Injection for hair growth therapy, method for extracting klotho mRNA for injection, and method for producing injection for hair growth therapy

The injectable hair growth treatment using nanobubble hydrogen gas and RNA-expressing Klotho-α protein addresses the side effects of conventional treatments by promoting hair regrowth and stem cell regeneration, achieving significant hair density increase with minimal adverse reactions.

JP2026038346APending Publication Date: 2026-03-06广田 毅
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-08-23
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Conventional treatments for hair loss, such as finasteride and dutasteride, have significant side effects like palpitations, shortness of breath, and liver dysfunction, while existing hair growth products like minoxidil cause unwanted hair growth and other adverse reactions, and there is a need for a more effective and safer method to regenerate hair follicle stem cells.

Method used

An injectable hair growth treatment using a compound of nanobubble hydrogen gas mixed with RNA expressing Klotho-α protein and an RNA-containing extracellular vesicle, which includes microRNAs, is developed to promote hair regrowth by activating Klotho-α protein and enhancing hair follicle stem cell regeneration.

Benefits of technology

The treatment effectively promotes hair regrowth with reduced side effects, increasing hair density by 30-40% over 1-2 months without the adverse reactions seen with conventional treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026038346000001_ABST
    Figure 2026038346000001_ABST
Patent Text Reader

Abstract

To provide an injection for hair growth therapy suppressing side effects such as palpitation and shortness of breath observed in conventional AGA therapeutic agents and promoting hair growth regeneration.SOLUTION: The present invention relates to an injection for hair growth therapy for regenerating degraded hair follicle stem cells, characterized in that the injection comprises a compound, which is obtained by mixing nanobubble hydrogen gas with a recombinant nucleic acid (rNA) expressing a rNA-containing extracellular vesicle exhibiting gene activity, as a compound exhibiting activity in hair regrowth.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to an injectable hair growth treatment for regenerating degraded hair follicle stem cells, a method for extracting Klotho mRNA for use in an injectable hair growth treatment, and a method for producing an injectable hair growth treatment. [Background technology]

[0002] Currently, the Klotho gene is encoded by human chromosome 13. The Klotho gene is widely involved in age-related disorders, and it is known that the Klotho gene-produced proteins Klotho α and β decrease with age, causing various diseases. Furthermore, the dwarfism of hair follicle cells is known as an age-related pathological phenomenon. One of the causes of this dwarfism is a decrease in collagen 17 and various collagens.

[0003] The anti-aging gene klotho in human adipose-derived stem cells is known to be related to the functional activity of collagen-chondroitin scaffolds. The paracrine bioactivity generated by ADSCs (Adipose-Derived Stem Cells) activates the expression of α-SMA and elastin proteins for the regeneration and maturation of basement membrane (fibronectin, laminin, and collagen IV proteins). It is known to regulate human endothelial angiogenesis and pro-fibrotic responses in skin fibroblasts through paracrine signaling, and to enhance basement membrane regeneration through increased deposition of collagen and laminin (see Non-Patent Document 1). The regeneration of hair follicle cells is related to stem cell depletion and collagen deficiency, and the addition of growth factors to activate hair follicle stem cells is effective in complementing these factors. Examples include HGF1, FGF, PDGF, IL8 / CXCL8, SDF-1 / CXCL12, angiogenin, VEGF-A, and TGF-β.

[0004] Non-Patent Document 2 publishes the following results of a molecular biological study of the effects of PRP on human cultured hair papilla cells in order to investigate the effect of platelet-rich plasma on hair growth. PRP is added to cultured dermal papilla cells, and after culturing for a certain period of time, the gene expression of fibroblast growth factor (FGF)-2, vascular endothelial growth factor (VEGF), bone morphogenetic protein (BMP)-2, Wnt5a, and ephrin (EFN) A3 is measured by quantitative PCR. The results showed that PRP significantly increased the gene expression of FGF2, VEGF, and BMP2 in dermal papilla cells. Furthermore, the sustained expression of Wnt5 and the short-term strong expression of BMP2, followed by its subsequent disappearance, suggest that PRP may be suppressing the induction of differentiation and atrophy of the dermal papilla. Furthermore, it was concluded that PRP is involved in hair growth by acting on the remaining hair follicles, rather than on the regeneration of atrophied hair follicles.

