Novel recombinant lysins and their use in the treatment of gram-negative bacterial infections

Abstract

Pharmaceutical compositions containing novel recombinant lysins for the treatment of gram-negative bacterial infections are provided. [Solution] A pharmaceutical composition comprising a protein containing or consisting solely of a specific amino acid sequence or a variant sequence or fragment having at least 90% identity thereto, wherein the variant or fragment has residues corresponding to E15, D24, T33 and R139 of the specific amino acid sequence, and the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of the specific amino acid sequence.

Description

[Technical Field]

[0001] The present invention relates to the fields of clinical and veterinary microbiology, and in particular to a new recombinant lysin and its use as an antimicrobial agent in a new therapeutic approach to eliminate antibiotic-resistant Gram-negative bacteria and minimize the emergence of new resistance. [Background technology]

[0002] Since the introduction of antibiotics in the 1940s, these powerful compounds have been used to cure infections in humans and animals, eliminate surface microorganisms, and even preserve food (Non-Patent Document 1). However, bacteria soon began to show signs of resistance to these antibiotics, with the first penicillin-resistant staphylococcus detected in 1946 (Non-Patent Document 2, Non-Patent Document 3). The overuse and misuse of antibiotics has led to the emergence and spread of antibiotic resistance in nearly all pathogenic bacteria, with some even resistant to all available antibiotics. Antibiotic-resistant bacteria are capable of growing in the presence of antibiotics that typically kill or limit their growth, whereas multidrug-resistant (MDR) bacteria are capable of growing in the presence of two or more unrelated antibiotics. In clinical settings, inappropriate use of antibiotics (e.g., the use of broad-spectrum antibiotics in viral infections) accounts for 20% to 50% of all antibiotic consumption (Non-Patent Document 4, Non-Patent Document 5). In the food industry, antibiotics have been used in livestock farming to promote animal growth, as prophylactics, and to treat infections in these animals (Non-Patent Document 6). The indiscriminate use of antibiotics in the food industry for purposes other than infection treatment has led to the emergence of resistant pathogens in industrial production environments. Currently, a variety of antimicrobial drugs are used for medical purposes in livestock, poultry, and aquaculture. Because some of these drugs, such as fluoroquinolones, are essential for treating Gram-negative bacterial infections in humans, the efficacy of these antibiotics could be compromised by the emergence of resistance in zoonotic pathogens (Non-Patent Document 7). As a result of the emergence and spread of pathogenic MDR bacteria, there is growing awareness of the risk of entering a post-antibiotic era in which it will be impossible to effectively treat common bacterial infections (Non-Patent Document 8). Several international studies have predicted a series of catastrophic global scenarios if we do not find a rapid approach to antimicrobial resistance. These studies predict 10 million deaths per year by 2050 (Non-Patent Documents 9 and 10). This risk, along with the currently very limited development of new therapies, means that alternative antimicrobials, preferably those with novel mechanisms of action to minimize the emergence of resistance, must be sought.

[0003] In response to these problems, various international organizations, such as the Food and Agriculture Organization of the United Nations (FAO), the World Organization for Animal Health (OIE) or the World Health Organization (WHO), have published numerous documents on the subject. In this context, the European Commission has called on Member States to draw up action plans against antimicrobial resistance, stressing the need for a multifaceted (human and veterinary) perspective to be truly effective in combating the emergence and spread of antibiotic resistance.

[0004] In Spain, in response to a request from the European Commission, the Ministry of Health, Consumer Affairs and Social Welfare (MSCBS) has launched the National Plan against Antibiotic Resistance (Plan Nacional frente a la Resistencia a los Antibioticos-PRAN). This plan includes a set of common programs and strategic directions for human and animal health, such as the voluntary reduction of the consumption of certain antibiotics in various animal species. In particular, the main Spanish association of poultry producers (Organizacion Interprofesional de la Avicultura de Carne de Pollo-PROPOLLO) has set as its main goal a 45% reduction in total antibiotic consumption in the Spanish poultry industry within two years, in addition to the complete elimination of antibiotic use in animal feed. In the specific case of colistin, an 80% reduction from the current 4.7 mg / kg to 1 mg / kg is expected. The goal is to achieve this.

[0005] Therefore, the development of new antimicrobial agents and new therapeutic approaches to eliminate resistant microorganisms and minimize the emergence of new resistance to antimicrobial drugs is currently an urgent priority. More promising alternatives or complementary alternatives to conventional antibiotics include bacteriophages (phages) and their lytic enzymes (Non-Patent Documents 11 and 12). Bacteriophages are among the most abundant biological entities in nature, and their potential as therapeutic agents has been widely recognized even before the discovery of antibiotics (Non-Patent Document 13). However, in the West, bacteriophages have been sidelined since the advent of antibiotics. The current problems caused by resistant microorganisms have sparked renewed interest in bacteriophages as potential candidates for the treatment of infections, particularly those caused by multidrug-resistant microorganisms (Non-Patent Document 13). Various research groups are attempting to develop strategies to use intact phages as alternatives to antibiotics. Furthermore, research is also underway to isolate and optimize phage components as antimicrobial agents, opening new avenues for the treatment of multidrug-resistant infections.

[0006] In particular, phage lysins are used by bacteriophages to degrade the peptidoglycan (PG) of their bacterial host from the inside at the end of their replication cycle, resulting in cell lysis and the release of progeny virus particles. It has been reported that this bactericidal effect persists even when lysins act exogenously ("from the outside") on bacteria, especially in the case of Gram-positive bacteria, which, unlike Gram-negative bacteria, lack an outer membrane and therefore have a more exposed cell wall. This property makes this type of enzyme useful as an antimicrobial agent, also known as an "enzybiotic." (Non-Patent Document 14, Non-Patent Document 15) This has been widely documented in the literature, demonstrating that lysins can be used as therapeutic agents for the prevention of infections with group A streptococci (Non-Patent Document 16) or for the suppression of sepsis caused by infections with Enterococcus faecalis and Enterococcus faecium (Non-Patent Document 17), Clostridium perfringens (Non-Patent Document 18), group B streptococci (Non-Patent Document 19), and Streptococcus pneumoniae (Non-Patent Document 20).

[0007] The advantage of endolysins compared to conventional antibiotics is their high specificity for certain PG types; their antimicrobial activity is generally limited to members of a particular bacterial genus, species, or even serotype. This near-species specificity significantly reduces the risk of the development of resistant (commensal) strains, often associated with the use of broad-spectrum antibiotics, and allows for the selective killing of a given target pathogen without affecting commensal bacteria or desirable organisms of the associated microflora (Non-Patent Document 15). Another advantage of PG hydrolases is that they are not only effective against growing cells, but also target non-dividing or slowly growing cells, such as biofilms.

[0008] In recent years, huge investments have been made to obtain recombinant lysins with improved properties, making lysin derivatives one of the most promising alternatives in the fight against antibiotic-resistant bacteria. These improved properties include increased lytic activity (Non-Patent Document 21, Non-Patent Document 22), broadened bactericidal spectrum (Non-Patent Document 23, Non-Patent Document 24, Non-Patent Document 25, Non-Patent Document 26), and application of lysins to Gram-negative bacteria (Non-Patent Document 27, Non-Patent Document 28, Non-Patent Document 29, Non-Patent Document 30, Patent Document 1, and Patent Document 2).

[0009] Gram-negative bacteria are inherently resistant to many antibiotics due to the permeability barrier provided by their unique cell envelope. This envelope consists of only an outer membrane (OM) and an inner membrane (IM) separated by the periplasmic space. The OM is an asymmetric lipid bilayer in which phospholipids are distributed exclusively in the inner leaflet, while the lipid A portion of lipopolysaccharide (LPS) forms the outer leaflet. The OM is a bilayer. The LPS layer of the OM is an important component in providing a protective layer against harmful compounds in the extracellular environment. The IM is a normal phospholipid bilayer. Between the two membranes is the periplasm, a viscous intracellular compartment in which the peptidoglycan layer is located (Non-Patent Document 31).

[0010] Treatment of Gram-negative bacteria with lysins has been more challenging because the outer membrane (OM) prevents lytic enzymes from accessing PG from the outside of the bacteria. The OM is impermeable to macromolecules and allows only limited diffusion of hydrophobic substances through its LPS-covered surface (Non-Patent Document 32). Endolysins are characterized by a modular structure, often containing multiple lytic domains and / or cell wall-binding domains (CBDs). Recombinant constructs that promote OM translocation have recently been described to render lysins active against Gram-negative bacteria (Non-Patent Document 14, Non-Patent Document 15).

[0011] One approach involves fusing PG hydrolases to various cationic, polycationic, or other membrane-disrupting peptides, as described in US Pat. No. 5,629,297 or US Pat. No. 5,629,298. An alternative approach involves fusing them to peptides with OM-penetrating properties. In particular, Non-Patent Document 29 describes the fusion of E. coli bacteriophage lysin (Lysep3) fused to the D8 domain of Lys1521 from the Bacillus amyloliquefaciens phage, which contains two cationic regions. It has been described (Non-Patent Document 33). It has been reported in Non-Patent Document 29 that the Lysep3 / D8 fusion protein has lytic activity against both Gram-negative and Gram-positive bacteria. In particular, it is mentioned that the lytic effect was observed against 14 strains of E. coli, 3 strains of Pseudomonas aeruginosa, 1 strain of Acinetobacter baumannii, and 1 strain of Streptococcus. Therefore, this chimeric endolysin is not selective for Gram-negative bacteria. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] International Publication No. 2015 / 200783 [Patent Document 2] International Publication No. 2017 / 049233 [Patent Document 3] International Publication No. 2010149792 [Patent Document 4] International Publication No. 2011023702 [Non-patent literature]

[0013] [Non-Patent Document 1] Farber, L. et al. 1959 [Non-patent document 2] Davies, J. & Davies, D. 2010 [Non-patent document 3] Frankel, R.B. et al. 2006 [Non-patent document 4] Tenover, F.C. 2006 [Non-Patent Document 5] Starrels, JL et al. 2009 [Non-patent document 6] Lekshmi M. et al. 2017

Non-licensed Document 7

Non-licensed Document 8

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

Non-licensed Document 21

Non-licensed Document 22

Non-licensed Document 23

Non-licensed Document 24

[0014] Despite recent advances, however, there is a continuing need to search for novel lysins with improved properties to eradicate MDR bacteria and successfully prevent further resistance development. In particular, there is an ongoing need to identify new lysins that are capable of lysing Gram-negative bacteria upon exogenous administration, are nontoxic, and are specific for a narrow range of closely related pathogens. Among Gram-negative bacteria, antibiotic resistance in Escherichia coli is of particular concern, as it is the most common Gram-negative pathogen in humans. For example, in 2017, European surveillance showed that the prevalence of MDR E. coli ranged from 12% to 50% (European Centre for Disease Prevention and Control. Surveillance of antimicrobial resistance in Europe - Annual report of the European Antimicrobial Resistance Surveillance Network (EARS-Net) 2017. Stockholm: ECDC; 2018).

[0015] Additionally, there is a need to discover new recombinant lysins with desirable safety, efficacy, and selectivity to replace and / or reduce the use of antibiotics (e.g., by using the lysin in combination with antibiotics) in the treatment of Gram-negative infections, such as those caused by E. coli, K. pneumoniae, P. aeruginosa, and / or Acinetobacter species. [Means for solving the problem]

[0016] In one aspect, the present invention provides a new recombinant endolysin that comprises a domain with PG hydrolase activity and a cell-penetrating domain that increases the permeability of the OM.

[0017] The chimeric protein of the present invention has been shown to exhibit high bactericidal efficacy against Gram-negative bacteria, particularly E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa. The inventors have also shown that this new enzybiotic is safe for mammalian cells and has a significant degree of selectivity against Gram-negative bacteria, particularly E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa, without affecting Gram-positive bacteria from the chicken microbiota.

[0018] In vitro experiments were performed using the chimeric protein of the present invention (i.e., IKB206). In the assay, it was observed that the chimeric enzyme, at a very low concentration (5 μg / mL), was able to significantly reduce the number of E. coli ATCC 25922 serotype O6 reference strain (Minogue et al., 2014), which is often used for quality control testing, in 15 minutes. (Figure 3). Furthermore, increasing the concentration of IKB206 to 15 μg / mL was able to significantly reduce cell numbers in just 5 minutes, and incubating the cells for 30 minutes was able to kill all cells present in suspension (5 log). These results were obtained at a dose as low as 15 μg / mL and without the use of membrane-disrupting agents. Furthermore, the enzyme was able to kill the entire culture in just 15 minutes of incubation at a concentration of 60 μg / mL.

[0019] Surprisingly, the obtained efficacy is significantly higher than that described in Non-Patent Document 29, in which the E. coli bacteriophage lysin (Lysep3) was fused to the D8 domain of Lys1521 from the Bacillus amyloliquefaciens phage (Non-Patent Document 33, Orito Y. et al. 2004).

[0020] Indeed, in Non-Patent Document 29, the assay was performed at a protein concentration of 60 μg / mL, whereas in the case of the chimeric protein of the present invention, a bactericidal effect (greater than 3 log reduction) was observed at a concentration of 15 μg / mL, i.e., a 4-fold lower amount, after only 15 minutes of incubation (see Figures 3A and 3B). Furthermore, the chimeric protein of the present invention was shown to be able to kill all cells in only a 30-minute incubation period, whereas the protein of Wang, S. et al. only achieved a 1-log or 2-log reduction after a 2-hour incubation period. In addition, Wang, S. et al. Although we were unable to demonstrate bactericidal activity against the related E. coli serotype O157:H7, the chimeric lysin of the present invention exhibited excellent activity against this serotype (FIGS. 4A and 4B).

[0021] Furthermore, the bactericidal activity of IKB206 was also determined against an MDR E. coli strain isolated from a chicken. It was observed that IKB206 at 15 μg / mL was able to achieve a significant 2-log to 5-log (100-fold to 100,000-fold) reduction in the number of bacteria present in the assay after 30 minutes of incubation (Figure 5).

[0022] On the other hand, IKB206 exhibited high bactericidal activity against the tested K. pneumoniae, A. baumannii, and P. aeruginosa strains, including antibiotic-resistant strains (Figures 7 and 8). IKB206 exhibits bactericidal activity against all strains tested at a concentration of 15 μg / mL and an incubation time of 120 minutes. Furthermore, at a concentration of 150 μg / mL and an incubation time of 120 minutes, the chimeric protein is able to kill all cells present in the assay.

[0023] It is well known that the composition of the gut microbiota has a profound impact on both human and animal health through a wide range of mechanisms, including immune function regulation (Hooper, LV et al. 2012), metabolic homeostasis regulation (Ley, RE et al. 2006, Cani, PD & Delzenne, NM 2009), and drug metabolism regulation (Claus, SP et al. 2011). Antimicrobial use has been associated with a decline in microbiota diversity with a subsequent decline in metabolism (Schulfer AF et al. 2018, Le Roy, CI et al. 2019). Therefore, determining whether antimicrobials affect the host microbiota is crucial. It is important to do so.

[0024] To determine whether the chimeric proteins of the present invention have a killing effect on other bacteria present in the gut microbiota of chickens, in vitro assays were performed using IKB206 to determine its bactericidal effect on various bacterial species that are part of the gut microbiota of chickens. In the assays described above, the species studied as part of the gut microbiota of domestic chickens were IKB206. It was observed that the treatment was not affected by 206, resulting in a safe treatment in terms of the intestinal microbiota (Figure 6).

[0025] Structural modeling and sequence alignment of the domains suggested that the catalytic domain of IKB206 belongs to a T4 lysozyme-like endolysin, with residues E15, D24, and T33 forming the catalytic triad of the enzyme (Fig. 9).

[0026] Surprisingly, we found that the catalytic domain (SEQ ID NO: 1) itself possesses intrinsic bactericidal activity against Gram-negative bacteria. In particular, IKB206ΔD8 at a concentration of 15 μg / mL was found to induce an approximately 3-log reduction in CFU / mL of E. coli strain ATCC 25922 after 60 minutes, reaching an approximately 5-log reduction at 180 minutes ( FIG. 10 ).

[0027] Based on these results, we performed a series of in vivo assays in a zebrafish animal model. As shown in Figure 11, IKB206 exhibited a protective effect against death due to E. coli ATCC 25922 infection, particularly at a dose of 1 μg / g (66.6% survival).

[0028] Furthermore, toxicity studies on human cells were performed in vitro (Figure 12). It was observed that protein IKB206 was not toxic at the concentrations / doses tested. These results suggest that the recombinant lysin of the present invention is safe for use in the prophylactic and / or therapeutic treatment of infections caused by Gram-negative bacteria, such as E. coli, in humans or animals.

[0029] Finally, we evaluated the potential synergistic effects of the chimeric proteins of the present invention in combination with some of the most commonly used antibiotics against MDR E. coli strains, particularly carbapenem antibiotics. Checkerboard experiments suggested synergistic effects for meropenem and imipenem (Tables 3 and 4 and Figures 13A and 13B). These results were confirmed by bacterial killing assays using E. coli ATCC 25922 strain (Figures 14A and 14B).

[0030] Thus, in a first aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) A protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 60% identity thereto, wherein the variant has conservative amino acid changes and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1, wherein the protein does not consist of SEQ ID NO: 1.

[0031] In a second aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a variant sequence having at least 60% identity thereto or a fragment of either thereof, wherein the variant has conservative amino acid changes and wherein the variant or fragment is a biologically active polypeptide, in particular wherein the variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; b) A polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or a variant sequence having at least 60% identity thereto or a fragment of any of them, wherein the variant has conservative amino acid changes, and wherein the variant or fragment is a biologically active polypeptide, in particular, wherein the variant or fragment has at least some of the cell penetrating activity of SEQ ID NO: 2. a polypeptide having at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% The present invention relates to a chimeric protein comprising:

[0032] In a third aspect, the present invention relates to polynucleotides comprising nucleic acid molecules that encode the proteins (including chimeric proteins) described herein.

[0033] In a fourth aspect, the present invention further relates to a vector comprising a polynucleotide described herein.

[0034] In a fifth aspect, the present invention relates to a host cell comprising a vector described herein.

[0035] In a sixth aspect, the present invention provides a method of making a protein (including a chimeric protein) of the present invention, comprising the steps of: i. introducing a vector containing a polynucleotide described herein into a suitable host cell; ii. culturing the host cell under conditions suitable for expression of the protein; iii. optionally isolating and / or purifying said protein; The present invention relates to a method, including:

[0036] In a seventh aspect, the present invention relates to a composition comprising a protein (including a chimeric protein), polynucleotide, vector or host cell described herein.

[0037] In an eighth aspect, the present invention provides a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and a chimeric protein described herein), a polynucleotide, a vector or a host cell or a pharmaceutical composition (hereinafter collectively referred to as "an active substance according to the present invention") described herein for use in the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0038] In a ninth aspect, the present invention relates to the use of a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and a chimeric protein described herein), polynucleotide, vector, host cell or pharmaceutical composition described herein in the manufacture of a medicament for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0039] In a tenth aspect, the present invention relates to a method for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria, comprising administering to a subject diagnosed with, at risk of or exhibiting symptoms of a bacterial infection, an effective amount of a composition containing a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotide, vector or host cell described herein.

