Fidgetin-like 2 as a target for enhancing wound healing

Targeting fidgetin-like 2 with specific siRNA sequences accelerates wound healing by enhancing cell migration and proliferation, addressing the limitations of current wound healing therapies.

JP2026041902APending Publication Date: 2026-03-10MICROCURES INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-12-05
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Current therapies for acute and chronic wounds are inadequate in stimulating the proliferation and migration of fibroblasts and epithelial cells to effectively close wounds, which is crucial for wound healing.

Method used

The use of specific siRNA sequences targeting fidgetin-like 2 (FL2) to enhance cell migration and proliferation, administered topically, which can be delivered through various carriers such as collagen microparticles or liposomal nanoparticles.

Benefits of technology

Enhances wound healing by increasing the rate at which fibroblasts and epithelial cells invade and close the wound, potentially reducing scarring and improving healing outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026041902000005
    Figure 2026041902000005
  • Figure 2026041902000006
    Figure 2026041902000006
  • Figure 2026041902000007
    Figure 2026041902000007
Patent Text Reader

Abstract

To provide a safe and effective therapy for treating acute and chronic wounds. Nucleic acid molecules and compositions thereof that target fidgetin-like 2, as well as methods for their use in treating wounds or scars in human subjects, are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Patent Application No. 62 / 983,193, filed February 28, 2020, which is incorporated herein by reference in its entirety. [Background technology]

[0002] The development of safe and effective therapies for treating acute and chronic wounds is currently of great interest to clinical scientists and industry alike. Wound healing is a complex, multi-step process that is highly dependent on the delivery of new cells to the wound zone. Two key components of the wound healing response are fibroplasia and epithelialization, respectively, when fibroblasts and epithelial cells enter the wound and form a protective barrier from the external environment. This is stimulated by cell proliferation and migration from the wound edge. Identifying an agent that increases the rate at which cells invade and close the wound would represent a major advance in wound healing therapy. Ideally, this would be a topically or locally applied agent that stimulates the proliferation and migration of fibroblasts and wound edge epithelial cells.

[0003] The disclosures of all publications, patents, patent application publications, and books referenced in this application are hereby incorporated by reference in their entireties into this application to more fully describe the state of the art to which this disclosure pertains. Summary of the Invention [Means for solving the problem]

[0004] In one aspect, 5'-fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO: 17), (Phos) 5'-U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO: 18), 5'-UUACACAGUAUUAAAGCGATT-3' (SEQ ID NO: 34), (Phos) 5'-mUmCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 35), (Phos)5'-mU(s)mC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 36), (Phos) 5'-fUfCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 37), (Phos)5'-fU(s)fC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 38), (Phos)5'-mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3' (SEQ ID NO: 39), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 40), (Phos)5'-mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO: 41), 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3' (SEQ ID NO: 42), (Phos)5'-mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3' (SEQ ID NO: 43), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3' (SEQ ID NO: 44), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3' (SEQ ID NO: 45), 5'UUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 46), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 47), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 48), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 49), 5'-mUmUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 50), (Phos)5'-U(s)CGCUUUAAUACUGUGUmAmATT-3' (SEQ ID NO: 51), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 52), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3' (SEQ ID NO: 53), 5'lUlUlAlClACAGUAUUAAAGCGATT-3' (SEQ ID NO: 54), (Phos) 5'-UCGCUUUAAUACUGlUlGlUlAlA TT-3' (SEQ ID NO: 55), 5'fUfUlAfClACAGUAUUAAAGCGA-3' (SEQ ID NO: 56), or A nucleic acid molecule is provided which consists of a sequence selected from the group consisting of: (Phos)5'-mU(s)mCmGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 57), where d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2'-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2'-fluorodeoxynucleotide, (Phos) = phosphodiester cap; capital nucleotide = RNA nucleotide, l(nucleotide) = locked nucleotide, and (s) = phosphorothioate. For example, in SEQ ID NO: 17, fC represents 2'-fluorodeoxycytidine ribonucleic acid, fU represents 2'-fluorodeoxyuracil ribonucleic acid, and mA represents 2'-O-methyladenosine ribonucleic acid.

[0005] In some embodiments, any of the aforementioned sequences shown with a phosphodiester cap may be provided without a phosphodiester cap, such as SEQ ID NOs: 58-72 described herein.

[0006] In some embodiments, the siRNA consists of any of the aforementioned sequences. In some embodiments, the siRNA comprises any of the aforementioned sequences. In some embodiments, a double-stranded nucleic acid is provided that consists of two nucleic acid molecules selected from among SEQ ID NOs: 17-18 and 34-72. In some embodiments, a double-stranded nucleic acid is provided that includes at least one nucleic acid molecule selected from among SEQ ID NOs: 17-18 and 34-72.

[0007] In some embodiments, the siRNA has at least one modification selected from a 3' overhang, a 5' overhang, a 5' phosphorylation, a 2' sugar modification, a nucleobase modification, a phosphate backbone modification, and any combination of any of the foregoing. Any of the siRNA sequences may have a phosphodiester cap. In some embodiments, any of the foregoing sequences shown with a phosphodiester cap may be provided without a phosphodiester cap, such as SEQ ID NOs: 58-72 described herein.

[0008] In some embodiments, a double-stranded nucleic acid is provided, which consists of an antisense nucleic acid molecule and a sense nucleic acid molecule, each selected from SEQ ID NOs: 17-18 and 34-72.

[0009] In some embodiments, a double-stranded nucleic acid is provided, comprising an antisense nucleic acid molecule selected from among SEQ ID NOs: 17-18 and 34-72, and a sense nucleic acid molecule selected from among SEQ ID NOs: 17-18 and 34-72.

[0010] In some embodiments, a double-stranded nucleic acid is provided, comprising two nucleic acid molecules selected from among SEQ ID NOs: 17 to 18 and 34 to 72. In some embodiments, the double-stranded nucleic acid comprises a sense strand and an antisense strand.

[0011] In some embodiments, each strand of the double-stranded nucleic acid has 52 or fewer nucleotides.

[0012] In some embodiments, a double-stranded nucleic acid consisting of SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:57 is provided.

[0013] In some embodiments, any one of the aforementioned nucleic acids has at least one nucleotide that is modified or further modified. In some embodiments, the modified nucleotide is selected from 2'-O-methyl-adenosine, 2'-O-methyl-uridine, 2'-O-methyl-cytosine, 2'-O-methyl-guanosine, 2'-O-methyl-thymidine, 2'-fluoro-adenosine, 2'-fluoro-cytidine, 2'-fluoro-guanosine, 2'-fluoro-uracil, 2'-fluoro-thymidine, deoxycytosine, deoxyguanosine, deoxyadenosine, deoxythymidine, deoxyuridine, locked adenosine, locked uridine, locked guanosine, locked cytidine, phosphorothioate, and phosphodiester cap. In some embodiments, at least one additional or modified nucleotide is added to the end of the nucleic acid.

[0014] In one aspect, a composition is provided that includes any of the aforementioned nucleic acid molecules or double-stranded nucleic acids and a pharmaceutically acceptable carrier, vehicle, excipient, or diluent.

[0015] In some embodiments, the carrier comprises at least one of the following: saline, sugar, polypeptide, polymer, lipid, cream, gel, micelle material, wafer, and nanoparticle. In some embodiments, the carrier comprises at least one of the following: glucose solution, polycationic binder, cationic lipid, cationic micelle, cationic polypeptide, hydrophilic polymer-grafted polymer, non-natural cationic polymer, cationic polyacetal, hydrophilic polymer-grafted polyacetal, ligand-functionalized cationic polymer, nucleic acid delivery vehicle, ligand-functionalized-hydrophilic polymer-grafted polymer, and ligand-functionalized liposome. In some embodiments, the carrier comprises a cationic polymer-nucleic acid complex. In some embodiments, the hydrophilic polymer is polyethylene glycol (PEG).

[0016] In some embodiments, the carrier comprises collagen. In some embodiments, the composition is a collagen microparticle. In some embodiments, the nucleic acid molecule is adsorbed to the collagen.

[0017] In some embodiments, the nanoparticle is a liposomal nanoparticle. In some embodiments, the liposome is further functionalized with at least one 2' sugar modification.

[0018] In one aspect, a method of treating a wound or inhibiting, reducing, or preventing scarring in a subject is provided, comprising administering to the subject a therapeutically effective amount of any of the aforementioned compositions. In some embodiments, the wound or scar is of the skin, eye, central nervous system, peripheral nervous system, heart tissue, blood vessels, tendons, ligaments, muscles, oral cavity, lip, palate, viscera, surgical wounds, abdominal cavity, pelvic cavity, or thoracic cavity. In some embodiments, the ocular wound or scar is of the cornea or lens capsule. In some embodiments, the wound or scar results from eye surgery, LASIK surgery, LASEK surgery, PRK surgery, glaucoma filtration surgery, cataract surgery, and corneal cicatrization.

[0019] In some embodiments, inhibiting scarring reduces the incidence of adhesion formation and / or the size of the adhesions formed. In some embodiments, preventing, reducing, or inhibiting scarring enhances neuronal reconnection and / or neuronal function. In some embodiments, the cardiac tissue wound results from a myocardial infarction. In some embodiments, the wound is a neuronal wound. In some embodiments, the wound results in capsular contraction. In some embodiments, the wound is a surgical wound. In some embodiments, the wound results from a cosmetic procedure or scar revision. In some embodiments, skin graft healing is enhanced using the compositions of the present disclosure. [Brief explanation of the drawings]

[0020] [Figure 1] 1 shows the cycle of steps involved in the solid phase synthesis of the sense and antisense strands of SEQ ID NO: 17 / 18 API. [Figure 2] SEQ ID NO: 17 / 18 shows the API manufacturing scheme. [Figure 3A-1] The structure of the sense strand SEQ ID NO: 17 is shown. [Figure 3A-2] The structure of the sense strand SEQ ID NO: 17 is shown. [Figure 3B-1] The structure of the antisense strand SEQ ID NO: 18 is shown. [Figure 3B-2] The structure of the antisense strand SEQ ID NO: 18 is shown. [Figure 4A] Figure 1 shows that siRNA-mediated depletion of FL2 enhances cell migration. [Figure 4B] Figure 1 shows that siRNA-mediated depletion of FL2 enhances cell migration. [Figure 4C] Figure 1 shows that siRNA-mediated depletion of FL2 enhances cell migration. [Figure 5] 1 shows the results of an initial scratch test screen of siRNAs for translocation using U2OS cells. [Figure 6] A second scratch test screen of siRNAs for translocation using U2OS cells is shown. [Figure 7] FL2 Western blot using cells from the study in FIG. 6 is shown. [Figure 8] Figure 1 shows the results of a time-lapse scratch test using SEQ ID NO: 17 / 18. DETAILED DESCRIPTION OF THE INVENTION

[0021] The subject matter of the present invention may be more readily understood by reference to the following detailed description, which forms a part of this disclosure: It is to be understood that the disclosure is not limited to the specific products, methods, conditions, or parameters described and / or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only, and is not intended to limit the disclosure as set forth in the claims.

[0022] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0023] As used above, and throughout this disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings:

[0024] In this disclosure, the singular forms "a," "an," and "the" include plural referents, and reference to a particular numerical value includes at least that particular value unless the context clearly dictates otherwise. Thus, for example, a reference to a "compound" is a reference to one or more of such compounds and equivalents thereof known to those of skill in the art, and so forth. As used herein, the term "plurality" means two or more. When a range of values ​​is expressed, another embodiment includes from the one particular value and / or to the other particular value.

[0025] Similarly, when values ​​are expressed as approximations, by use of the preposition "about," it will be understood that the particular value forms another embodiment. All ranges are inclusive and combinable. In the context of this disclosure, "about" a particular amount means that the amount is within ±20% of the stated amount, or preferably within ±10% of the stated amount, or more preferably within ±5% of the stated amount.

[0026] As used herein, the terms "treat," "treatment," or "therapy" (and their different forms) refer to therapeutic treatment, including prophylactic or preventative measures, where the purpose is to prevent or slow (alleviate) undesirable physiological changes associated with a disease or condition. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in the extent of the disease or condition, stabilization of the disease or condition (i.e., where the disease or condition does not worsen), delay or slowing of the progression of the disease or condition, remission or alleviation of the disease or condition, and remission (partial or total) of the disease or condition, whether detectable or undetectable. Those in need of treatment include those already suffering from the disease or condition, as well as those susceptible to the disease or condition, or those in whom the disease or condition is to be prevented.

[0027] As used herein, the terms "ingredient," "composition," "formulation," "composition of compound," "compound," "drug," "pharmacologically active agent," "active agent," "therapeutic agent," "therapy," "treatment," or "pharmaceutical product" are used interchangeably herein and refer to a composition of one or more compounds or substances that, when administered to a subject (human or animal), induces a desired pharmacological and / or physiological effect through local and / or systemic action, as context dictates. A personalized composition or method refers to a product or the use of a product in a regimen that is tailored or individualized to meet a specific need identified or intended in a subject.

