS150444, ISIS150445, ISIS150446, ISIS150447, ISIS150448, ISIS150449, ISIS150452, ISIS150454, ISIS150458, ISIS150460, ISIS150462-150467, ISIS150470, ISIS150472, and ISIS Also included in this assay were ISIS 150474, ISIS 150475, ISIS 150476, ISIS 150479-150483, ISIS 150488, ISIS 150489, ISIS 150490, ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609-333617, ISIS 333619, ISIS 333620-333636, ISIS 333638, and ISIS 333640. ISIS 333611, previously disclosed in WO 2005 / 040180, was also selected as a reference or comparative oligonucleotide. ISIS333611 was recently tested in a human clinical trial. See MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomized, first-in-man study," Lancet Neurol. (2013) 12(5):435-442.

[0422] The modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 7,000 nM of the modified oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

[0423] Human primer probe set RTS3898 (forward sequence CTCTCAGGAGACCATTGCATCA, herein referred to as SEQ ID NO:11; reverse sequence TCCTGTCTTTGTACTTTCTTCATTTCC, herein referred to as SEQ ID NO:12; probe sequence CCGCACACTGGTGGTCCATGAAAA, herein referred to as SEQ ID NO:13) was used to measure mRNA levels. When oligonucleotides overlapped with the amplicon of a primer probe set, alternative primer probe set HTS90 (forward sequence CGTGGCCTAGCGAGTTATGG, herein referred to as SEQ ID NO:14; reverse sequence GAAATTGATGATGCCCTGCA, herein referred to as SEQ ID NO:15; probe sequence ACGAAGGCCGTGTGCGTGCTGX, herein referred to as SEQ ID NO:16) was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results were expressed as percent inhibition of SOD-1 compared to untreated control cells. "nd" indicates that no inhibition level was measured using that primer-probe set.

[0424] The newly designed modified oligonucleotides in the table below were designed as 5-10-5MOE gapmers. These 5-10-5MOE gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments, each containing five nucleosides. Each nucleoside in the 5'-wing segment and each nucleoside in the 3'-wing segment contains a 2'-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" indicates the 5'-most nucleoside in the human gene sequence targeted by the gapmer. The "stop site" indicates the 3'-most nucleoside in the human gene sequence targeted by the gapmer. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO: 2. "n / a" indicates that the modified oligonucleotide does not target the gene sequence with 100% complementarity.

[0425] [Table 1] [Table 1-1]

[0426] [Table 2] [Table 2-1] [Table 2-2] Table 2-3

[0427] Table 3 Table 3-1

[0428] Table 4 Table 4-1 Table 4-2 Table 4-3

[0429] Table 5 Table 5-1 Table 5-2

[0430] Table 6 Table 6-1 Table 6-2

[0431] Table 7 Table 7-1 Table 7-2

[0432] Table 8 Table 8-1 Table 8-2

[0433] Table 9 Table 9-1 Table 9-2 Table 9-3

[0434] Table 10 Table 10-1 Table 10-2 Table 10-3 Table 10-4

[0435] Example 2: Inhibition of human SOD-1 in HepG2 cells by MOE gapmers Modified oligonucleotides targeting soluble superoxide dismutase 1 (SOD-1) nucleic acid were designed and their effects on SOD-1 mRNA were tested in vitro. The following oligonucleotides, previously disclosed in WO 2005 / 040180, were also included in this assay: ISIS 146143, ISIS 150438-150440, ISIS 150442, ISIS 150450, ISIS 150455-150457, ISIS 150459, ISIS 150461, ISIS 150469, ISIS 150473, ISIS 150478, ISIS 150484, ISIS 150486, ISIS 150494, ISIS 150508-150510, ISIS 333607, ISIS 333608, ISIS 333611, and ISIS 333618. Modified oligonucleotides were tested in a series of experiments using similar incubation conditions. The results of each experiment are presented in individual tables below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 5,000 nM of modified oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

[0436] mRNA levels were measured using the human primer probe set RTS3898. When oligonucleotides overlapped with the amplicon of a primer-probe set, mRNA levels were measured using an alternative primer-probe set, HTS90. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells. "nd" indicates that the level of inhibition was not measured using that primer-probe set.

[0437] The newly designed modified oligonucleotides in the table below were designed as 5-10-5MOE gapmers. These 5-10-5MOE gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments, each containing five nucleosides. Each nucleoside in the 5'-wing segment and each nucleoside in the 3'-wing segment contains a 2'-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" indicates the 5'-most nucleoside in the human gene sequence targeted by the gapmer. The "stop site" indicates the 3'-most nucleoside in the human gene sequence targeted by the gapmer. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO: 2. "n / a" indicates that the modified oligonucleotide does not target the gene sequence with 100% complementarity.

[0438] [Table 11] [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4]

[0439] [Table 12] [Table 12-1] [Table 12-2] [Table 12-3] [Table 12-4] [Table 12-5]

[0440] Example 3: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE, and cEt gapmers Modified oligonucleotides targeting soluble superoxide dismutase 1 (SOD-1) nucleic acids Nucleotides were designed and their effects on SOD-1 mRNA were tested in vitro. ISIS 333611, previously described in WO 2005 / 040180, was included as a reference. The 5-10-5 MOE gapmers ISIS 590067, ISIS 590074, ISIS 590082, ISIS 590130, ISIS 590138, and ISIS 590146, described in Example 1 above, were also included in this assay. ISIS 590512, which has a sequence similar to ISIS 333611 but contains deoxy, MOE, and cEt sugar modifications, was also included in this study.