[0040] In an eleventh aspect, the present invention relates to a process for preparing a pharmaceutical composition comprising mixing one or more of the proteins (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, vectors or host cells according to the present invention with a pharmaceutically acceptable carrier, vehicle or excipient.

[0041] In a twelfth aspect, the present invention relates to a kit comprising a protein as defined herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, vectors, host cells or compositions, alone or in combination.

[0042] In a thirteenth aspect, the present invention relates to an in vitro method for inhibiting the growth of, or reducing the population of, Gram-negative bacteria, or killing Gram-negative bacteria, comprising contacting the bacteria with a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, and the proteins and chimeric proteins described herein), polynucleotide, vector, host cell or composition described herein.

[0043] In a fourteenth aspect, the present invention provides a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and chimeric protein described herein), polynucleotide or expression vector or host cell, wherein the protein or encoded polypeptide has the property of inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria.

[0044] In a fifteenth aspect, the present invention also relates to an agent of the present invention as described herein (e.g., a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), a polynucleotide, an expression vector or a host cell), or a pharmaceutical composition comprising same, for use in a method for treating and / or preventing a Gram-negative bacterial infection as described herein, wherein said treatment comprises administering an agent of the present invention as described herein in combination with another drug.

[0045] The present invention also relates to the use of an agent of the present invention as described herein in the manufacture of a medicament for the treatment and / or prevention of a Gram-negative bacterial infection as described herein by combination therapy using an agent of the present invention as described herein and another drug, preferably an antibiotic, as described herein.

[0046] The present invention further relates to a method for treating and / or preventing a gram-negative bacterial infection as described herein, comprising administering to a patient in need of such treatment a therapeutically effective amount of an agent of the invention as described herein in combination with a therapeutically effective amount of another drug, preferably an antibiotic, as described herein.

[0047] In a further aspect, the present invention relates to the use of the proteins described herein (including the protein consisting of the amino acid sequence of SEQ ID NO: 1, the proteins and chimeric proteins described herein) as disinfectants for materials and / or surfaces in hospitals as well as in the general household. [Brief explanation of the drawings]

[0048] [Figure 1]A) Top, Schematic of IKB206 (SEQ ID NO: 3). Numbers indicate amino acid positions. White boxes correspond to phage Arya endolysin, and black boxes correspond to B. amyloliquefaciens phage lysin domain D8. Bottom, Amino acid sequence of chimeric IKB206. Letters in white boxes correspond to amino acids of phage Arya endolysin, and letters in black boxes correspond to amino acids of B. amyloliquefaciens phage lysin domain D8. B) Top, Schematic of IKB206 tag (SEQ ID NO: 5). Numbers indicate amino acid positions. Black and white square boxes correspond to S tag and thrombin cleavage site, white box corresponds to phage Arya endolysin, black box corresponds to B. amyloliquefaciens phage lysin domain D8, and hatched box corresponds to thrombin cleavage site and His tag. Bottom, amino acid sequence of the chimeric IKB206 tag. Bold letters correspond to amino acids of the S-tag and His-tag, underlined letters correspond to amino acids of the thrombin cleavage site, letters in white boxes correspond to amino acids of the phage Arya endolysin, and letters in black boxes correspond to amino acids of the B. amyloliquefaciens phage lysin domain D8. C) Top, Schematic of IKB206ΔD8 (SEQ ID NO: 1). Numbers indicate amino acid positions. White boxes correspond to phage Arya endolysin. Bottom, amino acid sequence of IKB206ΔD8. [Figure 2] FIG. 1 shows 4% to 12% SDS-polyacrylamide gel electrophoresis of A) purified IKB206 tag, B) purified IKB206, and C) IKB206ΔD8. [Figure 3]Figure 1 shows the bactericidal effect of IKB206 tag on E. coli strain ATCC 25922. E. coli cultures were resuspended in buffer, the bacterial suspension was adjusted to 10 colony-forming units (CFU) / mL, and the cultures were incubated for 2 hours at 37°C in the absence (buffer) or presence of enzyme. Data are representative of four independent experiments. Viable cells were determined by counting in LB agar plates. A) Bactericidal effect of expressed IKB206 tag on the reduction in CFU / mL over time in the presence of different enzyme concentrations. B) Bactericidal effect of expressed IKB206 tag on the reduction in log counts over time in the presence of different enzyme concentrations. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to one-way ANOVA followed by Tukey's test for samples showing normal distribution and homogeneity of variance, and Kruskal-Wallis test followed by Mann-Whitney U test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 4] Figure 1 shows the bactericidal effect of the IKB206 tag on E. coli serotype O157:H7. E. coli cultures were resuspended in buffer, the bacterial suspension adjusted to 10 CFU / mL, and the cultures were incubated for 2 hours at 37°C in the absence or presence of enzyme. Data are representative of five independent experiments. Viable cells were determined by counting in LB agar plates. A) Bactericidal effect of expressed IKB206 tag on the reduction in CFU / mL over time in the presence of 15 μg / mL of enzyme. B) Bactericidal effect of expressed IKB206 tag on the reduction in log counts over time in the presence of 15 μg / mL of enzyme. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to a T-test for samples showing normal distribution and homogeneity of variance, and a Mann-Whitney U-test for samples showing no normal distribution or heterogeneity of variance. [Figure 5]Figure 1 shows the bactericidal effect of IKB206 tag on a multidrug-resistant strain of E. coli. E. coli cultures were resuspended in buffer, the bacterial suspension adjusted to 10 CFU / mL, and the cultures were incubated for 2 hours at 37°C in the absence or presence of enzyme. Data are representative of three to five independent experiments. Viable cells were determined by counting in LB agar plates. A, C, and E) Bactericidal effect of expressed IKB206 tag on the reduction in CFU / mL over time in the presence of 15 μg / mL of enzyme. B, D, and F) Bactericidal effect of expressed IKB206 tag on the reduction in log counts over time in the presence of 15 μg / mL of enzyme. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to a T-test for samples showing normal distribution and homogeneity of variance, and a Mann-Whitney U-test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 6] Figure 1 shows the bactericidal effect of IKB206 tag on various strains of chicken microbiota. Cultures were resuspended in buffer, the bacterial suspension adjusted to 10 CFU / mL to 10 CFU / mL, and cultures were incubated for 2 hours at 37°C in the absence or presence of enzyme. Data are representative of four or five independent experiments. Viable cells were determined by counting in LB agar plates. A, C, E, and G) Bactericidal effect of expressed IKB206 tag on the reduction in CFU / mL over time in the presence of 15 μg / mL of enzyme. B, D, F, and H) Bactericidal effect of expressed IKB206 tag on the reduction in log counts over time in the presence of 15 μg / mL of enzyme. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to a T-test for samples showing normal distribution and homogeneity of variance, and a Mann-Whitney U-test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 7]Figure 1 shows the bactericidal effect of IKB206 on Enterobacterial species other than E. coli. Cultures were resuspended in buffer, the bacterial suspension adjusted to approximately 10 CFU / mL to 10 CFU / mL, and the cultures were incubated for 2 hours at 30°C (E. cloacae and S. marcescens) or 37°C (C. freundii and K. pneumoniae) in the absence or presence of enzyme. Data are representative of two to four independent experiments. Viable cells were determined by counting in LB agar plates. A, C, E, G, I, K, and M) Bactericidal effect of expressed IKB206 on the reduction of CFU / mL over time in the presence of 15 μg / mL or 150 μg / mL of enzyme. B, D, F, H, J, L, and N) Bactericidal effect of expressed IKB206 on log reduction over time in the presence of 15 μg / mL or 150 μg / mL of enzyme. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to control (buffer) according to a T-test for samples showing normal distribution and homogeneity of variance, and a Mann-Whitney U-test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 8] Figure 1 shows the bactericidal effect of IKB206 on other non-enterobacterial Gram-negative bacterial species. Cultures were resuspended in buffer, the bacterial suspension adjusted to approximately 10 CFU / mL to 10 CFU / mL, and the cultures were incubated for 2 hours at 37°C in the absence or presence of enzyme. Data are representative of four independent experiments. Viable cells were determined by counting in LB agar plates. A, C, E, and G) Bactericidal effect of expressed IKB206 on the reduction in CFU / mL over time in the presence of 15 μg / mL or 150 μg / mL of enzyme. B, D, F, and H) Bactericidal effect of expressed IKB206 on the reduction in log counts over time in the presence of 15 μg / mL or 150 μg / mL of enzyme. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to a T-test for samples showing normal distribution and homogeneity of variance, and a Mann-Whitney U-test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 9] Structural model of the catalytic domain of IKB206. (A) Structural model of the catalytic domain of IKB206. The model was constructed using the online server Phyre2 (Kelley LA et al. 2015). Secondary structure elements are shown as light gray sketches, and putative catalytic residues are shown as sticks. (B) Structural model of the D8 domain of IKB206. The model was constructed using the online server Swissmodel (Waterhouse A et al. 2018). Secondary structure elements are shown as gray sketches. (C) Structural alignment and (D) sequence alignment of the catalytic residues of T4 lysozyme (Daopin S et al. 1991), DLP12 endolysin (Babu K et al. 2018), P22 lysozyme (Mooers BH et al. 2006), and AB 5075UW muramidase (Sykilinda NN et al. 2018) (PDB codes 1L48, 4ZPU, 2ANV, and 6ET6, respectively). The catalytic residues superimposed on E15, D24, and T33 of IKB206 are shown as sticks (C) and asterisks (D). [Figure 10] Figure 1 shows the bactericidal effect of IKB206ΔD8 on E. coli strain ATCC 25922. E. coli cultures were resuspended in buffer, the bacterial suspension was adjusted to 10 colony-forming units (CFU) / mL, and the cultures were incubated for 2 hours at 37°C in the absence (buffer) or presence of enzyme. Data are representative of three independent experiments. Viable cells were determined by counting in LB agar plates. A) Bactericidal effect of expressed IKB206ΔD8 on the reduction in CFU / mL over time in the presence of different enzyme concentrations. B) Bactericidal effect of expressed IKB206ΔD8 on the reduction in log counts over time in the presence of different enzyme concentrations. Error bars represent standard error. Asterisks indicate significant differences (*P<0.05; **P<0.005; ***P<0.0005) relative to the control (buffer) according to one-way ANOVA followed by Tukey's test for samples showing normal distribution and homogeneity of variance, and Kruskal-Wallis test followed by Mann-Whitney U test for samples not showing normal distribution or showing heterogeneity of variance. [Figure 11] Figure 1 shows survival curves of zebrafish in infection experiments. The lines represent the survival of zebrafish treated or not with different concentrations of IKB206 tag. The black line corresponds to zebrafish treated with 1 μg / g, the dark gray line corresponds to zebrafish treated with 0.5 μg / g, the light gray line corresponds to zebrafish treated with 0.25 μg / g, and the dotted line corresponds to untreated zebrafish. Twelve zebrafish per condition were infected with 5.5 × 10 CFU / mL of E. coli ATCC 25922. The results were statistically significant (P = 0.001) when comparing treated zebrafish with untreated controls (Mantel-Cox test). [Figure 12] Cytotoxicity assay on human HEK293 cells. A concentration range of 50 μg / mL to 400 μg / mL was analyzed for cytotoxicity. Culture medium in which the cells were grown was used as a negative control. Data are the average of three independent experiments and were statistically analyzed by Tukey's test. [Figure 13] Figure 1 depicts isobolograms of (A) IKB206 tag + meropenem and (B) IKB206 tag + imipenem. Points below the dotted line representing the MIC are found to have a synergistic effect. [Figure 14] Synergy studies using bacterial killing studies: (A) Meropenem and IKB206 tag. (B) Imipenem and IKB206 tag. DETAILED DESCRIPTION OF THE INVENTION

[0049] definition As used herein, a "polynucleotide" or "nucleic acid" sequence refers to a DNA or RNA sequence, preferably a DNA sequence. This term includes, but is not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxymethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylamino Included are sequences containing any of the known base analogs of DNA and RNA, such as N-methyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueousine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxocine, pseudouracil, queousine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queousine, 2-thiocytosine, and 2,6-diaminopurine.

[0050] As used herein, a "coding sequence," i.e., a sequence that "encodes" a gene product, refers to a nucleic acid sequence that is transcribed (in the case of DNA) and translated (in the case of mRNA) in vitro or in vivo when placed under the control of appropriate regulatory sequences.

[0051] As used herein, the terms DNA "control sequence" and "control element" refer collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, etc., which collectively effect the replication, transcription, and translation of a coding sequence in a recipient cell. Not all of these control sequences / elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed, and translated in an appropriate host cell.

[0052] As used herein, "operably linked" refers to an arrangement of elements configured so that the components so described perform their normal function. Thus, control sequences operably linked to a coding sequence are capable of effecting expression of the coding sequence. Control sequences need not be contiguous with the coding sequence, so long as they function to direct its expression. Thus, for example, intervening sequences that are not translated but are transcribed can be present between the promoter sequence and the coding sequence, and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0053] As used herein, the term "promoter" refers to a region of DNA that initiates transcription of a specific coding sequence. A promoter is located upstream of a gene's transcription start site, on the same strand (toward the 5' region of the sense strand). Promoters can be approximately 100 to 1,000 base pairs in length. Prokaryotic promoters typically contain two short sequences upstream of the transcription start site, at positions -10 and -35. The -10 sequence, called the Pribnow box or -10 element, usually consists of six nucleotides: TATAAT. The Pribnow box is essential for transcription initiation in prokaryotes. Another sequence at -35 (the -35 element), usually consisting of six nucleotides: TTGACA, controls the rate of transcription. Bacterial cells contain sigma factors that assist RNA polymerase in binding to promoter regions. Common bacterial promoters are T7 (constitutive, promoter from T7 bacteriophage), Sp6 (constitutive, promoter from Sp6 bacteriophage), lac (constitutive in the absence of the lac repressor, can be inducible by IPTG or lactose), araBad (inducible by arabinose), trp (repressible by tryptophan), and Ptac (regulated similarly to the lac promoter).

[0054] As used herein, the term "amino acid" includes the 20 common naturally occurring amino acids, selenocysteine, pyrrolysine, and "unnatural amino acids." As used herein, the term "unnatural amino acids" refers to any other amino acid, modified amino acid, and / or amino acid analog.Examples of unnatural amino acids include p-acetyl-L-phenylalanine, p-iodo-L-phenylalanine, O-methyl-L-tyrosine, p-propargyloxyphenylalanine, p-propargyl-phenylalanine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-GlcNAc β-serine, L-dopa, fluorinated phenylalanine, isopropyl-L-phenylalanine, p-azido-L- Phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-bromophenylalanine, p-amino-L-phenylalanine, isopropyl-L-phenylalanine, non-natural analogues of the amino acid tyrosine; non-natural analogues of the amino acid glutamine; non-natural analogues of the amino acid phenylalanine; non-natural analogues of the amino acid serine; non-natural analogues of the amino acid threonine; alkyl, aryl, acyl, azido, cyano, halides hydrazine, hydrazide, hydroxyl, alkenyl, alkynyl, ether, thiol, sulfonyl, seleno, ester, thioacid, borate, boronate, phospho, phosphono, phosphine, heterocycle, enone, imine, aldehyde, hydroxylamine, keto- or amino-substituted amino acids, or any combination thereof; amino acids having a photoactivatable crosslinker; spin-labeled amino acids; fluorescent amino acids; metal-binding amino acids; metal-containing amino acids; radioactive amino acids; photocaged and / or photoisomerizable amino acids; biotin or biotin analog-containing amino acids; keto-containing amino acids; amino acids containing polyethylene glycol or polyethers; heavy atom-substituted amino acids; chemically cleavable or photocleavable amino acids; amino acids with extended side chains; amino acids containing toxic groups; sugar-substituted amino acids; carbon-linked sugar-containing amino acids; redox-active amino acids; alpha-hydroxy-containing acids; aminothioacids; alpha,alpha-disubstituted amino acids; beta-amino acids; cyclic amino acids other than proline or histidine, aromatic amino acids other than phenylalanine, tyrosine, or tryptophan. These include, but are not limited to, amino acids, and / or the like.

[0055] As used herein, the terms "peptide linker," "linker," or "spacer" refer to a spacer that acts as a hinge region between polypeptide domains, allowing them to move independently of one another while maintaining their three-dimensional configuration. In this sense, a preferred spacer is a hinge region characterized by structural ductility or flexibility that allows this movement. Typically, a structurally flexible peptide (i.e., a flexible connecting peptide or "flexible linker") contains two or more amino acids selected from the group consisting of glycine, serine, alanine, and threonine. Preferably, at least 65%, preferably 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the amino acids in the flexible peptide linker are selected from the group consisting of glycine, serine, alanine, and threonine. The spacer peptide preferably contains repeats of amino acid residues, particularly Gly and Ser, or any other suitable repeats of amino acid residues. The length of the spacer can vary. The preferred range is 2 to 30 amino acids, preferably 5 to 25 amino acids, and more preferably 10 to 20 amino acids.

[0056] "Identity," as known in the art, is a relationship between two or more polypeptide sequences, as determined by comparing the sequences. "Identity" can be readily calculated by known algorithms well known in the art. Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity are codified in publicly available computer programs. The percent identity between two sequences can be calculated using the algorithm of Needelman and Wunsch (J. Mol. Biol., 48; 443-453, 1970). Analysis software incorporating algorithms (e.g., NBLAST and XBLAST) (i.e., the Sequence Analysis Software Package from Genetics Computer Group, Madison, Wis.) ) can be determined using

[0057] Identity can be measured as "local identity" or "global identity." Local identity refers to the degree of sequence relatedness between polypeptides / polynucleotides as determined by the string-to-string match of such sequences. Global identity refers to the degree of sequence relatedness of a polypeptide / polynucleotide compared to a full-length reference polypeptide / polynucleotide. Unless otherwise specified, identity as used herein refers to global identity.

[0058] The terms "subject" or "individual" are used interchangeably herein to refer to all animals classified as mammals, including, but not limited to, domestic and farm animals, primates and humans, such as humans, non-human primates, cows, horses, pigs, poultry, sheep, goats, dogs, cats, or rodents. Preferably, the subject is a human, male or female, of any age or race.

[0059] The term "treatment" encompasses both preventative and therapeutic treatment. As used herein, the term "therapeutic treatment" or "therapy" refers to restoring the body from a pathological condition or disease to a normal, healthy state. As used herein, the term "prophylactic treatment" refers to preventing a pathological condition. This treatment may be a combination treatment or therapy. Treatment also refers to reducing the incidence, or alleviating symptoms, eliminating recurrence, preventing recurrence, preventing occurrence, improving symptoms, improving prognosis, or a combination thereof. "Treatment" further encompasses reducing the population, growth rate, or pathogenicity of bacteria in a subject, thereby controlling or reducing bacterial infection in a subject or bacterial contamination of an organ, tissue, or environment. Thus, a "treatment" that reduces incidence is effective in inhibiting the growth of at least one Gram-negative bacterium in a particular environment, whether in a subject or in the environment. On the other hand, a "treatment" of an already established infection refers to reducing the population of or killing Gram-negative bacteria that cause infection or contamination. It refers to eradicating, for example, gram-negative bacteria.

