Notch receptors with hinge domains

Abstract

This disclosure relates in particular to a novel class of receptors engineered to modulate transcriptional regulation in a ligand-dependent manner. [Solution] In particular, the novel receptor, despite being derived from Notch, does not require the Notch-negative regulatory region, which was previously thought to be essential for receptor function. Furthermore, the novel receptor described herein incorporates an extracellular oligomerization domain that promotes oligomerization of the chimeric receptor. This disclosure also provides such receptors, nucleic acids encoding them, compositions and methods useful for generating host cells genetically modified with the nucleic acids, as well as methods for modulating cell activity and / or treating various health conditions such as cancer.

Description

Technical Field

[0001] Statement Regarding Federally Sponsored Research and Development This invention was made with government support under grant number OD025751 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0002] Cross - Reference to Related Patents This application claims priority to both U.S. Provisional Patent Application Nos. 62 / 905,251 and 62 / 905,263, filed on September 24, 2019, the disclosures of which, including any drawings, are incorporated herein by reference in their entirety.

[0003] Incorporation of Sequence Listing This application includes a sequence listing that is incorporated herein by reference in its entirety. The attached sequence listing file entitled "048536_654001WO_Sequence_Listing_ST25.txt" was created on September 23, 2020, and is 144 KB in size.

[0004] This disclosure generally relates to novel synthetic cellular receptors that bind to cell - surface ligands and have selectable specificities and activities. This disclosure also provides such receptors, nucleic acids encoding them, compositions and methods useful for generating host cells genetically modified with such nucleic acids, and methods for modulating the activity of cells and / or treating various health conditions or diseases such as cancer.

Background Art

[0005] A major problem limiting the progress of artificial cell therapies in humans is the inability to modulate therapeutic gene expression to reduce or eliminate interactions that cause significant side effects, such as out-of-target activity or targeted extratumor activity (i.e., CAR-T targets being found on normal cells outside the tumor), or to modulate or cleave CAR-T activity when necessary. A possible solution to these problems lies in using synthetic receptors that can alter gene expression and / or cell behavior.

[0006] The Notch receptor is a transmembrane protein that mediates cell-to-cell contact signaling and plays a central role in the development and other characteristics of cell-to-cell communication, i.e., communication between two contact cells, one of which is a "receiving" cell and the other is a "transmitting" cell. Notch receptors expressed in the receiving cell recognize ligands (e.g., delta / serate / lag, i.e., proteins of the "DSL" family) expressed in the transmitting cell. The engagement of Notch and delta on the surface of these contact cells results in a two-step proteolytic degradation of the Notch receptor, which ultimately releases the intracellular portion of the receptor from the membrane into the cytoplasm. Notch has a metalloprotease cleavage site (denoted "S2"), which is usually protected from cleavage by a Notch-negative regulatory region (NRR), a domain consisting of three LIN-12-Notch repeat (LNR) modules, and a heterodimerization domain (HD) of the Notch extracellular subunit (NEC). This proteolytic degradation is controlled by the force exerted by the transmitting cell. The DSL ligand is thought to pull out the Notch receptor, altering the structure of the negative regulatory region and exposing the metalloprotein degradation site. This site is then cleaved by a constitutively active proteolytic enzyme, releasing the extracellular binding site and negative regulatory region (NRR) of the receptor. The release of this extracellular binding site subsequently exposes another intramembrane cleavage site (denoted "S3"), which is then cleaved by a γ-secreting enzyme within the cell membrane, releasing the nuclear-homing intracellular domain from the cell membrane. (See WR Gordon et al., Dev Cell (2015) 33:729-36). This released domain functions as a transcription regulator, altering the behavior of the receiving cell. The Notch receptor is involved in, or required for, various cellular functions during development and is crucial to the function of a vast number of cell types across all species.

[0007] In many cases, existing first-generation synthetic derivatives of the Notch receptor, often called "synthetic Notch receptors," involve substituting the extracellular ligand-binding domain containing multiple EGF-like repeats in wild-type Notch with an antibody derivative, and substituting the cytoplasmic domain with an arbitrary transcription factor, thereby utilizing the direct signaling behavior while depending on the functionality of the Notch NRR (see L. Morsut et al., Cell (2016) 164:780-91). Generally, synthetic Notch signaling correlates with ligand binding, but it is difficult to modulate the sensitivity or response of the receptor. Furthermore, the NRR spans approximately 160 amino acids, and this domain alone is the size of some mature proteins such as insulin and epidermal growth factor (EGF). This results in low expression efficiency of chimeric receptors, and due to size constraints related to vector capacity, the resulting chimeric receptors may exceed the capacity of some cloning and gene transfer vectors. [Overview of the Initiative]

[0008] This disclosure relates to immunotherapeutic agents, such as chimeric polypeptides, generally used to modulate cell activity or to treat various health conditions or diseases. In particular, provided herein are oligomeric chimeric receptors that, despite the complete absence of a Notch extracellular subunit (NEC) containing a negative regulatory region (NRR), surprisingly retain the ability to transduce signals in response to ligand binding. More specifically, these receptors incorporate an extracellular oligomerization domain to facilitate the formation of oligomeric forms of the chimeric receptor, such as dimeric or trimer forms. Without being bound by any particular theory, this design facilitates the oligomerization or clustering of the extracellular domain (ECD), which then combines with the intracellular domain (ICD) to activate cellular signaling, such as T cell signaling. Furthermore, these receptors offer broad sensitivity. Furthermore, by completely eliminating negative notch NECs, the polynucleotide encoding the receptor of this disclosure can be made smaller than the polynucleotide encoding the synthetic notch, thereby enabling the use of vectors with more limited capacity or facilitating the inclusion of further elements that might otherwise be excluded by size constraints related to vector capacity.

[0009] In one aspect, this specification provides a chimeric polynucleotide comprising, from N-terminus to C-terminus, (a) an extracellular ligand-binding domain having binding affinity to a selected ligand; (b) a hinge domain capable of promoting oligomerization of the chimeric polypeptide via intermolecular disulfide bonds; (c) a transmembrane domain containing one or more ligand-induced proteolytic cleavage sites; and (d) an intracellular domain containing a transcription factor, wherein when the selected ligand binds to the extracellular ligand-binding domain, cleavage is induced at one ligand-induced proteolytic cleavage site located between the transcription factor and the hinge domain, and the chimeric polypeptide does not contain a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of the Notch receptor.

[0010] Non-limiting embodiments of the chimeric polypeptides described herein include one or more of the following features: In some embodiments, the transmembrane domain further includes a transport termination sequence. In some embodiments, the extracellular domain includes an antigen-binding site that can bind to a ligand on the cell surface. In some embodiments, the cell is a pathogen. In some embodiments, the cell is a human cell. In some embodiments, the human cell is a tumor cell. In some embodiments, the human cell is a terminally differentiated cell. In some embodiments, the ligand includes a protein or a carbohydrate. In some embodiments, the ligand is a differentiation cluster (CD) marker. Depending on the embodiment, the CD markers are CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80(B7.1), CD86(B7.2), CD94, CD95, CD134, CD140(PDGFR4), CD152, CD154, CD158, CD178, CD181(C The group is selected from the following: XCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphate elimination enzyme, placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), and signal regulatory protein α (SIRPα).