[0441] The modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 3,000 nM of the modified oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

[0442] mRNA levels were measured using human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are shown as percent inhibition of SOD-1 compared to untreated control cells. "nd" indicates that no inhibition level was measured.

[0443] The newly designed modified oligonucleotides in the table below were designed as deoxy, MOE, and cEt gapmers. These gapmers are 17 nucleosides long, with each nucleoside having an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates a 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar. Internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosine. "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO: 2. "n / a" indicates that the modified oligonucleotide does not target the gene sequence with 100% complementarity.

[0444] [Table 13] [Table 13-1] Table 13-2 Table 13-3 Table 13-4

[0445] Table 14 Table 14-1 Table 14-2 Table 14-3 Table 14-4 Table 14-5

[0446] Table 15 Table 15-1 Table 15-2 Table 15-3 Table 15-4

[0447] Table 16 [Table 16-1] [Table 16-2] [Table 16-3] [Table 16-4]

[0448] [Table 17] [Table 17-1] [Table 17-2]

[0449] Example 4: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE, and cEt gapmers Modified oligonucleotides targeting soluble superoxide dismutase 1 (SOD-1) nucleic acid were designed and their effects on SOD-1 mRNA were tested in vitro. ISIS 333611, a 5-10-5 MOE gapmer previously described in WO 2005 / 040180, was included as a reference.

[0450] The modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 4,000 nM of the modified oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

[0451] mRNA levels were measured using human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are shown as percent inhibition of SOD-1 compared to untreated control cells. "nd" indicates that no inhibition level was measured.

[0452] The newly designed modified oligonucleotides in the table below were designed as deoxy, MOE, and cEt gapmers or 5-10-5 gapmers. These 5-10-5 MOE gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-deoxyribonucleosides flanked by 5' and 3' wing segments, each containing five nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment contains a 2'-MOE modification. The deoxy, MOE, and cEt oligonucleotides are 17 nucleosides long, with nucleosides containing an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates a 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosine. "Start site" indicates the 5'-most nucleoside to which the gapmer targets in the human gene sequence. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO: 2. "n / a" indicates that the modified oligonucleotide does not target the gene sequence with 100% complementarity.

[0453] [Table 18] [Table 18-1]

[0454] [Table 19] [Table 19-1] [Table 19-2] [Table 19-3] [Table 19-4]

[0455] [Table 20] [Table 20-1] [Table 20-2] [Table 20-3] [Table 20-4]

[0456] Example 5: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE, and cEt gapmers Modified oligonucleotides targeting the SOD-1 nucleic acid were designed and their effects on SOD-1 mRNA were tested in vitro. ISIS 333611, a 5-10-5 MOE gapmer previously described in WO 2005 / 040180, was included as a reference.

[0457] The modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 5,000 nM of the modified oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

[0458] mRNA levels were measured using the human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content as measured by IBOGREEN®. Results are shown as percent inhibition of SOD-1 compared to untreated control cells. "nd" indicates that no inhibition level was measured.

[0459] The newly designed modified oligonucleotides in the table below were designed as deoxy, MOE, and cEt gapmers. These gapmers are 17 nucleosides in length, with each nucleoside bearing an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates a 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO: 2. "n / a" indicates that the modified oligonucleotide does not target the gene sequence with 100% complementarity.

[0460] [Table 21] [Table 21-1] [Table 21-2] [Table 21-3] [Table 21-4]

[0461] [Table 22] [Table 22-1] [Table 22-2] [Table 22-3] [Table 22-4]

[0462] [Table 23] [Table 23-1] [Table 23-2] [Table 23-3] [Table 23-4]

[0463] Example 6: Dose-dependent inhibition of human SOD-1 by modified oligonucleotides in HepG2 cells Gapmers that exhibited significant in vitro inhibition of SOD-1 mRNA from the above studies were selected and tested at various doses in HepG2 cells. Reference compound ISIS 333611 and other compounds previously disclosed in WO 2005 / 040180, including ISIS 146144, 146145, 150445, 150446, 150447, 150454, 150463, 150465, 333606, 333609, and 333611, were also tested.

[0464] Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotide concentrations of 0.813 μM, 1.625 μM, 3.250 μM, 6.500 μM, and 13.000 μM, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as the percentage inhibition of SOD-1 compared to untreated control cells. It is shown as a

[0465] The 50% inhibitory concentration (IC) of each oligonucleotide 50 ) are also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0466] [Table 24]

[0467] [Table 25]

[0468] [Table 26]

[0469] [Table 27]

[0470] Example 7: Dose-dependent inhibition of human SOD-1 by modified oligonucleotides in HepG2 cells Gapmers that exhibited significant in vitro inhibition of SOD-1 mRNA from the above studies were selected and tested at various doses in HepG2 cells. Reference compounds ISIS 333611 and ISIS 333625 (both of which were previously disclosed in WO 2005 / 040180) were also tested.