[0060] The term "combination therapy," as used throughout this specification, is intended to include administration of the referenced therapeutic agents to a subject at the same time or at different times, in the same or separate pharmaceutical formulations. When the therapeutic agents are administered at different times, they should be administered close enough in time to produce a combined effect (e.g., an enhanced or synergistic response). The particular combination of therapies used in a combination regimen will take into account compatibility of the desired therapeutic agents and / or treatments and / or the desired therapeutic effect to be achieved. It will be understood that the therapies used may achieve the desired effect for the same disorder and / or may achieve different effects (e.g., control of any adverse effects).

[0061] The term "single agent" as used herein refers to the use of an active ingredient sufficiently separated from another active ingredient to prevent an enhanced or synergistic response. More specifically, use as a "single agent" does not encompass use as a "combination therapy."

[0062] As used herein, the term "therapeutically effective amount" refers to an amount effective upon single or multiple administration to a subject (such as a human patient) in the prophylactic or therapeutic treatment of a disease, disorder, or pathological condition.

[0063] The term "bactericidal" in relation to an agent conventionally means having the property of causing the death of bacteria or being capable of killing bacteria to an extent of at least a 3 log (99.9%) or greater reduction in the initial population of bacteria.

[0064] The term "bacteriostatic" conventionally means having the property of inhibiting bacterial growth, e.g., inhibiting the growth of bacterial cells, causing a 2 log (99%) or greater reduction, up to just under 3 log, in the initial population of bacteria.

[0065] The term "antibacterial" in reference to an agent is generally used to include both bacteriostatic and bacteriocidal agents.

[0066] The term "drug resistance" in the context of pathogens, and more specifically bacteria, generally refers to bacteria that are resistant to the antimicrobial activity of drugs. When used more specifically, drug resistance specifically refers to antibiotic resistance. In some cases, bacteria that are generally susceptible to a particular antibiotic can develop resistance to that antibiotic, resulting in a drug-resistant microorganism or strain. A "multidrug-resistant" pathogen is one that has developed resistance to at least two classes of antimicrobial drugs, each used as a monotherapy. For example, certain strains of E. coli can produce so-called extended-spectrum β-lactamases (ESBLs). ESBLs are enzymes that break down certain antibiotics, such as penicillin or cephalosporins, and therefore, these ESBL-producing strains are resistant to these antibiotics. In addition, ESBL-producing E. coli strains have already been found to be resistant to carbapenems, one of the few antibiotics effective against ESBL-producing E. coli (https: / / www.cdc.gov / hai / organisms / ESBL.html).

[0067] Those skilled in the art can readily determine whether bacteria are drug resistant using routine laboratory techniques to determine bacterial susceptibility or resistance to drugs or antibiotics.

[0068] The term "suitable" in the context of antibiotics being suitable for use against certain bacteria refers to antibiotics that have been found to be effective against those bacteria, even if resistance has subsequently developed.

[0069] Detailed Description In a first aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) A protein comprising the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 60% identity thereto, wherein the variant has conservative amino acid changes and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1, wherein the protein does not consist of SEQ ID NO: 1.

[0070] This includes, for example, chimeric proteins comprising one or more cell wall binding domains (CBDs) known in the art, hi certain embodiments, the protein is a chimeric protein of the invention as described herein below.

[0071] Preferred features and embodiments for this protein, including variants of SEQ ID NO: 1 and fragments thereof, are as described herein below for the chimeric proteins of the invention.

[0072] In some embodiments, the protein is a) comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, the variant or fragment having residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 1, and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1, wherein the protein does not consist of SEQ ID NO: 1.

[0073] In other embodiments, the protein consists of a variant sequence or fragment having at least 60% identity to SEQ ID NO:1, wherein the variant has conservative amino acid changes, and the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO:1.

[0074] In a second aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a variant sequence having at least 60% identity thereto or a fragment of either thereof, wherein the variant has conservative amino acid changes and wherein the variant or fragment is a biologically active polypeptide, in particular wherein the variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; b) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or a variant sequence having at least 60% identity thereto or a fragment of any of them, wherein the variant has conservative amino acid changes and wherein the variant or fragment is a biologically active polypeptide, in particular wherein the variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the cell penetrating activity of SEQ ID NO: 2; The present invention relates to a chimeric protein comprising:

[0075] SEQ ID NO: 1 corresponds to the putative endolysin (NCBI Reference Sequence: YP_009284326.1) of the Enterobacter phage Arya (NCBI Reference Sequence NC_031048.1) and consists of the following amino acid sequence: 1 mktspngiav tkyfesfear aypdpatggk pytigfgttv ypsgapvrlg dvctkeqaek 61 ylqndlakfe kivsdavrvp lnqgqfdalv sftynlgpan lrsstllkkl nagdyagaak 121 efprwnrang kvmkgltrrr aaeqclfegm ggasaiergv aaa

[0076] SEQ ID NO: 1 has peptidoglycan (PG) hydrolase activity as determined by turbidimetric assay. More specifically, by sequence homology, it corresponds to lysozyme.

[0077] Methods for determining the presence of PG hydrolase activity are known to those skilled in the art. For example, PG hydrolase activity can be determined by zymography or a turbidimetric assay that tracks the activity of the enzyme in Micrococcus lysodeikticus cells (Santin and Cascales, 2017). For illustrative purposes, see the turbidimetric assay protocol described in the Examples. In addition, there are fluorescent assays that label PG with a fluorescent substance that can only be detected after the enzyme has acted (Invitrogen's EnzChek™ Lysozyme Assay Kit). However, these assays only indicate PG hydrolase activity. To determine the cleavage site, a more accurate approach, such as reverse-phase high-performance liquid chromatography combined with mass spectrometry, is required (Santin and Cascales, 2017). A specific In embodiments, said variant or fragment of SEQ ID NO:1 has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the PG hydrolase activity of SEQ ID NO:1.

[0078] SEQ ID NO: 2 corresponds to the cell permeability domain (D8) of the lytic enzyme Lys1521 (D1) of the B. amyloliquefaciens phage (Non-Patent Document 33) (GenBank: AAK40280.1), and consists of the following amino acid sequence: 143 nsgtpknv srgtsstktt pkykvkngdn ltkiakkhnt 181 tvatllklnp gikdpnmirv gqtlnvtgsg gkthkvksgd tlskiavdnk ttvsklmnln 241 peitnpnhik vgqtirls

[0079] A polypeptide having the amino acid sequence of SEQ ID NO: 2 has previously been described to have cell penetrating activity (Orito et al. 2004).

[0080] It has been previously reported that helix-forming amphipathic peptides containing basic amino acid residues appear to interact with negatively charged membrane components, i.e., LPS, in Gram-negative bacteria (Duering, K., et al. 1999). Morita et al. (Non-Patent Document 33) have predicted that Based on the secondary structure, we report that there are two helical peptides at the C-terminus of the endolysin, one in the D9 region (aa 171-177 of D1, corresponding to aa 29-35 of SEQ ID NO: 2) and the other in the D10 region (aa 212-216 of D1, corresponding to aa 70-74 of SEQ ID NO: 2). These peptides are likely to bind to the LPS of P. aeruginosa strain PAO1. Furthermore, the structural model of the D8 cell-penetrating domain (SEQ ID NO: 2) is consistent with the putative endolysin of Thermus thermophilus. This study shows structural similarity to the LysM domain of putidase (Wong JE et al. 2015). The inventors have found that D8 is involved in the binding of enzyme substrates. See Example 7. LysM domains in bacterial proteins are repetitive entities known to interact with substrates containing N-acetylglucosamine, usually peptidoglycan. Therefore, without wishing to be bound by theory, this data suggests that D8 may be involved in binding to enzyme substrates.

[0081] Methods for determining the presence of outer membrane permeabilization activity are known to those skilled in the art. For example, the ability of endolysins to permeabilize the outer membrane of Gram-negative bacteria was tested by testing the release of the periplasmic β-lactamase of Pseudomonas aeruginosa PAO1 after treatment of cells of said bacteria with the enzyme under study, as described by Orito et al., 2004, and reproduced herein below for illustrative purposes. This can be assessed by experimenting.

[0082] An overnight culture of P. aeruginosa PAO1 (500 μl) was diluted with 30 ml of prewarmed (37°C) LB medium and incubated at 37°C for 2 hours with shaking (150 rpm). After inducing β-lactamase production by adding 0.25 mg / L imipenem, the culture was incubated for an additional 3 hours with shaking and harvested by centrifugation at 5,000 g for 10 minutes at room temperature. The cell pellet was washed once with PBS and resuspended in PBS to a final volume of 10 ml. Endolysin was added to the cell suspension (25 μl) at final concentrations of 40 μg / ml and 200 μg / ml (total volume: 50 μl). The mixture was incubated at 37°C for 10 minutes and centrifuged at 15,000 g for 30 minutes at room temperature in an Eppendorf tube. Control experimental conditions were performed using the supernatant of sonicated P. aeruginosa PAO1 cells. The supernatant is collected and assayed for β-lactamase activity using 100 μM chromogenic cephalothin (CENTA) as a substrate. CENTA hydrolysis can be monitored by continuously recording the absorbance at 405 nm. β-lactamase release (%) is defined as the ratio of β-lactamase activity under control conditions to that under test conditions.

[0083] In certain embodiments, the variant or fragment of SEQ ID NO:2 has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the cell penetration activity of SEQ ID NO:2.

[0084] In some embodiments, the chimeric protein comprises: a) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1; b) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2; It comprises or consists of:

[0085] The (b) polypeptide can be fused directly in tandem or via a peptide linker to the C-terminus of the (a) polypeptide, preferably fused directly to the C-terminus of the (a) polypeptide.

[0086] In a preferred embodiment, the chimeric protein has bacteriostatic or bactericidal activity against Gram-negative bacteria, preferably bactericidal activity against Gram-negative bacteria, as defined herein.

[0087] In some embodiments, the chimeric protein comprises or consists of the amino acid sequence of SEQ ID NO:3 (corresponding to SEQ ID NO:2 directly fused at the C-terminus of SEQ ID NO:1), or a variant sequence having at least 60% identity thereto, or a fragment of either thereof, wherein the variant has conservative amino acid changes, and the variant or fragment is biologically active. In particular, the variant or fragment has at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98%, 98%, 99% or 100% of the bactericidal or bacteriostatic activity of SEQ ID NO:3 against Gram-negative bacteria.

[0088] The chimeric proteins described herein have been shown by the inventors to be highly effective at inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria, particularly in bacteria of the genera Acinetobacter (e.g., A. baumannii), Pseudomonas (P. aeruginosa), Escherichia (e.g., E. coli), and Klebsiella (e.g., K. pneumoniae) (see Examples 4 and 6). Assays for analyzing the bactericidal activity of compounds are known in the art and are described, for example, by Loessner et al. (Loessner, MJ et al. 2002) and Schmelcher et al. (Schmelcher, M. et al. 2010). For example, assays for quantifying the bactericidal effect of antimicrobial agents can be used. To achieve this, for example, the absorbance at 600 nm (A 600A bacterial suspension with a log β = 0.3 is incubated at 37°C in the presence of the antimicrobial agent at a dose range to be tested. Samples are taken at different time points, serial dilutions are made, and these are plated onto plates containing culture medium to determine the number of viable bacteria. The bactericidal effect is quantified as the log reduction in the presence of the treatment after a given incubation time (log 10 (N0 / N i ), where N0 = number of CFU / mL before treatment and N i (=number of CFU / mL after the corresponding incubation time in the presence of each treatment). The bacterial suspension can be incubated with the antimicrobial agent in culture medium or a buffer solution, such as PBS or another aqueous salt solution. The specific assay used to determine IKB206 bactericidal activity is described in the Examples.

[0089] In a preferred embodiment, the bacteriostatic or bactericidal effect is achieved in an in vitro assay after 120 minutes of incubation with bacteria, preferably after 90 minutes, more preferably after 60 minutes, even more preferably after 30 minutes, 15 minutes, such as after 10 minutes or less, for example after 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes or 1 minute, wherein the starting concentration of Gram-negative bacteria (e.g., E. coli) in the bacterial culture is greater than or equal to an A of 0.3. 600 The absorbance level can be determined, for example, using a Spectrostar Nano spectrophotometer (BMG labtech).

[0090] Also in preferred embodiments, a bacteriostatic or bactericidal effect is achieved in an in vitro assay at a concentration of the chimeric protein of the invention of less than 60 μg / mL, preferably 55 μg / mL, 50 μg / mL, 45 μg / mL, 40 μg / mL, 35 μg / mL, 30 μg / mL, 25 μg / mL, 20 μg / mL, 15 μg / mL, 10 μg / mL, 9 μg / mL, 8 μg / mL, 7 μg / mL, 6 μg / mL, or 5 μg / mL, where the starting concentration of Gram-negative bacteria (e.g., E. coli) in the bacterial culture is less than 0.3 A. 600The absorbance level can be determined, for example, using a Spectrostar Nano spectrophotometer (BMG labtech).

[0091] This bacteriostatic or bactericidal effect is preferably a bactericidal effect, hi preferred embodiments, the bactericidal effect is at least a 4 log reduction, preferably at least a 5 log reduction, at least a 6 log reduction, at least a 7 log reduction or better reduction in the initial population of bacteria.

[0092] In a more preferred embodiment, the bactericidal effect is achieved in an in vitro assay after 30 minutes of incubation with bacteria at a concentration of 15 μg / mL, more preferably after 15 minutes of incubation, where the starting concentration of Gram-negative bacteria (e.g., E. coli) in the bacterial culture is greater than or equal to an A of 0.3. 600 The absorbance level can be determined using, for example, a Spectrostar Nano spectrophotometer (BMG labtech). do.

[0093] In another preferred embodiment, the bacteriostatic effect is achieved in an in vitro assay after 10 minutes of incubation with bacteria at a concentration of 15 μg / mL, more preferably after 5 minutes, even more preferably after 4 minutes, 3 minutes, 2 minutes or 1 minute, wherein the starting concentration of Gram-negative bacteria (e.g., E. coli) in the bacterial culture is greater than or equal to an A of 0.3. 600 The absorbance level was measured using, for example, a Spectrostar Nano spectrophotometer (BMG Labtech ) can be determined using

[0094] In some embodiments, the polypeptides having at least 60% identity to the corresponding sequence are preferably at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 120%, at least 121%, at least 122%, at least 123%, at least 124%, at least 125%, at least 126%, at least 127%, at least 128%, at least 129%, at least 130%, at least 131%, at least 132%, at least 133%, at least 134%, at least 135%, at least 136%, at least 137%, at least 138%, at least 139%, at least 140%, at least 141%, at least 142%, at least 143%, at least 144%, at least 145%, at least 146%, at least 147%, at least 148%, at least 149%, at least 149%, at least 150%, at least 151%, at least 152%, at least 153%, at least 154%, at least Preferably, the sequence has at least 95%, at least 96%, at least 97%, at least 98% or most preferably at least 99% identity.

[0095] In obtaining variant biologically active polypeptides and their respective coding sequences, those skilled in the art will recognize that polypeptides can be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications without loss or reduction of biological activity. In particular, it is well known that conservative amino acid substitutions, in which one amino acid is replaced with another amino acid of similar size, charge, polarity, and conformation, are unlikely to significantly alter protein function. The 20 standard amino acids that are the building blocks of proteins can be broadly divided into four conserved amino acid groups as follows: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine; the positively charged (basic) group includes arginine, histidine, and lysine; and the negatively charged (acidic) group includes aspartic acid and glutamic acid. Substitution of one amino acid in a protein for another amino acid within the same group is unlikely to adversely affect the biological activity of the protein.

[0096] Generally, production of the chimeric proteins of the present invention can be accomplished by procedures disclosed herein and by generally accepted recombinant DNA techniques including, for example, polymerase chain amplification (PCR), preparation of plasmid DNA, cleavage of DNA with restriction enzymes, preparation of oligonucleotides, ligation of DNA, isolation of mRNA, introduction of DNA into suitable cells, transformation or transfection of the host, and cultivation of the host. Additionally, fusion molecules can be isolated and purified using chaotropic agents and known electrophoretic, centrifugation, and chromatographic methods. Generally, for disclosures regarding these methods, see Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. (1989) and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989)). Please refer to.

[0097] Proteins or polypeptides of the invention can be engineered to have one or more amino acid substitutions, deletions, or additions compared to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. These changes are preferably minor in nature, i.e., conservative amino acid substitutions and other changes that do not significantly affect the folding or activity of the protein or polypeptide, and may include amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a tag to facilitate modification, identification, and / or purification of the fusion protein. Two or more tags (e.g., affinity tags to facilitate purification) may also be used in combination. Polypeptides containing affinity tags can further include a polypeptide linker and / or a proteolytic cleavage site between the polypeptide and the affinity tag.

[0098] As discussed in Example 7, the present inventors investigated the mechanism of action of the chimeric protein of the present invention. From the structural model of the catalytic domain, it was found that T4 lysozyme and other T4 lysozyme-like endolysins, such as P22 phage lysozyme (Mooers BH et al. 2006) or Escherichia coli lysozyme (Escherichia coli lysozyme) are involved in the catalytic activity of the chimeric protein. The overall fold revealed a similarity to the endolysin encoded by the E. coli DLP12 prophage (Babu K et al. 2018). Based on sequence alignment (Figure 9D) and structural overlay of the IKB206 structural model against the crystal structures of these endolysins (Figure 9C), we propose that the catalytic domain of IKB206 belongs to T4 lysozyme-like endolysins, with residues E15, D24, and T33 forming the catalytic triad of the enzyme. Furthermore, it is suggested that R139 may form a salt bridge with E15.

[0099] In some embodiments, variants of SEQ ID NO:1 or SEQ ID NO:3 are characterized by having conservative amino acid changes, such that in the variant or fragment, residues corresponding to E15, D24, and T33 of SEQ ID NO:1 or SEQ ID NO:3, respectively, are maintained. In some embodiments, the amino acid changes are conservative, such that residues corresponding to positions 12-35, or even positions 12-54, of SEQ ID NO:1 or SEQ ID NO:3, respectively, remain unchanged. Additionally, in some embodiments in combination with any of the above, the amino acid corresponding to R139 of SEQ ID NO:1 or SEQ ID NO:3, respectively, remains unchanged, for example, residues corresponding to E15, D24, T33, and R139 remain unchanged.

[0100] In some embodiments, variants of SEQ ID NO: 2 are characterized by having conservative amino acid changes, such that the amino acids corresponding to positions 29-35 and 70-74 of SEQ ID NO: 2 are maintained in the variant or fragment.