[0028] The terms "subject," "individual," and "patient" are used interchangeably herein and refer to an animal, e.g., a human, to which treatment with a composition or formulation according to the present disclosure is provided. As used herein, the term "subject" refers to a human and a non-human animal. The terms "non-human animal" and "non-human mammal" are used interchangeably herein and include all vertebrates, e.g., mammals such as non-human primates (particularly higher primates), sheep, dogs, rodents (e.g., mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, horses, and non-mammals such as reptiles, amphibians, chickens, and turkeys. The compositions described herein can be used to treat any suitable mammal, including primates such as monkeys and humans, horses, cows, cats, dogs, rabbits, and rodents such as rats and mice. In some embodiments, the mammal being treated is a human. The human can be any human of any age. In certain embodiments, the human is an adult. In other embodiments, the human is a child. The human may be male, female, pregnant, middle-aged, adolescent, or elderly. According to any of the methods of the present disclosure, in some embodiments, the subject is a human. In another embodiment, the subject is a non-human primate. In another embodiment, the subject is a rat, in some embodiments, a mouse, and in another embodiment, a rat. In another embodiment, the subject is a dog, a cat, a cow, a horse, a laplin, or a pig. In another embodiment, the subject is a mammal. As described herein, treatment of non-human animals (e.g., non-human primates, non-human mammals) using the teachings of the present disclosure may require the use of siRNAs directed to orthologs of figetin-like 2 in a particular species.

[0029] The conditions and disorders in a subject for which a particular drug, compound, composition, formulation (or combination thereof) is said to be "indicated" are not limited to those conditions and disorders for which the drug or compound or composition or formulation has been expressly approved by a regulatory agency, but also include other conditions and disorders that are known or reasonably believed by a physician or other health or nutritionist to be suitable for treatment with that drug or compound or composition or formulation, or combination thereof.

[0030] The present disclosure is directed to nucleic acid sequences that inhibit human figetin-like 2 activity, pharmaceutical compositions thereof, and methods of their use to prevent or treat various injuries, wounds, and diseases.

[0031] Nucleic acid sequence

[0032] In some embodiments, the present disclosure provides the following sequence: Sense strand 5'-fUfUmAfCmAfCAGUAUUAAAGCGATT (SEQ ID NO: 17), Antisense strand: (Phos) 5'-U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO: 18), Sense strand: 5'-UUACACAGUAUUAAAGCGATT-3' (SEQ ID NO: 34), Antisense strand: (Phos) 5'-mUmCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 35), Antisense strand: (Phos)5'-mU(s)mC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 36), Antisense strand: (Phos) 5'-fUfCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 37), Antisense strand: (Phos)5'-fU(s)fC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 38), Antisense strand: (Phos)5'-mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3' (SEQ ID NO: 39), Antisense strand: (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 40), Antisense strand: (Phos) 5'-mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT-3' (SEQ ID NO: 41), Sense strand: 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3' (SEQ ID NO: 42), Antisense strand: (Phos) 5'-mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3' (SEQ ID NO: 43), Sense strand: 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3' (SEQ ID NO: 44), Sense strand: 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3' (SEQ ID NO: 45), Sense strand: 5'-UUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 46), Antisense strand: (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 47), Antisense strand: (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 48), Antisense strand: (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 49), Sense strand: 5'-mUmUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 50), Antisense strand: (Phos)5'-U(s)CGCUUUAAUACUGUGUmAmATT-3' (SEQ ID NO: 51), Antisense strand: (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 52), Antisense strand: (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3' (SEQ ID NO: 53), Sense strand: 5'-lUlUlAlClACAGUAUUAAAGCGATT-3' (SEQ ID NO: 54), Antisense strand: (Phos) 5'-UCGCUUUAAUACUGlUlGlUlAlA TT-3' (SEQ ID NO: 55), Sense strand: 5'-fUfUlAfClACAGUAUUAAAGCGA-3' (SEQ ID NO: 56), Antisense strand: (Phos)5'-mU(s)mCmGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 57), Antisense strand: 5'-fUfCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 58), Antisense strand: 5'-fU(s)fC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 59), Antisense strand: 5'-mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3' (SEQ ID NO: 60), Antisense strand: 5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 61), Antisense strand: 5'-mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO: 62), Antisense strand: 5'-mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3' (SEQ ID NO: 63), Antisense strand: 5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 64), Antisense strand: 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 65), Antisense strand: 5'-U(s)C(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 66), Antisense strand: 5'-U(s)CGCUUUAAUACUGUGUmAmATT-3' (SEQ ID NO: 67), Antisense strand: 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 68), Antisense strand: 5'-U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3' (SEQ ID NO: 69), Antisense strand: 5'-UCGCUUUAAUACUGlUlGlUlAlA TT -3' (SEQ ID NO: 70), Antisense strand: 5'-mU(s)mCmGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 71), or Antisense strand: 5'-U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO: 72), and a complement thereof, where d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2'-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2'-fluorodeoxynucleotide, (Phos) = phosphodiester cap; capital nucleotide = RNA nucleotide, l(nucleotide) = locked nucleotide, and (s) = phosphorothioate. Thus, for example, dT represents deoxythymidine, dC represents deoxycytidine, fC represents 2'-fluorodeoxycytidine ribonucleic acid, fU represents 2'-fluorodeoxyuracil ribonucleic acid, mA represents 2'-O-methyladenosine ribonucleic acid, mU represents 2'-O-methyluracil ribonucleic acid, mC represents 2'-O-methylcytosine ribonucleic acid, and mG represents 2'-O-methylguanosine ribonucleic acid.

[0033] In some embodiments, a complement refers to the complementary nucleic acid strand comprising a double-stranded nucleic acid. In some embodiments, when a sense strand is selected, its complement is the antisense strand. In some embodiments, when an antisense strand is selected, its complement is the sense strand.

[0034] In some embodiments, the complement may be selected from any of SEQ ID NOs: 17-18 and 34-72. In some embodiments, when the siRNA molecule is the sense strand of SEQ ID NOs: 17-18 and 34-72, the complement may be selected from the antisense strand of SEQ ID NOs: 17-18 and 34-72. In some embodiments, when the siRNA molecule is the antisense strand of SEQ ID NOs: 17-18 and 34-72, the complement may be selected from the sense strand of SEQ ID NOs: 17-18 and 34-72.

[0035] In some embodiments, the complement may be selected from SEQ ID NOs: 1-10. In some embodiments, when the siRNA molecule is the sense strand of SEQ ID NOs: 17-18 and 34-72, the complement may be selected from the antisense strand of SEQ ID NOs: 1-10. In some embodiments, when the siRNA molecule is the antisense strand of SEQ ID NOs: 17-18 and 34-72, the complement may be selected from the sense strand of SEQ ID NOs: 1-10. Sequence numbers 1 to 10 are: sense strand: UUACACAGUAUUAAAGCGAUU (sequence number 1), antisense strand: 5'UCGCUUUAAUACUGUGUAAUU (sequence number 2), sense strand: CAUCUGAAACCUAGGGUCUUU (sequence number 3), antisense strand: 5'AGACCCUAGGUUUCAGAUGUU (sequence number 4), sense strand: GUGACUUAUGCUAGGAGGAUU (sequence number 5), antisense strand: 5'UCCUCCUAGCAUAAGUCACUU (sequence number 6), sense strand: GGUCAGAAGCAGAAUGUAUUU (sequence number 7), antisense strand: 5'AUACAUUCUGCUUCUGACCUU (sequence number 8), sense: 5'CGCCGGCCCACAAGUUGGAdTdT (sequence number 9), and antisense: 5'UCCAACUUGUGGGCCGGCGdTdT (sequence number 10).

[0036] In some embodiments, any of the nucleic acid sequences disclosed herein may be modified or further modified with one or more nucleotide modifications as described herein. In some embodiments, any unmodified nucleotide in a sequence described herein may be modified to one of the modified nucleotides, such as, but not limited to, those described herein. In some embodiments, a modified nucleotide in a sequence described herein may be changed to a different modified nucleotide, such as, but not limited to, one of the modified nucleotides described herein. Modified nucleotides or modified nucleic acids include modified nucleotides, linkages between any component of a nucleotide, and the addition of one or more modified or unmodified nucleotides to one or both ends of a sequence, or the addition of a cap, as described herein.

[0037] In some embodiments, a double-stranded nucleic acid is provided that consists of two nucleic acid molecules selected from SEQ ID NOs: 17-18 and 34-72.

[0038] In some embodiments, a double-stranded nucleic acid is provided that consists of complementary nucleic acid molecules selected from among SEQ ID NOs: 17-18 and 34-72.

[0039] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0040] In some embodiments, a double-stranded nucleic acid is provided, consisting of a sense strand selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, 54, and 56, and an antisense strand selected from SEQ ID NOs: 2, 4, 6, 8, and 10.

[0041] In some embodiments, a double-stranded nucleic acid is provided, consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, and 9, and an antisense strand selected from SEQ ID NOs: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0042] In some embodiments, double-stranded nucleic acids are provided, wherein the double-stranded nucleic acid consists of a sense strand selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from SEQ ID NOs: 2, 4, 6, 8, 10, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0043] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from SEQ ID NOs: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0044] In some embodiments, a double-stranded nucleic acid consisting of SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:57 is provided.

[0045] In some embodiments, a double-stranded nucleic acid is provided that includes at least one nucleic acid molecule selected from among SEQ ID NOs: 17-18 and 34-57.

[0046] In some embodiments, there is provided a double-stranded nucleic acid comprising two nucleic acid molecules selected from SEQ ID NOs: 17 to 18 or 34 to 57. In some embodiments, the double-stranded nucleic acid comprises a sense strand and an antisense strand.

[0047] In some embodiments, each strand of the double-stranded nucleic acid has 52 or fewer nucleotides.

[0048] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54, and 56, and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0049] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, 54, and 56, and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 4, 6, 8, and 10.

[0050] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 3, 5, 7, and 9, and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

[0051] In some embodiments, the double-stranded nucleic acid comprises a nucleic acid molecule comprising SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:57.

[0052] In some embodiments, a double-stranded nucleic acid is provided, which consists of a sense strand selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from any one of SEQ ID NOs: 58-72.

[0053] In some embodiments, a double-stranded nucleic acid is provided, which consists of a sense strand selected from SEQ ID NOs: 1, 3, 5, and 7, and an antisense strand selected from any one of SEQ ID NOs: 58-72.

[0054] In some embodiments, a double-stranded nucleic acid is provided, which consists of a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from any one of SEQ ID NOs: 58 to 72.

[0055] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from any one of SEQ ID NOs: 58-72.

[0056] In some embodiments, a double-stranded nucleic acid is provided consisting of SEQ ID NO:34 and SEQ ID NO:58, SEQ ID NO:34 and SEQ ID NO:59, SEQ ID NO:34 and SEQ ID NO:60, SEQ ID NO:17 and SEQ ID NO:61, SEQ ID NO:34 and SEQ ID NO:62, SEQ ID NO:42 and SEQ ID NO:63, SEQ ID NO:44 and SEQ ID NO:63, SEQ ID NO:45 and SEQ ID NO:63, SEQ ID NO:46 and SEQ ID NO:64, SEQ ID NO:46 and SEQ ID NO:65, SEQ ID NO:46 and SEQ ID NO:66, SEQ ID NO:50 and SEQ ID NO:67, SEQ ID NO:46 and SEQ ID NO:69, SEQ ID NO:54 and SEQ ID NO:70, SEQ ID NO:17 and SEQ ID NO:72, or SEQ ID NO:56 and SEQ ID NO:71.

[0057] In some embodiments, a double-stranded nucleic acid is provided that consists of SEQ ID NO:17 and any one of the following: SEQ ID NO:2, SEQ ID NO:18, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, or SEQ ID NO:72.

[0058] In some embodiments, SEQ ID NO:17 and SEQ ID NO:2, SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:17 and SEQ ID NO:35, SEQ ID NO:17 and SEQ ID NO:36, SEQ ID NO:17 and SEQ ID NO:37, SEQ ID NO:17 and SEQ ID NO:38, SEQ ID NO:17 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:17 and SEQ ID NO:41, SEQ ID NO:17 and SEQ ID NO:42, SEQ ID NO:17 and SEQ ID NO:43, SEQ ID NO:17 and SEQ ID NO:44, SEQ ID NO:17 and SEQ ID NO:47, SEQ ID NO:17 and SEQ ID NO:48, SEQ ID NO:17 and SEQ ID NO:49, SEQ ID NO:17 and SEQ ID NO:51, SEQ ID NO:17 and SEQ ID NO:52, SEQ ID NO:17 and SEQ ID NO: and SEQ ID NO: 53, SEQ ID NO: 17 and SEQ ID NO: 55, SEQ ID NO: 17 and SEQ ID NO: 57, SEQ ID NO: 17 and SEQ ID NO: 58, SEQ ID NO: 17 and SEQ ID NO: 59, SEQ ID NO: 17 and SEQ ID NO: 60, SEQ ID NO: 17 and SEQ ID NO: 61, SEQ ID NO: 17 and SEQ ID NO: 62, SEQ ID NO: 17 and SEQ ID NO: 63, SEQ ID NO: 17 and SEQ ID NO: 64, SEQ ID NO: 17 and SEQ ID NO: 65, SEQ ID NO: 17 and SEQ ID NO: 66, SEQ ID NO: 17 and SEQ ID NO: 67, SEQ ID NO: 17 and SEQ ID NO: 68, SEQ ID NO: 17 and SEQ ID NO: 69, SEQ ID NO: 17 and SEQ ID NO: 70, SEQ ID NO: 17 and SEQ ID NO: 71, or SEQ ID NO: 17 and SEQ ID NO: 72.