[0471] Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were cultured at a density of 20,000 cells per well. Cells were plated and transfected using electroporation with modified oligonucleotide concentrations of 0.148 μM, 0.444 μM, 1.330 μM, 4.000 μM, and 12.000 μM, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using human primer probe sets RTS3898 or HTS90. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells.

[0472] The 50% inhibitory concentration (IC) of each oligonucleotide 50 ) are also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0473] [Table 28]

[0474] [Table 29]

[0475] Example 8: Dose-dependent inhibition of human SOD-1 by modified oligonucleotides in HepG2 cells Gapmers that exhibited significant in vitro inhibition of SOD-1 mRNA from the above studies were selected and tested at various doses in HepG2 cells. Additional compounds, including the reference compound ISIS 333611, and ISIS 146143, 150442, 195753, 333607, and 333608, previously disclosed in WO 2005 / 040180, were also tested.

[0476] Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotide concentrations of 0.1875 μM, 0.7500 μM, 3.0000 μM, and 12.0000 μM, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells.

[0477] The 50% inhibitory concentration (IC) of each oligonucleotide 50 ) are also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0478] [Table 30]

[0479] [Table 31]

[0480] [Table 32]

[0481] [Table 33]

[0482] [Table 34]

[0483] Example 9: Dose-dependent inhibition of human SOD-1 in HepG2 cells by gapmers with hybrid backbone chemistries Based on the sequences of the oligonucleotides disclosed in the above studies, additional gapmers were designed. These oligonucleotides were designated as 5-10-5MOE, 5-8-5MOE, and deoxy, MOE, and cEt oligonucleotides. The 5-10-5MOE gapmer is 20 nucleosides long, with a central gap segment consisting of 10 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments containing five nucleosides each. The 5-8-5MOE gapmer is 18 nucleosides long, with a central gap segment consisting of eight 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments containing five nucleosides each. Each nucleoside in the 5'-wing segment and each nucleoside in the 3'-wing segment contains a 2'-MOE modification. The deoxy, MOE, and cEt oligonucleotides are 16 or 17 nucleosides in length, with each nucleoside having an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates a 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar. The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate. The internucleoside linkages of each oligonucleotide are indicated in the "Backbone Chemistry" column, where "o" indicates a phosphodiester linkage and "s" indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosine. The "Start Site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" refers to the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), referred to herein as SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), referred to herein as SEQ ID NO: 2.

[0484] [Table 35] [Table 35-1] [Table 35-2]

[0485] The newly designed oligonucleotides were tested at various doses in HepG2 cells. Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotide concentrations of 0.222 μM, 0.667 μM, 2.000 μM, and 6.000 μM as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and analyzed. SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are shown as percent inhibition of SOD-1 compared to untreated control cells.

[0486] The 50% inhibitory concentration (IC) of each oligonucleotide 50 ) are also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0487] [Table 36]

[0488] [Table 37]

[0489] [Table 38]

[0490] [Table 39]

[0491] Example 10: Dose-dependent inhibition of human SOD-1 by gapmers with hybrid backbone chemistries Based on the sequences of the oligonucleotides disclosed in the above studies, additional gapmers were designed. These oligonucleotides were designed as deoxy, MOE, and cEt oligonucleotides. These deoxy, MOE, and cEt oligonucleotides were 16 or 17 nucleosides in length, with each nucleoside having an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar and "d" indicates a 2'-deoxyribonucleotide. "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), referred to herein as SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), referred to herein as SEQ ID NO: 2.

[0492] [Table 40] [Table 40-1]

[0493] The newly designed oligonucleotides were tested at various doses in A431 cells. Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were plated at a density of 5,000 cells per well, and modified oligonucleotides were added to the medium at concentrations of 0.12 μM, 0.60 μM, 3.00 μM, and 15.00 μM as specified in the table below to allow for spontaneous cellular uptake. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells.

[0494] [Table 41]

[0495] [Table 42]

[0496] [Table 43]

[0497] [Table 44]

[0498] Example 11: Dose-dependent inhibition of human SOD-1 by gapmers with hybrid backbone chemistries Based on the sequences of the oligonucleotides disclosed in the above studies, additional gapmers were designed as 5-10-5 MOE gapmers, 4-8-5 MOE gapmers, 5-8-5 MOE gapmers, 5-8-7 MOE gapmers, 6-8-6 MOE gapmers, 6-9-5 MOE gapmers, or deoxy, MOE, and cEt oligonucleotides.