[0005] In studies of male pattern hair loss (androgenetic alopecia (AGA)), inactivation of adenosine signaling has been reported. Adenosine is a purine nucleoside present in the body and is thought to be a physiological regulator of coronary circulation. Adenosine receptors (A1, A2A, A2B, and A3) are widely distributed in the body.

[0006] On the other hand, there has also been an increase in women experiencing thinning hair and hair loss and thinning due to aging. In most cases of female hair loss, hair density decreases, mainly around the center of the head, and histologically, it is known that some hair follicles shrink and the proportion of telogen hair increases in the thinning areas. This phenomenon is called female pattern hair loss (FPHL), as opposed to AGA, which is widely seen in male hair loss. In AGA, the hairline typically recedes gradually from the forehead to the vertex as the disease progresses, whereas in FPHL, the hairline at the front is maintained, but hair density in the center of the head decreases diffusely, and thinning areas can spread across the entire scalp. FPHL is the main cause of AGA, and no correlation has been found with increased levels of male hormones, suggesting the existence of a male hormone-independent mechanism (see Non-Patent Document 3).

[0007] Non-Patent Document 4 conducts a detailed analysis of thinning hair in Japanese women and reports that FPHL, a condition in which hair density in the central part of the head decreases diffusely after the age of 40, is common among Japanese women. It has been suggested that the main cause of the decrease in hair density is a decrease in the proportion of single hairs versus multiple hairs. A decrease in hair diameter and thinning of the scalp have also been observed. There has been almost no increase in the downy hairs characteristic of AGA.

[0008] Adenosine is currently included in hair growth products and is thought to be effective against female hair loss (FAGA) due to its ability to activate FGF7, and is primarily used in functional cosmetics. Adenosine is known as a substance that induces sleep in the brain. It prevents facial muscle contraction and inhibits enzymes that destroy collagen, promoting collagen synthesis. The ingredient adenosine phosphate disodium has been shown to activate skin turnover and promote the excretion of melanin. Adenosine is also a component responsible for vasodilation in major organs such as the heart, brain, and liver. It plays a particular role in regulating the blood flow in the coronary vessels that supply nutrients to the heart. It also exerts a strong myocardial protective effect during ischemia. Therefore, adenosine is used as a stress inducer when diagnosing heart disease. Adenosine is a substance produced in the body and is said to have very few side effects. For this reason, it is recommended to apply a 0.75% aqueous solution of adenosine in combination with plant-derived nutrients such as ginsenoids (saponins extracted from ginseng, etc.) twice a day.

[0009] In Non-Patent Document 5, it is recognized as an active ingredient in quasi-drugs in addition to adenosine. After six months of continuous use as a hair growth promoter, hair density increased to 161.7±36.5 strands / cm. 2 ~166.3±37.6 lines / cm 2 It was also reported that the thick hair rate increased from 36.2±23.3% to 38.6±23.8%, and it was verified that the hair density increased by about 3% and the thick hair rate increased by about 5-6%.

[0010] However, there are reports that AGA treatments have side effects such as palpitations and shortness of breath, as shown below. In male AGA, type 1 and type 2 reductases combine with the male hormone testosterone to produce the bad male hormone dihydrotestosterone, which is the cause of hair loss. Drugs such as finasteride and dutasteride are used as reductase inhibitors. It is said that it takes about four to six months for these treatments to be effective. Side effects reported include decreased lipids (decreased libido), erectile dysfunction (ED), and liver dysfunction. Finasteride was originally developed as a treatment for benign prostatic hyperplasia, but due to its hair growth effects it is now also used as a treatment for AGA. Due to its high effectiveness, with 98% of patients seeing improvement in symptoms (preventing the progression of hair loss), it has become the most widely used drug worldwide. In clinical trials of long-term administration by MSD, a US company that is approved in Japan, it was reported that side effects such as decreased lipids (decreased libido), erectile dysfunction (ED), and decreased semen volume occurred in 1.1% of subjects after 48 weeks of use and 1.6% of subjects after 96 weeks of use. In addition, although the frequency is unknown, side effects such as liver dysfunction, depression, breast tenderness, and hypertrophy have also been reported. A 2011 paper by doctors at George Washington University reported 71 cases in which sexual dysfunction and psychiatric disorders such as depression persisted even after the medication was discontinued.