[0011] In another aspect, nucleic acids comprising nucleotide sequences encoding the chimeric polypeptide disclosed herein are provided herein. Depending on the embodiment, this nucleotide sequence is incorporated into an expression cassette or expression vector.

[0012] In some embodiments, recombinant cells are provided herein, comprising (a) a chimeric polypeptide and / or (b) a recombinant nucleic acid disclosed herein. In related aspects, a cell culture comprising at least one recombinant cell and culture medium disclosed herein is also provided.

[0013] In another aspect, the disclosed pharmaceutical composition comprises a pharmaceutically acceptable carrier and one or more recombinant nucleic acids and recombinant cells as disclosed herein. Depending on the embodiment, the disclosed pharmaceutical composition comprises recombinant nucleic acids and a pharmaceutically acceptable carrier. Depending on the embodiment, the recombinant nucleic acid is encapsulated within a viral capsid or lipid nanoparticles.

[0014] In another aspect, the Specified provides a method for modulating the activity of cells, comprising the steps of (a) providing recombinant cells of the Disclosure and (b) contacting the cells with a selected ligand, the selected ligand binding to the extracellular ligand-binding domain of a chimeric polypeptide inducing cleavage of a ligand-induced proteolytic cleavage site and releasing a transcription factor, the released transcription factor modulating the activity of the recombinant cells. Another aspect relates to a method for modulating the activity of target cells in an organism, comprising the steps of administering an effective number of recombinant cells of the Disclosure to the organism, the recombinant cells inhibiting the activity of target cells in the organism.

[0015] Another aspect relates to a method for treating a health condition (e.g., disease) in an individual, which involves administering an effective number of recombinant cells of the present disclosure to the individual, and these recombinant cells treat the health condition in the individual.

[0016] In another aspect, some embodiments of the present disclosure relate to systems for modulating the activity of cells in an individual that requires it, inhibiting targeted cancer cells, or treating a health condition (e.g., disease), the system comprising one or more of the chimeric polypeptides, polynucleotides, recombinant cells, or pharmaceutical compositions of the present disclosure.

[0017] Another aspect of the present disclosure relates to a method for generating recombinant cells of the present disclosure, the method comprising the steps of (a) providing cells capable of protein expression, and (b) contacting the provided cells with recombinant nucleic acids of the present disclosure. In some embodiments, these cells are obtained by a leukocyte apheresis performed on a sample taken from a subject, and these cells are contacted in vitro. In some embodiments, the recombinant nucleic acids are encapsulated within a viral capsid or lipid nanoparticles.

[0018] Another aspect of this disclosure relates to the use of one or more of the chimeric polypeptides, polynucleotides, recombinant cells, or pharmaceutical compositions of the Disclosure for the treatment of a health condition. In some embodiments, this health condition is a disease such as cancer. In some embodiments, this cancer is a solid tumor, a soft tissue tumor, or a metastatic lesion.

[0019] Another aspect of this disclosure relates to the use of one or more of the chimeric polypeptides, polynucleotides, recombinant cells, or pharmaceutical compositions of this disclosure for the manufacture of pharmaceuticals for the treatment of health conditions, such as diseases.

[0020] The above summary is illustrative and not intended to limit in any sense. In addition to the exemplary embodiments and features described herein, further aspects, embodiments, purposes, and features of this disclosure will be readily apparent from the drawings and detailed description and the claims. [Brief explanation of the drawing]

[0021] [Figure 1]Figures 1A and 1B schematically illustrate the differences between the synthetic Notch receptor and the chimeric polypeptide of this disclosure. Figure 1A shows the schematic structure of an existing synthetic Notch receptor (SynNotch) having a ligand recognition domain (e.g., anti-CD19 scFv), a proximity-of-membrane domain (JMD) containing a Notch-negative regulatory region (NRR), a single-pass transmembrane domain (TMD), a transport termination sequence (STS), and a transcriptional regulator (e.g., Gal4VP64). Figure 1B shows the schematic structure of an exemplary second-generation synthetic Notch receptor (Hinge-Notch receptor) disclosed herein, in which the entire NEC of the wild-type Notch polypeptide, including the NRR, is deleted. A hinge polypeptide sequence derived from the CD8 hinge domain is inserted at the N-terminus of the TMD. The CD8 hinge sequence contains a polypeptide motif that facilitates dimerization of the chimeric polypeptide via an intermolecular disulfide bond.

[0022] [Figure 2]Figures 2A-2C schematically summarize the design, expression, and activation of hinge-notch receptors in primary T CD4+ T cells. Figure 2A schematically shows an exemplary synthetic Notch-1 receptor designed based on the human Notch-1 protein (left panel). The center panel schematically shows an exemplary CD8 hinge-notch-1 receptor. Compared to the synthetic Notch-1 receptor in the left panel, the CD8 hinge-notch-1 receptor has the entire JMD replaced by the CD8A hinge domain and contains cysteine ​​residues known to form disulfide bonds. The right panel schematically shows the truncated CD8 hinge-notch-1 receptor (truncCD8 hinge-notch-1). Compared to the CD8 hinge-notch 1 receptor, the truncCD8 hinge-notch 1 receptor contains a C-terminal deletion of the CD8A hinge sequence, retaining one cysteine ​​residue and a shorter extracellular region. Figure 2B is a summary of flow cytometry data for receptor expression. In these experiments, primary human T cells were transduced with two lentiviral constructs expressing either the receptor or a transcriptional reporter plasmid, and activated with anti-CD3 / anti-CD28 Dynabeads (Gibco). Receptor signaling was measured using an AlexaFluor647-tagged anti-myc antibody (Cell Signaling). Reporter expression was measured by the constitutive mCitrine gene found on the surface of the reporter plasmid. Double-positive cells were selected 5 days after stimulation of primary T cells and further grown for activation testing. Figure 2C is a summary of the results of the receptor activation test, where the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences).

[0023] [Figure 3]Figure 3 schematically summarizes the results of experiments conducted to demonstrate receptor activation simultaneously with T cell activation. In these experiments, an anti-MCAM, anti-CD3 bispecific T cell engager (MCAM BiTE®) that activates the T cell receptor in the presence of K562 cells was used to mimic T cell activation. 1 × 10⁵ bipositive T cells expressing the anti-CD19 receptor were co-cultured for 24 hours with MCAM BiTE® (top figure), 1 × 10⁵ K562 cells and MCAM BiTE® (middle figure), 1 × 10⁵ CD19, K562 cells, and MCAM BiTE® (bottom figure). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences), and an increase in the reporter signal was observed compared to the signal obtained from inactivated T cells in Figure 2.