[0101] In certain embodiments, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis. a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, and wherein the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 1, and preferably has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; b) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or a variant sequence or fragment having at least 80% identity thereto, characterized in that the variant has conservative amino acid changes, and the variant or fragment has amino acids corresponding to positions 29-35 and 70-74 of SEQ ID NO: 2, and preferably has at least 90% of the cell penetrating activity of SEQ ID NO: 2; wherein the polypeptide (b) is fused directly or via a peptide linker to the C-terminus of the polypeptide (a).

[0102] In another embodiment, the present invention relates to a chimeric protein comprising or consisting of the amino acid sequence of SEQ ID NO: 3 or a variant sequence or fragment having at least 80% identity thereto, characterized in that the variant has conservative amino acid changes, and the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 3, and preferably has at least 90% of the bacteriostatic or bactericidal activity of SEQ ID NO: 3 against Gram-negative bacteria.

[0103] Proteins or polypeptides may contain specific affinity purification tags. Illustrative, non-limiting examples of affinity tags include glutathione S-transferase (GST), maltose E-binding protein, protein A, FLAG tag, hexahistidine, myc tag, or influenza HA tag. The affinity purification tag can be fused directly in tandem to the polypeptide, or alternatively, via a cleavable linker, i.e., a peptide segment containing an amino acid sequence (i.e., a recognition / cleavage site) that can be specifically cleaved by enzymatic or chemical means. When the affinity tag is fused directly, the reading frame of the peptide of interest is joined to the reading frame of the gene encoding the affinity tag, resulting in a translational fusion. In certain embodiments, the cleavable linker contains an amino acid sequence that can be cleaved by a protease, such as enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, Factor Xa, furin-like proprotein convertase, or thrombin. Alternatively, in another specific embodiment, the cleavable linker comprises an amino acid sequence that is cleavable by a chemical reagent, such as cyanogen bromide, which cleaves methionine residues, or any other suitable chemical reagent. Cleavable linkers are useful when subsequent removal of the affinity purification tag is desired.

[0104] In some embodiments, the chimeric protein of the present invention further comprises a recognition / cleavage site downstream of peptide (b). In certain embodiments, the cleavage site is a thrombin cleavage site (e.g., the amino acid sequence of SEQ ID NO: 4).

[0105] In some preferred embodiments, the chimeric protein of the present invention comprises or consists of a polypeptide of the amino acid sequence of SEQ ID NO: 5. The chimeric protein consisting of the amino acid sequence of SEQ ID NO: 5 is the result of fusing SEQ ID NO: 1 with SEQ ID NO: 2, where SEQ ID NO: 2 is directly fused to the C-terminus of SEQ ID NO: 1 (SEQ ID NO: 3) before being cloned into a pET29b+ vector and expressed. This protein is characterized by further exhibiting an S-tag at the N-terminus, a 6-His-tag at the C-terminus, thrombin cleavage sites (SEQ ID NO: 4) at both termini, and three extra amino acids between the tags and SEQ ID NO: 3 (to improve thrombin cleavage efficiency), and is IKB206. タグ By way of non-limiting example, IKB206 and IKB206 タグ A schematic diagram of this is shown in Figure 1 (A and B).

[0106] In further embodiments, optionally in combination with one or more of the embodiments and features described herein, the chimeric proteins of the invention may comprise an additional peptide (such as a polycationic peptide) with OM permeabilizing or destabilizing properties. In preferred embodiments, no additional peptide (such as a polycationic peptide) with OM permeabilizing or destabilizing properties is included.

[0107] In still further embodiments, optionally in combination with one or more of the embodiments and features described herein, the chimeric proteins of the invention may comprise an additional domain having antimicrobial activity, and in preferred embodiments, do not comprise an additional domain having antimicrobial activity.

[0108] In some embodiments, the chimeric proteins of the present invention may be chemically modified. Chemical modifications include, but are not limited to, adding chemical moieties, creating new bonds, and removing chemical moieties. Chemical modifications can occur anywhere in the polypeptide, including the amino or carboxyl termini, as well as amino acid side chains. Such modifications can occur at more than one site in the polypeptide. Furthermore, one or more side or terminal groups of the polypeptide may be protected by protecting groups known to those skilled in the art.

[0109] In some embodiments, the chimeric proteins of the present invention may also have a duration-extending moiety attached. A non-limiting example of a duration-extending moiety is polyethylene glycol. Polyethylene glycol ("PEG") has been used in the art to obtain therapeutic polypeptides with extended duration (Zalipsky, S., Bioconjugate Chemistry, 6:150-165 (1995); Mehvar, R., J. Pharm. Pharmaceut. Set, 3:125-136 (2000)). PEG backbone ((CH2CH2-O-) n PEG (where n is the number of repeating monomers) is flexible and amphiphilic. When attached to another chemical entity, such as the chimeric protein of the present invention, the PEG polymer chains can protect such polypeptides from immune responses and other clearance mechanisms. As a result, PEGylation can lead to improved efficacy and safety by optimizing pharmacokinetics, increasing bioavailability, and reducing immunogenicity and dosage and / or frequency.

[0110] The proteins of the present invention (including chimeric proteins) can be used alone or in combination with agents that permeabilize or disrupt the outer membrane of Gram-negative bacteria, including, but not limited to, metal chelators such as EDTA, TRIS, lactic acid, lactoferrin, polymyxin, and citric acid (Non-Patent Document 32). These permeabilization agents can be of the same or different composition. In a preferred embodiment, the protein (including the chimeric protein) is used without a permeabilizing agent.

[0111] In a third aspect, the present invention relates to polynucleotides comprising nucleic acid molecules that encode the proteins (including chimeric proteins) described herein.

[0112] In some embodiments, the polynucleotide comprises: a) a nucleic acid sequence comprising or consisting of SEQ ID NO: 6 or a variant sequence having at least 70% identity thereto or any fragment thereof, wherein said variant sequence or fragment encodes a biologically active polypeptide; Includes: SEQ ID NO:6 atgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattggcttcggaaccactgtcta cccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcgagaagattgtatctgacgcagtgcgcgttcccctta atcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagtaccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagttt ccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgccgcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgca

[0113] In other embodiments, the polynucleotide is a) a nucleic acid sequence comprising or consisting of SEQ ID NO: 6 or a variant sequence having at least 70% identity thereto or a fragment of any thereof, wherein the variant sequence or fragment encodes a biologically active polypeptide; b) a nucleic acid sequence comprising or consisting of SEQ ID NO: 7 or a variant sequence having at least 70% identity thereto or any fragment thereof, wherein the variant sequence or fragment encodes a biologically active polypeptide; Includes: SEQ ID NO:7 aacagtgggacaccaaagaatgtttccgcggaacctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaacttaatccagggatcaaagaccccaacatgattcgtgta gggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagtaaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagc.

[0114] In a preferred embodiment, the polynucleotide is a) a nucleic acid sequence comprising or consisting of SEQ ID NO: 6 or a variant sequence having at least 70% identity thereto or a fragment of any of them, wherein said nucleic acid sequence encodes SEQ ID NO: 1 or a variant or fragment thereof as defined herein; b) a nucleic acid sequence comprising or consisting of SEQ ID NO: 7 or a variant sequence having at least 70% identity thereto or a fragment of any of them, wherein said nucleic acid sequence encodes SEQ ID NO: 2 or a variant or fragment thereof as defined herein; and Includes:

[0115] In a further embodiment, the polynucleotide comprises or consists of SEQ ID NO: 8 or a variant sequence having at least 70% identity thereto, or a fragment of any thereof, wherein the variant sequence or fragment encodes a biologically active polypeptide. SEQ ID NO:8 atgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattggcttcggaaccactgtctacccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcgagaagattgtatctgacgcagtgcgcgttccccttaatcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagtaccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagtttccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgccgcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgcaaacagtgggacaccaaagaatgtttcccgcggaacctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaacttaatccagggatcaaagaccccaacatgattcgtgtagggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagtaaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagc

[0116] In a preferred embodiment, the polynucleotide comprises a nucleic acid sequence comprising or consisting of SEQ ID NO: 8 or a variant sequence having at least 70% identity thereto or any fragment thereof, wherein the nucleic acid sequence encodes SEQ ID NO: 3 or a variant or fragment thereof as defined herein.

[0117] In yet a further embodiment, the polynucleotide comprises or consists of SEQ ID NO: 9 or a variant sequence having at least 70% identity thereto, or a fragment of any thereof, which sequence encodes a biologically active polypeptide. SEQ ID NO:9 atgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagcccagatctgggtaccctggtgccacgcggttccatggcgatatcggatccgatgaaaacctctccaaatggtatcgccgttaccaagtacttcgaatcatttgaagcccgcgcataccctgaccccgccactggcggtaaaccatacacgattggcttcggaaccactgtctacccgtctggcgcacccgtccgtttaggggatgtgtgtacgaaagaacaggccgagaaatatttacaaaatgacttggcgaaattcgagaagattgtatctgacgcagtgcgcgttccccttaatcaaggtcagtttgacgcgttagtgtcatttacgtataacttaggacccgccaatttgcgcagcagtaccctgttaaaaaagttgaacgctggggactatgcgggggccgctaaagagtttccgcgttggaaccgtgcaaacggtaaagtgatgaaaggtttgacacgtcgccgcgcggcagaacaatgtttgtttgaagggatgggaggcgcgagcgcgattgaacgtggtgtagccgctgcaaacagtgggacaccaaagaatgtttcccgcggaacctcgtccacgaagacaacacctaagtataaggtaaaaaatggtgacaacttaactaaaatcgcgaagaaacataatactacagtagcgacattgctgaaacttaatccagggatcaaagaccccaacatgattcgtgtagggcagactttaaatgttacagggtccggtgggaaaactcataaagtcaagtcgggtgacacactgagtaaaatcgcagttgataataagacgactgttagcaagttgatgaatcttaacccggaaatcactaatcctaaccatatcaaagtcggccagacaatccgtttgagcctgggtaccctggtgccacgcggttccctcgagcaccaccaccaccaccac

[0118] In a preferred embodiment, the polynucleotide comprises a nucleic acid sequence comprising or consisting of SEQ ID NO: 9 or a variant sequence having at least 70% identity thereto or a fragment of any of them, wherein the nucleic acid sequence encodes SEQ ID NO: 5 or a variant or fragment thereof as defined herein.

[0119] Preferably, said nucleic acid sequences having at least 70% identity have at least 75%, at least 80%, at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or most preferably at least 99% identity to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:9, respectively.

[0120] In some embodiments, the polynucleotide comprises the nucleic acid sequences (a) and (b) above, and preferably the polynucleotide comprises SEQ ID NO: 8 and SEQ ID NO: 9 or a combination thereof. The polynucleotide is selected from sequences that have at least 70% identity to the sequence of the present invention, and the sequence encodes a biologically active polypeptide, and the polynucleotide is operably linked to a control sequence.Preferably, the polynucleotide is operably linked to at least one promoter, preferably a prokaryotic promoter, that is, it allows the inserted coding sequence to be expressed in prokaryotic cells, such as bacterial cells.In certain embodiments, the polynucleotide is a vector.

[0121] In a fourth aspect, the present invention further relates to a vector comprising the polynucleotide described herein. By "vector" is meant any genetic element, such as a plasmid, phage, hybrid vector, transposon, cosmid, chromosome, virus, or virion, that is capable of replication and transfer of genetic sequences between cells when associated with appropriate control elements. The sequences encoding the peptides described herein can be inserted into vectors capable of delivering and maintaining nucleic acid molecules in bacterial cells. The polynucleotide may be inserted into an autonomously replicating vector. The vector may be a bacterial vector, such as pET29b+, pGEM3Z, and pcDNA3, and their derivatives, or a bacteriophage DNA vector, such as bacteriophage λ or M13, and their derivatives. Preferably, the vector is a bacterial plasmid. The plasmid may be an extrachromosomal or integrative plasmid, preferably an extrachromosomal plasmid.

[0122] In addition to the encoding nucleic acid molecule, the vector also contains elements that enable expression, such as a promoter and regulatory sequences. The expression vector may contain transcriptional control sequences that control transcription initiation, such as promoter, enhancer, operator, and repressor sequences. Various transcriptional control sequences are known to those skilled in the art. The expression vector may also contain translational control sequences (e.g., untranslated 5' sequences, untranslated 3' sequences). The vector may be capable of autonomous replication or may integrate into host DNA to ensure stability during peptide production.

[0123] Expression vectors containing inducible promoters generally contain an operator sequence. Operator sequences that can be used are known in the art and include lac, gal, deo, gin, raf, rha, araC, fru, and mel. One or more perfectly palindromic operator sequences may be used. In certain embodiments, the operator sequence overlaps with the transcription start site. It is recognized that operator systems are generally used in conjunction with an appropriate repressor sequence. The repressor sequence produces a repressor protein, for example, the lacl gene sequence when the lac operator is used. Other lac repressor sequences may also be used; for example, the laclq sequence can be used to increase the level of the lac repressor protein. The repressor sequence can be provided by the host cell genome or by an additional compatible plasmid.

[0124] Expression can be induced by the addition of inducers such as isopropyl-β-D-1-thiogalactopyranoside (IPTG), analogs of IPTG such as isobutyl-C-galactoside (IBCG), lactose, or melibiose. Other inducers may be used and are described more fully elsewhere (see, e.g., The Operon, eds. Miller and Renznikoff (1978)). Inducers can be used individually or in combination. The construction of appropriate plasmids or expression vectors will be apparent to a scientist of ordinary skill.

[0125] Construction of vectors containing the nucleic acids described herein can be followed by transformation of host cells. Introduction can be by any available technique. For bacterial cells, suitable techniques can include heat shock, calcium chloride transformation, electroporation, and transfection using bacteriophage.

[0126] In a fifth aspect, the present invention relates to a host cell comprising a vector as described herein. Preferably, the host cell is a prokaryotic host cell. Examples of prokaryotic cells include bacterial cells, such as Gram-negative bacterial cells including E. coli, Salmonella typhimurium, Serratia marsescens, Pseudomonas putida, and Pseudomonas aeruginosa, as well as Bacillus subtilis. Gram-positive bacterial cells, including Bacillus subtilis, are preferred. Preferred host cells are bacteria, particularly Enterobacteriaceae, preferably E. coli, including strains B or K12. Most preferably, the host cell is Escherichia coli BL21(DE3).

[0127] Following introduction of the nucleic acid into the cell, expression from the nucleic acid can be induced or enabled, for example, by invading the host cell under conditions for expression of the polynucleotide. Typically, the cells are cultured in a cell culture medium under appropriate temperature and atmospheric conditions (e.g., 37°C). Depending on the host cell, this culture medium may be a "microbial medium," which refers to any substrate suitable for the growth and propagation of microorganisms, such as bacteria or fungi. The most common microbial growth media are nutrient broth (liquid nutrient medium) or LB medium (lysogeny medium). Often, the liquid medium is mixed with agar and poured into Petri dishes using a sterile medium dispenser and allowed to solidify. Those skilled in the art will understand that the term "microbial medium" encompasses solid plate media, as well as semi-solid and liquid microbial growth systems.

[0128] In a sixth aspect, the present invention provides a method of making a protein (including a chimeric protein) of the present invention, comprising the steps of: i. introducing a vector containing a polynucleotide described herein into a suitable host cell; ii. culturing the host cell under conditions suitable for expression of the protein; iii. optionally isolating and / or purifying said protein; The present invention relates to a method, including:

[0129] The most appropriate culture conditions for each host cell are known to those skilled in the art. Examples of host cells and their culture methods are given above.

[0130] Methods for isolating and / or purifying polypeptides are known in the art (see, for example, Isolation and Purification of Proteins, February 5, 2003 by CRC Press, ISBN 9780824707262). Procedures for purifying polypeptides begin with isolating the protein from the expression site. The purification process depends on the location of the protein. Some proteins are secreted into the cell culture medium, while others are intracellular. In a second example, the first step in the purification process involves lysis of the cells, which can be achieved by a variety of methods, including mechanical shear, osmotic shock, or enzymatic treatment. Optionally, cellular debris is removed by differential centrifugation or filtration.

[0131] After obtaining a clear solution containing the polypeptide of interest, separation from other proteins produced by the cells is attempted, usually using a combination of different chromatography methods. These techniques separate the mixture of proteins based on charge, degree of hydrophobicity, or size. Several different chromatography resins are available for each of these techniques, allowing the purification scheme to be precisely tailored to the specific protein involved. Affinity chromatography, which utilizes specific interactions between the protein to be purified and an immobilized capture agent, may also be an option for some polypeptides. For example, if the protein described herein contains a tag, affinity chromatography can be used to purify it. In other embodiments, if the protein does not contain a tag, size exclusion chromatography may be used, preferably followed by cation exchange.

[0132] The proteins of the present invention (including chimeric proteins) are expressed in Drosophila Sf9 cells. Proteins can also be produced in non-bacterial protein expression systems, including baculovirus expression systems, yeast or filamentous fungal expression systems, and mammalian cell expression systems.

[0133] Additionally, the proteins (including chimeric proteins) and polypeptides described herein can be synthesized by solid-phase synthesis using an automated peptide synthesizer. For example, peptides can be synthesized on Cyc(4-CH2Bxl)-OCH2-4-(oxymethyl)-phenylacetamidomethyl resin using a double coupling program. Peptides can also be synthesized by a number of other methods, including solid-phase synthesis using conventional FMOC protection (i.e., coupling with DCC-HOBt and deprotection with piperidine in DMF).

[0134] In a seventh aspect, the present invention relates to a composition comprising a protein (including a chimeric protein), polynucleotide, vector or host cell described herein.

[0135] An appropriate amount of the proteins (including chimeric proteins), polynucleotides, vectors, or host cells described herein can be combined with a pharmaceutically acceptable excipient, vehicle, and / or carrier to provide a pharmaceutical composition, which preferably comprises the proteins (including chimeric proteins), polynucleotides, or expression vectors described herein.

[0136] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable excipients, vehicles, and / or carriers" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for human administration. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present disclosure, its use in therapeutic compositions is contemplated. Additional active ingredients may be incorporated into the compositions, provided they do not inactivate the agent according to the present invention, e.g., the chimeric protein of the present invention.

[0137] In an eighth aspect, the present invention provides a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and a chimeric protein described herein), a polynucleotide, a vector or a host cell or a pharmaceutical composition (hereinafter collectively referred to as "an active substance according to the present invention") described herein for use in the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0138] In a ninth aspect, the present invention relates to the use of a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and a chimeric protein described herein), polynucleotide, vector, host cell or pharmaceutical composition described herein in the manufacture of a medicament for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria.

[0139] In a tenth aspect, the present invention relates to a method for the prophylactic and / or therapeutic treatment of bacterial infections caused by Gram-negative bacteria, comprising administering to a subject diagnosed with, at risk of or showing symptoms of a bacterial infection, a composition containing an effective amount of a protein described herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and chimeric protein described herein), polynucleotide, vector or host cell, preferably an effective amount of a protein described herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and chimeric protein).