[0011] Age-related androgen imbalance and chronic inflammation are pathophysiological risk factors, and testosterone, the primary androgen, is essential for proper development and function of the adult prostate. However, with age, circulating testosterone levels decrease and sex hormone-binding globulin levels increase, reducing the free testosterone available to bind to androgen receptors. Type 1 or type 2 5-alpha reductase converts testosterone to dihydrotestosterone (DHT), which then binds to androgen receptors, leading to age-related diseases such as benign prostatic hyperplasia, androgenetic alopecia (AGA), and androgen-induced baldness (androgenetic alopecia). These are thought to be the result of a series of androgenic events that are initiated and propagated with age. 5-AR1 and 5-AR2 inhibitors, such as finasteride and dutasteride, are also associated with antioxidant properties. Increased antioxidant activity controls / eliminates free radicals, potentially preventing aging. However, conventional AGA treatments have been criticized for their side effects, as mentioned above. [Prior art documents] [Patent documents]

[0012] [Non-Patent Document 1] PMCID:PMC8619173 / PMID:34832950 Published online 2021 Nov 17.doi:10.3390 / ph14111168 Pharmaceuticals(Basel) [Non-patent document 2] Journal of Nara Medical Association 2008;59:33-41: Oji Yukiteru, Yoshikawa Masahide, Ishizaka Shigeaki, Regenerative medicine for hair growth [Non-patent document 3] P. Birch, H. Lashen, S. Agarwal, AGMessenger, Br. J. Dermatol., 154, 85-89 (2006) [Non-patent document 4] Tajima, C. Hamada, T. Arai, M. Miyazawa, R. Shibata, A. Ishino, J. Dermtol. Sci., 117, 1594-1600 (2001) [Non-patent document 5] J.Soc.Cosmet.Chem.Jpn.Hobun 45(1)35-40(2011) [Non-patent document 6] J Sex Med 2011;8:1747 Summary of the Invention [Problem to be solved by the invention]

[0013] The inventors of the present invention also discovered that the expression of the anti-aging gene Klotho gene becomes inactivated with age, and that a lack of the protein produced by this gene, Klotho α protein, causes hair follicle cells to shrink, which is one of the causes of hair loss. Furthermore, the inventors have discovered that as we age, the number of stem cells in hair follicles and hair matrix cells decreases, and that removing reactive oxygen species that cause gene mutations in a hydrogen-rich environment is an important factor in repairing gene mutations caused by reactive oxygen species and ultraviolet rays in the extracellular matrix and the microenvironment surrounding the stem cells. Therefore, the present invention aims to provide an injectable agent for hair growth treatment that suppresses side effects such as palpitations and shortness of breath seen in conventional AGA treatments and promotes hair regrowth.

[0014] The present invention has been made to solve the above problems, and the inventor has invented the following configuration. (1) An injectable hair growth treatment containing a compound that exhibits hair regrowth activity, which is a compound obtained by mixing nanobubble hydrogen gas with RNA that expresses Klotho-α protein, an RNA-containing extracellular vesicle that exhibits genetic activity.