[0059] In some embodiments, a double-stranded nucleic acid is provided that consists of SEQ ID NO:18 and any one of SEQ ID NO:1, SEQ ID NO:17, SEQ ID NO:34, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:50, SEQ ID NO:54, or SEQ ID NO:56.

[0060] In some embodiments, double-stranded nucleic acids are provided consisting of SEQ ID NO:18 and SEQ ID NO:1, SEQ ID NO:18 and SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:34, SEQ ID NO:18 and SEQ ID NO:44, SEQ ID NO:18 and SEQ ID NO:45, SEQ ID NO:18 and SEQ ID NO:46, SEQ ID NO:18 and SEQ ID NO:50, SEQ ID NO:18 and SEQ ID NO:54, or SEQ ID NO:18 and SEQ ID NO:56.

[0061] In some embodiments, a double-stranded nucleic acid is provided that includes at least one nucleic acid molecule selected from among SEQ ID NOs: 58-72.

[0062] In some embodiments, a double-stranded nucleic acid is provided, comprising two nucleic acid molecules selected from SEQ ID NOs: 17 to 18 or 34 to 72. In some embodiments, the double-stranded nucleic acid comprises a sense strand and an antisense strand.

[0063] In some embodiments, each strand of the double-stranded nucleic acid has 52 or fewer nucleotides.

[0064] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54, and 56, and an antisense strand comprising a nucleic acid molecule selected from any one of SEQ ID NOs: 58-72.

[0065] In some embodiments, a double-stranded nucleic acid is provided, comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 3, 5, 7, and 9, and an antisense strand comprising a nucleic acid molecule selected from any one of SEQ ID NOs: 58-72.

[0066] In some embodiments, the double-stranded nucleic acid comprises a nucleic acid molecule comprising SEQ ID NO:34 and SEQ ID NO:58, SEQ ID NO:34 and SEQ ID NO:59, SEQ ID NO:34 and SEQ ID NO:60, SEQ ID NO:17 and SEQ ID NO:61, SEQ ID NO:34 and SEQ ID NO:62, SEQ ID NO:42 and SEQ ID NO:63, SEQ ID NO:44 and SEQ ID NO:63, SEQ ID NO:45 and SEQ ID NO:63, SEQ ID NO:46 and SEQ ID NO:64, SEQ ID NO:46 and SEQ ID NO:65, SEQ ID NO:46 and SEQ ID NO:66, SEQ ID NO:50 and SEQ ID NO:67, SEQ ID NO:46 and SEQ ID NO:69, SEQ ID NO:54 and SEQ ID NO:70, SEQ ID NO:17 and SEQ ID NO:72, or SEQ ID NO:56 and SEQ ID NO:71.

[0067] In some embodiments, a double-stranded nucleic acid is provided that comprises SEQ ID NO:17 and any one of the following: SEQ ID NO:2, SEQ ID NO:18, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, or SEQ ID NO:72.

[0068] In some embodiments, SEQ ID NO:17 and SEQ ID NO:2, SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:17 and SEQ ID NO:35, SEQ ID NO:17 and SEQ ID NO:36, SEQ ID NO:17 and SEQ ID NO:37, SEQ ID NO:17 and SEQ ID NO:38, SEQ ID NO:17 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:17 and SEQ ID NO:41, SEQ ID NO:17 and SEQ ID NO:42, SEQ ID NO:17 and SEQ ID NO:43, SEQ ID NO:17 and SEQ ID NO:44, SEQ ID NO:17 and SEQ ID NO:47, SEQ ID NO:17 and SEQ ID NO:48, SEQ ID NO:17 and SEQ ID NO:49, SEQ ID NO:17 and SEQ ID NO:51, SEQ ID NO:17 and SEQ ID NO:52, SEQ ID NO:17 and SEQ ID NO:53 Double-stranded nucleic acids are provided comprising SEQ ID NO:53, SEQ ID NO:17 and SEQ ID NO:55, SEQ ID NO:17 and SEQ ID NO:57, SEQ ID NO:17 and SEQ ID NO:58, SEQ ID NO:17 and SEQ ID NO:59, SEQ ID NO:17 and SEQ ID NO:60, SEQ ID NO:17 and SEQ ID NO:61, SEQ ID NO:17 and SEQ ID NO:62, SEQ ID NO:17 and SEQ ID NO:63, SEQ ID NO:17 and SEQ ID NO:64, SEQ ID NO:17 and SEQ ID NO:65, SEQ ID NO:17 and SEQ ID NO:66, SEQ ID NO:17 and SEQ ID NO:67, SEQ ID NO:17 and SEQ ID NO:68, SEQ ID NO:17 and SEQ ID NO:69, SEQ ID NO:17 and SEQ ID NO:70, SEQ ID NO:17 and SEQ ID NO:71, or SEQ ID NO:17 and SEQ ID NO:72.

[0069] In some embodiments, a double-stranded nucleic acid is provided that includes SEQ ID NO:18 and any one of SEQ ID NO:1, SEQ ID NO:17, SEQ ID NO:34, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:50, SEQ ID NO:54, or SEQ ID NO:56.

[0070] In some embodiments, a double-stranded nucleic acid is provided that includes SEQ ID NO:18 and SEQ ID NO:1, SEQ ID NO:18 and SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:34, SEQ ID NO:18 and SEQ ID NO:44, SEQ ID NO:18 and SEQ ID NO:45, SEQ ID NO:18 and SEQ ID NO:46, SEQ ID NO:18 and SEQ ID NO:50, SEQ ID NO:18 and SEQ ID NO:54, or SEQ ID NO:18 and SEQ ID NO:56.

[0071] Any of the compositions and uses of FL2-directed siRNA as described elsewhere herein may utilize any of the foregoing single-stranded nucleic acid sequences (SEQ ID NOs: 58-72) or double-stranded nucleic acids comprising or consisting of any of SEQ ID NOs: 58-72.

[0072] In some embodiments, the 5'-end residue of the siRNA strand is phosphorylated. In some embodiments, the 5'-end residue of the siRNA antisense strand is phosphorylated. In some embodiments, the 5'-end residue of the siRNA strand is not phosphorylated. In some embodiments, the 5'-end residue of the siRNA antisense strand is not phosphorylated.

[0073] In some embodiments, the siRNA comprises a double-stranded portion (duplex). In some embodiments, the siRNA is 20-25 nucleotides in length. In one embodiment, the siRNA comprises a 19-21 core RNA duplex with one or two nucleotide 3' overhangs, independently, on either one or both strands. The siRNA may or may not be 5' phosphorylated, and may be modified or further modified with any of the modifications known in the art to improve efficacy and / or resistance to nuclease degradation. In one embodiment, the siRNA can be administered to transfect one or more cells. In some embodiments, the siRNA is 5' phosphorylated. In some embodiments, any of the nucleic acid sequences disclosed herein may be modified or further modified with one or more nucleotide modifications as described herein.

[0074] As defined herein, the abbreviation "d(nucleotide)" refers to a deoxynucleotide. The abbreviation "m(nucleotide)" refers to a 2'-O-methyl nucleotide. The abbreviation "T" refers to thymidine. The abbreviation "f(nucleotide)" refers to a 2'-fluorodeoxynucleotide. The abbreviation "(Phos)" refers to a phosphodiester cap. Capitalized residues refer to RNA residues. The abbreviation "l(nucleotide)" refers to a locked nucleotide. A locked nucleotide has an extra bridge connecting the 2' oxygen and the 4' carbon. The abbreviation "(s)" refers to phosphorothioate, i.e., a phosphorothioate linkage between adjacent nucleotides or modified nucleotides. Otherwise, nucleotide and ribonucleotide abbreviations have the meanings known in the art.

[0075] Abbreviations for nucleotide modifications described herein are as follows: mU refers to 2'-O-methyl-uridine; mA refers to 2'-O-methyl-adenosine; mC refers to 2'-O-methyl-cytidine; mG refers to 2'-O-methyl-guanosine; fA refers to 2'-fluoro-adenosine; fC refers to 2'-fluoro-cytidine; fG refers to 2'-fluoro-guanosine; fU refers to 2'-fluoro-uridine; dC refers to deoxycytidine; dG refers to deoxyguanosine; dA refers to deoxyadenosine; A refers to adenine. Abbreviations for unmodified nucleotide bases include: A refers to adenine, U refers to uracil, G refers to guanine, C refers to cytosine, and T refers to thymine. lA (lowercase LA) refers to locked adenosine. lU refers to locked uridine. lG refers to locked guanosine. lC refers to locked cytidine.

[0076] In some embodiments, any of the nucleic acid sequences disclosed herein may be modified or further modified with one or more modifications or additional modifications as described herein. In addition to the above-mentioned modifications that may be present in the sequences listed herein and further included in any of the nucleic acids at other positions that are not modified, or in substitution for those that have already been modified, other nucleic acid modifications are fully encompassed herein. Such other modifications include 2'-O-methyl-thymidine, 2'-fluoro-thymidine, and deoxyuridine.

[0077] It should be noted that the abbreviations herein for unmodified and modified nucleic acids may refer to the nucleic acid base, the nucleoside (i.e., the base and sugar), or the nucleotide (the nucleoside and phosphate group), from which one of skill in the art will recognize the components of an unmodified or modified nucleic acid.

[0078] Locked nucleic acids (LNA), often referred to as inaccessible RNA, are modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and the 4' carbon. In some embodiments, the nucleic acid comprises a locked adenosine. In some embodiments, the nucleic acid comprises a locked cytosine. In some embodiments, the nucleic acid comprises a locked guanosine. In some embodiments, the nucleic acid comprises a locked uridine. In some embodiments, the nucleic acid comprises a locked thymidine.

[0079] In certain embodiments, the 5'-terminal residue of the siRNA strand is phosphorylated. In one embodiment, the 5'-terminal residue of the antisense strand of the siRNA is phosphorylated.

[0080] In some embodiments, the single-stranded component of an siRNA of the present disclosure is 14 to 50 nucleotides in length. In other embodiments, the single-stranded component of an siRNA of the present disclosure is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length. In yet other embodiments, the single-stranded component of an siRNA of the present disclosure is 21 nucleotides in length. In yet other embodiments, the single-stranded component of an siRNA of the present disclosure is 22 nucleotides in length. In yet other embodiments, the single-stranded component of an siRNA of the present disclosure is 23 nucleotides in length. In some embodiments, the siRNA of the present disclosure is 28 to 56 nucleotides in length. In other embodiments, the siRNA of the present disclosure is 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 nucleotides in length.

[0081] In another embodiment, the siRNA of the present disclosure comprises at least one 2' sugar modification. In another embodiment, the siRNA of the present disclosure comprises at least one nucleobase modification. In another embodiment, the siRNA of the present disclosure comprises at least one phosphate backbone modification. As used herein, "at least one" means one or more.