[0499] The 5-10-5 MOE gapmer is 20 nucleosides long, with a central gap segment consisting of 10 2'-deoxynucleosides flanked by 5'- and 3'-wing segments containing 5 nucleosides each. The 4-8-5 MOE gapmer is 17 nucleosides long, with a central gap segment consisting of 8 2'-deoxynucleosides flanked by 5'- and 3'-wing segments containing 4 and 5 nucleosides each. The 5-8-5 MOE gapmer is 18 nucleosides long, with a central gap segment consisting of 8 2'-deoxynucleosides flanked by 5'- and 3'-wing segments containing 5 nucleosides each. The 5-8-7 MOE gapmer is 20 nucleosides long, with a central gap segment consisting of eight 2'-deoxynucleosides flanked by 5' and 3' wing segments containing five and seven nucleosides, respectively. The 6-8-6 MOE gapmer is 20 nucleosides long, with a central gap segment consisting of eight 2'-deoxynucleosides flanked by 5' and 3' wing segments containing six nucleosides, respectively. The 6-9-5 MOE gapmer is 20 nucleosides long, with a central gap segment consisting of nine 2'-deoxynucleosides. It is composed of a 5'- and 3'-wing segment containing six and five nucleosides, respectively, and each nucleoside in the 5'-wing segment and each nucleoside in the 3'-wing segment has a 2'-MOE modification.

[0500] Deoxy, MOE, and cEt oligonucleotides are 17 nucleosides in length, with each nucleoside containing either an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar.

[0501] The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate. The internucleoside linkages of each oligonucleotide are indicated in the "Backbone Chemistry" column, where "o" indicates a phosphodiester linkage and "s" indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), referred to herein as SEQ ID NO: 1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), referred to herein as SEQ ID NO: 2.

[0502] [Table 45] [Table 45-1]

[0503] The newly designed oligonucleotides were tested at various doses in A431 cells. Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results are presented in separate tables below. Cells were plated at a density of 5,000 cells per well, and modified oligonucleotides were added to the medium at concentrations of 0.062 μM, 0.185 μM, 0.556 μM, 1.667 μM, 5.000 μM, and 15.000 μM as specified in the table below, and allowed to naturally be taken up by the cells. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and SOD-1 mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells.

[0504] [Table 46]

[0505] [Table 47]

[0506] The newly designed oligonucleotides were also tested in SH-SY5Y cells at various doses. Modified oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were grown at a density of 20,000 cells per well. Cells were plated at 100°C and transfected using electroporation with modified oligonucleotides at concentrations of 0.062 μM, 0.185 μM, 0.556 μM, 1.667 μM, 5.000 μM, and 15.000 μM modified oligonucleotides, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using human primer probe set RTS3898. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells.

[0507] [Table 48]

[0508] [Table 49]

[0509] Example 12: Inhibition of human SOD-1 in a transgenic rat model Gapmers from the above studies were tested in an SOD-1 transgenic rat model (Taconic, Cat. Nos. 2148-F and 2148-M), including the reference compound ISIS 333611 previously disclosed in WO 2005 / 040180. Hemizygous rats from the group express mutant human SOD-1 in the spinal cord.

[0510] Based on the sequences of the oligonucleotides disclosed in the above studies, additional gapmers were designed. These oligonucleotides were designated as 5-9-5MOE gapmers, 5-10-5MOE gapmers, or deoxy, MOE, and cEt oligonucleotides. The 5-9-5MOE gapmers are 19 nucleosides long, with a central gap segment consisting of nine 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments containing five nucleosides each. The 5-10-5MOE gapmers are 20 nucleosides long, with a central gap segment consisting of ten 2'-deoxyribonucleosides flanked by 5'- and 3'-wing segments containing five nucleosides each. Each nucleoside in the 5'-wing segment and each nucleoside in the 3'-wing segment contains a 2'-MOE modification. The deoxy, MOE, and cEt oligonucleotides are 17 nucleosides long, with each nucleoside having an MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is indicated as shown in the "Chemistry" column, where "k" indicates a cEt-modified sugar, "d" indicates a 2'-deoxyribose, and "e" indicates a 2'-MOE-modified sugar. The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate. The internucleoside linkages of each oligonucleotide are indicated in the "Backbone Chemistry" column, where "o" indicates a phosphodiester linkage and "s" indicates a phosphorothioate linkage. All cytosine residues throughout each oligonucleotide are 5-methylcytosine. The "Start Site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. The "Stop Site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted.Each gapmer listed in the table below targets either the human SOD-1 mRNA (GENBANK Accession No. NM_000454.4), herein designated SEQ ID NO:1, or the human SOD-1 genomic sequence (GENBANK Accession No. NT_011512.10, truncated from nucleotide 18693000 to nucleotide 18704000), herein designated SEQ ID NO:2.

[0511] [Table 50] [Table 50-1] [Table 50-2] [Table 50-3]

[0512] The modified oligonucleotides were tested in a series of experiments with similar conditions. The results of each experiment are presented in a separate table below. Rats were injected intrathecally with 30 μL of a 16.67 mg / ml solution of the modified oligonucleotides diluted in PBS (final dose of 500 μg). A control group of rats was injected intrathecally with PBS. The level of inhibition of SOD-1 in the lumbar, thoracic, and cervical spinal cord was assessed. The data are presented below. The data show that several modified oligonucleotides inhibited human SOD-1 levels in this model.