[0015] Here, the compound consisting of a mixture of RNA expressing Klotho-α protein, an RNA-containing extracellular vesicle that exhibits gene activity, refers to extracellular microvesicles containing microRNA and messenger RNA. MicroRNAs are small non-coding RNA molecules, typically approximately 22 nucleotides in length. These molecules regulate gene expression. Specifically, they are known to bind to mRNA, inhibit its translation, or degrade mRNA, thereby suppressing the production of specific proteins. One substance that enhances the activity of Klotho-α protein, an RNA-containing extracellular vesicle, is the growth factor FGF23, a coactivator of KLOTHO. Furthermore, factors that regulate KL gene expression include dietary phosphorus and activated vitamin D. Vitamin D is a fat-soluble vitamin, not water-soluble like vitamins C and B, so excessive intake is not recommended. Klotho-α protein is produced by ribosomes translating mRNA in the cytoplasm. The human Klotho gene is encoded on chromosome 13. This DNA code is transcribed, and mRNA is transported from the nucleus to the cytoplasm. This mRNA is translated by ribosomes, which are responsible for protein production, and Klotho-α protein is expressed. To add these growth factors, 15cc to 90cc of the patient's own whole blood components are collected and centrifuged at 1500 to 2000 rpm for 5 to 10 minutes to separate the platelet-rich plasma (PRP) and blood cell components, and the growth factors contained in this PRP component are then mixed into the injection. The injection thus produced has the function of suppressing inflammatory responses.

[0016] (2) The present invention relates to an injectable hair growth treatment according to (1) above, characterized in that the nanobubble hydrogen gas contains 100 million to 1 billion hydrogen nanobubbles of 50 to 100 nanometers in size per cc, and the compound mixed with RNA expressing Klotho-α protein is contained in an amount of 10 μg to 50 μg per 2 to 5 cc of the injectable saline solution. Here, a feature of the present invention is that it uses nanobubble hydrogen gas containing 100 million to 1 billion hydrogen nanobubbles of 50 to 100 nanometers in size per cc. Bubbles smaller than 50 nanometers pose a risk of not being able to confirm the existence of hydrogen, while bubbles larger than 100 nanometers pose a problem of being easily crushed. Furthermore, the present invention is characterized in that the compound mixed with RNA that expresses Klotho-α protein is contained in an amount of 10 μg to 50 μg per 2 to 5 cc injection in physiological saline. If the compound containing RNA expressing Klotho-α protein is used in an amount less than 10 μg per 5 cc of saline, the problem of insufficient expression of Klotho protein will occur, while if it exceeds 50 μg per 2 cc of saline, there is a risk of causing an inflammatory reaction due to an immune response.

[0017] Next, we will explain an example of a method for generating 100 million to 1 billion hydrogen nanobubbles of 50 to 100 nanometers in size, and further mixing them with RNA that expresses Klotho-α protein, to produce a compound in a state where 10 μg to 50 μg is contained per 2 to 5 cc of injection in physiological saline. As shown in Figure 1, between syringes (5 ml to 20 ml) A and B, a carbon porous filter of the same configuration as shown in Figure 1 is placed in the stainless steel outer diameter and a double structure is placed in the inner diameter, generating hydrogen nanobubbles, and the drug solution is passed back and forth between the outer and inner cylinders 3 to 10 times. This process can be carried out using the ultrafine bubble generator described in Japanese Patent No. 6741248. That is, hydrogen nanobubbles of 100 million or more per cc are mixed from a hydrogen cylinder through a porous carbon material at a pressure of 0.01 to 0.1 MPa, thereby obtaining the nanobubble hydrogen gas used in the present invention. In particular, adenosine activation is an important factor for hair growth, and KL intervention is known to reverse age-related pathology and extend longevity by regulating the FGF23 and Wnt pathways. However, the accumulation of reactive oxygen species (ROS) in mitochondria is involved in hair follicle cell damage and aging disorders. Therefore, by providing a device that can mix nanosized hydrogen gas (100 million to 1 billion particles at 50 to 100 nanometers per 1 cc) into this injection, it is possible to make the medicinal solution contain a large amount of hydrogen, which removes active oxygen.