[0140] In a preferred embodiment, the infection is caused by a bacterium, preferably an Acinetobacter species, The infection is caused by enteric gram-negative bacteria selected from the group consisting of bacteria of the genera Iodes, Campylobacter, Fusobacterium, Haemophilus, Helicobacter, Mobiluncus, Porphyromonas, Prevotella, Pseudomonas, and Veillonella, and bacteria of the family Enterobacteriaceae (also referred to herein as Enterobacteriaceae). Illustrative, but non-limiting, examples of Enterobacteriaceae include bacteria of the genera Citrobacter, Enterobacter, Escherichia, Klebsiella, Proteus, Salmonella, Serratia, Shigella, and Yersinia.

[0141] In certain embodiments, the Gram-negative bacteria is selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, Klebsiella, Serratia, and Citrobacter, preferably from the group consisting of Acinetobacter, Pseudomonas, Escherichia, and Klebsiella. In preferred embodiments, the Gram-negative bacteria is selected from the group consisting of E. coli, K. pneumoniae, A. baumannii, P. aeruginosa, S. marcescens, and C. freundii, preferably from the group consisting of E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa. In certain embodiments, the Gram-negative bacteria is a drug-resistant strain, including a multidrug-resistant (MDR) strain.

[0142] In the 2019 EARS-Net European surveillance, the most commonly reported bacterial species was Escherichia coli (44.2%), followed by Staphylococcus aureus (20.6%), Klebsiella pneumoniae (11.3%), E. faecalis (6.8%), P. aeruginosa (5.6%), S. pneumoniae (5.3%), and E. The most common bacterial infections were E. faecium (4.5%) and Acinetobacter species (1.7%) (European Centre for Disease Prevention and Control. Antimicrobial resistance in the EU / EEA (EARS-Net) - Annual Epidemiological Report 2019. Stockholm: ECDC; 2020). It was observed that more than half of the reported E. coli isolates and more than one-third of the K. pneumoniae isolates were resistant to at least one antimicrobial class under surveillance, and multiple resistance to several antimicrobial classes was frequently observed. Carbapenem resistance was common in P. aeruginosa and Acinetobacter species and was observed at a higher rate than in K. pneumoniae.

[0143] In some embodiments, the Gram-negative bacteria are of the Enterobacteriaceae family. In preferred embodiments, the infection is caused by Escherichia coli. The E. coli strain is not particularly limited to any serotype, and illustrative examples include E. coli bacteria of serotype O1 (e.g., serotype O1A), serotype O2, serotype O6 (e.g., serotype O6A), serotype O25 (e.g., serotype O25B), or O157, which are serotypes frequently involved in urinary tract infections (Huttner and Gambillara 2018). In preferred embodiments, The E. coli strain belongs to a serotype O6 strain, such as E. coli ATCC 25922, or a serotype O157 strain, such as E. coli O157:H7. In certain embodiments, the E. coli strain is a drug-resistant strain, including a multidrug-resistant (MDR) strain.

[0144] These MDR strains may be resistant to one, two, three, four, five, six, seven, or more antibiotics, such as sulfonamides (e.g., sulfamethoxazole and trimethoprim-sulfamethoxazole), penicillins (e.g., ticarcillin, ticarcillin-clavulanate, piperacillin, piperacillin-tazobactam, amoxicillin, amoxicillin-clavulanate), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone), monobactams (e.g., aztreonam), lincosamides (e.g., lincomycin), fluoroquinolones (e.g., ciprofloxacin, levofloxacin, norfloxacin), carbapenems (e.g., imipenem, meropenem, ertapenem, doripenem), aminoglycosides (e.g., cyclosporine, cyclosporine), cyclosporine-4-hydroxybenzoates ( ... The MDR strains may be resistant to antibiotics such as cocaine (e.g., gentamicin, tobramycin, amikacin) and polymyxins (e.g., colistin, polymyxin B). For example, the MDR strains may be resistant to one or more, e.g., all, of the antibiotics selected from the list consisting of sulfonamides, penicillins, lincosamides, fluoroquinolones, aminoglycosides, and tetracyclines; preferably, the MDR strains are resistant to one or more, e.g., all, of the antibiotics selected from the list consisting of sulfonamides, amoxicillin, lincomycin, Linco-Spectin™ (lincomycin plus spectinomycin), enrofloxacin, neomycin, and doxycycline (see MDR E. coli strains in Table 1 and Example 4).

[0145] In certain embodiments, the Gram-negative bacteria is Escherichia coli and is resistant to one or more of sulfamide, amoxicillin, lincomycin, lincospectin, enrofloxacin, neomycin, and doxycycline, hi other embodiments, the Gram-negative bacteria is Klebsiella pneumoniae and is resistant to one or more of beta-lactams (e.g., carbapenems), fluoroquinolones, and trimethoprim / sulfamethoxazole.

[0146] In further embodiments, the Gram-negative bacterium is Acinetobacter baumannii and is resistant to one or more of aminoglycosides and trimethoprim / sulfamethoxazole.

[0147] In still further embodiments, the Gram-negative bacterium is Pseudomonas aeruginosa and is resistant to β-lactams.

[0148] Infection caused by gram-negative bacteria can occur in any organ or tissue of a subject. In certain embodiments, infection caused by gram-negative bacteria occurs in the blood, gastrointestinal tract, heart, cardiovascular system, liver, lungs, respiratory tract, kidneys, urinary tract, central nervous system, skin, subcutaneous tissue, or surgical wound. In a preferred embodiment, infection caused by gram-negative bacteria, such as one or more of the genera or species described herein above, preferably E. coli strains, occurs in the urinary tract. In another preferred embodiment, the infection occurs in the blood.

[0149] The Gram-negative bacteria causing the infection to be treated can be a human or animal pathogenic bacteria or strain. In some embodiments, the Gram-negative bacteria is a human pathogenic bacteria or strain. In other embodiments, the Gram-negative bacteria is an animal pathogenic bacteria or strain, such as a pathogenic bacteria or strain of birds or non-human mammals.

[0150] Compositions comprising the proteins described herein (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, vectors, or host cells, preferably proteins (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), can be delivered to a subject by various routes, for example, but not limited to, local (e.g., topical, rectal, ocular, etc.) or systemic administration. Systemic delivery may include oral or parenteral (e.g., intravenous, subcutaneous, intramuscular, and intraperitoneal) administration. Furthermore, compositions comprising the agents of the present invention may be administered intranasally or sublingually, which allows for systemic administration through a non-invasive mode of administration. Intraventricular administration may also be appropriate. Preferred delivery routes are intravascular (e.g., intraarterial or intravenous) or subcutaneous injection. In certain embodiments, agents used in accordance with the present invention are administered to a subject subcutaneously or intravenously. Those skilled in the art will appreciate the benefits of Remington's Pharmaceutical Science (17th Ed., Mack Publishing Co., Easton, Pa., 1985) and Goodman and Gilman's The Pharmaceutical Basis of Therapeutics (8th Ed. Those skilled in the art will be familiar with the principles and procedures discussed in widely known and available sources, such as "Theory of Electromagnetics and the Electromagnetic Field," Ed., Pergamon Press, Elmsford, NY, 1990, both of which are incorporated herein by reference.

[0151] The agents of the present invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include salts formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and salts formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

[0152] Solid dosage forms for oral administration may include conventional capsules, extended-release capsules, conventional tablets, extended-release tablets, chewable tablets, sublingual tablets, effervescent tablets, pills, suspensions, powders, granules, and gels. Formulations may contain standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharide, cellulose, magnesium carbonate, and the like. As is common practice, such dosage forms may contain additional substances other than inert diluents, such as dispersing and / or granulating agents, surfactants and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils. In the case of capsules, tablets, effervescent tablets, and pills, the dosage forms may also contain buffering agents. Tablets and pills may be prepared with enteric coatings.

[0153] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.

[0154] Exemplary granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, yang These include, but are not limited to, ion exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked polyvinylpyrrolidone (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and combinations thereof.

[0155] Exemplary surfactants and / or emulsifiers include natural emulsifiers (e.g., gum arabic, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite (aluminum silicate) and Veegum (magnesium aluminum silicate)), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydrolyzed cellulose, and the like), and / or cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydrolyzed cellulose, and the like). hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate (Tween 20), polyoxyethylene sorbitan (Tween 60), polyoxyethylene sorbitan monooleate (Tween 80), sorbitan monopalmitate (Span 40), sorbitan monostearate (Span 60), sorbitan tristearate (Span 65), glyceryl monooleate, sorbitan monooleate (Span 80)), polyoxyethylene esters (e.g., polyoxyethylene monostearate (Myrj 45), polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether (Brij 30), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and the like, and / or combinations thereof.

[0156] Exemplary binders include, but are not limited to, starches (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., gum arabic, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husk, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, polyvinylpyrrolidone), magnesium aluminum silicate (Veegum) and larch arabinogalactan; alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohol; and combinations thereof.

[0157] Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. Exemplary antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and phenylethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, and the like. mesylate), cetrimide, butylated hydroxyanisole (BHA), butylated hydroxyanisole Examples of preservatives include, but are not limited to, hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In certain embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0158] Exemplary buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.

[0159] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0160] Exemplary oils include almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon bark, cocoa butter, palm, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, linseed, geraniol, gourd, grape seed, helianthus annuus, laurel wreath ... Zezelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, lily of the valley, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, bran, rosemary, safflower, sandalwood, sasanqua, savory, seabuckthorn Exemplary oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof.

[0161] Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water. These compositions may contain adjuvants such as wetting agents, emulsifying agents, and suspending agents, as well as sweeteners, flavoring agents, and the like. It may also contain fragrance.

[0162] Various delivery systems are known in the art, including encapsulation in liposomes, microbubbles, emulsions, microparticles, microcapsules, etc.

[0163] Injectable preparations, such as aqueous or oily suspensions, can be formulated according to known methods using suitable dispersants, wetting agents, and / or suspending agents. Acceptable vehicles and solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. Sterile oils are also conventionally used as solvents or suspending media.

[0164] Typically, compositions for intravenous, intramuscular, subcutaneous, intraperitoneal, or intracerebroventricular administration are solutions in sterile isotonic aqueous buffer. In some embodiments, the compositions may contain small amounts of wetting or emulsifying agents, or pH buffering agents. Illustrative, non-limiting examples of pH buffering agents include Tris-HCl buffer, acetate buffer, citrate buffer, and phosphate buffer, or combinations thereof. As used herein, the terms "acetate buffer," "citrate buffer," and "phosphate buffer" may refer to buffer systems containing organic acids (acetic acid, citric acid, and phosphoric acid, respectively) and their salts. Each of these may be added in sufficient amounts. The pH of the compositions according to the present invention may be in the range of about 4 to about 8, preferably about 5 to about 7, e.g., pH 5, pH 5.5, pH 6, pH 6.5, and pH 7.

[0165] If necessary, the active ingredient of the present invention is included in a composition further comprising a solubilizing agent and a local anesthetic to ease any pain at the injection site. Generally, the ingredients are supplied separately or mixed in unit dosage form, for example as a dry lyophilized powder or water-free concentrate, in a hermetically sealed container such as an ampule or sachet indicating the quantity of active ingredient. When the composition is administered by injection, it can be dispensed with an infusion bottle containing sterile pharmaceutical-grade water or saline. When the composition is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

[0166] The effective amount of the agent of the present invention can vary widely and generally depends on the particular application, duration of exposure, and other considerations. In certain embodiments, the dosage ranges from 0.01 mg / kg to 20 mg / kg, preferably 0.05 mg / kg to 10 mg / kg, e.g., 0.1 mg / kg to 5 mg / kg or 1 mg / kg to 2 mg / kg.

[0167] In an eleventh aspect, the present invention relates to a process for preparing a pharmaceutical composition comprising mixing one or more of the proteins (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, vectors or host cells according to the present invention with a pharmaceutically acceptable carrier, vehicle or excipient.

[0168] In a twelfth aspect, the present invention relates to a kit comprising a protein defined herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotide, vector, host cell, or composition, alone or in combination. Reagents, tools, and / or instructions for carrying out the methods described herein can be provided in the kit. For example, the kit can include reagents, tools, and instructions for use in the prophylactic and / or therapeutic treatment of infections caused by Gram-negative bacteria, or for carrying out an in vitro method of inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria. For example, the Gram-negative bacteria is one or more of the genera or species described herein above.

[0169] In a thirteenth aspect, the present invention relates to an in vitro method for inhibiting the growth of, or reducing the population of, or killing Gram-negative bacteria. The present invention relates to an in vitro method comprising contacting a bacterium with a protein described herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and chimeric protein described herein), a polynucleotide, a vector, a host cell, or a composition. Preferably, the protein described herein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein and chimeric protein). For example, the Gram-negative bacterium is one or more of the genera or species described herein above. In a preferred embodiment, the Gram-negative bacterium is an Enterobacterium described herein above, preferably K. pneumoniae or E. coli. In another preferred embodiment, the Gram-negative bacterium is one or more species selected from the group consisting of the genera Acinetobacter, Pseudomonas, Escherichia, and Klebsiella, preferably one or more species selected from the group consisting of E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa.

[0170] In a fourteenth aspect, the present invention provides a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotide, expression vector or host cell described herein, wherein the protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein) or the encoded polypeptide has the property of inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria. For example, the Gram-negative bacteria is one or more of the genera or species described herein above. In a preferred embodiment, the Gram-negative bacteria is an Enterobacterium described herein above, preferably K. pneumoniae or E. coli. In another preferred embodiment, the Gram-negative bacteria is one or more species selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia and Klebsiella, preferably one or more species selected from the group consisting of E. coli, K. pneumoniae, A. baumannii and P. aeruginosa.

[0171] The agents of the present invention (e.g., proteins (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, expression vectors, or host cells) can be used alone or in combination with permeabilization agents for the outer membrane of Gram-negative bacteria, including, but not limited to, metal chelators such as EDTA, TRIS, lactic acid, lactoferrin, polymyxin, and citric acid (Non-Patent Document 32). This can be part of the same or a separate composition. In a preferred embodiment, the agents of the present invention are not used in combination with a permeabilization agent.

[0172] The proteins (including the protein consisting of the amino acid sequence of SEQ ID NO: 1, the proteins and chimeric proteins described herein), polynucleotides, vectors, host cells or pharmaceutical compositions used in the therapeutic methods described herein may be used alone (i.e., as a single agent) or in combination with one or more therapeutic agents, including antiseptic agents, lantibiotics, bacteriocins, other endolysins or antibiotics.

[0173] Antiseptic reagents include Daquin's solution, sodium hypochlorite, or calcium carbonate. Examples of suitable antiseptics include, but are not limited to, sodium solution, benzenesulfochloramide sodium solution, certain iodine agents such as iodopovidone, peroxides such as urea perhydrate solution and pH buffered peracetic acid solution, alcohol with or without preservative additives, weak organic acids such as sorbic acid, benzoic acid, lactic acid, and salicylic acid, some phenolic compounds such as hexachlorophene, triclosan, and dibromol, and cationically active compounds such as benzalkonium, chlorhexidine, methylisothiazolone, α-terpineol, thymol, and chloroxylenol octenidine solution.

[0174] In a fifteenth aspect, the present invention provides an agent of the invention as described herein (e.g., The present invention also relates to a protein (including a protein consisting of the amino acid sequence of SEQ ID NO: 1, the proteins and chimeric proteins described herein), polynucleotide, expression vector, or host cell), or pharmaceutical composition comprising the same, wherein the treatment comprises administering an agent of the present invention described herein in combination with another drug. Each agent can be administered as a single agent or in combination therapy, at a dose and / or time schedule commonly used therefor. Dosages and administration regimens for the chimeric proteins of the present invention are described herein.

[0175] In certain embodiments, the administration of the agents of the invention described herein is simultaneous with the administration of the other drug as part of the same or a separate composition, hi another specific embodiment, the administration of the agents of the invention described herein is sequential (before or after) with respect to the administration of the other drug.

[0176] In a preferred embodiment, the other drug is an antibiotic. Conventional antibiotics used against gram-negative bacteria that can be used in the present invention include, but are not limited to, sulfonamides (e.g., sulfamethoxazole and trimethoprim-sulfamethoxazole), penicillins (e.g., ticarcillin, piperacillin, amoxicillin (including ureidopenicillins such as azlocillin, piperacillin, and mezlocillin)), cephalosporins (e.g., ceftazidime, cefepime, and cefoperazone), monobactams (e.g., aztreonam), lincosamides (e.g., lincomycin), fluoroquinolones (e.g., ciprofloxacin, levofloxacin, and norfloxacin), carbapenems (e.g., imipenem, meropenem, ertapenem, and doripenem), aminoglycosides (e.g., gentamicin, tobramycin, and amikacin), and polymyxins (e.g., colistin and polymyxin B).

[0177] The present invention also relates to the use of an agent of the present invention as described herein in the manufacture of a medicament for the treatment and / or prevention of a Gram-negative bacterial infection as described herein by combination therapy using an agent of the present invention as described herein and another drug, preferably an antibiotic, as described herein.

[0178] The present invention further relates to a method for treating and / or preventing a gram-negative bacterial infection as described herein, comprising administering to a patient in need of such treatment a therapeutically effective amount of an agent of the invention as described herein in combination with a therapeutically effective amount of another drug, preferably an antibiotic, as described herein.

[0179] In a preferred embodiment, the above combination is a synergistic combination. As described in Example 10, a synergistic effect has been observed between the protein of the present invention (including the protein consisting of the amino acid sequence of SEQ ID NO: 1, the protein described herein, and the chimeric protein) and a carbapenem antibiotic, preferably selected from the group consisting of imipenem and meropenem. Therefore, in a particularly preferred embodiment, the chimeric protein of the present invention is used in combination with a carbapenem antibiotic.

[0180] In a further aspect, the present invention relates to the use of the proteins described herein (including the protein consisting of the amino acid sequence of SEQ ID NO: 1, the proteins and chimeric proteins described herein) or compositions comprising same as disinfectants for materials and / or surfaces in hospitals as well as in the general household. These materials and / or surfaces include, but are not limited to, medical devices such as joint replacements and other types of orthopedic devices, prosthetic heart valves, pacemakers, implantable cardioverter-defibrillators, urinary catheters and stents, peritoneal dialysis catheters, intravascular catheters, cerebrospinal fluid shunts, breast implants, and vascular grafts and stents. The compositions described above contain the proteins of the present invention (including the protein consisting of the amino acid sequence of SEQ ID NO: 1, the proteins and chimeric proteins described herein). The composition may also contain, and optionally may further contain, other disinfectants and / or surfactants.

[0181] It is contemplated that any feature described herein can be combined in any way with any of the embodiments of the proteins (including proteins consisting of the amino acid sequence of SEQ ID NO: 1, proteins and chimeric proteins described herein), polynucleotides, vectors, host cells, compositions, kits, any use, medical use, method of treatment, method of manufacturing a medicament, and combination therapy of the present invention, and any embodiment discussed herein can be implemented with respect to any of these. It is understood that the specific embodiments described herein are presented by way of illustration, not as limitations of the present invention.

[0182] All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0183] The use of the word "a" or "an" may mean "one," but is also consistent with the meanings "one or more," "at least one," and "one or more." The use of the word "another" may also refer to one or more. The use of the word "or" in the claims is used to mean "and / or" unless expressly stated to refer only to alternatives or unless the alternatives are mutually exclusive.