[0513] [Table 51]

[0514] [Table 52]

[0515] [Table 53]

[0516] [Table 54]

[0517] [Table 55]

[0518] [Table 56]

[0519] [Table 57]

[0520] [Table 58]

[0521] [Table 59]

[0522] [Table 60]

[0523] [Table 61]

[0524] Example 13: Dose-dependent inhibition of human SOD-1 by modified oligonucleotides in LLC-MK2 cells From the above studies, gapmers that exhibited significant in vitro inhibition of SOD-1 mRNA, including the reference compound ISIS333611, were selected and tested at various doses in LLC-MK2 cells. The cross-reactivity of the human modified oligonucleotides tested in this study with the rhesus monkey genomic sequence (the complementary strand of GENBANK Accession No. NW_001114168.1 truncated from nucleotide 2258000 to nucleotide 2271000, herein referred to as SEQ ID NO: 3) is shown in the table below.

[0525] [Table 62]

[0526] Cells were plated at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotide concentrations of 0.078 μM, 0.156 μM, 0.313 μM, 0.625 μM, 1.25 μM, 2.50 μM, 5.00 μM, and 10,000 μM, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Primer probe set RTS3121 (forward sequence TGGAGATAATACACAAGGCTGTACCA, herein referred to as SEQ ID NO: 17; reverse sequence CAACATGCCTCTCTTCATCCTTT, herein referred to as SEQ ID NO: 18; probe sequence ATCCTCTATCCAGACAACACGGTGGGC, herein referred to as SEQ ID NO: 19) was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1 compared to untreated control cells. The 50% inhibitory concentration (IC) of each oligonucleotide was 50 ) are also presented. As presented in the table, some of the newly designed oligonucleotides were more potent than the reference ISIS 336611.

[0527] [Table 63]

[0528] Example 14: Tolerability of SOD-1 modified oligonucleotides in a rat model Gapmers from the above studies, including the reference compound ISIS 333611 previously disclosed in WO 2005 / 040180, were tested for tolerability in Sprague-Dawley rats.

[0529] Modified oligonucleotides were tested in a series of experiments under similar conditions. Rats received a single intrathecal injection of 3 mg of ISIS oligonucleotide. Control rats received an intrathecal injection of PBS. Acute tolerability was assessed 3 hours after administration using the Functional Observational Blindness Score (FOB). The acute tolerability of a compound was assessed using this score, with lower scores representing better-tolerated compounds. Control animals typically received a score of "0" or "1." Three hours after injection, each rat was placed on its cage and observed by assessing certain functions. For each function, a number of "0" or "1" was assigned depending on whether the rat exhibited normal function in the area of ​​interest (0) or not (1), and all scores were then added together. Seven areas were assessed, including the tail, hind paws, hind legs, hind end, forward posture, forepaws, and head. The scoring results are presented in the table below. As shown in the table, several of the newly designed oligonucleotides demonstrated better acute tolerability compared to the reference ISIS 333611.

[0530] [Table 64] [Table 64-1] [Table 64-2] [Table 64-3] [Table 64-4] [Table 64-5]

[0531] Tolerability was also assessed 8 weeks after treatment by measuring the levels of the microglial marker IBA1 and the astrocyte marker GFAP in the lumbar spinal cord. Both IBA1 and GFAP are markers of CNS inflammation (Frank, MG, Brain Behav. Immun. 2007, 21, 47-59). In this rat model, higher levels of these markers indicate poorer tolerance of the antisense oligonucleotide.

[0532] IBA1 mRNA levels were measured with primer probe set rAIF1_LTS00219 (forward sequence AGGAGAAAAACAAAGAACACCAGAA, herein referred to as SEQ ID NO:5; reverse sequence CAATTAGGGCAACTCAGAAATAGCT, herein referred to as SEQ ID NO:6; probe sequence CCAACTGGTCCCCCAGCCAAGA, herein referred to as SEQ ID NO:7). GFAP mRNA levels were measured with primer probe set mGFAP_LTS00370 (forward sequence GAAACCAGCTGGACACCAA, herein referred to as SEQ ID NO:8; reverse sequence TCCACAGCTTTACCACGATGTTC, herein referred to as SEQ ID NO:9; probe sequence TCCGTGTCAGAAGGCCACCTCAAGA, herein referred to as SEQ ID NO:10).

[0533] The results are presented in the table below: As shown in the table, some of the newly designed oligonucleotides were better tolerated compared to the reference ISIS333611.

[0534] [Table 65] [Table 65-1] [Table 65-2]

[0535] Example 15: Dose-dependent inhibition of human SOD-1 in a transgenic rat model Gapmers from the studies described above were tested in an SOD-1 transgenic rat model (Taconic, catalog numbers 2148-F and 2148-M), including the reference compound ISIS 333611. These hemizygous rats express mutant human SOD-1 in the spinal cord, many brain regions, and peripheral organs.

[0536] Rats were intrathecally injected with 10, 30, 100, 300, 1000, or 3000 μg of a gapmer listed in the table below, or PBS alone. Animals were sacrificed two weeks later. Inhibition of SOD-1 mRNA in the lumbar spinal cord, cervical spinal cord, rostral cortex, and caudal cortex was assessed by RT-PCR using the primer probe set RTS3898 described in Example 1. Data were collected from ED 50 The data show that these oligonucleotides inhibited SOD1 mRNA more potently than Isis333611 in multiple CNS tissues. In fact, the ED of Isis number 333611 50 A value could not even be calculated because the highest concentration tested (3000 μg) did not inhibit SOD-1 mRNA by more than 55-65%, as indicated by the entry "n / a." "nd" indicates that data is not available for the indicated sample.