[0018] (3) The present invention is a method for extracting Klotho mRNA for injection by simultaneously treating isolated anagen human hair follicle units in a 24-well plate containing 500 μl of William's E solution, medium insulin, hydrocortisone, glutamine, penicillin, streptomycin, Klotho protein, TGF-β1, TGF-βRI inhibitor, and SB-431542 (Sigma-Aldrich).

[0019] (4) The present invention provides a method for producing an injectable hair growth treatment, which comprises simultaneously treating isolated anagen human hair follicle units with 500 μl of William's E in a 24-well plate, medium insulin, hydrocortisone, glutamine, penicillin, streptomycin, Klothoprotein, TGF-β1, a TGF-βRI inhibitor, and SB-431542 (Sigma-Aldrich) to extract Klotho mRNA, and then mixing the Klotho mRNA extracted by the above process with the nanobubble hydrogen gas using a nanobubble hydrogen gas generator equipped with a bubble-generating medium formed entirely or partially of a high-density composite of graphite and a non-metal and having porous chambers, a pumping means for sending gas within the bubble-generating medium, and an ozone generator for generating ozone within the bubble-generating medium. [Effects of the Invention]

[0020] The present invention has the effect of providing an injectable agent for hair growth treatment that suppresses side effects such as palpitations and shortness of breath seen in conventional AGA treatment drugs and promotes hair regrowth. [Brief explanation of the drawings]

[0021] [Figure 1] FIG. 1 is a diagram showing a process for generating nanobubble hydrogen gas. [Figure 2] FIG. 1 shows the structure of microRNA520d. DETAILED DESCRIPTION OF THE INVENTION

[0022] The method for extracting Klotho mRNA used in the present invention is described below. The following shows one embodiment of the method for extracting Klotho mRNA, and is not intended to limit the present invention. Human anagen hair follicular units (small pieces of scalp skin) were isolated and subcutaneous fat was collected (Olympus isolation device). Each anagen hair follicular unit was carefully transferred into a well plate (Corning, NY, USA) containing 500 μl of William's E. They were then co-treated in 24-well plates (Corning, NY, USA) containing 500 μl of William's E medium (Gibco BRL, Gaithersburg, MD, USA), 10· / ml insulin (Sigma Aldrich, St Louis, MO, USA), 10 ng / ml hydrocortisone (Sigma Aldrich), 2 mM L-glutamine (Gibco BRL), 100 IU / ml penicillin and 100 μg / ml streptomycin (Gibco BRL), klotho protein (catalog no. 5334KL, R&D Systems, Minneapolis, MN, USA), or klotho siRNA (Invitrogen, Carlsbad, CA, USA), 5 ng / ml TGF-β1 (R&D Systems), and the TGF-βRI inhibitor, SB-431542 (Sigma Aldrich).

[0023] For hair follicle unit cell culture, the RNA used to transfect hair follicle cells was human Klotho siRNA (catalog no. s225119, Invitrogen) or control siRNA (catalog no. sc-37007, Santa Cruz Biotechnology, Santa Cruz, CA, USA). After transfection with a transfection reagent (Santa Cruz), hair follicle units were maintained in 24-well plates in 500 μl of William's E medium (Biochrom, Cambridge, UK) supplemented with 10 μg / ml insulin (Sigma-Aldrich) and 10 ng / ml ATP. Hydrocortisone (Sigma Aldrich), 2 mM L-glutamine (Gibco BRL), 100 IU / ml penicillin and 100 μg / ml streptomycin (Gibco BRL), cDNA (1 μl) assessed by RT-PCR and Western blot was subjected to PCR with the following cycling program: denaturation at 94°C for 5 min, followed by 33 min of denaturation at 94°C for 30 s, 59°C for 30 s, 72°C for 30 s, and an additional extension at 72°C for 5 min.