[0082] NCBI Reference Sequence: NM001013690.4 (Accession number 19) corresponds to the nucleic acid encoding human fetuin-like 2, 1 agtgagctat ggggacacta ctgcactgta gcctgggcaa cagagcaaga ccttgtctca 61 aaaatgtata tatattttgg gctttttttc ctaaaacggg aactacaaca gcatatttgc 121 gagctgatga gagtgaccca gcagagaggg aaatggatca gctctgttga agatgcactg 181 gacaccagaa cacgcccagc ccctcaacca gtggccagag cagcacctgg acgtctcctc 241 caccaccccg tcgccggccc acaagttgga gttgccccct gggggtcgcc aacgctgcca 3(...) 361 tgcagagaag tactctgggg tcttggattc tccctacgag cgtccggccc tgggcgggta 421 cagcgacgcc tccttcctca acggcgccaa aggggatccc gagccctggc cagggccgga 481 gccaccctac cccttggcct cactccacga aggcctccca ggaaccaaat cgggcggtgg 541 cggcggttcc ggggccctgg ggggctcccc agttttagcc gggaacctcc ctgaacccct 601 ctacgccggc aatgcgtgcg ggggcccatc ggcggcgccc gagtacgcgg ccggctacgg 661 cggggggtac ctggcgccgg gttactgcgc gcagacgggc gccgcgctgc ccccgccgcc 721 cccggccgcg ctcctgcagc ccccaccgcc tccggggtac gggccctcag cgccgctgta 781 caactatccc gcagggggct acgcagcgca gcccggctat ggcgcgctcc cgccgccccc 841 aggcccaccc ccggccccct acctgacccc gggcctgccc gcgcccacgc ccctgcccgc 901 gccggcaccg cccaccgcct atggcttccc cacggccgcg ccgggtgccg aatccgggct 961 gtcgctgaag cgcaaggccg ccgacgaggg gcccgagggc cgctaccgca agtacgcgta 1021 cgagcccgcc aaggcccccg tggctgacgg agcctcctac cccgccgcgg acaacggcga 1081 atgtcggggc aacgggttcc gggccaagcc gccaggagcc gcggaggagg cgtcgggcaa 1141 gtacggtggc ggcgtccccc tcaaggtcct gggctccccc gtctacggcc cgcaactgga 1201 gccctttgaa aagttcccgg agcgggcccc ggctcctcgt ggggggttcg ccgtgccgtc 1261 gggggagact cccaaaggcg tggaccctgg ggccctggag ctggtgacga gcaagatggt 1321 ggactgcggg cccccggtgc agtgggcgga tgtggcgggc cagggcgcgc tcaaggcggc 1381 gctggaggag gagctggtgt ggcccctgct caggccgccc gcctacccgg gcagcctgcg 1441 cccgccgcgg accgtcctgc tctttgggcc gcggggcgcg ggcaaagcgc tgctgggccg 1501 ctgcctcgcc acgcagctgg gcgccacgct gttgcgcctg cgcggcgcga ccctggctgc 1561 gcccggcgcc gccgagggcg cgcgcctcct ccaggccgcc ttcgcggccg cgcgctgccg 1621 cccaccctcc gtactcctca tcagcgagct agaggcgctg ctccccgccc gggacgacgg 1681 cgcggcggca ggggcgcgc tgcaggtgcc gctcctggcc tgcctggacg ggggctgcgg 1741 cgcggggct gacggcgtgc tggttgtggg caccacctcg cggcccgcgg ctctggacga 1801 ggcgacccgc cggcgcttct ctctccgctt ctacgtggcg ctgcccgaca gcccggcccg 1861 cgggcagatc ctgcagcggg cgctggccca gcagggctgc gcgctcagtg agcgggaact 1921 ggcggcgctg gtgcagggca cgcagggctt ctctggggc gagctggggc agctgtgcca 1981 gcaggcggcg gccggggcgg gcctccccggg gctccagcgc cccctctcct acaaggacct 2041 ggaggcggcg ctggccaagg tgggccctag ggcctctgcc aaagactgg actcgttcgt 2101 ggagtgggac aaaatgtacg gctccggaca ctgacggcgc gcgggggagg ccgcgggagc 2161 cgcagtccct ccgtccccgc cgcctccgcg tgggagggat gtcactgact aaacccggct 2221 ggcaggggct ggagtggtga atgtgggatc ggggacagga ggggtctgcc ggtggatatt 2281 ttttttttcg tgggaaggaa aatgcttctg ccaggcagat gccatatgcg ccgtgtactc 2341 aggtttttcc tatttattgt ggactggaag ctcgccatct ccgcccggca gaccgggcag 2401 atccggcatg ggctggcacc cggggcctta agaactcctg ctctcttgcc acaacgcttt 2461 tgtctcctcg ctatctgaat ggcaccctcc ttctccctca ctctctccat cccattctct 2521 gcattctctt ggttttctct cccttttgct ttgtcgctga cacccctgcc caccccatgc 2581 tggccctgtt tctctcctgc ccctccctcc ccagctctcc atccctcacc ctctgtgctt 2641 ctgtctccat ccctggctct ccagcgtccc tggccttttg gtccctgagc tttaatgcct 2701 ttccctgcct tctgttctta tttggactgc agtggccctt tgcaggagct ctggaggccc 2761 aggggctgag gaggagggtt acccctctac ccatctgaaa cctagggtct agggggatca 2821 aggaaaaaaa gtccccaaag aaggggaatt ttttgtttgt ttttgagggg agatcccaga 2881 aatgtagctt gtttcatatt ttagtcttct tatttttgta aaatgtgtag aatttgctgt 2941 3001 gctgctctcc tgtgtgcccc tcacacctgc cccctccccc ccactccatc caggggacca 3061 aattctccca gacactcaaa aaatgagact tacggggaaag gggagaggaa gacccagagg 3121 cctcagtgaa accccagcta ttcctggtca gaagcagaat gtattcctaa gggcttctc 3181 cccagggccg aggcctaggc atgaatgtgg ggagtgggct gtggggtttg agaaaggga 3241 ggccttattc ctctcctgct gctccccacc ccctgcccca cccaacccct ccgctgagtg 3301 ttttctgtga agggctatcc agagttagga tgcccttgcc caattccttc ctgagaccca 3361 gaaggtaggg tgggagggcc caaatgggaa ggtgacctaa gcagaaagtc tccagaaagg 3421 tcatgtcccc tggccctgcc ttggcagagg tccccagtga cttatgctag gaggattcca 3481 tctgggtaga cagtctggcc acaaaatcag ctactggacc tcagccatct ctgctgggagg 3541 ctctgaggag gagtgagcat ccctcacttg tgggggctct gtgaggaaat gtgccttccc 3601 cattcccccg gagtcctagg tctggagctc cagggctggg agagggtgag ggagatgggc 3661 aggggtgttt tctctgacct tgggggctta gtctcagtcc tgcctgaact ttccactagg 3721 cttggaaccc ttccaagaac catatttctc tccttcccac caattttccc ttgatgaggc 3781 tttagcagtt tgctcccacc acccccagcc catttcacaa ctctgatctt agtccaaagc 3841 aggggacacg cccccccacc accacttttt ctctctccca tctcagcctc ctgtgcagtt 3901 ccttgcctgc ccgtgcattt cctagagtct actgcctccc ccctggctgg gagggtgtct 3961 gggggggatc tttcaggggc cctggcaccc agggcctgtg ctggcctagg agtgctgacc 4021 agaaggctgc tctgttcccc cccacccccg ttgctttctg gccccctctt tggagccagc 4081 cacccacagg gctttggtgc ctcagaagca gtgggctgcc gggtcacagc cgcaggctgc 4141 aaaagaccct cggagggagc atggagtgag gggttctctc tcaggtgtgt atgtattggg 4201 gggtgggggt gggtggaggg tgtcagggaa gttggggtgg gatcccagcc ttcccttcaa 4261 gaggcaggga gctctgggag gtggagtccc caccgctttc tctactaggc tcctcctgtt 4321 ccccaggctt ggggagcttt gcacaaggag actgccccca gcctagtggc acctacctca 4381 tgggctctgg ggcaggtagg ggaagggcca gtccagctct ggtaatgctg gggggaggca 4441 taccaaagaa tccaggggca gggagtgggg agggtgactt ccgagctggc ctctcccctt 4501 cctctaccca gactggggct gggatcctct cctcccgctg taaccatttc tacctcattt 4561 tgctgcgtgt tgtacatgga cgtatttatc tcctgtctga cgatgctctg cagttgtggt 4621 ctgtctacct cagaagagac tgtattttaa aagaaagtat tacacagtat taaagcgatg 4681 acatgtggtt tgcaaaaaaa aaaaaaaaaa a (SEQ ID NO: 19), and (SEQ ID NO:2) (human figetin-like 20).

[0083] The nucleic acid sequences are disclosed herein. [Table 1-1] [Table 1-2] [Table 1-3]

[0084] The present disclosure encompasses modifications of the nucleic acid sequences disclosed herein that are useful for treating non-human animals (e.g., non-human primates, non-human mammals). Such modifications of the nucleic acids disclosed herein include siRNAs directed to orthologs of figetin-like 2 in specific species.

[0085] Pharmaceutical Compositions

[0086] In some embodiments, a formulation, pharmaceutical composition, or delivery system of any of the nucleic acids described herein is provided. In some embodiments, the formulation, pharmaceutical composition, or delivery system comprises a nucleic acid consisting of or including any of these nucleic acids described herein, including single-stranded and double-stranded or duplexed versions. In some embodiments, the formulation comprises a duplex or double-stranded nucleic acid comprising one or more nucleic acids selected from among SEQ ID NOS: 17-18 and 34-72, or a nucleic acid consisting of two nucleic acid molecules selected from among SEQ ID NOS: 17-18 and 34-72. In some embodiments, the formulation, pharmaceutical composition, or delivery system comprises a nucleic acid comprising a sequence selected from SEQ ID NOS: 17-18 or 34-72, or a duplex or double-stranded nucleic acid comprising SEQ ID NOS: 17-18 or 34-72. In any of the following descriptions of formulations, pharmaceutical compositions, or delivery systems, any of the aforementioned nucleic acids or nucleic acids described elsewhere herein may be embodied and referred to as an inhibitor of figetin-like 2. In some embodiments, compounds of the present disclosure inhibit the activity of Fidgetin-like 2 (nucleic acid sequence (SEQ ID NO: 1), protein sequence (SEQ ID NO: 20)).

[0087] In one embodiment of the present disclosure, an inhibitor of figetin-like 2 is provided by a subcutaneous implant or depot pharmaceutical system for pulsatile delivery of the inhibitor to a wound or the site where a wound is expected to form, for example, to promote wound healing after surgery. The inhibitor may be provided, for example, in a therapeutically effective amount, to each centimeter of the wound edge or each centimeter of the site where a wound is expected to form.

[0088] The pharmaceutical preparations according to this aspect of the disclosure may be formulated in any suitable carrier, vehicle, diluent, excipient, or other delivery system. Suitable carriers are pharmaceutically acceptable carriers, preferably those that are consistent with topical or injectable administration.

[0089] It will be understood that while the inhibitor of figetin-like 2 may be administered by the same route and in the same form in each episode of treatment, different episodes of treatment may provide the inhibitor of figetin-like 2 by different pharmaceutical agents and / or different routes of administration. In embodiments of the present disclosure, an initial episode of treatment may provide the inhibitor of figetin-like 2 by injection, such as intradermal injection, while a second (and any subsequent) episode of treatment may include providing the inhibitor of figetin-like 2 by an alternative route, such as a topical formulation, or vice versa. In certain embodiments, multiple administrations of an inhibitor of figetin-like 2 may be effected by the same means or route.

[0090] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising saline. In some embodiments, the pharmaceutical composition is normal saline or phosphate buffered saline.

[0091] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a sugar. In some embodiments, the pharmaceutical composition is a glucose solution.

[0092] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a polypeptide. In some embodiments, the polypeptide is a cationic polypeptide. In some embodiments, the cationic polypeptide is a histidine-lysine copolypeptide.

[0093] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a polymer. In some embodiments, the hydrophilic polymer is polyethylene glycol (PEG). In some embodiments, the polymer is a hydrophilic polymer-grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer-grafted polyacetal, a ligand-functionalized cationic polymer, or a ligand-functionalized hydrophilic polymer-grafted polymer. In some embodiments, the hydrophilic polymer is polyethylene glycol (PEG).

[0094] In some embodiments, the pharmaceutical composition comprises a polycationic binding agent.

[0095] In some embodiments, the pharmaceutical composition comprises a nucleic acid delivery vehicle.

[0096] In some embodiments, the pharmaceutical composition comprises a cationic polymer-nucleic acid complex.

[0097] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a lipid. In some embodiments, the lipid is a cationic lipid.

[0098] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a cream.

[0099] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising eye drops.

[0100] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a gel.

[0101] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a micelle material.

[0102] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a wafer. In some embodiments, the wafer comprises collagen, chondroitin sulfate, polyvinylpyrrolidone, and polyethylene glycol 400. A non-limiting example of a wafer is described in the Examples section herein.

[0103] In some embodiments, the inhibitor of figetin-like 2 is provided in or associated with a collagen particle. In some embodiments, the collagen particle is a microparticle. In some embodiments, the collagen particle is in a surfactant polymer dressing, such as, but not limited to, PluroGel®.

[0104] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a nanoparticle microemulsion, a non-limiting example of which is described in the Examples section herein.

[0105] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising a liposome. In some embodiments, the liposome is a ligand-functionalized liposome. In some embodiments, the liposome is further functionalized with at least one 2' sugar modification.

[0106] In some embodiments, the inhibitor of figetin-like 2 is provided in a pharmaceutical composition comprising nanoparticles. In certain embodiments, the inhibitor of figetin-like 2 is encapsulated in nanoparticles. In one embodiment, the nanoparticles are liposomal nanoparticles.

[0107] In one non-limiting example, nanoparticles were prepared as follows: 500 μl of tetramethyl orthosilicate (TMOS) was hydrolyzed in the presence of 100 μl of 1 mM HCl by sonication on ice for approximately 15 minutes until a single phase was formed. The hydrolyzed TMOS (100 μl) was added to 900 μl of a 20 μM siRNA solution containing 10 mM phosphate at pH 7.4. A gel formed within 10 minutes. The gel was frozen at -80°C for 15 minutes and lyophilized.

[0108] In some exemplary, but non-limiting, embodiments, the nanoparticles comprise poly(lactic-co-glycolic acid) (PLGA, PLG), a copolymer produced using methods known in the art. In some embodiments, the nanoparticles are 1-100 nm in size. In some embodiments, the nanoparticles are biocompatible and / or biodegradable. This addition may, in certain embodiments, enhance the purification of the microparticles or nanoparticles using methods known in the art.