[0184] As used in this specification and claims, "comprising" (and any form of "comprise", such as "comprise" and "comprises"), "having" and "including" are used interchangeably. "having" (and "have" and "has" etc.) "including" (and "includes"), "including any form of "including" and any form of "comprises" such as "include" or "containing" (containing)" (and "contains" and "contain" etc.) The words "comprises" and "comprises" (any form of "comprises") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The terms "consists of" and "consists essentially of" are also encompassed and expressly disclosed. As used herein, the phrase "consisting essentially of" limits the scope of a claim to the materials or steps specified and to those that do not materially affect the basic and novel attribute(s) of the claimed invention. As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim, except, for example, impurities ordinarily associated with that element or limitation.

[0185] As used herein, the term "or combinations thereof" refers to all permutations and combinations of the items listed preceding the term. For example, "A, B, C, or combinations thereof" includes at least one of A, B, C, AB, AC, BC, or ABC, and is intended to also include BA, CA, CB, CBA, BCA, ACB, BAC, or CAB if order is important in the particular context. Continuing with this example, combinations including repeats of one or more items or terms, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, etc., are expressly included. Those of skill in the art will understand that there is typically no limit to the number of items or terms in any combination unless the context makes clear otherwise.

[0186] As used herein, open-ended approximation terms such as "about," "around," and "approximately," when so modified, are not necessarily understood to be absolute or complete, but refer to a condition that would be considered by one skilled in the art to be sufficiently close to provide a basis for designating the condition as existing. The extent to which the description may vary depends on the degree of modification that can be made, and it is understood by one skilled in the art that the modified feature is the required characteristic and the unmodified feature is the required characteristic. It is recognized that the present invention still has the ability to achieve the characteristics described above. Generally, subject to the foregoing, numerical values ​​herein modified by approximation terms such as "about" may vary from the stated value by ±1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. Thus, the term "about" can mean ±5% of the stated value, preferably ±2% of the stated value, and most preferably, the term "about" means exactly the stated value (±0%). The following examples serve to illustrate the present invention and should not be construed as limiting its scope. [Example]

[0187] The assays disclosed in the Examples below were performed using the following materials and methods.

[0188] Bacterial strains and culture media The bacterial strains and culture media used are detailed in Table 1.

[0189] All solutions and culture media used were sterilized by moist heat in an autoclave at 120° C. and 1 atmosphere or by filtration through sterile Millipore filters with a diameter of 0.2 μm.

[0190] The antibiotics were prepared in concentrated aqueous solutions, which were sterilized by filtration and stored at -20°C.

[0191] [Table 1]

[0192] Construction, expression and purification of IKB206 and IKB206 mutants IKB206 is the result of the fusion of the putative endolysin (SEQ ID NO: 1) (protein ID: YP_009284326.1) of the Enterobacter phage Arya (NCBI accession number NC_031048.1) with the putative cell wall-binding domain (D8) (SEQ ID NO: 2) of the phage endolysin of Bacillus amyloliquefaciens (Non-Patent Document 33) (accession number AAK40280.1). Constructs were designed and cloned into the expression plasmid pET29b(+) using GenScript™. In the first construct, a DNA fragment encoding the IKB206 chimera was cloned into the plasmid such that the sequences encoding two tags (S tag and His tag) were removed from the plasmid. In the second construct, the sequences corresponding to the tags were not removed, and a thrombin cleavage site and three amino acids were added to the resulting fusion to improve thrombin cleavage efficiency. For non-limiting illustrative purposes, a schematic diagram of the chimeric lysin is shown in Figure 1.

[0193] Additionally, a putative endolysin derived solely from phage Arya was cloned into the plasmid pET29b(+) following the same strategy as for the tagless IKB206. This construct was designated IKB206ΔD8.

[0194] These three IKB206 recombinant plasmids were transformed into competent Escherichia coli BL21(DE3) (Invitrogen, Carlsbad, CA, USA).

[0195] For overexpression using tags, see IKB206 タグ ), the transformed BL21(DE3) cells were cultured at 37°C in LB medium supplemented with 30 μg / mL kanamycin sulfate. 600When the pH reached 1.5, 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added and the mixture was incubated at 37°C for 4–5 hours. Cells were harvested by centrifugation (10,000 × g, 30 min), resuspended in 20 mM NaHPO / NaHPO, 0.5 M NaCl, and 20 mM imidazole (pH 7), and disrupted using a Branson Sonifier SFX150 (Branson Sonic Power, Danbury). The soluble protein fraction (supernatant) was isolated by centrifugation (15,000 × g, 30 min), filtered (0.45 μm), and purified. A 5 mL prepacked HisTrap FF column preloaded with Ni-Sepharose was used on an AKTAStar chromatography system (GE Healthcare, USA) to analyze IKB206. タグ IKB206 was purified in 20 mM NaHPO / NaHPO, 0.25 M NaCl, and 0.4 M imidazole (pH 8). タグ Subsequently, IKB206 was eluted using 5 mL HiTrap™ Desalting and 20 mM NaHPO / NaHPO (pH 6) on an AKTAStar chromatography system (GE Healthcare, USA). タグ Desalted. IKB206 タグ was stored at -20°C.

[0196] For overexpression of untagged IKB206, transformed BL21(DE3) cells were grown at 37°C in autoinducing LB broth medium (Studier FW, 2005) supplemented with 30 μg / mL kanamycin sulfate. After 3 h at 37°C, the temperature was shifted to 25°C, and cells were grown for 4 h before being harvested. Cells were harvested by centrifugation (10,000 × g, 30 min) and resuspended in lysis buffer containing 50 mM Tris (pH 9), protease inhibitors (Thermo Fisher Scientific, Massachusetts, USA), and DNase I (Roche). The soluble protein fraction (supernatant) was separated by centrifugation (23,666 × g, 1 hour 30 minutes), filtered (0.22 μm), and purified using an AKTA go chromatography system (Cytiva Life Sciences, USA). The protein solution was subjected to cation exchange chromatography using a 5 mL HiTrap SP HP column. IKB206 was eluted with a gradient of 50 mM Tris, 1 M NaCl (pH 9). The presence of the protein was confirmed by SDS-PAGE, and the protein-containing fractions were pooled and concentrated to a final volume of approximately 2 mL to 5 mL. The solution was 0.22 μm filtered and loaded onto a HiLoad 16 / 600 Superdex 75 size-exclusion column pre-equilibrated with 20 mM Tris, 500 mM NaCl (pH 8). The presence of the protein was confirmed by SDS-PAGE. AKT 5 mL HiTrap connected to A go chromatography system (Cytiva, USA) IKB206 was desalted using a desalting column and 10 mM NaHPO / NaHPO (pH 6). IKB206 was stored at -80°C.

[0197] For overexpression of IKB206ΔD8, the transformed BL21(DE3) cells were cultured at 37°C in LB broth medium supplemented with 30 μg / mL kanamycin sulfate. 600 When the pH reached 0.8, 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added, and the cells were incubated overnight at 25°C before being harvested. Cells were harvested by centrifugation (10,000 × g, 30 min) and resuspended in lysis buffer containing 50 mM Tris (pH 8.5), protease inhibitors (Thermo Fisher Scientific, Massachusetts, USA), and DNase I (Roche). The soluble protein fraction (supernatant) was separated by centrifugation (23,666 × g, 1 hour 30 minutes), filtered (0.22 μm), and purified by connecting to an AKTA go chromatography system (Cytiva Life Sciences, USA). The protein solution was subjected to cation exchange chromatography using a 5 mL HiTrap SP HP column. The endolysin was eluted with a gradient of 50 mM Tris, 1 M NaCl (pH 8.5). The presence of the protein was confirmed by SDS-PAGE, and the protein-containing fractions were pooled and 0.22 μm filtered. The 5 mL HiTrap desalting column was connected to an AKTA go chromatography system (Cytiva, USA). The protein was desalted using a g column and 10 mM NaHPO / NaHPO (pH 6). IKB206ΔD8 was stored at -80°C.

[0198] Purified proteins were quantified by the Bradford method using Coomassie Blue (Thermo Fisher Scientific) and a Spectrostar Nano spectrophotometer (BMG labtech). A 595 The purity of the isolated protein was verified by SDS-PAGE. SDS-PAGE analysis was performed using 4%-12% SurePage™ gels (GenScript, Nanjing) in Tris-MOPS-SDS electrophoresis buffer (GenScript, Nanjing) at a constant voltage (200 V).

[0199] Enzyme bactericidal activity assay Experiments performed to analyze the bactericidal activity of the enzyme IKB206 (untagged, tagged, or without the D8 domain) were performed using a modified version of the protocol previously described by Loessner et al. (Loessner, M. J. et al. 2002) and Schmelcher et al. (Schmelcher, M. et al. 2010). Briefly, various bacterial cultures were incubated at 37°C or 30°C in specific media (Table 1), depending on the strain, for 1 hour. 600 The cells were then sedimented by centrifugation (4500 × g, 10 min), washed twice with the corresponding buffer, and incubated until the A 600 The pH was adjusted to approximately 0.3. A volume of 160 μl of the bacterial suspension was transferred to a sterile 96-well plate, and 40 μl of the enzyme under study was added at doses ranging from 1 μg / mL to 60 μg / mL. Control wells were treated with the same volume of buffer containing the enzyme. The plates were incubated at 37°C. At different time points, samples were taken, serially diluted, and plated on plates containing specific media to determine the viable bacterial count. The experiment was repeated at least three times. The bactericidal effect of IKB206 (and its mutants) was quantified as the log reduction in the presence of treatment after a given incubation time (log 10 (N0 / N i ), where N0 = number of CFU / mL before treatment and N i = the number of CFU / mL after the corresponding incubation time in the presence of each treatment.) A compound is considered to have bactericidal activity if the initial bacterial count is reduced by 99.9% or more (a 3-log reduction or greater) after incubation with the compound.

[0200] Enzyme specific activity assay Specific activity (U / mG) was measured using cold buffer (IKB206 タグThe enzyme activity was determined by incubating a 0.6 mg / mL suspension of lyophilized M. lysodeikticus cells resuspended in 10 mM NaHPO / NaHPO (pH 6) for lysosomes and 50 mM KHPO / KHPO (pH 6.2) for egg white lysozyme with different enzyme concentrations. Egg white lysozyme (Fisher BioReagents™ Lysozyme) was used as a control. Specifically, 100 μL of M. lysodeikticus suspension was plated in triplicate in a multiwell plate, and 100 μL of each of the different enzyme concentrations was added to the corresponding wells. The plate was then placed in a thermostated spectrophotometer (IKB206) and incubated at the appropriate temperature. タグ 37°C for lysozyme and 25°C for egg white lysozyme), 450 The decrease in was monitored over a 10 minute period.

[0201] Unit definition: One unit is the amount of enzyme required to catalyze a 0.001 / min decrease in absorbance at 450 nm upon lysis using an approximately 0.4 mg / mL to 0.6 mg / mL M. rhizodeikticus suspension in a 1 cm cuvette at the appropriate temperature and pH for each lysozyme.

[0202] Physicochemical characterization assays IKB206 タグ Experiments to investigate the optimal conditions for the enzyme activity of this strain were carried out using an E. coli bactericidal activity assay. For this purpose, E. coli strain ATCC 25922 and protein concentrations ranging from 1 μg / mL to 60 μg / mL were used. The assay was carried out in a pH range of 6 to 8 and in a sodium phosphate buffer (NaHPO / NaHPO) concentration range of 10 mM to 50 mM.

[0203] stability studies Experiments to determine the stability of IKB206 were performed by E. coli bactericidal activity assay with an incubation time of 60 minutes. For this purpose, E. coli strain ATCC 25922 dissolved in different concentrations of glycerol (0%, 0.2%, 2%, 5%, and 10%) and 15 μg / mL IKB206 were used. The assay was performed at different storage temperatures (-80°C, -20°C, 4°C, and 25°C) and storage times (1 day, 5 days, 7 days, 14 days, 21 days, and 29 days).

[0204] Cytotoxicity assay using sulforhodamine B Prior to the experiment, seeding tests were performed using human HEK293 cells. To this end, three different cell concentrations were seeded in 100 μl of DMEM medium + 10% fetal bovine serum (FBS) in 96-well plates. These cells were incubated at 37°C and 5% CO2 for 72 hours, and growth was monitored. The initial cell concentration that showed 80% confluence at 72 hours was selected for further assays, in this case 7000 cells / well.

[0205] 24 hours after cell seeding, the purified protein IKB206 タグ An additional 100 μl of medium containing the following concentrations of ATP was added: 400 μg / mL, 200 μg / mL, 100 μg / mL, and 50 μg / mL. Assays were performed in quadruplicate. As controls, cells were incubated with culture medium alone and with the protein dissolving buffer alone (vehicle control). The volume of buffer added to the vehicle control was the same as the volume of the highest protein concentration. Plates were further incubated for 48 hours.

[0206] Cells were fixed by adding 50 μl of 50% cold trichloroacetic acid (TCA) per well and incubating the plate at room temperature for 1 hour. After discarding the TCA, the plate was washed with distilled water and 40 μl of 0.4% sulforhodamine B (SRB) was added. The plate was incubated at room temperature for 15 minutes and washed three times with 1% acetic acid. The plate was then dried. Finally, 200 μl of 10 mM Tris Base was added per well, and the plate was incubated at room temperature for 20 minutes with stirring to resuspend the SRB. The results were read at an absorbance of 510 nm using a Cytation 5 (Bioteck, USA).

[0207] Efficacy assay using a sepsis model in zebrafish Experiments with adult zebrafish were carried out at the facilities of Ikan Biotech in Noain (Navarre). All scientific methods for the above assays were carried out in accordance with Royal Decree 53 / 2013 of 8 February 2013 and approved by the Institutional Committee for the Care and Use of Animals of the National Institute of Health for Laboratory Animals at the University of Navarre (Pamplona, ​​Spain). All experiments performed with animals in this study were approved by the institutional committee (Protocol 034-17 and amendment e035-17) and were conducted in accordance with the regulations of the Guide for the Care and Use of Animals.

[0208] To calculate the minimum lethal dose that caused 100% mortality over 7 days, groups of five 6-month-old wild-type female zebrafish were inoculated intraperitoneally (IP) with different bacterial dilutions of E. coli strains in LB medium.

[0209] After determining the minimum lethal dose, 6-month-old wild-type zebrafish (1.2 g) were inoculated with 5.5 × 10 7 A total of 10 μl containing CFU / mL of E. coli bacteria was inoculated intraperitoneally (IP). All experiments were repeated at least three times.

[0210] Chimera IKB206 タグ To study the protection afforded by E. coli, groups of five 6-month-old wild-type female zebrafish were challenged with a lethal dose of the bacteria E. coli (5.5 × 10 7After 1 hour, the mice were infected intraperitoneally (IP) with 10 μl of IKB206 at doses of 1 mg / kg body weight, 0.5 mg / kg body weight, and 0.25 mg / kg body weight. タグ Animals were treated with subcutaneous injection of 100 mg of 10 ...

[0211] Bacterial strains, antibiotics and endolysins used in synergy studies The E. coli strains used in this study and their MICs are shown in Table 2. IKB206 タグ The endolysin was purified from Escherichia coli strain BL21(DE3) as previously described.

[0212] [Table 2]

[0213] Checkerboard and isobologram analyses The checkerboard test was assessed by the microdilution method as previously described (Moody JA 1992, Moellering EG., Jr. 1996). All compounds were diluted two-fold in serial dilutions and then diluted to 100 mg / mL. were tested at six concentrations ranging from 0.03x to 2x the MIC. Each microtiter well was filled with 1 x 10 mAb containing or without the corresponding compound in a final volume of 200 μl per well of 10 mM sodium phosphate (TP-Na) buffer (pH 6.15). 5 100 μl of CFU / mL of E. coli inoculum was added, and the plates were incubated at 37°C for 17 hours.

[0214] The fractional inhibitory concentration index (FICI) is a simple IKB206 alone or in combination divided by the MIC of each antibiotic タグor calculated as the MIC of each antibiotic (Moody JA 1992, Moellering EG., Jr. 1996). F ICI obtained the FICI by summing as follows: FICI X = FICI A + FICI B = MIC in combination A / MIC A + MIC in combination B / MIC B

[0215] The MIC of drug A is shown on the x-axis of the isobologram, and the MIC of drug B is shown on the y-axis. The line connecting these two data is the indifference line (no interaction). Various FICI values of the combination indicate synergistic (FICI ≤ 0.5), partial synergistic effect (0.5 < FICI < 1), additive (FICI = 1), irrelevant (1 < FICI < 2), or antagonistic (FICI > 2) interactions.

[0216] In vitro time-kill curve tests of single agents and combinations Time-kill assays were evaluated according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (National Committee for Clinical Laboratory Standard (NCCLS) Methods for determining bactericidal activity of antimicrobial agents. Wayne, PA: CLSI; 1999. Document M26-A). Studies of combinations in time-kill assays were performed using each antibiotic and enzyme alone or in combination at concentrations where a synergistic effect was demonstrated. In these assays, 1×10 6 CFU / mL of the test strain was incubated in separate tubes with individual compounds or combinations in 10 mM TP-Na (pH 6.15). At the 17-hour time point, aliquots were removed from each tube, serially diluted (1:10) using sterile physiological saline, and cell viability was determined. 10 μl was added from each dilution to LB agar plates and incubated at 37 °C for 24 hours (detection limit, 102 CFU / mL). According to the Clinical and Laboratory Standards Institute, a combination of two antimicrobial agents is considered synergistic if it causes a 2-log unit or greater reduction in CFU / mL compared to the sum of the reductions observed by the individual compounds at the end of the experiment, in this case, 17 hours (CLSI guidelines).

[0217] Bioinformatics analysis Programs accessible on the internet, such as BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), GenomeNet (http: / / www.genome.jp), Expasy (https: / / web.expasy.org / protparam / ), and PFAM (http: / / pfam.xfam.org), were used for bioinformatics analysis.

[0218] Structural models of the catalytic cavity and D8 domain of IKB206 were generated using the online software Phyre2 (Kelley LA et al. 2015) and Swissmod ( The sequence alignment was performed using Clu stal omega(https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) and Espri pt (http: / / espript.ibcp.fr / ESPript / ESPript / ).

[0219] Structural analysis and drawings were generated using Pymol (available online at https: / / pymol.org / 2 / ) and Chimera software (Pettersen EF et al. 2004).

[0220] statistical analysis Data presented throughout this study are representative of results from three to five independent experimental replicates, depending on the assay type. Furthermore, mean and standard error are shown for each data point. Statistical analysis was performed using the program GraphPad InStat version 3.0 (GraphPad Software, San Diego, CA) and the software Stata 15.0 (StataCorp LLC, Texas, TX).

[0221] For in vitro bactericidal activity assays, the Kruskal-Wallis test was used along with the Mann-Whitney U test depending on the characteristics of the data (normality and homoscedasticity), and analysis of variance (ANOVA) was used. VA) was used with Tukey's test or t-test.