[0024] The primers used were: human klotho, 5'-ACTCCCCCAGTCAGGTGGCGGTA-3', 5'-TGGGCCCGGGAAACCATTGCTGTC-3'; human GAPDH, 5'-GAAGGTGAAGGTCGGAGT-3', 5'-GAAGATGGTGATGGGATTTC-3'. For quantitative analysis of changes in klotho mRNA expression, cultured hair follicle units were transfected with klotho siRNA, and real-time PCR was performed using a Rotor-Gene™ 3000 (Corbett Life). Real-time PCR was performed using rapid cycling 1x SYBR green PCR Master Mix (Qiagen, Hilden, Germany) in a reaction volume of 10 μl, 10 μM of each primer, and 1 μl of template cDNA. The primers used to amplify each fragment were: Human klotho (forward) 5'-GGTGTCCATTGCCCTAAGCTC3', 5'-TCGGTCATTCTTCGAGGATTGA-3'; Human GAPDH (forward) 5'-ATGTTCGTCATGGGTGTGAA-3', 5'-GAAGATGGTGATGGGATTTC-3'. Amplification and detection were performed at 95°C for 15 min, followed by 45 cycles of 95°C for 15 s and 60°C for 1 min. Housekeeping gene data is used to determine Ct values ​​(the number of lines above a calculated threshold on a cycle log PCR plot) according to manufacturer guidelines. Gene expression was analyzed using the ΔCt value (Ct of target gene - Ct of housekeeping gene) as raw data.

[0025] Next, an example of a method for producing such a hair growth injection without side effects will be described. Klothoprotein is known to be involved in adenosine A2B and A2A signaling, and is involved in the expression of A2B receptors and cAMP response element binding proteins. Binding of A2B and A2A to Gs proteins increases cAMP production. These receptors can be activated by adding allosteric modulators. Allosteric modulators include benzodiazepines, diazepam, alprazolam, and chlordiazepoxide, which modulate GABA receptors, and cinacalcet, which modulates calcium-sensing receptors.

[0026] Klothoprotein is known to play an important role in the maintenance and function of skeletal muscle in sarcopenia, a known age-related disease. The four hallmarks of sarcopenia are muscle dysfunction, loss of muscle mass, accelerated aging, and impaired regenerative potential. These are associated with decreased levels of KL and A2B (reference: Hung-Liang Pai et al. Am J Pathol. 2023 Jul.). Therefore, activation of Klotho protein can increase the levels of A2B and A2A receptors, thereby activating adenosine transmission and improving the deterioration of aging conditions and impaired regenerative potential. MicroRNA 520d and other RNAs are involved in the activation of Klotho protein. Addition of microRNA 520d activates the aging-related genome repair interactions and enhances Klotho protein expression.

[0027] Next, a method for obtaining microRNA 520d will be described. Figure 2 shows the structure of microRNA 520d. As shown in Figure 2, a lentiviral vector having the sequence of 5'LTR CUACAAAGGGAAGCCCUUUC, AAAGUGCUUCUCUUUGGUGGGU is constructed. The promoter used is hTERT, and the terminal codons are TAG, TGA, and TAA. Lentiviral vectors containing these sequences are transfected into 293T cells, and the resulting cell culture supernatant is centrifuged to collect exosomes. The collected exosomes are then mixed with the culture medium of HeLa cells. When Hela cells undergo apoptosis, the supernatant is collected and centrifuged to collect exosomes containing microRNA520d. The centrifugation process for exosome recovery involves 10 minutes at 3,000 × g to recover apoptotic bodies, followed by 20 minutes at 16,500 × g to recover extracellular microvesicles, and then the supernatant is recovered, followed by 120,000 × g to recover 50-60 nanometer-sized extracellular microvesicles. The extracellular vesicles recovered by this treatment contain exosomes containing microRNA520d, and when combined with KLOTHOα protein, they stimulate hair follicle cell growth and fibroblasts. The activity of fibroblasts significantly stimulates the production of collagen and hyaluronic acid in the extracellular matrix. The reduction in hair follicle cells and the inhibition of regeneration are related to stem cell depletion and collagen deficiency, and adding growth factors to supplement these is also effective. When adding growth factors such as HGF1, FGF, and PDGF to this injection, it is recommended to centrifuge 15 cc of the patient's own whole blood components at 1,500 rpm for 5 minutes to separate the platelet-rich plasma (PRP) and blood cell components, and then mix them with the growth factors contained in the PRP components. A solution to collagen 17 deficiency would be to incorporate PTEN protein.