[0109] In non-limiting embodiments, the inhibitor of figetin-like 2 is provided in a bulk-eroding system, such as a polylactic acid and glycolic acid (PLGA) copolymer-based microsphere or microcapsule system containing the inhibitor of figetin-like 2. In some embodiments, a PLGA:ethylcellulose blend can be used as a suitable carrier. Additional pharmaceuticals according to this aspect of the disclosure can be formulated in a surface-eroding system, in which the inhibitor of figetin-like 2 is embedded in an erodible matrix (rapid polymer hydrolysis), such as a poly(ortho)ester and polyanhydride matrix.

[0110] In some embodiments, inhibitors of figetin-like 2 may also be formulated by combining a pulsatile delivery system, as described above, with an immediate release system, such as the lyophilized injectable composition described above.

[0111] The inhibitor of figetin-like 2 may be used in a composition containing an additive. Examples of suitable additives include sodium alginate as a gelatinizing agent to prepare a suitable base, or cellulose derivatives such as guar gum or xanthan gum, inorganic gelatinizing agents (called thixotropic gel-forming agents) such as aluminum hydroxide or bentonite, polyacrylic acid derivatives such as Carbopol®, polyvinylpyrrolidone, microcrystalline cellulose, and carboxymethylcellulose. Amphiphilic low- and higher-molecular-weight compounds and phospholipids are also suitable. Gels can exist as either aqueous hydrogels or hydrophobic organogels, for example, based on mixtures of low- and high-molecular-weight paraffin hydrocarbons and petrolatum. Hydrophilic organogels can be prepared, for example, based on high-molecular-weight polyethylene glycol. These gelatinous forms are washable. Hydrophobic organogels are also suitable. Hydrophobic additives such as petroleum jelly, wax, oleyl alcohol, propylene glycol monostearate, and / or propylene glycol monopalmitostearate, especially isopropyl myristate, may be included. In one embodiment, the inhibitor is in a composition that includes one or more dyes, e.g., yellow and / or red iron oxide and / or titanium dioxide, for color matching purposes.

[0112] The compositions may be in any suitable form, including gels, lotions, balms, pastes, sprays, powders, bandages, wound dressings, emulsions, creams, and ointments based on mixed or amphiphilic emulsions (oil / water / oil mixed phases), liposomes and transferosomes, or plaster / band-aid type covers. Emulsifiers that can be used in compositions containing inhibitors of figetin-like 2 include anionic, cationic, or neutral surfactants, such as alkali metal soaps, metal soaps, amine soaps, sulfurized and sulfonated compounds, invert soaps, higher fatty alcohols, partial fatty acid esters of sorbitan and polyoxyethylene sorbitan, such as lanet types, wool wax, lanolin, or other synthetic products for preparing oil / water and / or water / oil emulsions.

[0113] Compositions comprising an inhibitor of figetin-like 2 may also contain, for example, monoglycerides, diglycerides or triglycerides, paraffin oil or vegetable oil, hydrogenated castor oil or coconut oil, porcine fat, synthetic fats (e.g., caprylic acid, capric acid, lauric acid, or stearic acid, e.g., Softisan®), petrolatum, natural or synthetic waxes, fatty acids, fatty alcohols, fatty acid esters, or triglyceride mixtures such as Miglyol®, as lipids, and can be used in the form of fatty and / or oily and / or waxy components to prepare ointments, creams, or emulsions of compositions comprising an inhibitor of figetin-like 2 used in the methods described herein.

[0114] In some embodiments, pharmaceutical compositions may contain osmotically activated acid or alkaline solutions, such as hydrochloric acid, citric acid, sodium hydroxide solution, potassium hydroxide solution, or sodium bicarbonate, as well as buffer systems such as citrate, phosphate, Tris buffer, or triethanolamine to adjust the pH. Preservatives such as methyl or propyl benzoate (parabens) or sorbic acid may also be added to increase stability.

[0115] Pastes, powders, and solutions are additional forms of compositions containing inhibitors of figetin-like 2 that can be applied topically. As a base to impart consistency, pastes often contain hydrophobic and hydrophilic auxiliary substances, but preferably contain hydrophobic auxiliary substances with a very high solid content. To increase dispersibility, flowability, and slipperiness and to prevent agglomeration, powders or topically applicable powders can contain starch species such as wheat or rice starch, flame-dispersed silicon dioxide, or siliceous earth, which also function as diluents.

[0116] In certain embodiments, the composition comprises additional active ingredients suitable for protecting the wound or aiding wound healing, such as one or more antibiotics, antiseptics, vitamins, anesthetics, antihistamines, anti-inflammatory agents, moisturizers, penetration enhancers, and / or anti-irritants.

[0117] Preferably, the inhibitor of figetin-like 2 is biomembrane permeable or is conjugated or otherwise attached to a moiety that renders the inhibitor biomembrane permeable.

[0118] In some embodiments, the carrier further comprises a targeting ligand. In some embodiments, the targeting ligand is a protein. In some embodiments, the targeting ligand binds to epithelial cells, vascular endothelial cells, vascular smooth muscle cells, myocardial (heart) cells, or passenger white blood cells that reside in skin tissue during wound healing.

[0119] In some embodiments, the carrier comprises (a) a histidine-lysine copolymer, (b) a hydrophilic polymer comprising PEG, and, optionally, (c) a targeting ligand.

[0120] In some embodiments, the composition may further comprise one or more additional nucleic acid molecules that induce RNA interference and reduce expression of a gene of interest. In some embodiments, the one or more additional nucleic acid molecules reduce expression of a gene selected from the group consisting of figetin and figetin-like 2.

[0121] How to use

[0122] In some embodiments, methods of use are provided for any of the nucleic acids and pharmaceutical compositions thereof described herein. In some embodiments, methods of use are provided using a nucleic acid consisting of SEQ ID NO: 17-18 or 34-72, or a duplex or double-stranded nucleic acid comprising a nucleic acid consisting of SEQ ID NO: 17-18 or 34-72. In some embodiments, methods of use are provided using a nucleic acid comprising a sequence selected from SEQ ID NO: 17-18 or 34-72, or a duplex or double-stranded nucleic acid comprising two of SEQ ID NO: 17-18 or 34-72. In some embodiments, methods of use are provided using a nucleic acid consisting of any one of SEQ ID NO: 17-18 or 34-72 and any complementary nucleic acid disclosed herein. In some embodiments, methods of use are provided using a duplex or double-stranded nucleic acid comprising a nucleic acid comprising any of SEQ ID NO: 17-18 or 34-72 and any complementary nucleic acid disclosed herein. In some embodiments, modifications or additional modifications to nucleic acids, such as, but not limited to, those described herein, are encompassed herein. Any of the following descriptions of methods of use embody the aforementioned nucleic acids or any of those described elsewhere herein. The term "inhibitor of figetin-like 2" is meant to encompass any of the nucleic acid sequences and modifications thereof described herein. In some embodiments, each individual strand in the double-stranded nucleic acid is 52 nucleotides or less. The present disclosure encompasses methods of use for the treatment of non-human animals (e.g., non-human primates, non-human mammals) comprising modifications of the nucleic acid sequences disclosed herein. Such modifications of the nucleic acids disclosed herein include siRNAs directed to orthologs of figetin-like 2 in a particular species. In some embodiments, the nucleic acids and siRNAs disclosed herein are cross-reactive and therefore useful in at least one other species.

[0123] The following description provides non-limiting guidance regarding various wounds, injuries, and diseases, among other conditions, that can benefit from the compounds and compositions of the present disclosure. The following description is categorized by body system or region, recognizing that such classification is for convenience only, that certain aspects are shared between categories, and that such classification is not intended to limit the scope to a particular condition, disease, wound, or injury of any particular body system or region.

[0124] Skin treatment

[0125] A method of treating a wound in a subject is provided, comprising administering to the subject an inhibitor of figetin-like 2 in an amount effective to treat the wound.

[0126] In one embodiment, the amount of the inhibitor of figetin-like 2 is effective to accelerate wound healing.

[0127] In some embodiments, the wound is an epidermal wound. In some embodiments, the wound is a dermal wound. Non-limiting examples of specific wounds whose healing may be promoted using the medicaments and methods of the present disclosure include, but are not limited to, results of sun damage such as wrinkles, unresponsive skin after a facelift, lasabrasion, aging or sun-damaged skin, liver spots, birthmarks, warts, oil gland enlargement, port-wine stains, hemangiomas, telangiectasias, or changes in the appearance of skin color. In embodiments of the present methods, the birthmark is a linear epithelial nevus. In some embodiments, the method is directed to enhancing the recovery of healthy skin from skin treatments involving the application of a laser to the skin. In some embodiments, the method is directed to rejuvenating skin from skin treatments involving the application of a laser to the skin.

[0128] In some embodiments, the compounds of the present disclosure are useful for improving or accelerating the healing of skin graft sites, such as after burns, scar revision, plastic surgery, or other procedures involving the placement of a skin graft. As described elsewhere, healing of the skin site from which the graft is taken is also an advantage of the compounds described herein.

[0129] In some embodiments, compounds of the present disclosure are useful for enhancing healing of skin grafts or skin transplant sites. In some embodiments, skin grafts are provided to treat burns. In some embodiments, the burns are partial thickness burns. In some embodiments, the burns are full thickness burns. In some embodiments, skin grafts are provided to treat injuries, such as from large open wounds. In some embodiments, skin grafts are provided to treat ulcers, such as, but not limited to, pressure ulcers. In some embodiments, skin grafts are provided to treat skin infections. In some embodiments, skin grafts are provided to treat skin cancer surgery sites. In some embodiments, skin grafts are provided to cover a larger surface area than is available from a supply of donor skin.

[0130] In some embodiments, the method for enhancing hair follicle growth in the skin comprises administering directly to the skin an inhibitor of figetin-like 2 in an amount effective to enhance hair follicle growth in the skin. In some embodiments, the method increases hair growth in the skin.

[0131] Heart treatment

[0132] In some embodiments, the wound is a cardiac tissue wound. In some embodiments, the wound is a cardiovascular wound resulting from, for example, myocardial infarction. In some embodiments, compounds of the present disclosure promote cardiac angiogenesis. In some embodiments, compounds of the present disclosure improve cardiac function after myocardial infarction.

[0133] Nervous system treatment

[0134] In some embodiments, the injury is a neuronal injury.

[0135] In some embodiments, the wound is a central nervous system wound. In some embodiments, the wound occurs in a spinal cord injury. In some embodiments, preventing, reducing, or inhibiting scarring may enhance neuronal reconnection and / or neuronal function. In some embodiments, compounds of the present disclosure promote nerve growth. In some embodiments, compounds of the present disclosure reduce neuronal inflammation. In some embodiments, compounds of the present disclosure promote recovery from nerve transection. In some embodiments, compounds of the present disclosure promote nerve regeneration after injury. In some embodiments, the wound is a peripheral nervous system wound. In some embodiments, the wound is a cavernous nerve injury. In some embodiments, preventing, reducing, or inhibiting scarring may enhance neuronal reconnection and / or neuronal function. In some embodiments, compounds of the present disclosure promote peripheral nerve growth. In some embodiments, compounds of the present disclosure reduce neuronal inflammation. In some embodiments, compounds of the present disclosure promote recovery from nerve transection. In some embodiments, compounds of the present disclosure promote nerve regeneration after injury. In some embodiments, compounds of the present disclosure have anti-inflammatory activity in nervous tissue and other tissues.

[0136] In some embodiments, compounds of the present disclosure treat or prevent neurological apraxia.

[0137] In some embodiments, compounds of the present disclosure treat or prevent the adverse sequelae of nerve-sparing surgery.

[0138] In some embodiments, compounds of the present disclosure promote recovery of erectile response after unilateral or bilateral cavernous nerve transection. In some embodiments, compounds of the present disclosure promote recovery of erectile response within two weeks of cavernous nerve injury. In some embodiments, cavernous nerve injury is the result of a surgical procedure such as a prostatectomy. In some embodiments, the prostatectomy is a radical prostatectomy. In some embodiments, wafers containing siRNA of the present disclosure are implanted at the site of surgery. In some embodiments, an siRNA concentration of about 6.6, about 13.3, or about 26.6 micrograms per 100 mg wafer is implanted. In some embodiments, the wafer comprises about 2.5% collagen, about 7.5% chondroitin sulfate, about 82.5% polyvinylpyrrolidone, and about 7.5% polyethylene glycol 400.

[0139] Eye treatment

[0140] In certain embodiments, the wound is an ocular wound (including inhibition of scarring resulting from ocular surgery such as LASIK surgery, LASEK surgery, PRK surgery, glaucoma filtration surgery, cataract surgery, or surgery in which the lens capsule may be scarred), for example, a wound that causes corneal scarring, or a wound that undergoes capsular contracture (which is common around breast implants).

[0141] Vascular treatment

[0142] In some embodiments, the wound is a wound in the circulatory system, for example, but not limited to, a blood vessel, a venous or arterial valve, a heart valve, or to enhance the vascular integrity of a replacement heart valve, a bypass graft, or a transplanted organ, as non-limiting examples.