[0024] [Figure 4] Figures 4A-4D summarize the results of experiments conducted to optimize the hinge domain in the chimeric notch receptor environment. Figure 4A schematically shows various CD8 hinge-notch truncated mutants containing one or more hinge components, labeled "a," "b," "c," and "d." Component "a" represents the N-terminal region of the first cysteine ​​residue. Component "b" represents the first cysteine ​​residue. Component "c" represents the region between the first and second cysteine ​​residues. Component "d" represents the second cysteine ​​residue and the region from the second cysteine ​​residue to the receptor transmembrane domain. The hinge components of the four mutants tested are listed. Figure 4B summarizes the results of receptor activation tests in Jurkat T cells. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). Figure 4C shows the quantification of %BFP-positive cells from the data in Figure 4B. Figure 4D shows the signal-to-noise ratio from the data in Figure 4B.

[0025] [Figure 5]Figure 5 schematically summarizes the results of experiments conducted to test the activation of the trunkCD8 hinge 2 receptor simultaneously with PKC (protein kinase C) signaling. In these experiments, phorbol 12-myristate 13-acetate (PMA) was added to mimic PKC signaling. 1 × 10⁵ double-positive T cells expressing the anti-CD19 receptor were co-cultured for 24 hours under conditions with and without PMA, either without additional cells (top panel), or with 1 × 10⁵ K562 cells (middle panel) or 1 × 10⁵ CD19+ K562 cells (bottom panel). Subsequently, transcriptional activation of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences).

[0026] [Figure 6] Figures 6A-6B schematically summarize the results for hinge-notch receptors containing alternative hinge domains derived from other sources. As shown in Figure 6A, in addition to CD8A, CD28, OX40, and IgG4 were found to possess usable hinge domains. In these experiments, four exemplary hinge-notch receptors were pIZ343 (truncate CD8 hinge-notch), pIZ358 (CD28 hinge-notch), pIZ360 (OX40 hinge-notch), and pIZ359 (IgG4 hinge-notch). A brief description of each hinge-notch receptor is shown in Table 2. Figure 6B shows the results of quantification of %BFP-positive cells from the tests in Figure 6A.

[0027] [Figure 7]Figures 7A-7B provide a schematic summary of the results of experiments conducted to test hinge-notch receptors containing other ligand-recognition domains. As shown in Figure 7A, in addition to anti-CD19 scFv, anti-ALPPL2 scFv and eGFP can be used as ligand-recognition domains. As shown in Figure 7B, the receptor construct was transduced into the previously generated reporter-positive Jurkat T cell line. Receptor expression was measured using an AlexaFluor647-tagged anti-myc antibody (Cell Signaling). In the receptor activation test, 1 × 10⁵ Jurkat T cells expressing the anti-CD19 receptor were co-cultured for 24 hours with no additives (top figure), or with 1 × 10⁵ K562 cells (middle figure), or with 1 × 10⁵ ALPPL2+ K562 cells / 1 × 10⁵ K562 cells expressing anti-GFP nanobodies on the cell surface (bottom figure). Next, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences).

[0028] [Figure 8]Figures 8A-8B provide a schematic summary of experiments conducted to test hinge-notch receptors with other transport stop sequences (STSs). As shown in Figure 8A, in addition to the Notch 1 STS, it is possible to influence receptor behavior using other STSs (e.g., Notch 2 STS, Notch 4 STS, DAG1 STS, PTPRF STS, and KL STS). In these experiments, primary human T cells were activated with Dynabeads (Gibco) conjugated with anti-CD3 / anti-CD28 and transduced with two lentiviral constructs expressing either the receptor or a transcription reporter construct. Receptor / reporter-positive cells were selected 5 days after primary T cell stimulation and further grown for activation testing. For the experiment, 1 × 10⁵ double-positive T cells expressing the anti-CD19 receptor were co-cultured for 24 hours either without additives (top figure), or with 1 × 10⁵ K562 cells (middle figure) or 1 × 10⁵ CD19+ K562 cells (bottom figure). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). Figure 8B shows the quantitative results of the activation data from Figure 8A.

[0029] [Figure 9]Figures 9A-9C provide a schematic summary of the results of experiments conducted to evaluate the functionality of various hinge-notch truncated mutants, exemplified by the hinge-notch 1 construct, in order to optimize the hinge-notch receptor. Figure 9A shows the construct designs for mutants containing either the full-length or truncated form of the N-JMD domain of construct pIZ341. Black bars indicate the amino acids that make up each mutant. "Full" refers to the full-length mutant containing SEQ ID NO: 12. "Truncation 1" refers to truncated mutant 1 containing SEQ ID NO: 39. "Truncation 2" refers to truncated mutant 2 containing SEQ ID NO: 13. "Truncation 3" refers to truncated mutant 3 containing SEQ ID NO: 40. "Truncation 4" refers to truncated mutant 4 containing SEQ ID NO: 41. A comparison of the expression of these CD8 hinge mutants is shown in Figure 9B. Specifically, primary human CD4+ T cells were activated with Dynabeads tagged with anti-CD3 / anti-CD28, and then transduced with two lentiviral constructs: one expressing a hinged-truncation mutant receptor, and the other expressing a BFP transcription reporter + anti-alkali dephosphate, placenta-like 2 (ALPPL2)CAR. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. The five figures on the left of Figure 9B show the relative expression levels of each receptor (y-axis) measured by anti-myc tag staining versus the expression levels of the reporter construct (x-axis) measured by GFP. The far right figure of Figure 9B shows the quantification of MFI of CD8 hinged mutant receptor expression in double-positive cells. Figure 9C shows five figures from left to right representing the full mutant and truncated mutants 1-4. In each mutant, T cells expressing the anti-CD19 receptor were co-cultured either without additives (top figure) or with ALPPL2+K562 cells (second figure from the top), CD19+K562 cells (third figure from the top), or ALPPL2+CD19+ cells (bottom figure). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences).

[0030] [Figure 10]Figure 10 schematically summarizes the results of experiments conducted to test hinge-notch mutants with various binding domains and their dependence on proteolytic activity. Primary human CD4+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs: one expressing a hinge receptor with a specified binding head truncated mutant receptor, and the other expressing a transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. For the test, 1 × 10⁵ double-positive T cells expressing the receptor were co-cultured with 1 × 10⁵ K562 cells (top figure), 1 × 10⁵ ligand + K562 cells (second figure from the top), 1 × 10⁵ ligand + K562 cells containing an ADAM10 inhibitor (third figure from the top), and 1 × 10⁵ ligand + K562 cells containing the γ secretion enzyme inhibitor DAPT (bottom figure). Subsequently, Fortessa X-50 (BD Biosciences) was measured using the transcriptional activity of the induced BFP reporter gene.