[0222] For human cytotoxicity data, the Kruskal-Wallis test was used.

[0223] In survival experiments to determine the protective effect of the enzyme IKB206 in various animal models, ANOVA was used together with Dunnett's test and ordered log-rank (Mantel-Cox) test to verify the significance of the survival of animals in the different experimental groups.

[0224] Example 1.-IKB206 and IKB206 タグ Expression and purification It has an S tag and a 6xHis tag at the N-terminus and C-terminus (IKB206 タグ The chimeras were cloned into the pET-29b(+) plasmid in two different ways: with (IKB206, Figure 1b) and without any tag (IKB206, Figure 1a). The first assay was performed using IKB206 to facilitate the purification process. タグ After it was observed that the chimera exhibited bactericidal activity against E. coli, the following bactericidal assay was performed using the tagless chimera IKB206.

[0225] A 600 IKB206 was grown by inducing a culture of approximately 1.5 ml with 1 mM IPTG at 37°C and 200 rpm for 4-5 hours.タグ The IKB206 protein was overexpressed because better results were obtained under the above conditions during the purification process. Protein purification was performed by affinity chromatography using the 6xHis tag. Figure 2 shows the IKB206 protein obtained. タグ As can be seen, the size predicted by computer is consistent with the size obtained by electrophoresis (35.4 kDa).

[0226] IKB206 was overexpressed in autoinducible LB broth (Studier FW. 2005) at 25°C and 200 rpm for 4 hours. Protein purification was performed by cation exchange chromatography at pH 9 (the pI of IKB206 is approximately 10) followed by size exclusion chromatography. Figure 2b shows the resulting protein purity of IKB206. The molecular weight of the band is consistent with the calculated molecular weight of IKB206, which is 29.9 kDa.

[0227] Example 2. Physicochemical characterization IKB206 in in vitro assays to obtain maximum activity タグ To determine the optimum conditions for IKB206 タグ The effects of different sodium phosphate buffer concentrations and pH on the bactericidal activity of E. coli ATCC 25922 were investigated. For this purpose, E. coli ATCC 25922 resuspended at different concentrations in phosphate buffer and adjusted to different pH values ​​was used as a substrate. The difference in CFU / mL between the control and protein treatment under different conditions was measured, and it was found that the highest bactericidal activity was observed in phosphate buffer at a concentration of 10 mM and pH 6 (data not shown).

[0228] Furthermore, both the net charge of the protein and the net charge of the modules were estimated based on their respective sequences using the bioinformatics portal Expasy ProtParam: the net charge of the complete protein is +21, the net charge of the module corresponding to the phage Arya endolysin is +7, and the net charge of module D8 is +15.

[0229] Example 3. - Stability studies To determine the optimal storage conditions for chimeric IKB206, bactericidal activity assays were performed using chimeras stored at different temperatures for different time periods. Furthermore, we investigated whether glycerol could help increase protein stability under the various storage conditions studied. The chimeric protein was found to remain fully active at all temperatures and glycerol concentrations tested upon 29 days of storage (data not shown).

[0230] Example 4.-IKB206 タグ Functional characterization of IKB206 タグ After the optimum conditions for activity were determined, the enzyme was subjected to functional characterization. For this purpose, the specific activity (U / mg) and bactericidal activity of the enzyme were determined.

[0231] The standard test for determining the enzymatic activity of lysozyme is the A of a suspension of intact M. rhizodeikticus cells after incubation with the enzyme. 450 Two independent assays of this type were performed and, after following the protocol described above, the reduction of IKB206 タグ The specific activity of was determined to be approximately 8100 U / mg.

[0232] After determining the specific activity, the bactericidal activity of this enzyme against E. coli ATCC 25922 at different concentrations was determined. Following the protocol described above, IKB206 was found to be bactericidal after only 5 minutes of incubation at a concentration of 15 μg / mL. タグ It was observed that IKB206 could significantly (2 log or more than 100-fold) reduce the number of CFU / mL compared to the control (P<0.05) (Figure 3). Furthermore, extending the incubation time to 15 min significantly reduced the number of CFU / mL. タグ The reduction in CFU / mL in the presence of 10 was significant (P<0.05) at concentrations of only 5 μg / mL. 5When this type of assay was performed, starting with a bacterial suspension consisting of CFU / mL, it was observed that the enzyme was able to kill the entire culture within 15 minutes of incubation at a concentration of 60 μg / mL and 30 minutes of incubation at a concentration of 15 μg / mL (Figure 3). In other words, IKB206 was able to achieve a 5-log (100,000-fold) reduction within 30 minutes of incubation of the bacterial suspension.

[0233] IKB206 タグ To determine whether activity could be extended to serotypes other than E. coli strain ATCC 25922 (O6 serotype), the studies were expanded to include E. coli strain DSM 17076, serotype O157:H7. Based on the results described above, 15 μg / mL was selected as an appropriate concentration for these assays. The results obtained are shown in Figure 4. The recombinant lysin significantly reduced the number of E. coli strain DSM 17076 cells, although it was unable to kill the entire culture.

[0234] Due to the clinical importance of multidrug-resistant (MDR) E. coli strains to human and animal health, a series of assays were performed to evaluate the efficacy of IKB206 against MDR strains isolated from chickens. タグ The bactericidal activity of IKB206 was determined (see Table 1). タグ It was observed that at 15 μg / mL after 30 minutes of incubation, a significant 2-log to 5-log (100-fold to 100,000-fold) reduction in the number of bacteria present in the assay was achieved (FIG. 5).

[0235] Example 5. - IKB206 on the chicken microbiota タグ Study of the impact of The aim of this paper is to obtain a molecule with bactericidal effect against E. coli for both human and animal health applications. To this end, the specificity of this enzyme for E. coli was demonstrated and its activity was tested against strains of the bacterial population present in chickens over 40 days of age, namely S. xylosus, E. avium, E. faecium and E. faecalis, in order to exclude any possibility of interaction with the bacterial microflora present in chickens and therefore any possible influences deriving from said microflora. The bactericidal activity of IKB206, a microbial fungicide, was analyzed (Proietti, PC et al. 2006). The results in Figure 6 show that IKB206 has virtually no effect on the strains of chicken microbiota analyzed.

[0236] Example 6. - Action spectrum study of IKB206 In addition, to determine the spectrum of action of IKB206, other enterobacteria (Citrobacter freundii, Enterobacter cloacae, Serratia marcescens, and The bactericidal activity of this enzyme against Klebsiella pneumoniae and other non-enterobacterial Gram-negative bacteria (Acinetobacter baumannii and Pseudomonas aeruginosa) was studied. Regarding its effect on enterobacteria, it can be seen in Figure 7 that IKB206 exhibited high bactericidal activity against K. pneumoniae, i.e., a greater than 4-log reduction was observed under the test conditions. However, the same effect was not observed with C. freundii, and although this effect was observed to increase with incubation time, the bactericidal activity was significantly lower than that observed with E. coli or K. pneumoniae. In the case of S. marcescens, IKB206 exerted a higher efficacy compared to C. freundii. For S. marcescens, the mortality observed with E. coli was not reached at the incubation times tested, but a much greater upward trend with incubation time was observed, reaching a bactericidal effect of nearly 3 logs at 120 minutes of incubation. Extending the bactericidal activity studies to other non-enterobacterial Gram-negative bacteria, it was observed that IKB206 also exhibited high bactericidal activity against A. baumannii and P. aeruginosa, achieving a greater than 4 log reduction in CFU / mL (Figure 8).

[0237] Example 7. - Study of the mechanism of action of IKB206 To study the mechanism of action of IKB206, the secondary structure of the enzyme was modeled to determine the importance of domain D8 in the activity of IKB206.

[0238] To determine the putative protein structure of IKB206, structural models of the catalytic domain and D8 domain were constructed using the online software Phyre2 (Kelley LA et al. 2015) and Swissmodel (Waterhouse A et al. 2018) (Figures 9A and 9B). The driver was built separately.

[0239] The D8 domain was constructed using the N-terminal LysM domain of a putative endopeptidase from Thermus thermophilus as a template (Wong JE et al. 2015). The model was constructed using the crystal structure of Acinetobacter baumannii AB 5075UW2 prophage lamidase as a template (Sykilinda NN et al. 2018). The structural model of the catalytic domain suggests that it is similar to the structure of T4 lysozyme and other T4 lysozyme-like endolysins, such as P22 phage lysozyme (Mooers BH et al. 2006) or the E. coli DLP12 prophage lamidase (Sykilinda NN et al. 2018). The overall fold of T4 lysozyme is similar to that of endolysins encoded by phage cleavages (Babu K et al. 2018). The catalytic mechanism of T4 lysozyme is well described, and the residues involved in the catalytic reaction are well described (Rennel D et al. 1991; Kuroki R et al. 1995; Kuroki R et al. 1999). Other endolysins, such as P21 and P22, have similar amino acids in the catalytic cleft (Xu M, et al. 2005; Mooers BH et al. 2006; Maciejewska B et al. 2018). al. 2017), which is usually formed by an E-8aa-D / C-5aa-T motif. It has also been shown to constitute the so-called catalytic triad (Babu K et al. 2018). The presence of this motif has been described as a hallmark of T4 lysozyme-like endolysins (Sun Q et al. 2009, Maciejewska B et al. 2017, Babu K et al. 2018). The sequence of IKB206 reveals that residues E15, D24, and T33 closely match the catalytic residues of DLP12 endolysin, T4 lysozyme, P22 lysozyme, and BA 5075UW muramidase, all of which have been identified as T4 lysozyme-like endolysins (Babu K et al. 2018, Daopin S et al. 1991, Mooers BH et al. 2006, Sykilinda NN et al. 2018, respectively) (Figure 1). 9D). Furthermore, structural superposition of the IKB206 structural model onto the crystal structures of these endolysins (PDB codes 1L48, 4ZPU, 2ANV, and 6ET6, respectively) (Figure 9C), along with sequence alignment, indicates that E15, D24, and T33 may constitute the catalytic triad of IKB206. Another structural feature of T4 lysozyme is the presence of a salt bridge between R145 and catalytic E11 (Rennel D et al., 1991; Babu K et al., 2018). The presence of a salt bridge between the catalytic glutamate and an arginine located near the C-terminal region is conserved among other T4 lysozyme-like endolysins (Babu K et al., 2018). The role of this salt bridge may be important for the catalytic activity of IKB206. It has been proposed that this mechanism orients the glutamate side chain within the catalytic cleft (Rennel D et al., 1991; Babu K et al., 2018). In the structural model of IKB206, R139 may form a salt bridge with E15, supporting the hypothesis that E15 is one of the catalytic residues of IKB206.

[0240] These findings support the idea that the catalytic domain of IKB206 belongs to a T4 lysozyme-like endolysin, with residues E15, D24, and T33 forming the catalytic triad of the enzyme.

[0241] To determine the importance of domain D8, we obtained a protein corresponding to only the catalytic domain, IKB206ΔD8. This construct was overexpressed in LB broth. Protein overexpression was induced with 1 mM IPTG at 25°C and 200 rpm for 16 hours when the A600 reached approximately 0.8. IKB206ΔD8 was purified by cation exchange chromatography at pH 8.5 (pI approximately 9.5). Figure 2C shows the purity of the resulting protein. The molecular weight of this band is consistent with the calculated molecular weight of the protein, 17.54 kDa. Assays to determine the bactericidal activity of IKB206ΔD8 in E. coli strain ATCC 25922 showed that the polypeptide exhibited bactericidal activity in the absence of the D8 domain. However, a longer incubation time was required to achieve the same level of bactericidal activity as IKB206 (Figure 10).

[0242] Example 8.—IKB206 in an in vivo sepsis model タグ Study of the effectiveness of IKB206 タグ To be able to determine whether this molecule is effective in treating E. coli infection in an organism, a series of assays were performed to evaluate the efficacy of this molecule in an E. coli-induced sepsis model in zebrafish.

[0243] The intraperitoneal (IP) route was chosen for the infection model because it is easy and rapid to perform, making this technique particularly suitable for use with various experimental animal groups. One hour after infection with E. coli ATCC 25922, various doses of IKB206 were administered to each group. High levels of protection were observed at 72 hpi, with protection achieved at the highest concentrations (66.6%, 33.3%, and 16.6%) (Figure 11). To further determine the toxicity of IKB206 in adult fish, we performed an assay in which uninfected fish were inoculated with the highest amount of protein used in the efficacy assay (1 μg / g). No difference was observed between fish injected with protein buffer and those injected with 1 μg / g of protein (data not shown).

[0244] Example 9. - IKB206 on human cells タグ Toxicity studies of IKB206 on human cells for potential applicability in humans タグ To determine the toxicity of IKB206, a toxicity assay was performed on the human HEK293 cell line. In case the toxicity of the assay was related to the buffer rather than the protein, IKB206 was used. タグ A buffer was included to dissolve the protein. As shown in Figure 12, no significant differences were observed between the control (culture medium) and the various assay concentrations (p>0.05).

[0245] Example 10.-IKB206 タグ Study of possible synergistic effects between cefotaxime and antibiotics IKB206 タグ and synergistic effects of carbapenem antibiotics Exploring combinations of two or more antibacterial agents may be useful because they may act synergistically, an effective way to improve the bactericidal activity of individual agents. タグ To test the bactericidal effects of several of the most commonly used drugs against MDR E. coli disease, we tested them (Hawkey PM et al. 2018). In particular, carbapenems Two penem antibiotics were used. The E. coli strain selected was ATCC 25922, a standard E. coli strain according to CLSI guidelines.

[0246] The combination used (IKB206 タグ The results of the checkerboard in vitro studies testing endolysin and antibiotic combinations are summarized in Tables 3 and 4, and the isobolograms for each endolysin and antibiotic combination are shown in Figure 13. These data demonstrated both synergistic and additive effects depending on the specific antibiotic. Interestingly, none of the combinations produced unrelated or antagonistic effects. Meropenem or imipenem were used with IKB206. タグ When used in combination with

[0247] [Table 3]

[0248] [Table 4]

[0249] Time-kill analysis of drug combinations against E. coli strains IKB206 タグ To confirm the possible synergistic activity of IKB206 with meropenem and imipenem, a time-kill assay was performed on E. coli strain ATCC 25922. The antibiotics and IKB206 were compared according to the checkerboard and isobologram results. タグ A range of concentrations of IKB206 was determined. These concentrations were used for each treatment, either alone or in combination. The results, shown in Figure 14, demonstrate that the combination of antibiotics and IKB206 was effective at doses below the MIC of the test compounds.

[0250] Furthermore, at several tested concentrations the effect was shown to be synergistic, i.e., viable cells were reduced by at least 2 log units relative to the control after 17 hours of treatment, consistent with CLSI guidelines.

[0251] Overall, the initial checkerboard experiments suggested synergistic effects for the carbapenem antibiotics. These results were confirmed by time-kill assays using E. coli ATCC 25922, comparing meropenem and imipenem with IKB206. タグ A clear synergistic effect was observed when combined with