[0143] Musculoskeletal treatment

[0144] In some embodiments, the wound is a tendon, ligament, or muscle wound.

[0145] Oral treatment

[0146] In certain embodiments, the wound is a wound of the oral cavity, including the lip and palate, hi some embodiments, the method inhibits scarring resulting from the treatment of a cleft lip or palate.

[0147] Treatment of organs and body cavities

[0148] In certain embodiments, the wound is a wound to an internal organ, such as, but not limited to, the liver, heart, brain, digestive tissue, and reproductive tissue.

[0149] In certain embodiments, the wound is a wound in a body cavity, such as, but not limited to, the abdominal cavity, pelvic cavity, and thoracic cavity, hi some embodiments, inhibiting scarring may reduce the incidence of adhesion formation and / or the size of adhesions formed.

[0150] surgical wound treatment

[0151] In some embodiments, the wound is a surgical wound, including, but not limited to, certain wounds associated with cosmetic procedures such as scar revision. In particular, it is preferred to use the medicaments and methods of the present disclosure to promote the healing of skin wounds. Other non-limiting examples include surgical procedures on the eye and other parts of the body. As described herein, the compounds or compositions of the present disclosure can be applied to the site before an injury or wound occurs, such as a surgical incision.

[0152] Other Aspects of the Disclosure

[0153] In one embodiment of the methods and compositions described herein, the subject is a mammal. In one embodiment, the subject is a human.

[0154] As used herein, "promotion" of wound healing, or grammatical equivalents, means an acceleration in any one or more of the visual appearances of wound repair, reduction in wound size, reduction in the distance between wound edges, scab formation, fibrosis, and re-epithelialization, compared to the corresponding parameters in an untreated wound.

[0155] As used herein, a "wound" is a break or discontinuity in the structure of an organ or tissue (including skin), including epithelium, connective tissue, and muscle tissue, caused by an external agent. Examples of wounds include, but are not limited to, skin wounds, ulcers, pressure sores, scrapes, lacerations, cuts, punctures, perforated eardrums, burns, and wounds resulting from plastic surgery.

[0156] Method of administration

[0157] The benefits that can be derived from the present disclosure may be applicable to wounds at any site throughout the body. In some embodiments, the wound whose healing is promoted is a skin wound. For illustrative purposes, embodiments of the present disclosure are generally described with reference to skin wounds, although they remain applicable to other tissues and organs. By way of example only, in another preferred embodiment, the wound may be a wound of the circulatory system, particularly a wound of a blood vessel. Other wounds whose healing may be promoted in accordance with the present disclosure include those resulting from surgery or burns. Other wounds whose healing may be promoted in accordance with the present disclosure include skin ulcers caused by pressure, venous congestion, or diabetes. In some embodiments, the result of a wound is a scar, which may be treated as described herein to prevent or reduce scarring of wounds at any site within or on the body.

[0158] In some embodiments, the inhibitor of figetin-like 2 is administered locally to the wound. In some embodiments, the inhibitor of figetin-like 2 is administered intravenously or intraarterially. In some embodiments, the inhibitor of figetin-like 2 is administered by injection, catheterization, or cannulation. In some embodiments, the inhibitor of figetin-like 2 is administered from an implant that elutes the inhibitor, such as an eluting stent or an eluting skin patch.

[0159] The dosage of inhibitor administered in treatment will vary depending on factors such as the pharmacodynamic characteristics of the particular inhibitor and its mode and route of administration; the age, sex, metabolic rate, absorption efficiency, health, and weight of the recipient; the nature and extent of symptoms; the type of concurrent treatment administered; the frequency of treatment with the inhibitor and the desired therapeutic effect.

[0160] Dosage units of the inhibitor may contain a single compound or a mixture of compounds with one or more anti-infective or wound healing promoting compounds.

[0161] In some embodiments, the inhibitor of figetin-like 2 is applied to the wound once. In some embodiments, the inhibitor of figetin-like 2 is applied to the wound multiple times. In some embodiments, the inhibitor of figetin-like 2 is applied to the wound in the form of a controlled delivery device, such as, but not limited to, a stent, a wafer, an implant, a bandage, or any other sustained release device. In some embodiments, the inhibitor of figetin-like 2 is applied to the wound every time the dressing is changed.

[0162] In some embodiments, the inhibitor of figetin-like 2 is applied to the wound until healing occurs. In some embodiments, the inhibitor of figetin-like 2 is applied to or maintained at the site for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days. In some embodiments, the inhibitor of figetin-like 2 is implanted or placed at the surgical site at the time of surgery. In some embodiments, such placement is in the form of a controlled-release composition so that the inhibitor of figetin-like 2 can act at the site over a period of time.

[0163] All combinations of the various elements described herein are within the scope of the disclosure unless otherwise indicated herein or clearly contradicted by context.

[0164] The following numbered embodiments are non-limiting examples of certain aspects of the present disclosure. 1. A nucleic acid molecule comprising: 5'-fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO: 17), (Phos) 5'-U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO: 18), 5'-UUACACAGUAUUAAAGCGATT-3' (SEQ ID NO: 34), (Phos) 5'-mUmCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 35), (Phos)5'-mU(s)mC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 36), (Phos) 5'-fUfCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 37), (Phos)5'-fU(s)fC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 38), (Phos)5'-mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3' (SEQ ID NO: 39), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 40), (Phos)5'-mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO: 41), 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3' (SEQ ID NO: 42), (Phos)5'-mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3' (SEQ ID NO: 43), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3' (SEQ ID NO: 44), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3' (SEQ ID NO: 45), 5'UUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 46), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 47), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 48), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 49), 5'-mUmUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 50), (Phos)5'-U(s)CGCUUUAAUACUGUGUmAmATT-3' (SEQ ID NO: 51), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 52), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3' (SEQ ID NO: 53), 5'lUlUlAlClACAGUAUUAAAGCGATT-3' (SEQ ID NO: 54), (Phos) 5'-UCGCUUUAAUACUGlUlGlUlAlA TT-3' (SEQ ID NO: 55), 5'fUfUlAfClACAGUAUUAAAGCGA-3' (SEQ ID NO: 56), or (Phos)5'-mU(s)mCmGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 57), A nucleic acid molecule where d (nucleotide) = deoxy-(nucleotide), m (nucleotide) = 2'-O-methyl nucleotide, T = thymidine, f (nucleotide) = 2'-fluorodeoxynucleotide, (Phos) = phosphodiester cap; uppercase nucleotide = RNA nucleotide, l (nucleotide) = locked nucleotide, and (s) = phosphorothioate. 2. A double-stranded nucleic acid consisting of two nucleic acid molecules according to embodiment 1. 3. The double-stranded nucleic acid of embodiment 2, consisting of a sense strand selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57. 4. The double-stranded nucleic acid of embodiment 2, consisting of SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:57. 5. A double-stranded nucleic acid comprising the nucleic acid molecule of embodiment 1. 6. The double-stranded nucleic acid of embodiment 5, wherein each strand has 52 or fewer nucleotides. 7. The double-stranded nucleic acid of embodiment 5, consisting of a sense strand comprising a nucleic acid molecule selected from among SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand comprising a nucleic acid molecule selected from among SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57. 8. The double-stranded nucleic acid of embodiment 5, comprising SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:57. 9. The double-stranded nucleic acid of embodiment 5, wherein each strand has 52 or fewer nucleotides. 10. The nucleic acid molecule according to any one of embodiments 1 to 9, wherein at least one nucleotide is modified or further modified. 11. The nucleic acid of embodiment 10, wherein the modified or further modified nucleotide is selected from 2'-O-methyl-adenosine, 2'-O-methyl-uridine, 2'-O-methyl-cytosine, 2'-O-methyl-guanosine, 2'-O-methyl-thymidine, 2'-fluoro-adenosine, 2'-fluoro-cytidine, 2'-fluoro-guanosine, 2'-fluoro-uracil, 2'-fluoro-thymidine, deoxycytosine, deoxyguanosine, deoxyadenosine, deoxythymidine, deoxyuridine, locked adenosine, locked uridine, locked guanosine, locked cytidine, phosphorothioate, and phosphodiester cap. 12. A composition comprising a nucleic acid molecule according to any one of embodiments 1 to 11 and a pharmaceutically acceptable carrier, vehicle, excipient, or diluent. 13. The composition of embodiment 12, wherein the carrier comprises at least one of the following: saline, sugar, polypeptide, polymer, lipid, cream, gel, micelle material, wafer, and nanoparticle. 14. The composition of embodiment 12, wherein the carrier comprises at least one of the following: a glucose solution, a polycationic binder, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer-grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer-grafted polyacetal, a ligand-functionalized cationic polymer, a nucleic acid delivery vehicle, a ligand-functionalized-hydrophilic polymer-grafted polymer, and a ligand-functionalized liposome. 15. The composition of embodiment 14, wherein the carrier comprises a cationic polymer-nucleic acid complex. 16. The composition of embodiment 14, wherein the hydrophilic polymer is polyethylene glycol (PEG). 17. The composition of embodiment 13, wherein the nanoparticles are liposomal nanoparticles. 18. The composition of embodiment 17, wherein the liposome is further functionalized with at least one 2' sugar modification. 19. A method of treating a wound or inhibiting, reducing or preventing scarring in a subject, comprising administering to the subject a therapeutically effective amount of the composition of embodiment 12. 20. The method of embodiment 19, wherein the wound or scar is in the skin, eye, central nervous system, peripheral nervous system, cardiac tissue, blood vessels, tendons, ligaments, muscles, oral cavity, lips, palate, internal organs, surgical wounds, abdominal cavity, pelvic cavity, or thoracic cavity. 21. The method of embodiment 20, wherein the ocular wound or scar is of the cornea or lens capsule. 22. The method of embodiment 20, wherein the wound or scar results from ocular surgery, LASIK surgery, LASEK surgery, PRK surgery, glaucoma filtration surgery, cataract surgery, and corneal scarring. 23. The method of embodiment 19, wherein inhibiting scarring reduces the incidence of adhesion formation and / or the size of adhesions formed. 24. The method of embodiment 19, wherein preventing, reducing, or inhibiting scarring enhances neuronal reconnection and / or neuronal function. 25. The method of embodiment 20, wherein the cardiac tissue wound results from a myocardial infarction. 26. The method of embodiment 20, wherein the wound is a neuronal wound. 27. The method of embodiment 20, wherein the wound results in capsular contracture. 28. The method of embodiment 20, wherein the wound is a surgical wound. 29. The method of embodiment 20, wherein the wound results from a cosmetic procedure or scar revision. 30. A method for promoting or improving healing of a skin graft or skin transplant site in a subject, comprising administering to the subject an amount of the composition described in embodiment 12 effective to promote healing of the skin graft or skin transplant site.

[0165] The present disclosure will be better understood from the following Experimental Details, however, those skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the present disclosure, as more fully set forth in the claims that follow. [Example]

[0166] Example 1. siRNA synthesis

[0167] The oligonucleotide sequences of SEQ ID NOs: 17-18 and 34-57 were prepared by synthesizing two single strands of oligonucleotides (sense and antisense) by conventional solid-phase oligonucleotide synthesis using phosphoramidite chemistry. Assembly of oligonucleotide strands by the phosphoramidite method on a solid support such as controlled pore glass (CPG) or polystyrene is shown in Figure 1.

[0168] Each cycle consists of 5' deprotection, coupling, oxidation, and capping. Each coupling step is carried out by reaction of an appropriate activated amidite with the free 5' hydroxyl group of a support-anchored protected nucleoside or oligonucleotide. The oligonucleotide is then deprotected and cleaved from the support. The 2' TBDMS protecting group is then cleaved to yield the crude sense or antisense strand. The sense and antisense strands are then individually purified. The purified single strands are analyzed to confirm the correct molecular weight and impurity profile before annealing to the siRNA duplex (referred to as SiFi2 in Figure 2). The annealed duplex is lyophilized to yield the active pharmaceutical ingredient (API). The API is stored at -20°C.

[0169] Figure 3 shows the chemical structures of a pair of oligonucleotides, sense nucleic acid molecule SEQ ID NO: 17 (Figure 3A) and antisense nucleic acid molecule SEQ ID NO: 18 (Figure 3B). The calculated masses, observed masses (via mass spectrometry), and chemical formulas of SEQ ID NO: 17 / 18 are found in Table 1 below. The designation 17 / 18 refers to the duplex of SEQ ID NO: 17 and SEQ ID NO: 18. [Table 2]

[0170] The other nucleic acid molecules described herein were prepared in the same manner.

[0171] Example 2. siRNA transfection of U2OS cells

[0172] In preparation for testing the efficacy of the nucleic acids and siRNAs described herein, the following method is used to transfect U2OS cells.

[0173] siRNA transfection protocol (6-well plate). Seed 100,000 U2OS cells per well (6-well dish) and culture for 2 days (approximately 80% confluency). 12 hours before transfection, cells must be in serum-free medium. Lipofectamine RNAiMAX: Dilute 3.5 μL of siRNA (20 μM stock) / transfection (70 pmol) in 250 μL of OptiMEM. Then, dilute 3.5 μL of Lipofectamine 3000 in 250 μL of OptimMEM. Mix the siRNA / OptiMEM into the Lipofectamine / OptiMEM solution. Incubate at room temperature for 5 minutes. Add the mixture dropwise to the well. Add 500 μL of serum-free medium.