[0031] [Figure 11]Figures 11A-11C schematically summarize the results of experiments conducted to test hinge-notch mutants possessing various binding domains and notch 2 STS domains. Primary CD4+ human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs, one expressing a specified binding head hinge-notch receptor and the other expressing a transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further proliferated for activation testing. For testing, 1 × 10⁵ double-positive T cells expressing the receptor were co-cultured for 2 days either without additives (top figure) or with 1 × 10⁵ K562 cells (middle figure) or 1 × 10⁵ BCMA+ K562 cells (bottom figure) (Figure 11A). In Figure 11A, the left figure represents the construct with an anti-BCMA scFv binding head, the center figure represents the construct with an anti-BCMA fully humanized VH binding head, and the right figure represents the construct with an anti-BCMA fully humanized VH binding head (Hinge 5) that has a hinge domain optimized for the binding domain. SIRPα binding heads were tested similarly. 1 × 10⁵ double-positive T cells expressing the receptor were co-cultured for 2 days either without additives (upper figure) or with 1 × 10⁵ K562 cells (lower figure) (Figure 11B). In Figure 11C, various scFvs against the HER2 antigen were tested and compared using the same method. 1 × 10⁵ double-positive T cells expressing the receptor were co-cultured for 2 days either without additives (top figure) or with adherent HEK293 T cells (second figure from the top), adherent MBMDA-468 cells (third figure from the top), adherent MCF7 cells (fourth figure from the top), and adherent SKBR3 cells (bottom figure) (Figure 11C). The figure on the left shows the anti-HER2 4D5-7 scFv binding head, and the figure on the right shows the anti-HER2 4D5-8 scFv binding head. In Figures 11A-11C, the transcriptional activity of the induced BFP reporter gene was subsequently measured using a Fortessa X-50 (BD Biosciences).

[0032] [Figure 12]Figure 12 schematically summarizes the results of experiments conducted to compare the activation of hinge-notch mutants with various promoters and STS domains. For the tests, 1 × 10⁵ double-positive T cells expressing the anti-CD19 receptor were co-cultured either without additives (top figure) or with 1 × 10⁵ ALPPL2+K562 cells (second figure from the top), 1 × 10⁵ CD19+K562 cells (third figure from the top), or 1 × 10⁵ ALPPL2+CD19+K562 cells (bottom figure). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). For comparison, activation using the original synthetic notch constructs from mouse and human was included.

[0033] [Figure 13] Figures 13A-13B schematically summarize the results of experiments on mutation analysis of the Notch 1 transmembrane domain (TMD) in the Hinge-Notch construct. Mutants containing various alanine mutations within the TMD domain of the Hinge-Notch construct were prepared. Each amino acid residue from position 301 (F) to 322 (S) within the Hinge-Notch TMD was individually mutated to alanine. Primary human CD4+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs, one expressing the TMD mutant and the other expressing a BFP transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. In Figure 13A, the left panel shows the relative expression (y-axis) of various receptors measured by anti-myc tag staining versus the expression of reporter construct markers (x-axis), while the right panel shows the quantification of MFI of receptor expression in TMD mutants within double-positive cells. In Figure 13B, T cells expressing the anti-CD19 receptor were co-cultured in a 1:1 ratio with control CD19(-) or CD19(+) K562 cells. Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). The left panel is a flowchart of the activation characteristics. The right panel shows the BFP% as a line graph.

[0034] [Figure 14] Figure 14 schematically summarizes the experimental results of mutation analysis of the transmembrane domain (TMD) and STS domains within the hinge-notch construct. In this example, four exemplary hinge-notch receptors were used, all of which contained an anti-CD19 scFv domain, a truncated CD8 hinge domain, and a Gal4VP64 domain, in addition to various TMD domains (CLSTN1 TMD or CLSTN2 TMD) and various STS domains (CLSTN1 STS, CLSTN2 STS, or Notch 1 STS). Primary human CD4+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs, one expressing a hinge receptor with a specified TMD / STS combination and the other expressing a transcription reporter with a constitutively expressed anti-ALPPL2 CAR. Cells containing both constructs were selected 5 days after primary T cell stimulation and further proliferated for activation testing. For testing, 1 × 10⁵ double-positive T cells expressing the receptor were co-cultured with 1 × 10⁵ K562 cells ("-CAR" diagram, blue) or 1 × 10⁵ CD19+K562 cells ("-CAR" diagram, red). Similarly, 1 × 10⁵ double-positive T cells expressing the receptor were tested in the presence of CAR activity by co-culture with 1 × 10⁵ ALPPL2+K562 cells ("+CAR" diagram, blue) or 1 × 10⁵ ALPPL2+CD19+K562 cells ("+CAR" diagram, red). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences).

[0035] [Figure 15]Figures 15A-15B schematically summarize the results of experiments on controllable ligand-dependent proliferation of T cells using hinge-notch controlled expression of artificial cytokines. Figure 15A is a diagram of T cells manipulated with a hinge-notch STS mutant to provide ligand-induced secretion of artificial cytokines for autocrine and paracrine proliferation of T cells. Figure 15B shows the expression characteristics of the anti-CD19 hinge-notch receptor with specified STS modification. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs, one expressing a CAR against the MCAM antigen and the other expressing the hinge-notch receptor via induced super IL2 under Gal4-UAS control. Cells containing both constructs were selected 5 days after primary T cell stimulation and further proliferated for activation testing. Receptor expression was determined by anti-myc tag staining (Y axis).

[0036] [Figure 16] Figure 16 schematically summarizes the results of experiments conducted to demonstrate that ligand-induced expression of super IL2 improves the cell viability of CAR-T cells. 1 × 10⁵ double-positive T cells expressing the anti-CD19 hinge-notch notch STS receptor were co-cultured in IL-2-free medium, K562-free medium (upper left figure), or medium containing CD19+K562 cells (upper right figure) to induce hinge-notch; or in medium containing MCAM+K562 cells (lower left figure) to induce CAR activation; or in medium containing MCAM+ and CD19+K562 cells (lower right figure) to induce activation of both receptors. After 9 days, the percentage of viable T cells was evaluated by forward and side scattering measurements using a Fortessa X-50.

[0037] [Figure 17]Figure 17 provides a schematic summary of the results of experiments conducted to demonstrate regulated T cell proliferation using hinge-notch STS mutants. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs, one expressing a CAR against the MCAM antigen and the other expressing a hinge-notch receptor with induced super IL2 under Gal4-UAS control (four figures on the right). Hinge-notch receptors, including three different STS mutants (NRG1, Notch 1, Notch 2), were tested against non-hinge-notch control. Similarly, primary human T cells were generated without CAR expression (figure on the left). The T cells were stained with CellTrace Violet according to the manufacturer's instructions and co-cultured with CD19+K562 target cells in IL-2-free medium. Proliferation was evaluated by the decay of the CTV signal measured using Fortessa X-50 at specified time points.

[0038] [Figure 18] Figures 18A-18B schematically summarize the results of experiments conducted to demonstrate the controllable secretion of super IL-2 using hinge-notch STS mutants. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with the hinge-notch receptor, a lentiviral construct containing inducible super IL-2, under Gal4-UAS control (Figure 18A). Hinge-notch receptors containing three different STS mutants (NRG1, Notch 1, Notch 2) were tested against non-hinge-notch control. T cells were co-cultured with MCAM+CD19+K562 cells in IL-2-free medium, and IL-2 in the supernatant was measured at specified time points using an Instant ELISA Kit equipped with a microplate reader, according to the manufacturer's instructions. The red dotted line indicates the standard concentration of IL-2 used in T cell culture. Stepwise secretion of super IL2 was achieved by activation of the hinge-notch receptor regulated by STS. In Figure 18B, primary human T cells were generated using a further lentiviral vector expressing CAR against MCAM.