[0252] References: (1) Farber, L. Antibiotics in Food Preservation. Annu. Rev. Microbiol. 1959. 13: 125-140. (2) Davies, J. y Davies, D. Origins and evolution of antibiotic resistance. Microbiol. Mol. Biol. Rev. MMBR. 2010. 74: 417-4335. (3) Frankel, R.B.; Kalmijn, A.J.; Amann, R.; Ludwig, W.; Petersen, N.; Arakaki, A.; Matsunaga, T.; Bleil, U.; Kirschvink, J.L.; Sievert, S.M.; et al. Sampling the Antibiotic Resistome. Science. 2006. 311: 374-378. (4) Tenover, F.C. Mechanisms of antimicrobial resistance in bacteria. Am. J. Infect. Control. 2006. 34: S3-S10. (5) Starrels, J.L.; Barg, F.K.; Metlay, J.P. Populations at Risk Patterns and Determinants of Inappropriate Antibiotic Use in Injection Drug Users. J. Gen. Intern. Med. 2009. 24: 263-269. (6) Manjusha Lekshmi 1, Parvathi Ammini 2, Sanath Kumar 1 and Manuel F. Varela 3. The Food Production Environment and the Development of Antimicrobial Resistance in Human Pathogens of Animal Origin. Microorganism. 2017. 5: 11. (7) Smith, K.E.; Besser, J.M.; Hedberg, C.W.; Leano, F.T.; Bender, J.B.; Wicklund, J.H.; Johnson, B.P.; Moore, K.A.; Osterholm, M.T. Quinolone-resistant Campylobacter jejuni infections in Minnesota, 1992-1998. Investigation Team. N. Engl. J. Med. 1999. 340: 1525-1532. (8) WHO. The World Is Running Out of Antibiotics, WHO Report Confirms. 2017. Available online: http: / / www.who.int / mediacentre / news / releases / 2017 / running-out-antibiotics / en / (accessed on 3 January 2018). (9) O’Neill, J. Tackling Drug-Restistant Infections Globally: Final Report and Recommendations. 2016. Available online: https: / / amr-review.org / sites / default / files / 160525_Final%20paper_with%20cover.pdf (accessed on 1 March 2018). (10) Adeyi, OO; Barris, E.; Jonas, OB; Irwin, A.; Berthe, FCJ; Le Gall, FG; Marquez, PV; Nikolic, IA; Plante, CA; Schneidman, M.; et al. Drug-Resistant Infections: A Threat to Our Economic Future; Final Report; World Bank Group: Washington, DC, USA, 2017. (11) Antilles N, Blanco A, Camprubi Q, Jove R and Biarnes M. Analysis of antimicrobial resistances of E. coli strains isolated from poultry in Spain from 1998 to 2013 Center de Sanitat Avicola de Catalunya i Arago (CESAC) Reus, Tarragona, Spain. (12) Czaplewski, L.; Bax, R.; Clokie, M.; Dawson, M.; Fairhead, H.; Fischetti, VA; Foster, S.; Gilmore, BF; Hancock, RE; Harper, D.; et al. Alternatives to antibiotics-a pipeline portfolio review. Lancet Infect. This. 2016. 16: 239-251. (13) Hermoso JA, Garcia JL and Garcia P. Taking aim on bacterial pathogens: from phage therapy to enzybiotics. Curr. Opinion. Microbiol. 2007. 10: 461-472. (14) Fischetti V.A., Nelson D. and Schuch R. Reinventing phage therapy: are the parts greater than the sum? Nat. Biotechnol. 2006. 24:1508-11. (15) Pires, D.P.; Oliveira, H.; Melo, L.D.; Sillankorva, S. and Azeredo, J. Bacteriophage-encoded depolymerases: Their diversity and biotechnological applications. Appl. Microbiol. Biotechnol. 2016. 100, 2141-2151. (16) Nelson D., Loomis L. and Fischetti V.A. Prevention and elimination colonization of mice by group A streptococci by using a bacteriophage lytic enzyme. Proc. Natl. Acad. Sci. USA. 2001. 98:4107-4112. (17) Yoong P., Schuch R., Nelson D. and Fischetti V.A. Identification of a broadly active phage lytic enzyme with lethal activity against antibiotic-resistant Enterococcus faecalis and Enterococcus faecium. J Bacteriol. 2004. 186:4808-4812.(18) Zimmer M., Vukov N., Scherer S. and Loessner M.J.: The murein hydrolase of the bacteriophage Φ3626 dual lysis system is active against all tested Clostridium perfringens strains. Appl. Environ. Microbiol. 2002. 68:5311-5317. (19) Cheng Q., Nelson D., Zhu S. and Fischetti V.A.: Removal of group B streptococci colonizing the vagina and oropharynx of mice with a bacteriophage lytic enz yme. Antimicrob. Agents Chemother. 2005. 49:111-117. (20) McCullers J.A., Karlstroem A., Iverson A.R., Loeffler J.M. and Fischetti VA: Novel strategy to prevent otitis media caused by colonizing Streptococcus pneumoniae. PLoS Pathog. 2007. 3: e28. (21) Schmelcher M.; Tchang V.S. and Loessner M.J. Domain shuffling and module engineering of Listeria phage endolysins for enhanced lytic activity and binding affinity. Microb. Biotechnol. 2011. 4, 651-662. (22) Diez-Martinez, R.; De Paz H.D.; Garcia-Fernandez, E.; Bustamante, N.; Euler, C.W.; Fischetti, V.A.; Menendez, M. and Garcia, P. A novel chimeric phage lysin with high in vitro and in vivo bactericidal activity against Streptococcus pneumoniae. J. Antimicrob. Chemother. 2015.70, 1763-1773. (23) Becker S.C.; Foster-Frey J.; Stodola A.J.; Anacker D. and Donovan D.M. Differentially conserved staphylococcal SH3b_5 cell wall binding domains confer increased staphylolytic and streptolytic activity to a streptococcal prophage endolysin domain. Gene. 2009. 443: 32-41. (24) Yang H.; Linden S.B.; Wan J.; Yu J.; Nelson D.C. and Wei, H. A chimeolysin with extended-spectrum streptococcal host range found by an induced lysis-based rapid screening method. Sci. Rep. 2015. 5, 17257. (25) Yang H.; Bi Y.; Shang X.; Wang M.; Linden S.B.; Li Y.; Nelson D.C. and Wei H. Antibiofilm activities of a novel chimeolysin against Streptococcus mutans under physiological and cariogenic conditions. Antimicrob. Agents Chemother. 2016. 60: 7436-7443. (26) Briers Y. and Lavigne R. Breaking barriers: Expansion of the use of endolysins as novel antibacterials against Gram-negative bacteria. Future Microbiol. 2015. 10: 377-390. (27) Briers Y., Walmagh M., Van Puyenbroeck V. et al. Engineered endolysin-based ‘Artilysins’ to combat multidrug-resistant Gram-negative pathogens. MBio. 2014. 5 (4): e 01379 - e 01414. (28) Wang, S., Gu, J., Lv, M., Guo, Z., Yan, G., et al. The antibacterial activity of E. coli bacteriophage lysin Lysep3 is enhanced by fusing the Bacillus amyloliquefaciens bacteriophage endolysin binding domain D8 to the C-terminal region. J Microbiol. 2017. 55(5):403-408. (29) Heselpoth, R.D., Euler, C. W., Schuch, R. y Fischetti, V. A. Lysocins: Bioengineered Antimicrobials that Deliver Lysins Across the Outer Membrane of Gram-Negative Bacteria. 2019. Antimicrob. Agents Chemother. doi:10.1128 / AAC.00342-19(30) Loessner, M.J., Kramer, K., Ebel, F. y Scherer, S. C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates. Mol. Microbiol. 2002. 44: 335-349. (31) Schmelcher, M., Shabarova, T., Eugster, M.R., Eichenseher, F., Tchang, V.S., Banz, M., et al. Rapid multiplex detection and differentiation of Listeria cells by use of fluorescent phage endolysin cell wall binding domains. Appl. Environ. Microbiol. 2010. 76: 5745-5756. (32) Tikhe, C., and Husseneder, C. Whole genome sequencing and characterization of Enterobacter phage Arya isolated from the termite gut. Direct submission National Center for Biotechnology Information, NIH. 2016 (33) Morita, M., Tanji, Y., Orito, Y., Mizoguchi, K., Soejima, A. and Unno, H. Functional analysis of antibacterial activity of Bacillus amyloliquefaciens phage endolysin against Gram-negative bacteria. FEBS Letters. 2001. 500: 56-59. (34) Proietti, P.C., Castellini, C., Pedrazzoli, M., Dal Bosco, A. and Franciosi ni, M. Bacterial Counts and Characterization of Intestinal Flora in Organic and Conventional Chickens. World’s Poultry Science Association (WPSA), Beekbergen, the Netherlands. 2006. (35) OECD GUIDELINES FOR TESTING OF CHEMICALS: Fish Embryo Acute Toxicity (FET) Test, in 236. (36) David A and Pancharatna K. Effects of acetaminophen (paracetamol) in the embryonic development of zebrafish, Danio rerio. J Appl Toxicol. 2009 7:597-602. (37) Fischetti, V., Nelson, D. and Schuch, R. Reinventing phage therapy: are the parts greater than the sum? Nat Biotechnology. 2006. 24 (12): 1508-11. (38) Vazquez, R., Garcia, E. and Garcia, P. Phage Lysins for Fighting Bacterial Respiratory Infections: A New Generation of Antimicrobials. Front Immunol. 2018. 9: 2252. (39) Sao-Jose, C. Engineering of Phage-Derived Lytic Enzymes: Improving Their Potential as Antimicrobials. Antibiotics. 2018. 7, 29. (40) Orito Y., Morita, M., Hori, K., Unno, H. and Tanji, Y. Bacillus amyloliquefaciens phage endolysin can enhance permeability of Pseudomonas aeruginosa outer membrane and induce cell lysis. Appl Microbiol Biotechnol. 2004. 65 (1): 105-9.(41) Hojckova, K., Stano, M. y Klucar, L. phiBIOTICS: catalogue of therapeutic enzybiotics, relevant research studies and practical applications. BMC Microbiol. 2013. 13: 53. (42) Letrado P., Corsini, B., Diez-Martinez, R., Bustamante, N., Yuste, J.E. and Garcia, P. Bactericidal synergism between antibiotics and phage endolysin Cpl-711 to kill multidrug-resistant pneumococcus. Future Microbiol. 2018. 13 (11): 1215-1223. (43) Vazquez, R., Domenech, M., Iglesias-Bexiga, M., Menendez, M. and Garcia, P. Csl2, a novel chimeric bacteriophage lysin to fight infections caused by Streptococcus suis, an emerging zoonotic pathogen. Sci Rep. 2017. 7(1): 16506. (44) Hooper, L.V., Littman, D.R. and Macpherson, A.J. Interactions between the microbiota and the immune system. Science. 2012. 336(6086):1268-1273. (45) Ley, R.E., Turnbaugh, P.J., Klein, S. and Gordon, J.I. Microbial ecology: human gut microbes associated with obesity. Nature. 2006. 444:1022. (46) Cani, P.D. and Delzenne, N.M. The role of the gut microbiota in energy metabolism and metabolic disease. Curr Pharm Des. 2009. 15:1546-1558. (47) Claus, S.P., Ellero, S.L., Berger, B., Krause, L., Bruttin, A., et al. Colonization-induced host-gut microbial metabolic interaction. Mol Bio. 2011. 2: e00271-e00210. (48) Spor, A., Koren, O. and Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 2011. 9:279. (49) Schulfer A.F., Battaglia, T., Alvarez, Y., Bijnens, L., Ruiz, V.E., et al. Intergenerational transfer of antibiotic-perturbed microbiota enhances colitis in susceptible mice. Nat Microbiol. 2018. 3:234. (50) Le Roy, C.I., Woodward, W.J., Ellis, R. J., La Ragione, R.M. and Claus, S.P. Antibiotic treatment triggers gut dysbiosis and modulates metabolism in a chicken model of gastro-intestinal infection. BMC Vet Res. 2019. 25 (1): 37. (51) Kelley L.A, Mezulis S, Yates C.M, Wass M.N, Sternberg M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc. 2015 Jun;10(6):845-58. doi: 10.1038 / nprot.2015.053. (52) Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny, R., Heer, F.T., de Beer, T.A.P., Rempfer, C., Bordoli, L., Lepore, R., Schwede, T. SWISS-MODEL: homology modelling of protein structures and complexes. Nucl eic Acids Res. 46(W1), W296-W303 (2018) (53) Daopin, S., Alber, T., Baase, W.A., Wozniak, J.A., Matthews, B.W. Structural and thermodynamic analysis of the packing of two alpha-helices in bacteriophage T4 lysozyme.(1991) J Mol Biol 221: 647-667 (54) Babu K, Arulandu A, Sankaran K. The structure of DLP12 endolysin exhibiting alternate loop conformation and comparative analysis with other endolysins. Proteins. 2018 Feb;86(2):210-217. Doi:10.1002 / prot.25428. Epub 2017 Dec 1. (55) Mooers, B.H., Matthews, B.W.Extension to 2268 atoms of direct methods in the ab initio determination of the unknown structure of bacteriophage P22 lysozyme.(2006) Acta Crystallogr D Biol Crystallogr 62: 165-176 (56) Sykilinda NN, Nikolaeva AY, Shneider MM, Mishkin DV, Patutin AA, Popov VO, Boyko KM, Klyachko NL, Miroshnikov KA Structure of an Acinetobacter Broad-Range Prophage Endolysin Reveals a C-Terminal α-Helix with the Proposed Role in Activity against Live Bacterial Cells. Viruses. 2018 Jun 6;10(6):309. doi: 10.3390 / v10060309. (57) Schmelcher M, Donovan DM, Loessner MJ.; Bacteriophage endolysins as novel antimicrobials. Future Microbiol. 2012; 7(10): 1147-1171. (58) Minogue TD, Daligault HA, Davenport KW, Bishop-Lilly KA, Broomall SM, Bruce DC, Chain PS, Chertkov O, Coyne SR, Freitas T, Frey KG, Gibbons HS, Jaissle J, Redden CL, Rosenzweig CN, Xu Y, Johnson SL. Complete Genome Assembly of Escherichia coli ATCC 25922, a Serotype O6 Reference Strain. Genome Announc. 2014 Sep-Oct; 2(5): e00969-14. (59) Nelson DC, Schmelcher M, Rodriguez-Rubio L, Klumpp J, Pritchard DG, Dong S, Donovan DM., Endolysins as antimicrobials, Adv Virus Res. 2012;83:299-365. (60) Vaara M. Agents that increase the permeability of the outer membrane. Microbiol Rev. 56(3):395-441 (1992). (61) Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005 May;41(1):207-34. doi: 10.1016 / j.pep.2005.01.016 (62) Santin and Cascales. Measure of peptidoglycan hydrolase activity. Methods Mol Biol. 1615: 151-158 (2017). (63) European Centre for Disease Prevention and Control. Surveillance of antimicrobial resistance in Europe - Annual report of the European Antimicrobial Resistance Surveillance Network (EARS-Net) 2017. Stockholm: ECDC; 2018. (64) Moody JA. Synergism testing: broth microdilution checkerboard and broth macrodilution methods. In: Isenberg HD, editor. Clinical Microbiology Procedures Handbook. American Society for Microbiology; DCUSA: 1992. pp. 5.18.1-28. (65) Moellering EG., Jr . Antimicrobial combinations. In: Lorian V, editor. Antibiotics in Laboratory Medicine. The Williams & Wilkins Co.; MDUSA: 1996. pp. 330-396 (66) Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera-A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605-1612. (67) Peter M Hawkey, Roderic E Warren, David M Livermore, Cliodna A M McNulty, David A Enoch, Jonathan A Otter, A Peter R Wilson. Treatment of infections caused by multidrug-resistant Gram-negative bacteria: report of the British Society for Antimicrobial Chemotherapy / Healthcare Infection Society / British Infection Association Joint Working Party. Journal of Antimicrobial Chemotherapy, Volume 73, Issue suppl_3, 1 March 2018, Pages iii2-iii78. (68) Huttner A. and Gambillara V. The development and early clinical testing of the ExPEC4V conjugate vaccine against uropathogenic Escherichia coli. Clin Microbiol Infect. 2018 Oct;24(10):1046-1050. (69) Wong JE, Midtgaard SR, Gysel K, Thygesen MB, Sorensen KK, Jensen KJ, Stougaard J, Thirup S, Blaise M An intermolecular binding mechanism involving multiple LysM domains mediates carbohydrate recognition by an endopeptidase. (70) Rennell D, Bouvier SE, Hardy LW, Poteete AR. Systematic Mutation of Bacteriophage T4 Lysozyme. J MolBiol1991;222:67-88. (71) Kuroki R, Weaver LH, Matthews BW. Structure-based design of a lysozyme with altered catalytic activity. Nat Struct Biol1995;2:1007-1011 (72) Kuroki R, Weaver LH, Matthews BW. Structural basis of the conversion of T4 lysozyme into a transglycosidase by reengineering the active site. Proc Natl Acad Sci USA 1999;96:8949-8954. (73) Xu M, Arockiasamy A, Struck DK, Swanson S, Sacchettini JC, Young R. Disulfide isomerization after membrane release of its SAR domain activates P1 lysozyme. Science 2005;307:113-117 (74) Maciejewska B, Zrubek K, Espaillat A, Wisniewska M, Rembacz KP, Cava F, Dubin G, Drulis-Kawa Z Modular endolysin of Burkholderia AP3 phage has the largest lysozyme-like catalytic subunit discovered to date and no catalytic aspartate residue. Sci Rep. 2017 Nov 6;7(1):14501. doi: 10.1038 / s41598-017-14797-9. (75) Sun Q, Kuty GF, Arockiasamy A, Xu M, Young R, Sacchettini JC. Regulation of a muralytic enzyme by dynamic membrane topology. Nat Struct Mol Biol. 2009 Nov;16(11):1192-4. doi: 10.1038 / nsmb.1681. Epub 2009 Nov 1. (76) Masi, M., Refregiers, M., Pos, K. et al. Mechanisms of envelope permeability and antibiotic influx and efflux in Gram-negative bacteria. Nat Microbiol 2, 17001 (2017). (77) Duering, K., Porsch, P., Mahn, A., Brinkmann, O. and Gieffers, W. (1999) FEBS Lett. 449, 93-100.

Claims

1. a) the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, the variant or fragment having residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 1, and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; A protein comprising or consisting of SEQ ID NO: 1, wherein the protein does not consist of SEQ ID NO:

1.

2. the protein is a chimeric protein, a) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, such that the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 1, and wherein the variant or fragment has at least 90% of the peptidoglycan hydrolase activity of SEQ ID NO: 1; b) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, and wherein the variant or fragment has at least 90% of the cell penetrating activity of SEQ ID NO: 2; The protein of claim 1, wherein the polypeptide of (b) is fused directly or via a peptide linker to the C-terminus of the polypeptide of (a).

3. The protein is a) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 1; b) a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 2; The protein according to claim 1 or 2, wherein the polypeptide (b) is fused to the C-terminus of the polypeptide (a) directly or via a peptide linker.

4. 4. The protein of any one of claims 1 to 3, wherein the chimeric protein comprises or consists of the amino acid sequence of SEQ ID NO: 3 or a variant sequence or fragment having at least 80% identity thereto, wherein the variant has conservative amino acid changes, and wherein the variant or fragment has residues corresponding to E15, D24, T33 and R139 of SEQ ID NO: 3, and has at least 90% of the bacteriostatic or bactericidal activity of SEQ ID NO: 3 against Gram-negative bacteria.

5. The protein according to any one of claims 1 to 4, which has bacteriostatic or bactericidal activity against gram-negative bacteria.

6. The protein according to any one of claims 1 to 5, wherein the Gram-negative bacterium is one or more species selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, and Klebsiella.

7. The protein according to any one of claims 1 to 6, wherein the Gram-negative bacterium is one or more selected from the group consisting of E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa.

8. A protein according to any one of claims 1 to 7, comprising or consisting of the amino acid sequence of SEQ ID NO:

3.

9. A protein according to any one of claims 1 to 8, comprising or consisting of the amino acid sequence of SEQ ID NO:

5.

10. A polynucleotide comprising a nucleic acid molecule encoding the protein according to any one of claims 1 to 9.

11. a nucleic acid sequence comprising or consisting of SEQ ID NO:6; a nucleic acid sequence comprising or consisting of SEQ ID NO:7; 11. The polynucleotide sequence of claim 10, comprising:

12. A vector comprising the polynucleotide of claim 10 or 11.

13. A host cell comprising the vector of claim 12.

14. A method for producing the protein according to any one of claims 1 to 9, comprising: i. introducing a vector comprising the polynucleotide of claim 10 or 11 into a suitable host cell; ii. Culturing the host cell under conditions suitable for expression of the protein; iii. Optionally, isolating and / or purifying said protein; A method comprising:

15. A composition comprising the protein according to any one of claims 1 to 9, the polynucleotide according to claim 10 or 11, the vector according to claim 12, or the host cell according to claim 13.

16. 16. The composition of claim 15, which is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier, vehicle or excipient.

17. A kit comprising the protein according to any one of claims 1 to 9, the polynucleotide according to claim 10 or 11, the vector according to claim 12, the host cell according to claim 13, or the composition according to claim 15 or 16.

18. A protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein according to any one of claims 1 to 9, or a pharmaceutical composition comprising either of them, for use in the prophylactic and / or therapeutic treatment of Gram-negative bacterial infection in a subject.

19. 19. The protein or pharmaceutical composition for use according to claim 18, which is used in combination with one or more antibiotics, preferably the antibiotic is a carbapenem, more preferably the antibiotic is selected from imipenem and meropenem.

20. 20. The protein or pharmaceutical composition for use according to claim 18 or 19, wherein the Gram-negative bacterium is one or more species selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia and Klebsiella.

21. The protein or pharmaceutical composition for use according to any one of claims 18 to 20, wherein the Gram-negative bacterium is one or more selected from the group consisting of E. coli, K. pneumoniae, A. baumannii and P. aeruginosa.

22. Inhibits the growth of gram-negative bacteria, reduces the population of gram-negative bacteria, or An in vitro method for killing Mu-negative bacteria, comprising contacting the bacteria with a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein described in any one of claims 1 to 9, or a composition containing any of them.

23. 23. The in vitro method of inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria of claim 22, wherein the Gram-negative bacteria is one or more species selected from the group consisting of Acinetobacter, Pseudomonas, Escherichia, and Klebsiella.

24. 24. The in vitro method of inhibiting the growth of, reducing the population of, or killing Gram-negative bacteria according to claim 22 or 23, wherein the Gram-negative bacteria is one or more selected from the group consisting of E. coli, K. pneumoniae, A. baumannii, and P. aeruginosa.

25. Use of a protein consisting of the amino acid sequence of SEQ ID NO: 1, a protein according to any one of claims 1 to 9, or a composition comprising any of them, as a disinfectant for materials and / or surfaces.

Images