[0174] siRNA transfection protocol (24-well plate). Seed 20,000 U2OS cells per well (6-well dish) and culture for 2 days (approximately 80% confluency). Follow Lipofectamine 3000 protocol. Dilute 0.7 μL of siRNA (20 μM stock) / transfection (70 pmol) in 125 μL of OptiMEM. Dilute 0.7 μL of Lipofectamine 3000 in 125 μL of OptimMEM. Mix siRNA / OptiMEM into Lipofectamine / OptiMEM solution. Incubate at room temperature for 15 minutes. Add mixture dropwise to well. Add 250 μL of serum-free medium.

[0175] Example 3. siRNA nucleofection of HUVECs

[0176] For HUVECs, the following nucleofection protocol was followed.

[0177] Solution 1: 125 mM Na2HPO4 (1.4998 g in 100 ml H2O), 12.5 mM KCl (0.09318 g in 100 mL H2O). Solution 2: 55 mM MgCl2 (0.9524 g in 100 mL H2O). Working solutions: 80% Solution 1, 20% Solution 2. Use 100 μL per nucleofection.

[0178] Protocol: Prepare warm M200 medium in a plate in the incubator. Before starting, select the HUVEC Nucleofection protocol on the Nucleofector (CM-104 for U2OS). It works best if the cells have been dividing for 48 hours before nucleofection. Work as quickly as possible to minimize the time the cells spend in the nucleofection solution.

[0179] Procedure: Trypsinize and count 1T75 HUVECs. Typically, approximately 1.3 million cells / flask. Pellet cells at 1200 rpm for 5 minutes. Resuspend the pellet in Nucleofection Solution and divide equally among the number of Nucleofection cuvettes. 100 μL / Nucleofection. 1 x 10 cells per cuvette. 4 ~1×10 6 Nucleofect cells. Add nucleic acid directly to the cuvette (30 pmol siRNA = 1.5 μL of 20 μM stock siRNA / 1-2 μg plasmid DNA). Flick the side to remove any air bubbles. Place the cuvette in the Nuclefector and run. Add 500 μL of warm medium directly to the cuvette. Plate the cells into a well plate filled with warm medium. Rotate the plate to evenly distribute the cells. Analyze knockdown / gene expression after 24-48 hours.

[0180] Example 4. Efficacy Testing - Migration Assay

[0181] U2OS cells were seeded into wells of a 6-well dish (100,000 cells per well) and cultured for 2 days until they reached approximately 80% confluency. As described above, cells were transfected with 3.5 μL of 20 μM siRNA (70 pmol) using 3.75 μL of Lipofectamine 3000 according to the manufacturer's protocol. After 24 hours, cells were washed and grown until harvested at either 24, 48, or 72 hours.

[0182] Migration of U2OS cells and HUVECs containing siRNA, as described above, was monitored using time-lapse phase-contrast images. Figure 4A shows representative results from scratch assays performed on U2OS cells after treatment with control non-targeting siRNA (siN) or FL2 siRNA. (4B) Graph comparing the average migration speed of control and FL2-depleted cells. Data were pooled from three independent scratch assay experiments. (4C) Graph comparing the directional persistence of migrating control and FL2-depleted cells. Directionality was determined as the distance (D) between the start and end points divided by the total path length (L) of each trajectory. Error bars indicate the standard error of the mean (SEM). ***P<0.05.

[0183] Using the same assay, we tested the following double-stranded siRNAs from SEQ ID NOs: 17-57, demonstrating their effect on cell phenotype. The siRNAs tested were SEQ ID NOs: 17 and 18, SEQ ID NOs: 34 and 35, SEQ ID NOs: 34 and 36, SEQ ID NOs: 34 and 37, SEQ ID NOs: 34 and 38, SEQ ID NOs: 34 and 39, SEQ ID NOs: 17 and 40, SEQ ID NOs: 34 and 41, SEQ ID NOs: 42 and 43, SEQ ID NOs: 44 and 43, SEQ ID NOs: 45 and 43, SEQ ID NOs: 46 and 47, SEQ ID NOs: 46 and 48, SEQ ID NOs: 46 and 49, SEQ ID NOs: 50 and 51, SEQ ID NOs: 46 and 52, SEQ ID NOs: 46 and 53, SEQ ID NOs: 54 and 55, and SEQ ID NOs: 56 and 57. U2OS cells were transfected with each siRNA as described above and grown to confluency. Wells were then scratched and imaged over the healing process. Data are shown in Figure 5 for an initial screen of U2OS cells.

[0184] As shown in Figure 6, certain candidates identified in the initial screen were tested in a larger sample size of n=4.

[0185] HUVEC cells were nucleofected as described above with either control siRNA or FL2-targeting siRNA, plated, and allowed to reach confluence before performing a time-lapse scratch assay. Individual cells were tracked using FIJI, and cell migration rates were analyzed using the Diper Excel macro. Student's t-tests were performed to determine significance. n ≥ 49 cells. Cells were harvested and probed for Western blot to confirm siRNA-mediated FL2 knockdown. GAPDH was used as a loading control.

[0186] Cell tracking showed that these modifications improved cell migration rates while effectively producing knockdown. Knockdown results for siRNA containing SEQ ID NO: 17 / 18 are shown in Figure 7, and migration data are shown in Figure 8.

[0187] In vitro, depletion of FL2 from human tissue culture cells by SEQ ID NO: 17 / 18 siRNA results in increased cell migration rates, due in part to increased directional motility. Other siRNA sequences, including nucleic acid molecules from SEQ ID NO: 17-57, also exhibit increased migration rates.

[0188] Example 5. siRNA Compositions

[0189] Nanoparticles (np) containing siRNA of the present disclosure were hydrolyzed using 500 μl of tetramethyl orthosilicate (TMOS) in the presence of 100 μl of 1 mM HCl by sonication on ice for approximately 15 minutes until a single phase was formed. The hydrolyzed TMOS (100 μl) was added to 900 μl of 20 μM siRNA (mouse FL2 (Sigma-Aldrich, SASI_Mm02_00354635) or negative control) solution containing 10 mM phosphate (pH 7.4). A gel formed within 10 minutes. The gel was frozen at -80°C for 15 minutes and lyophilized.

[0190] The wafers containing siRNA of the present disclosure are made from 2.5% collagen, 7.5% chondroitin sulfate, 82.5% polyvinylpyrrolidone, and 7.5% polyethylene glycol 400. Such wafers are made to contain 6.6, 13.3, or 26.6 micrograms of siRNA per 100 mg of wafer. The wafers are implanted into the surgical site during, for example, nerve-sparing surgery or procedures with a high risk of neuronal dysfunction, such as radical prostatectomy.

[0191] Example 6. Nanoparticle Microemulsion Formulation

[0192] Components required for the methodology: Zonyl FSO-100 (FSO), Poloxamer 188, perfluorodecalin (PFD), DNAse / RNAse-free water, siRNA as described herein, or control.

[0193] Pre-procedure precautions before starting formulation: The protocol is carried out in a sterile environment at room temperature using DNAse / RNAse-free water. Containers required for processing the formulation are pre-cleaned with an RNAse zap, autoclaved, and rinsed with DNAse / RNAse-free water in a sterile laminar flow hood.

[0194] Preparation of the organic phase. A 20% PFD solution is made in FSO in a tissue culture laminar flow hood. For a 100 mL batch formulation, weigh out 20 grams of FSO and add PFD to bring the volume to 80 mL. The mixture is vortexed and then sonicated in an ultrasonic water batch every 10 minutes for 1 hour, followed by stirring for 4 hours. Because FSO is poorly soluble in PFD, the consistency of the mixture must be checked periodically. To avoid large clumps of FSO and air entrapment, the mixture should be sonicated in an ultrasonic water batch without exposing it to moisture or water. Solubility can be measured anywhere from overnight stirring at room temperature to a 24-hour period. If large clumps of undissolved FSO are present, they should be separated from the mixture by slow centrifugation at 300 g for 5 minutes at room temperature. The dissolved phase should be carefully decanted into a sterile Falcon tube. The supernatant is set aside, and 10 mL of PFD is added to the large clumps of FSO. The mixture is vortexed with the cap tightly closed, followed by sonication in an ultrasonic water bath. This procedure may need to be repeated until any large chunks of PFD are completely dissolved in the PFD. Pool both PFD mixtures and make up to 90 mL. This should result in a homogenous suspension.

[0195] An alternative scale-up process can be performed by preparing the organic phase in small volumes and then finally pooling all fractions to obtain a homogenous suspension.

[0196] Characterization of particle size in the organic phase. The PFD mixture must have a specific particle size, preferably less than 5 μm. After stirring the FSO in the PFD overnight, an aliquot (10 μL) of the mixture was diluted and subjected to dynamic light scattering (DLS) to monitor the particle size optimized for maximum stability. At higher particle sizes, formulation stability is unlikely, so for maximum efficiency, the particle size should be around or below 5 μm. If the DLS measurement indicates a particle size greater than 5 μm, an additional sonication step using a probe is performed with slow pulses spaced 20 seconds apart. Care should be taken not to exceed 10 minutes of sonication. If larger particles greater than 5 μm are still present as measured by DLS, the mixture should be stirred overnight under sterile conditions to obtain a uniform particle size mixture.

[0197] DLS result: 3.433±0.215μm. Instrument: Brookhaven Instruments Corporation, particle size analyzer

[0198] Aqueous Phase Preparation: In a separate 50 mL Falcon tube, prepare a 4% poloxamer solution in DNAse / RNAse-free water. Weigh 400 mg of poloxamer into 9 mL of DNAse / RNAse-free water and mix with a nutator for 2 hours, checking consistency every 30 minutes. The poloxamer must be completely dissolved in the DNAse / RNAse-free water. The poloxamer solution should be chilled in an ice-water bath or refrigerated until use. The poloxamer solution should be made in a clean laminar flow hood and can be mixed using a nutator after tightly capping it outside the hood. (Note: The poloxamer solution is made in 9 mL of water, and later 1 mL of siRNA mixed in DNAse / RNAse-free water is added to make the poloxamer aqueous phase.)

[0199] Addition of siRNA / Control in the Aqueous Phase: Mix siRNA powder or liquid in pre-chilled DNAse / RNAse-free water to make up to 1 mL. Thaw the siRNA quickly and dilute with DNAse / RNAse-free water in an ice bucket just before making the formulation. Do not thaw the siRNA until ready to formulate. Gently add 1 mL of siRNA solution to 9 mL of pre-chilled poloxamer solution in a laminar flow hood and mix thoroughly to obtain a homogenous solution. This procedure must be performed in a certified biosafety hood.

[0200] Preparation of emulsion formulation. The PFD mixture is stirred at a constant speed of 1200 rpm using a magnetic stir bar in a laminar flow hood over an ice bath. The consistency and stability of the microemulsion formation are periodically checked by optical microscopy. Using a micropipette, the aqueous phase of the poloxamer and siRNA mixture is gently added. Slow addition of the aqueous phase is important; faster addition may result in separation of the organic and aqueous phases. A total of 10 mL of aqueous phase is added at a rate of 0.5 mL / min or less over 20 minutes to obtain a stable emulsion. Emulsion stability should be tested by monitoring phase separation while the solution is maintained at 4°C for 1 hour.

[0201] Emulsion formulation characterization. Microscopic image. DLS result: 4.358 ± 0.657 μm. Equipment: Brookhaven Instruments Corporation, Particle Size Analyzer.

[0202] Zeta potential result: -16.97±2.09mV. Equipment: Brookhaven Instruments Corporation, PALS Zeta Potential Analyzer

[0203] Emulsion stability (1 hour) = 100% (Vb-Va) / Vb x 100% was used, where Vb is the volume of the aqueous phase before emulsification and Va is the volume of the aqueous phase after emulsification.

[0204] pH: 6.0

[0205] Charge: Neutral

[0206] Storage and Use: Store emulsion or spray formulations at 4°C (do not freeze) until use. Emulsions should be shaken well before use.

[0207] Example 7. siRNA Collagen-Surfactant Polymer Dressing

[0208] A dressing for treating wounds, burns, and other injuries using collagen microparticles and a surface polymer dressing (SPD) was prepared as follows: 10 g of sodium bis(2-ethylhexyl) sulfosuccinate (AOT) (Sigma-Aldrich) was dissolved in 34 ml of n-hexane and 2 ml of 5% collagen-I dissolved in acetic acid was added. The resulting microemulsion was stirred for 45 minutes until clear. The solution was then evaporated to remove the hexane. The residue was washed, then suspended in nuclease-free water and lyophilized. 100 mg of the lyophilized powder was then treated with 1000 μl of a 25 μM siRNA solution and lyophilized again. This material was then suspended in 1.25 mL of SPD at 4°C for 2 hours and then lyophilized. The lyophilized powder was then added to 1.25 mL of nuclease-free water and 1.25 mL of SPD.