[0537] [Table 66]

[0538] Example 16: Tolerance of SOD-1 modified oligonucleotides in rats The gapmers from the above study, along with the reference compound ISIS 333611, were tested for tolerability in Sprague-Dawley rats. Groups of four to six rats received a single intrathecal injection of 1 mg or 3 mg of ISIS oligonucleotides. A control group of rats received an intrathecal injection of PBS. Acute tolerability was assessed 3 hours post-dose as described in Example 14. Results for the 1 mg dose are the average for each group after one experiment. Results for the 3 mg dose are the average for each group over two replicate experiments. The results of this study, presented in the table below, demonstrate that some of the newly designed oligonucleotides are better tolerated than the reference compound ISIS 333611.

[0539] [Table 67]

[0540] Example 17: Dose-dependent inhibition of human SOD-1 in a transgenic mouse model To confirm the results obtained in transgenic rats in another species, gapmers from the above studies were tested in an SOD-1 transgenic mouse model expressing the same G93A human mutant SOD1 gene as expressed by transgenic rats (Examples 12 and 15).

[0541] Mice were given an intracerebroventricular bolus (ICVB) of 10, 30, 100, 300, or 700 μg of the gapmers listed in the table below, or PBS. Animals were sacrificed two weeks later. Inhibition of SOD-1 mRNA in the lumbar spinal cord and cortex was assessed by RT-PCR using the primer probe set RTS3898 described in Example 1. Data are presented below. 50 The data are presented as mean values. The data show that the oligonucleotides inhibited SOD1 mRNA more potently than Isis333611 in both rats and mice.

[0542] [Table 68]

[0543] Example 18: Tolerance of SOD-1 modified oligonucleotides in mice The gapmers from the above study, including the reference compound ISIS 333611, were tested for tolerability in C57bl6 mice. Mice received a single stereotactic intracerebroventricular injection of 700 μg of ISIS oligonucleotides. Control mice received an intracerebroventricular injection of PBS. Acute tolerability was assessed 3 hours after injection using a functional observational global scale (FOB), different from that used for rats. Each mouse was evaluated according to seven different criteria: (1) the mouse was cheerful, alert, and alert; (2) the mouse was motionless or hunched without stimulation; (3) the mouse exhibited any movement without stimulation; (4) the mouse exhibited forward movement after being lifted; (5) the mouse exhibited any movement after being lifted; (6) the mouse responded to a tail pinch; and (7) the mouse had regular breathing. For each of these seven criteria, mice were assigned a subscore of 0 if the criteria was met and 1 if it was not met. After assessing these seven criteria, the subscores were summed for each mouse and then averaged for each group. For example, if a mouse was cheerful, alert, and alert 3 hours after 700 μg ICV administration and met all other criteria, its total score would be 0. If another mouse was not cheerful, alert, or alert 3 hours after 700 μg ICV administration but met all other criteria, it would be given a score of 1. Saline-treated mice generally received a score of 0. Scores at the high end of the range would suggest acute toxicity.

[0544] Body weight was measured throughout the study and is reported below as a percent change from baseline at 8 weeks. Long-term tolerability was assessed by measuring IBA1 and GFAP levels after 8 weeks of administration as described in Example 14. IBA1 and GFAP mRNA levels are reported relative to PBS-treated animals. The results of this study, presented below, demonstrate that several of the newly designed oligonucleotides were better tolerated in rats and mice than the reference ISIS 333611.

[0545] [Table 69]

[0546] [Table 70]

[0547] Example 19: Dose-dependent inhibition of monkey SOD-1 in cynomolgus monkeys Isis #666853 was tested in cynomolgus monkeys. There is one mismatch between Isis #666853 and cynomolgus monkey SOD-1, with 17 consecutive bases in Isis #666853 that are 100% complementary to cynomolgus monkey SOD-1.

[0548] On days 1, 14, 28, 56, and 84 of the study, groups of 6 to 10 male and female monkeys received an intrathecal lumbar bolus of PBS or 4, 12, or 35 mg of Isis #666853. Each group received the same dose on all five dosing days. Animals were sacrificed on day 91. Inhibition of SOD-1 mRNA in the lumbar, thoracic, and cervical spinal cord, as well as the frontal cortex, motor cortex, hippocampus, pons, and cerebellum, was assessed by RT-PCR using primer probe set RTS3898. Data are presented below as the mean percent inhibition for each treatment group relative to the PBS-treated group. These results demonstrate that Isis #666853 inhibited SOD-1 mRNA in multiple target tissues in cynomolgus monkeys.

[0549] Treatment with 666853 was well tolerated over the 13-week study duration, with no clinically observed adverse reactions in monkeys.

[0550] [Table 71]

Claims

1. A compound comprising: a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 118-1461.

2. 1. A compound comprising: a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15, 21, 23, 47, 54, and 67, wherein at least one internucleoside linkage is a phosphodiester bond.