[0039] [Figure 19] Figure 19 provides a schematic summary of the results of experiments conducted to demonstrate that the regulated secretion of super IL2 by hinge-notch STS mutants promotes bystander T cell proliferation. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with lentiviral constructs containing hinge-notch receptors with induced super IL2 under Gal4-UAS control (right-hand panel). Hinge-notch receptors containing three different STS mutants (NRG1, Notch 1, Notch 2) were tested against non-hinge-notch control. Hinge-notch T cells were cultured with "bystander" T cells stained with CellTrace Far Red expressing CAR against MCAM (left-hand panel), or without CAR (right-hand panel). T cells were co-cultured with MCAM+CD19+K562 cells in IL-2-free culture medium, and bystander T cell proliferation was evaluated by measuring signal attenuation using Fortessa X-50.

[0040] [Figure 20] Figure 20 schematically summarizes the results of experiments conducted to test a single lentiviral vector construct containing the hinge-notch receptor CAR circuit. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an induced anti-MCAM CAR cassette under Gal4-UAS control. Cells were selected for hinge-notch receptor expression via myc tag 5 days after primary T cell stimulation and further proliferated for activation testing. Three STS mutants were tested as instructed using constitutively expressed CAR as a control. For testing, 1 × 10⁵ T cells expressing the anti-CD19 receptor were co-cultured either without additives (top panel) or with 5 × 10⁵ K562 cells (middle panel) or 5 × 10⁴ CD19+ K562 cells (bottom panel). Next, the transcriptional activity of induced CARs was measured using GFP tagging with Fortessa X-50.

[0041] [Figure 21] Figure 21 schematically summarizes the results of an experiment conducted to demonstrate the killing of specific dual antigen target cells by T cells manipulated with a single lenti vector containing the hinge-notch CAR circuit. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an induced anti-MCAM CAR cassette under Gal4-UAS control. Cells were selected for hinge-notch receptor expression via myc tag 5 days after primary T cell stimulation and further proliferated for activation testing. Three STS mutants were tested as instructed using constitutively expressed CAR as a control. For testing, 1 × 10⁵ T cells expressing the anti-CD19 receptor were co-cultured with 5 × 10⁵ MCAM+K562 cells or 5 × 10⁴ MCAM+CD19+K562 cells. Target cell death was evaluated using forward / side scattering in a K562 population with Fortessa X-50.

[0042] [Figure 22]Figure 22 schematically summarizes the results of experiments conducted to test a single lentiviral vector construct containing the hinge-notch receptor for the control of T cell activation and depletion. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an induced anti-MCAM CAR cassette under the control of Gal4-UAS. Cells were selected for hinge-notch receptor expression via myc tag 5 days after primary T cell stimulation and further proliferated for activation testing. Three STS mutants were tested as instructed using a constitutively expressed CAR as a control. For testing, 1 × 10⁵ T cells expressing the anti-CD19 receptor were co-cultured with 5 × 10⁴ CD19+K562 cells. Subsequently, the transcriptional activity of the induced CAR was measured by GFP tagging using Fortessa X-50 (leftmost figure). T cell activation and depletion were measured by the expression of CD25 (second figure from the left) and CD39 (third and fourth figures from the left), respectively.

[0043] [Figure 23]Figure 23 schematically summarizes the results of experiments conducted on the hinge-notch versus CAR circuit in vitro. For unilateral tumors, 1 × 10⁶ K562-BCMA / CD19 tumor cells were subcutaneously transplanted into the left flank of NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ(NSG) mice. For contralateral tumors, 1 × 10⁶ K562-BCMA / CD19 tumor cells were transplanted into the left flank of NSG mice, and 1 × 10⁶ K562-CD19 tumor cells were transplanted into the right flank. Four days after tumor transplantation, 2.5 × 10⁶ manipulated primary human CD4+ cells and CD8+ T cells (a total of 5 × 10⁶ T cells) were intravenously injected via tail vein injection. Tumor size was monitored with calipers 2-3 times a week, and the mouse was considered to have reached its endpoint when the tumor size exceeded 20 mm. For immunophenotypic analysis, tumors and spleens were harvested 10 days after T-cell transplantation. The tumors were manually dissected and digested in RPMI-1640 containing 4 mg / mL collagenase IV and 0.1 mg / mL DNase I at 37°C for 30 minutes. The spleens were manually dissected and subjected to erythrolysis. Anti-CD45, anti-CD3, anti-CD4, and anti-CD8 antibodies were used. Dead cells were removed using Draq7. Samples were analyzed using FACSymphony X50 SORP, and data were analyzed using FlowJo software. [Modes for carrying out the invention]

[0044] This disclosure relates in general to a novel class of oligomerizable chimeric polypeptide receptors, particularly novel ones, that have been engineered to modulate transcriptional regulation in a ligand-dependent manner. In particular, the novel receptors (referred to as "hinge-notch"), despite being derived from Notch, do not require the Notch NEC subunit, especially the NRR, which has previously been considered essential for receptor functionation. This novel class of receptors is synthetic and recombinant and does not exist in nature. As described below, the chimeric polypeptides disclosed herein may be synthetic polypeptides or may be engineered, designed, or modified to obtain desired properties and / or enhanced properties, such as transcriptional regulation. The fact that the novel hinge-notch receptors disclosed herein are not only functional but also exhibit enhanced bioactivity is surprising and completely contrary to the teachings in the art. Furthermore, the novel chimeric receptors described herein incorporate extracellular oligomerization domains to facilitate the formation of oligomeric forms, such as dimeric or trimer forms of the chimeric receptor. This design is thought to promote oligomerization / clustering of the extracellular domain (ECD), followed by fusion with the intracellular domain (ICD), thereby activating cellular signaling, such as T cell signaling. Depending on the embodiment, the receptors disclosed herein bind to a target cell surface ligand, thereby inducing proteolytic cleavage of the chimeric receptor and releasing transcription regulators that modulate specific intracellular transcription programs. The disclosure also provides such receptors, nucleic acids encoding them, host cells genetically modified with these nucleic acids, and compositions and methods useful for modulating cell activity and / or treating various health conditions, such as diseases (e.g., cancer).

[0045] The following detailed description refers to the accompanying drawings, which form part of this specification. Similar symbols in the drawings generally identify similar components unless otherwise indicated in the context. The various exemplary alternatives described in the detailed description, drawings, and claims are not intended to be limiting. Other alternatives may be used to make further modifications without departing from the spirit or scope of the subject matter presented herein. Naturally, aspects generally described herein and shown in the drawings may be adjusted, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly considered to constitute parts of this application. definition

[0046] The singular forms "a," "an," and "the" include plural references unless explicitly indicated otherwise in the context. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all options: "A," "B," "A or B," and "A and B."