[0209] Example 8. siRNA improves outcomes of radical prostatectomy

[0210] Radical prostatectomy is performed on prostate cancer patients.This type of surgery can have up to 50% risk of erectile dysfunction.In order to reduce the possibility of postoperative erectile dysfunction and other neurological complications, 100mg of wafer prepared as described herein, which contains 10 micrograms of siRNA of SEQ ID NO: 17 / 18, is implanted at the surgical site near the cavernous nerve.Patients recover erectile function after surgery.

[0211] Example 9. siRNA improves healing of excision wounds

[0212] A double-blind, placebo-controlled, randomized excisional wound clinical trial in normal healthy volunteers was conducted to evaluate the rate of wound healing at split-thickness skin graft (STSG) donor sites. In normal volunteers, a 0.08-inch-thick STSG measuring 1 inch x 1 inch was harvested from the upper lateral aspect of each buttock using a calibrated microdermatome. Subjects underwent initial hemostatic management using standard techniques (pressure, thrombin spray, epinephrine). Wound photographs were taken with a calibrated ruler filling 80% of the camera frame within the field of the photograph. A Telfa® pad saturated with a fixed dose of SEQ ID NO: 17 / 18 was applied to one STSG donor site using a parallel randomization designation. An additional vehicle-saturated Telfa® pad was administered on the contralateral side. A sterile, non-adhesive film was placed over the Tegaderm™, followed by a gauze bolster taped into place. During repeated administrations, the dressing was lowered to include the film but not the Telfa pad. Repeat doses are used to saturate the Telfa pads, similar to the first dose. The dressing is then replaced as described above. One day after the final dose is administered, the bolster is removed and both Telfa® pads are slowly removed from the donor site using saline irrigation. A second similar photograph is taken. The wound is then allowed to dry and covered with a transparent, breathable film dressing to allow subsequent visualization of wound healing. Photographs are taken daily for two weeks or until complete epithelialization occurs. The film dressing is removed when the clinician determines that 100% wound epithelialization has occurred or as otherwise clinically indicated. Planarization is performed by a blinded observer to measure and report the rate of wound healing at all time points and times until complete epithelialization.

[0213] Subjects return for photographs at least 1, 3, and 6 months to confirm durability of healing and quality of scar using category 1 on the Hamilton Scar Rating Scale.

[0214] Dosing frequency (once daily, twice daily, and three times daily) will be investigated among the three cohorts.

[0215] Primary Objective: To demonstrate that treatment of STSG donor sites with SiFi2 supports more rapid wound healing than STSG donor sites treated with vehicle alone.

[0216] Secondary Objective: To demonstrate that wound healing following treatment of STSG donor sites with SiFi2 is sustained and is not associated with hypertrophic scarring as determined by the Hamilton Scar Rating Scale compared to vehicle-treated STSG donor site areas.

[0217] Primary endpoint: Rate and completion of wound healing at the STSG donor site as determined by interpretation of standardized photography on days 5–19.

[0218] Secondary endpoints: (1) maintenance of healed wounds at 1, 3, and 6 months; (2) the extent of hypertrophic scarring in each treatment group as assessed by Hamilton Scar Rating Scale 6 score category 1 on photographs of the STSG donor site at 1, 3, and 6 months as interpreted by three independent expert wound care surgeon reviewers; and (3) the extent of pain and pruritus on the treated and untreated sides.

[0219] Inclusion criteria: (1) healthy subjects of either sex of any race; (2) age range: 21-65 years; (3) basal metabolic index of 18-30; (4) willingness and ability to provide informed consent and participate in postoperative scar evaluation; (5) willingness to comply with the follow-up evaluation schedule. Exclusion criteria: (1) inability to provide informed consent; (2) unwillingness to participate in postoperative scar evaluation; (3) skin disease (scleroderma or other collagen vascular disease, previous keloids, severe skin thinning with previous skin lacerations); (4) use of systemic or cutaneous steroids in the past 6 months; (5) pregnancy or attempting to become pregnant; (6) taking anticoagulants; (7) immunocompromised state; (8) diabetes; (9) malnutrition; (10) use of platelets or NSAIDs in the past 2 weeks; (11) known hypersensitivity to suture or dressing materials; (12) known hypersensitivity to epinephrine or thrombin; (13) infection within the past 2 weeks; (14) any condition that, in the investigator's opinion, would prevent the subject from successfully completing the clinical trial.

[0220] Safety: Monitor for any adverse events, clinically significant laboratory abnormalities from baseline, abnormal bleeding, infection, and hypertrophic scar formation.

[0221] Number of subjects: Approximately 15 completed subjects across three cohorts (5 subjects per cohort). One cohort will receive treatment once daily (qd), a second cohort twice daily (bid), and a third cohort three times daily (tid).

[0222] Study participation: 6 months

[0223] Each subject will receive 4 days of medication applied on a Telfa® absorbent pad under the knot on the bolster at the STSG donor site, either qd (Cohort 1), bid (Cohort 2), or tid (Cohort 3) on days 1, 2, 3, and 4. In all cases, total surgical time is estimated to be less than 2 hours.

[0224] Estimated time to complete registration: 3 months.

[0225] The results show that treatment of STSG donor sites with SEQ ID NO: 17 / 18 supports more rapid wound healing than STSG donor site areas treated with vehicle alone, and that wound healing following treatment of STSG donor sites with SiFi2 is not associated with hypertrophic scarring as determined by the Hamilton Scar Rating Scale compared to vehicle-treated STSG donor site areas.

[0226] While certain features of the present disclosure have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes that fall within the true spirit of the present disclosure.

Claims

1. A nucleic acid molecule comprising: 5'-fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO: 17), (Phos) 5'-U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO: 18), 5'-UUACACAGUAUUAAAGCGATT-3' (SEQ ID NO: 34), (Phos) 5'-mUmCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 35), (Phos)5'-mU(s)mC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 36), (Phos) 5'-fUfCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 37), (Phos) 5'-fU(s)fC(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 38), (Phos)5'-mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3' (SEQ ID NO: 39), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 40), (Phos)5'-mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO: 41), 5'-mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3' (SEQ ID NO: 42), (Phos) 5'-mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3' (SEQ ID NO: 43), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3' (SEQ ID NO: 44), 5'mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3' (SEQ ID NO: 45), 5'UUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 46), (Phos)5'-U(s)CGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 47), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 48), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 49), 5'-mUmUACACAGUAUUAAAGCGA-3' (SEQ ID NO: 50), (Phos)5'-U(s)CGCUUUAAUACUGUGUmAmATT-3' (SEQ ID NO: 51), (Phos) 5'-UCGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 52), (Phos)5'-U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3' (SEQ ID NO: 53), 5'lUlUlAlClACAGUAUUAAAGCGATT-3' (SEQ ID NO: 54), (Phos) 5'-UCGCUUUAAUACUGlUlGlUlAlA TT-3' (SEQ ID NO: 55), 5'fUfUlAfClACAGUAUUAAAGCGA-3' (SEQ ID NO: 56), or (Phos)5'-mU(s)mCmGCUUUAAUACUGUGUAATT-3' (SEQ ID NO: 57), A nucleic acid molecule where d (nucleotide) = deoxy-(nucleotide), m (nucleotide) = 2'-O-methyl nucleotide, T = thymidine, f (nucleotide) = 2'-fluorodeoxynucleotide, (Phos) = phosphodiester cap; uppercase nucleotide = RNA nucleotide, l (nucleotide) = locked nucleotide, and (s) = phosphorothioate.

2. A double-stranded nucleic acid consisting of two nucleic acid molecules according to claim 1.

3. The double-stranded nucleic acid of claim 2, consisting of a sense strand selected from SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand selected from SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

4. The double-stranded nucleic acid of claim 2, consisting of SEQ ID NOs:17 and 18, SEQ ID NOs:34 and 35, SEQ ID NOs:34 and 36, SEQ ID NOs:34 and 37, SEQ ID NOs:34 and 38, SEQ ID NOs:34 and 39, SEQ ID NOs:17 and 40, SEQ ID NOs:34 and 41, SEQ ID NOs:42 and 43, SEQ ID NOs:44 and 43, SEQ ID NOs:45 and 43, SEQ ID NOs:46 and 47, SEQ ID NOs:46 and 48, SEQ ID NOs:46 and 49, SEQ ID NOs:50 and 51, SEQ ID NOs:46 and 52, SEQ ID NOs:46 and 53, SEQ ID NOs:54 and 55, or SEQ ID NOs:56 and 57.

5. A double-stranded nucleic acid comprising the nucleic acid molecule of claim 1.

6. 6. The double-stranded nucleic acid of claim 5, wherein each strand has 52 or fewer nucleotides.

7. The double-stranded nucleic acid of claim 5, comprising a sense strand comprising a nucleic acid molecule selected from among SEQ ID NOs: 17, 34, 42, 44, 45, 46, 50, and 54, and an antisense strand comprising a nucleic acid molecule selected from among SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55, and 57.

8. 6. The double-stranded nucleic acid of claim 5, comprising SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:35, SEQ ID NO:34 and SEQ ID NO:36, SEQ ID NO:34 and SEQ ID NO:37, SEQ ID NO:34 and SEQ ID NO:38, SEQ ID NO:34 and SEQ ID NO:39, SEQ ID NO:17 and SEQ ID NO:40, SEQ ID NO:34 and SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:43, SEQ ID NO:46 and SEQ ID NO:47, SEQ ID NO:46 and SEQ ID NO:48, SEQ ID NO:46 and SEQ ID NO:49, SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:46 and SEQ ID NO:52, SEQ ID NO:46 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or SEQ ID NO:56 and SEQ ID NO:

57.

9. 6. The double-stranded nucleic acid of claim 5, wherein each strand has 52 or fewer nucleotides.

10. The nucleic acid molecule according to any one of claims 1 to 9, wherein at least one nucleotide is modified or further modified.

11. 11. The nucleic acid of claim 10, wherein the modified or further modified nucleotide is selected from 2'-O-methyl-adenosine, 2'-O-methyl-uridine, 2'-O-methyl-cytosine, 2'-O-methyl-guanosine, 2'-O-methyl-thymidine, 2'-fluoro-adenosine, 2'-fluoro-cytidine, 2'-fluoro-guanosine, 2'-fluoro-uracil, 2'-fluoro-thymidine, deoxycytosine, deoxyguanosine, deoxyadenosine, deoxythymidine, deoxyuridine, locked adenosine, locked uridine, locked guanosine, locked cytidine, phosphorothioate, and phosphodiester cap.

12. A composition comprising the nucleic acid molecule of any one of claims 1 to 11 and a pharmaceutically acceptable carrier, vehicle, excipient, or diluent.

13. 13. The composition of claim 12, wherein the carrier comprises at least one of the following: saline, sugar, polypeptide, polymer, lipid, cream, gel, micelle material, wafer, and nanoparticle.

14. 13. The composition of claim 12, wherein the carrier comprises at least one of the following: a glucose solution, a polycationic binder, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer-grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer-grafted polyacetal, a ligand-functionalized cationic polymer, a nucleic acid delivery vehicle, a ligand-functionalized-hydrophilic polymer-grafted polymer, and a ligand-functionalized liposome.

15. The composition of claim 14, wherein the carrier comprises a cationic polymer-nucleic acid complex.

16. The composition of claim 14 , wherein the hydrophilic polymer is polyethylene glycol (PEG).

17. The composition of claim 13 , wherein the nanoparticles are liposomal nanoparticles.

18. 18. The composition of claim 17, wherein the liposome is further functionalized with at least one 2' sugar modification.

19. 13. A method of treating a wound or inhibiting, reducing or preventing scarring in a subject, comprising administering to the subject a therapeutically effective amount of the composition of claim 12.

20. 20. The method of claim 19, wherein the wound or scar is in the skin, eye, central nervous system, peripheral nervous system, cardiac tissue, blood vessels, tendons, ligaments, muscles, oral cavity, lip, palate, internal organs, surgical wounds, abdominal cavity, pelvic cavity, or thoracic cavity.

21. 21. The method of claim 20, wherein the wound or scar of the eye is of the cornea or lens capsule.

22. 21. The method of claim 20, wherein the wound or scar results from eye surgery, LASIK surgery, LASEK surgery, PRK surgery, glaucoma filtration surgery, cataract surgery, and corneal scarring.

23. 20. The method of claim 19, wherein inhibiting scarring reduces the incidence of adhesion formation and / or the size of adhesions formed.

24. 20. The method of claim 19, wherein said preventing, reducing, or inhibiting scarring enhances neuronal reconnection and / or neuronal function.

25. 21. The method of claim 20, wherein the wound in the cardiac tissue results from a myocardial infarction.

26. 21. The method of claim 20, wherein the injury is a neuronal injury.

27. 21. The method of claim 20, wherein the wound results in capsular contracture.

28. 21. The method of claim 20, wherein the wound is a surgical wound.

29. 21. The method of claim 20, wherein the wound results from a cosmetic procedure or scar revision.

30. A method for promoting or improving healing of a skin graft or skin transplant site in a subject, comprising administering to the subject an amount of the composition described in claim 12 effective to promote healing of the skin graft or skin transplant site.