3. The compound of claim 1 , wherein the modified oligonucleotide has a hybrid backbone.

4. The compound of embodiment 3, wherein the hybrid backbone motif is selected from: sossssssssoooss, sooossssssssssss, sooosssssssssssss, soosssssssssooss, sooossssssssooss, sooosssssssssooss, sooossssssssssooss, sooossssssssssssoos, soooossssssssssooss, sooosssssssssssooss, sososssssssssssssssosos, and sooossssssssssoooss (s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

5. 10. The compound of any one of the preceding claims, wherein the modified oligonucleotide has any of the following sugar chemical motifs: abdddddddababaa, babadddddddabab, aaaaddddddddbbaa, aaaadddddddaba, aaaaddddddddbabaa, aaaaddddddddbbaaa, aaaaaddddddddbbaa, aaaabddddddddbaaa, aaaabddddddbaaaa, aaabddddddddbaaaa, aaabbddddddbbaaa, aabbddddddddbbaa, aabbdddddddddaaaaa, aabbddddddddbbaaa, ababdddddddddaaaaa, ababddddddddbabaa, and babaddddddddaaaaa (e = any 2' non-bicyclic modified sugar; b = any bicyclic modified sugar; d = 2'-deoxyribose sugar).

6. 6. The compound of claim 5, wherein the modified oligonucleotide has any of the following sugar chemical motifs: ekdddddddekekee, kekedddddddkek, eeeeedddddddddkkee, eeeeedddddddkeke, eeeeedddddddkekee, eeeeedddddddkkeee, eeeeedddddddkkee, eeeeekddddddddkeee, eeeeekddddddkeeeee, eeekddddddddkeeeee, eeekkddddddkkeee, eekkddddddddkkee, eekkdddddddeeeee, eekkddddddddkkeee, ekekdddddddeeeee, ekekddddddddddkekeee, and kekeddddddddeeeee (e = 2'-O-methoxyethyl ribose modified sugar, k = cEt modified sugar, d = 2'-deoxyribose sugar).

7. 10. The compound of any one of the preceding claims, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO:1 or SEQ ID NO:

2.

8. 10. The compound of any one of the preceding claims, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

9. 9. The compound of any one of claims 1, 2, and 5-8, wherein at least one internucleoside linkage is a modified internucleoside linkage.

10. 10. The compound of claim 9, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

11. each modified internucleoside linkage is a phosphorothioate internucleoside linkage; The compound of claim 10.

12. 10. The compound of any one of claims 1, 2, and 5-9, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

13. 9. The compound of any one of claims 1, 2, and 5-8, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

14. 10. The compound of any one of the preceding claims, wherein at least one nucleoside comprises a modified nucleobase.

15. 15. The compound of claim 14, wherein the modified nucleobase is 5-methylcytosine.

16. at least one nucleoside of the modified oligonucleotide comprises a modified sugar; A compound according to any one of claims 1 to 4 and 7 to 15.

17. 17. The compound of claim 16, wherein the at least one modified sugar is a bicyclic sugar.

18. the bicyclic sugar has a 4'-CH(R)-O-2' bridge, where R is independently H, C １ ~C １２ 18. The compound of claim 17, wherein the aryl group is a aryl, alkyl, or protecting group.

19. 19. The compound of claim 18, wherein R is methyl.

20. 19. The compound of claim 18, wherein R is H.

21. 17. The compound of claim 16, wherein the at least one modified sugar comprises a 2'-O-methoxyethyl group.

22. the modified oligonucleotide a gap segment consisting of 8 to 10 linked deoxynucleosides; a 5' wing segment consisting of 4 to 6 linked nucleosides; and a 3' wing segment consisting of 5 to 7 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

23. the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

24. the modified oligonucleotide is a gap segment consisting of 9 linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. Item 23. The compound according to item 22.

25. the modified oligonucleotide is a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

26. the modified oligonucleotide is a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of four linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

27. the modified oligonucleotide is a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of seven linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

28. the modified oligonucleotide is a gap segment consisting of eight linked deoxynucleosides; a 5' wing segment consisting of 6 linked nucleosides; and a 3' wing segment consisting of six linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

29. the modified oligonucleotide is a gap segment consisting of 9 linked deoxynucleosides; a 5' wing segment consisting of 6 linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

30. 22. The compound of any one of claims 1-3 and 7-21, wherein the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides.

31. A compound consisting of a modified oligonucleotide according to the formula: 【Chemistry 1】

32. A compound consisting of a modified oligonucleotide according to the formula: 【Chemistry 2】

33. A compound consisting of a modified oligonucleotide according to the formula: 【Transformation 3】

34. A compound consisting of a modified oligonucleotide according to the formula: 【Chemistry 4】

35. A compound consisting of a modified oligonucleotide according to the formula: 【Transformation 5】

36. A compound consisting of a modified oligonucleotide according to the formula: 【Transformation 6】

37. A compound consisting of a modified oligonucleotide according to the formula: 【Transformation 7】

38. A compound consisting of a modified oligonucleotide according to the formula: 【Transformation 8】

39. A compound comprising a modified oligonucleotide according to the formula: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

40. A compound comprising a modified oligonucleotide according to the formula: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

41. A compound comprising a modified oligonucleotide according to the formula: Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