[0028] Next, we will describe the results of a treatment using an injection for hair growth treatment containing a compound containing RNA expressing Klotho alpha protein, an RNA-containing extracellular vesicle that exhibits genetic activity according to the present invention, as a compound active in promoting hair regrowth. By injecting 2 mL of the injection solution according to this embodiment into the scalp using nine 30-gauge needles (per 2 injections) to a depth of 0.8 mm to 1.5 mm (scalp thinning area 5 to 10), 4 to 5 times at intervals of 1 week to 10 days, hair density will increase by 30% to 40% over a period of 1 to 2 months. Minoxidil, known as an active ingredient in hair growth products, has the effect of promoting the proliferation of hair follicle epithelium, and it has been reported that part of its mechanism of action is through the activation of adenosine receptors in the upregulation of vascular endothelial growth factor (VEGF).It has also been revealed that the action of adenosine promotes the expression of growth factors such as fibroblast growth factor 7 (FGF-7). The problem with minoxidil is that it was developed by Upjohn, now Pfizer, and was used as an antihypertensive drug to treat high blood pressure, but because patients who took it were found to develop hirsutism, it was once again researched as a hair growth agent, and as a result, it is now widely used around the world.

[0029] In Japan, it has been approved by the Ministry of Health, Labor and Welfare and is used as a hair loss treatment drug in many medical institutions. There are a number of known side effects associated with the use of minoxidil. Initial hair loss, effects on the liver, nausea and shortness of breath, redness of the face, hirsutism, swelling, dizziness, heart disease. In particular, oral minoxidil is carried throughout the body by the blood, so it can cause not only hair to grow but also hair all over the body to grow and thicken. Therefore, if someone who is troubled by thick body hair uses minoxidil, their problems may actually worsen. Minoxidil also promotes blood flow, which causes the heart to try to supply excess blood. It is often thought that the better the blood flow, the easier it is for hair to grow, but it is known that this is not necessarily the case.

Claims

1. An injectable hair growth treatment preparation characterized by containing, as a compound exhibiting hair regrowth activity, a compound obtained by mixing nanobubble hydrogen gas with RNA expressing Klotho-α protein, which is an RNA-containing extracellular vesicle exhibiting genetic activity.

2. 2. The injectable hair growth treatment according to claim 1, wherein the nanobubble hydrogen gas contains 100 million to 1 billion hydrogen nanobubbles of 50 to 100 nanometers in size per cc, and the compound mixed with RNA expressing Klotho-α protein is contained in an amount of 10 μg to 50 μg per 2 to 5 cc of the injectable saline solution.

3. A method for extracting Klotho mRNA for injection was produced by simultaneously treating isolated anagen human hair follicle units in a 24-well plate containing 500 μl of William's E medium, insulin, hydrocortisone, glutamine, penicillin, streptomycin, Klotho protein, TGF-β1, TGF-βRI inhibitor, and SB-431542 (Sigma-Aldrich).

4. A method for producing an injectable preparation for hair growth treatment, comprising: extracting Klotho mRNA from isolated human hair follicle units in the anagen phase by simultaneously treating them with 500 μl of William's E in a 24-well plate, medium insulin, hydrocortisone, glutamine, penicillin, streptomycin, Klotho protein, TGF-β1, a TGF-βRI inhibitor, and SB-431542 (Sigma-Aldrich); and mixing the Klotho mRNA extracted by the above process with the nanobubble hydrogen gas using a nanobubble hydrogen gas generator equipped with a bubble-generating medium formed entirely or partially of a high-density composite of graphite and a non-metal and having porous chambers, a pumping means for sending gas within the bubble-generating medium, and an ozone generator for generating ozone within the bubble-generating medium.