[0047] As used herein, the terms “administration” and “administering” refer to the delivery of any composition or formulation disclosed herein by route of administration, including, but not limited to, intravenous, intra-arterial, intracranial, intramuscular, intraperitoneal, subcutaneous, intramuscular, or a combination thereof. This term includes, but not limited to, administration by a healthcare professional and self-administration.

[0048] "Cancer" refers to the presence of cells that possess characteristics typical of cancer-causing cells, such as uncontrolled growth, immortality, metastatic ability, rapid growth and proliferation rates, and certain characteristic morphological properties. Depending on the type of cancer cells, they may aggregate into masses such as tumors, while other cancer cells may exist individually within a subject. Tumors may be solid tumors, soft tissue tumors, or metastatic lesions. As used herein, the term "cancer" also encompasses cancers that are not other types of tumors. Non-limiting examples include hematological malignancies or cancers such as leukemia, lymphoma, and myeloma. Cancer may include pre-malignant cancers as well as malignant cancers.

[0049] The terms “host cell” and “recombinant cell” are used interchangeably herein. Naturally, these terms, like “cell,” “cell culture,” and “cell line,” refer not only to a specific target cell or cell line, but also to the offspring or potential offspring of that cell or cell line, regardless of the number of times it has been transplanted or passaged in culture. Naturally, not all offspring will be exactly identical to the parent cell. This is because certain modifications may occur in subsequent generations due to either mutation (e.g., intentional or unintentional mutation) or environmental influences (e.g., methylation or other epigenetic modifications), and offspring may not actually be identical to the parent cell, but as long as these offspring retain the same function as the original cell or cell line, they remain within the scope of the terminology used herein.

[0050] As used herein, the term "operably linked" refers to a physical or functional linkage between two or more elements, such as polypeptide sequences or polynucleotide sequences, that enables them to operate in the intended manner.

[0051] As used herein in the context of two or more nucleic acids or proteins, the term “percentage of identity” refers to two or more sequences or subsequences that are identical when measured by the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection, or to two or more sequences or subsequences that have a specific ratio of identical nucleotides or amino acids (e.g., approximately 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity, or higher, when compared and aligned to the greatest match across a comparison window or designated region). See, for example, the NCBI website at ncbi.nlm.nih.gov / BLAST. Such sequences are thus referred to as “substantially identical.” This definition also refers to, or can be fitted to, the complement of a sequence. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions. Sequence identity may be calculated over a region of at least approximately 20 amino acids or nucleotides in length, or over a region of 10 to 100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using publicly available techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, and FASTA (Atschul et al., J Mol Biol 215:403, 1990). Sequence identity can also be measured using sequence analysis software such as the Sequence Analysis Software Package from the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), using its default parameters.

[0052] As used herein, and unless otherwise specified, the “therapeutic dose” of a drug is the amount sufficient to provide a therapeutic benefit in the treatment or management of a health condition, such as a disease (e.g., cancer), or to delay or minimize one or more symptoms associated with the disease. The therapeutic dose of a compound means the amount of the drug, alone or in combination with other therapeutic agents, that provides a therapeutic benefit in the treatment or management of a disease. The term “therapeutic dose” may include the amount that improves the overall treatment of a disease, reduces or avoids the symptoms or causes of a disease, or enhances the therapeutic effect of other therapeutic agents. An example of an “effective dose” is the amount sufficient to contribute to the treatment, prevention, or reduction of the symptoms of a disease, which may also be called the “therapeutic dose.” “Reduction” of symptoms means reducing the severity or frequency of symptoms, or eliminating symptoms. The precise amount of a composition containing the "therapeutic dose" can be determined by methods known to those skilled in the art, depending on the therapeutic purpose (see Lieberman, "Pharmaceutical Dosage Forms" (vols. 1-3, 2010); Lloyd, "The Art, Science and Technology of Pharmaceutical Compounding" (2016); Pickar, "Dosage Calculations" (2012); and Remington, "The Science and Practice of Pharmacy," 22nd Edition, 2012, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0053] As used herein, “subject” or “individual” includes humans (e.g., human individuals) and animals such as non-human animals. Depending on the embodiment, “subject” or “individual” is a patient receiving medical treatment from a physician. Thus, a subject may be a human patient or individual who has, is at risk of having, or is suspected of having, a disease of interest (e.g., cancer) and / or one or more symptoms of that disease. The subject may also be an individual diagnosed at the time of diagnosis or thereafter as being at risk of having the symptoms of interest. The term “non-human animal” includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, and non-mammals, e.g., non-human primates, e.g., sheep, dogs, cattle, chickens, amphibians, reptiles, etc.

[0054] Where a range of numbers is presented, naturally, unless the context clearly indicates otherwise, the numbers between the upper and lower limits of that range, up to one-tenth of the lower limit unit, and any numbers within or between the presented range are included in this disclosure. The upper and lower limits of these smaller ranges may be independently included within these smaller ranges and are also included in this disclosure, subject to the exclusion of any specific limit values ​​within the presented range. Where the presented range includes one or both limit values, the range excluding one or both of those limit values ​​is also included in this disclosure.

[0055] The entire scope of the disclosure herein also encompasses any and all possible sub-scopes and combinations thereof. Any listed scope can be understood to be fully interpreted and possible to be decomposed into at least equally equal parts of 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 10, etc. As a non-limiting example, each scope considered herein can be readily decomposed into a lower 1 / 3, a middle 1 / 3, an upper 1 / 3, etc. Also, as will be apparent to those skilled in the art, all terms such as “up to,” “at least,” “greater than,” and “less than” refer to a scope that includes the stated numerical value and can subsequently be decomposed into the sub-scopes described above. Finally, as will be apparent to those skilled in the art, a scope includes individual elements. Thus, for example, a group having 1 to 3 items refers to a group having 1, 2, or 3 items. Similarly, for example, a group having 1 to 5 items refers to a group having 1, 2, 3, 4, or 5 items.

[0056] For clarity, certain features of the Disclosure described in the context of separate embodiments may also be provided in combination of a single embodiment. Conversely, for brevity, various features of the Disclosure described in the context of a single embodiment may also be provided separately or in any suitable partial combination. All combinations of embodiments relating to the Disclosure are expressly encompassed by the Disclosure, and each and all combinations are disclosed herein as if they were individually and expressly disclosed. Furthermore, all partial combinations of various embodiments and their elements are also expressly encompassed by the Disclosure, and each and all such partial combinations are disclosed herein as if they were individually and expressly disclosed herein. Notch receptor

[0057] The Notch receptor is a transmembrane protein that transmits signals correctly when it binds to a surface-bound ligand expressed in an adjacent cell. Notch signaling is dependent on cell-cell contact. The evolutionary divergence between vertebrates and invertebrates involves at least two gene duplications related to the Notch receptor; flies possess a single Notch gene, helminths possess two genes (GLP-1 and LIN-12), and mammals possess four genes (Notch 1-4). Transduction of Notch signaling depends on three key events: (i) ligand recognition, (ii) structural exposure of ligand-dependent cleavage sites, and (iii) assembly of the nuclear transcription activation complex.