42. A compound comprising a modified oligonucleotide according to the formula: Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

43. A compound comprising a modified oligonucleotide according to the formula: Ges Geo Aeo Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

44. A compound comprising a modified oligonucleotide according to the formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

45. A compound comprising a modified oligonucleotide according to the formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

46. A compound comprising a modified oligonucleotide according to the formula: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; k = cEt modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

47. A compound comprising a modified oligonucleotide according to the formula: mCes mCeo Geo Teo mCeo Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Ges mCes Ae (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

48. A compound comprising a modified oligonucleotide according to the formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Ges mCeo Aeo mCeo Ges mCes Ae (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

49. A compound comprising a modified oligonucleotide according to the formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Geo mCes Ae (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

50. A compound comprising a modified oligonucleotide according to the formula: Aes mCeo Aeo mCeo mCes Tds Tds mCds Ads mCds Tds Gds Gds Tds mCds mCeo Aeo Teo Tes Ae (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

51. A compound comprising a modified oligonucleotide according to the formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCeo Aes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

52. A compound comprising a modified oligonucleotide according to the formula: Ges Geo mCeo Geo Aes Tes mCds mCds mCds Ads Ads Tds Tds Ads mCeo Aeo mCeo mCes Aes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

53. A compound comprising a modified oligonucleotide according to the formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Aes mCeo Aeo mCeo mCes Aes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

54. A compound comprising a modified oligonucleotide according to the formula: Ges Geo mCeo Geo Aeo Tes mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCes Aes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

55. A compound comprising a modified oligonucleotide according to the formula: Ges Teo mCeo Geo mCes mCds mCds Tds Tds mCds Ads Gds mCds Ads mCds Geo mCeo Aeo mCes Ae (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

56. A compound comprising a modified oligonucleotide according to the formula: Tes mCeo Geo mCeo mCes mCds Tds Tds mCds Ads Gds mCds Ads mCds Gds mCeo Aeo mCeo Aes mCe (A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage).

57. A compound comprising a modified oligonucleotide according to the formula: Ges Aes Aes Aes Tes Tds Gds Ads Tds Gds Ads Tds Gds mCds mCds mCes Tes Ges mCes Ae where: A = adenine, mC = 5'-methylcytosine G = guanine, T = thymine; e = 2'-O-methoxyethyl ribose modified sugar; d=2′-deoxyribose sugar, and s = phosphorothioate internucleoside linkage.

58. 10. A composition comprising a compound according to any one of the preceding claims or a salt thereof and at least one pharmaceutically acceptable carrier or diluent.

59. 10. A method comprising administering to an animal a compound or composition according to any one of the preceding claims.

60. 60. The method of claim 59, wherein the animal is a human.

61. 60. The method of claim 59, wherein administration of the compound prevents, treats, ameliorates, or slows the progression of an SOD-1 associated disease.

62. 60. The method of claim 59, wherein the SOD-1 associated disease is a neurodegenerative disease.

63. 63. The method of claim 62, wherein the SOD-1 associated disease is ALS.

64. 10. Use of a compound or composition according to any one of the preceding claims for the manufacture of a medicament for the treatment of a neurodegenerative disorder.

65. 10. Use of a compound or composition according to any one of the preceding claims for the manufacture of a medicament for the treatment of ALS.

66. 20. The compound or composition of any one of the preceding claims, wherein the modified oligonucleotide does not have the nucleobase sequence of SEQ ID NO:

21.

67. 10. The compound or composition of any one of the preceding claims, wherein said modified oligonucleotide does not have the nucleobase sequence of any of SEQ ID NOs: 21-118.

68. consisting of 12 to 30 linked nucleosides and nucleotide 66 of SEQ ID NO:1 A compound comprising: a modified oligonucleotide having a nucleobase sequence comprising at least a 12-contiguous nucleobase portion complementary to an equal number of nucleobases between 5 and 684, wherein the modified oligonucleotide is at least 80% complementary to SEQ ID NO:

1.

69. 69. The compound of claim 68, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO:

1.

70. 69. The compound of claim 68, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.

71. 71. The compound of any one of claims 68 to 70, wherein at least one internucleoside linkage is a modified internucleoside linkage.

72. 72. The compound of claim 71, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

73. 73. The compound of claim 72, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

74. 72. The compound of any one of claims 68 to 71, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

75. 76. The compound of any one of claims 68 to 73 and 74 to 75, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

76. 76. The compound of any one of claims 68 to 75, wherein at least one nucleoside comprises a modified nucleobase.

77. 77. The compound of claim 76, wherein the modified nucleobase is 5-methylcytosine.

78. 78. The compound of any one of claims 68-77, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

79. 79. The compound of claim 78, wherein said at least one modified sugar is a bicyclic sugar.

80. the bicyclic sugar has a 4'-CH(R)-O-2' bridge, where R is independently H, C １ ~C １２ 80. The compound of claim 79, comprising a protecting group.

81. 81. The compound of claim 80, wherein R is methyl.

82. 81. The compound of claim 80, wherein R is H.

83. 79. The compound of claim 78, wherein said at least one modified sugar comprises a 2'-O-methoxyethyl group.

Images