[0058] The normal Notch signal is transduced by a process called controlled intramembrane proteolysis. The Notch receptor is normally maintained in a proteolytically resistant structure on the cell surface, but ligand binding initiates a proteolytic step that releases the intracellular portion of the receptor (also known as the intracellular notch (ICN) or Notch intracellular domain (NICD)) from the membrane. The crucial and controlled cleavage step is mediated by ADAM metalloproteinase and occurs at a site called S2, just outside the plasma membrane. This truncated receptor remains tethered to the membrane until it is processed at the S3 site by a multiprotein enzyme complex called γ-secreting enzyme, known as NEXT (Notch extracellular truncation).

[0059] Following γ-secretion enzyme-mediated cleavage, the ICN ultimately enters the nucleus, where it assembles a transcriptional activation complex containing a DNA-binding transcription factor called CSL (known as RBP-J C in mammals / a glabrous suppressor in Drosophila melanogaster / or lag 1 in Nematodes) and transcriptional coactivators of the mastermind / lag 3 family. This complex then engages with further coactivating proteins such as p300 to mobilize the basal transcription mechanism and activate the expression of downstream target genes.

[0060] The Notch receptor has a modular domain structure. The Notch extracellular subunit (NEC) of the Notch receptor consists of a series of N-terminal epidermal growth factor receptor (EGFR)-like repeats responsible for ligand binding. O-linked glycosylation of these EGFR repeats, including modifications by O-fucose, fringe, and lumi glycosyltransferases, also modulates Notch receptor activity in response to various ligand subtypes in flies and mammals.

[0061] EGFR repeats have three LIN-12-Notch repeats (LNRs) specific to the Notch receptor. L IN-12 / N otch r The epeat) module follows, and these repeats have been widely reported to be involved in preventing the activation of immature receptors. Notch 1 heterodimerization (HD: h etero d The imerization domain is cleaved by Furin cleavage, resulting in its N-terminal region becoming the terminus of the Notch extracellular (NEC) subunit and its C-terminal half forming the initiation of the Notch transmembrane (NTM) subunit. Following the extracellular HD-C region of the NEC is the transmembrane compartment and the intracellular region (ICN) containing transcription factors. Further information on the Notch receptor and Notch-mediated cell signaling can be found, for example, in WR Gordon et al., Dev Cell (2015) 33:729-36 and WR Gordon et al., J. Cell Sci. (2008) 121:3109-19, both of which are incorporated herein by reference. Composition of the present disclosure

[0062] As will be described in more detail below, the Disclosure provides a novel class of oligomerizable chimeric polypeptide receptors engineered to modulate transcriptional regulation in a ligand-dependent manner, offering various advantages over existing synthetic Notch receptors. For example, since the native Notch receptor, comprising an NEC subunit containing dozens of serially arranged EGFR-like repeats, is large even excluding the Notch regulatory region or the entire NEC subunit, the polynucleotide encoding the receptor of the Disclosure may be smaller than that encoding the native Notch receptor and existing synthetic Notch, thereby allowing the use of vectors with more limited capacity or the inclusion of further elements that might be excluded due to size constraints related to vector capacity.

[0063] Those skilled in the art will see that the chimeric polypeptide receptors disclosed herein promote amplified activation under specific cellular and environmental conditions. This type of feedback regarding receptor activity represents a novel capability that can be utilized to enhance and modulate the production of therapeutically effective levels by artificial cells. Furthermore, as will be described in more detail below, several receptor variants disclosed herein can be introduced with greater efficiency and expressed at higher levels on the cell surface of human primary T cells, making them easier to express than existing synthetic Notch receptors.

[0064] As will be further described in more detail below, certain chimeric polypeptide receptors disclosed herein have superior activity to existing synthetic Notch receptors, for example, because the desired transcription output is determined by the level of ligand-induced signaling. For example, hinge-notch and truncated hinge-notch receptors provide a higher ratio of ligand-induced signaling than the corresponding synthetic Notch receptor, and a lower ratio of signaling when not ligand-induced. Furthermore, certain chimeric polypeptide receptors disclosed herein provide a more modularized platform for further manipulation of Notch receptors. This modularized platform allows for customization of the receptor's activation properties by enabling the easy exchange of distinctly functional domains with, for example, corresponding domains of other species. As will be further described in the examples below, certain hinge-notch receptors and truncated hinge-notch receptors provided herein, in addition to being smaller and better expressed than existing synthetic Notch receptors, may be customized to a much wider extent, with all elements of the receptor's extracellular, transmembrane, and intracellular domains available for customization. For example, testing of the various CD8 hinge-notch receptors described herein demonstrated the possibility of various extracellular domains. In stark contrast, similar processes applied to existing synthetic notch 1 regulatory domains result in either loss of expression or loss of switch-like function.

[0065] Without being bound by any particular theory, the hinge-notch receptor described herein is thought to potentially provide higher levels of ligand-induced signaling compared to either the mouse or human form of synthetic Notch 1. Furthermore, the hinge-notch receptor described herein is thought to potentially provide lower levels of signaling (e.g., lower noise signaling) in the absence of ligand compared to the mouse form of synthetic Notch 1. For example, while existing synthetic Notch receptors can be manipulated with ligand-binding domains such as scFv and nanobodies, it has been difficult to utilize the innate extracellular domains from the receptor / ligand on the surface of synthetic Notch receptors. In contrast, the second-generation Notch receptor provided herein is suitable for the use of other types of ligand-binding domains, e.g., non-scFv binding domains, thus expanding the range of targetable diseases and tissues. For example, the experiments shown in the following Examples paragraph demonstrate the ability to use eGFP as the ligand-binding domain, thereby enabling the binding of the anti-GFP nanobodies LaG17 expressed on the surface of target cells. In contrast, existing synthetic Notch receptors, such as synthetic Notch 1 in mice and humans, were not compatible with eGFP as a ligand-binding domain.

[0066] As illustrated in the examples, specific chimeric polypeptide receptors have been tested and validated in primary human T cells. These novel receptors are expected to exhibit similar performance in mouse models. The receptors disclosed herein may be incorporated into various immune cell types to improve tumor identification and elimination, or into artificial cells for autoimmune control and tissue regeneration. Accordingly, artificial cells, such as immune cells engineered to express one or more of the chimeric receptors disclosed herein, are also within the scope of this disclosure. Chimeric polypeptide

[0067] As outlined above, some embodiments of this disclosure relate to novel, non-naturally occurring chimeric polypeptides engineered to modulate transcriptional regulation in a ligand-dependent manner. In particular, the novel receptors, despite being Notch-derived, do not require the Notch regulatory region (NRR) previously considered essential for receptor function. Furthermore, the novel artificial receptors described herein incorporate an extracellular oligomerization domain (e.g., a hinge domain) to facilitate oligomerization for higher-order oligomeric forms of the chimeric receptor, such as dimeric or trimer forms. In some embodiments, the hinge domain contains a polypeptide motif capable of promoting oligomerization of the chimeric polypeptide via intermolecular disulfide bonds. The extracellular oligomerization domain may substitute for part or all of the Notch extracellular domain. In some embodiments, the receptors disclosed herein bind to a target cell surface ligand, which induces proteolytic cleavage of the receptor and the release of transcriptional regulators that modulate specific intracellular transcriptional programs.

[0068] Depending on the embodiment, a chimeric polypeptide is provided herein, which has an extracellular ligand-binding domain (ECD) having binding affinity to a selected ligand from the N-terminus to the C-terminus (a). e xtra c ellular ligand-binding d (b) a hinge domain capable of promoting oligomer formation of chimeric polypeptides via intermolecular disulfide bonds; (c) a transmembrane domain (TMD) containing one or more ligand-induced proteolytic cleavage sites. t rans m embrane d (d) intracellular domains containing transcription regulators (ICD: i ntra c ellular dThe selected ligand contains a o-main, and when this ligand binds to the ECD, it induces cleavage at the ligand-induced proteolytic cleavage site between the transcription regulator and the hinge domain, and this chimeric polypeptide does not contain the LIN-12-Notch repeat (LNR) and / or the heterodimerization domain (HD) of the Notch receptor. Extracellular domain (ECD)

[0069] In some embodiments, the ECD of a chimeric polypeptide receptor (e.g., a hinge-notch receptor) disclosed herein has binding affinity to one or more target ligands. These target ligands are expressed on the cell surface or otherwise immobilized, immobilized, or constrained to exert mechanical force on the chimeric receptor. Thus, without being bound by any particular theory, the binding of the ECD of a chimeric receptor provided herein to a cell surface ligand does not necessarily require the removal of the target ligand from the target cell surface, but instead exerts mechanical tensile force on the chimeric receptor. Alternatively, for example, a soluble ligand may be targeted if the ligand is bound to a surface or a molecule in the extracellular matrix. In some embodiments, the target ligand is a cell surface ligand. Non-limiting examples of suitable ligand species include cell surface receptors, adhesive proteins, surface-bound carbohydrates, lipids, glycolipids, lipoproteins, and lipopolysaccharides, integrins, mucins, and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0070] In some embodiments, the ligand is a differentiation cluster (CD) marker. In some embodiments, the CD marker is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80(B7.1), CD86(B7.2), CD94, CD95, CD134, The group selected consists of CD140(pdgfr4), CD152, CD154, CD158, CD178, CD181(CXCR1), CD182(CXCR2), CD183(CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273(PD-L2), CD274(PD-L1), CD276(B7H3), CD279, CD295, CD339(JAG1), CD340(HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, and MAGE.

[0071] In some embodiments, the extracellular domain includes a ligand-binding moiety of the receptor. In some embodiments, the extracellular domain includes an antigen-binding moiety that binds to one or more target antigens. In some embodiments, the antigen-binding moiety includes one or more antigen-binding determinants of the antibody or a functional antigen-binding fragment thereof. Those skilled in the art will readily understand, upon reading this disclosure, that the terms “its functional fragment” or “its functional variant” refer to a molecule that has the same quantitative and / or qualitative bioactivity as the wild-type molecule from which the fragment or variant is derived. For example, a functional fragment or functional variant of an antibody retains essentially the same ability to bind to the same epitopes as the antibody from which the functional fragment or functional variant is derived. For example, an antibody having the ability to bind to an epitope of a cell surface receptor may be truncated at the N-terminus and / or C-terminus, and the retention of its epitope-binding activity may be evaluated using methods known to those skilled in the art. Depending on the embodiment, the antigen-binding site may be selected from the group consisting of antibodies, nanobodies, diabodies, triabodies, or minibodies, F(ab')2 fragments, F(ab) fragments, single-chain variable fragments (scFv), and single-domain antibodies (sdAb), or functional fragments thereof. Depending on the embodiment, the antigen-binding site may include scFv.

[0072] The antigen-binding site may contain naturally occurring amino acid sequences, or it may be manipulated, designed, or modified to provide desired and / or improved properties, such as binding affinity. Generally, the binding affinity of an antigen-binding site, such as an antibody against a target antigen (e.g., CD19 antigen), can be calculated by the Scachard method described in Frankel et al., Mol. Immunol, 16:101-06, 1979. In some embodiments, binding affinity is measured by the antigen / antibody dissociation rate. In some embodiments, binding affinity is measured by competitive radioimmunoassay. In some embodiments, binding affinity is measured by ELISA. In some embodiments, antibody affinity is measured by flow cytometry. Antibodies that "selectively bind" to an antigen (such as CD19) do not significantly bind to other antigens, but their antigen-binding sites bind to antigens with high affinity, where the equilibrium constant (KD) is, for example, 100 nM or less, 60 nM or less, 30 nM or less, 15 nM or less, or 10 nM or less, or 5 nM or less, or 1 nM or less, or 500 pM or less, or 400 pM or less, or 300 pM or less, or 200 pM or less, or 100 pM or less.

[0073] Those skilled in the art can select an ECD based on a desired location or function of a cell genetically modified to express the chimeric polypeptide or hinge-notch receptor of the Disclosure. For example, a chimeric polypeptide or mini-notch receptor having an ECD containing an antibody specific to the HER2 antigen can target cells against HER2-expressing breast cancer cells. Depending on the embodiment, the polypeptide hinge-notch receptor ECD of the Disclosure can bind to a tumor-associated antigen (TAA) or tumor-specific antigen (TSA). Those skilled in the art know that TAAs include molecules such as proteins, which are present on the surface of tumor cells and also on the surface of normal cells, i.e., a large number of normal cells, albeit at much lower concentrations than on the tumor cell surface. In contrast, TSAs generally include molecules such as proteins, which are present on the surface of tumor cells but not on normal cells.

[0074] In some cases, the antigen-binding site is specific to an epitope present in an antigen expressed by tumor cells, i.e., a tumor-associated antigen. Tumor-associated antigens may be, for example, antigens associated with breast cancer cells, B-cell lymphoma, pancreatic cancer, Hodgkin lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma, lung cancer cells, non-Hodgkin B-cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, melanoma cells, chronic lymphocytic leukemia cells, acute lymphocytic leukemia cells, neuroblastoma cells, glioma, glioblastoma, colorectal cancer cells, etc. Naturally, tumor-associated antigens may also be expressed by non-cancer cells. In some embodiments, the antigen-binding domain is specific to an epitope present in a tissue-specific antigen. In some embodiments, the antigen-binding domain is specific to an epitope present in a disease-associated antigen.

[0075] Non-limiting examples of appropriate target antigens include CD19, B7H3 (CD276), BCMA (CD269), alkaline phosphate dephosphate, placental-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal-regulating protein α (SIRPα), CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, C Examples include S-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

[0076] Depending on the embodiment, the target antigens may be CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT(CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen 125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial cell fibrous acidic protein (GFAP), coarse cystic fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan A (melanoma antigen recognized by T lymphocytes);MART-1), MyoD1, muscle-specific actin (MSA), nerve fibrils, nerve cell-specific enolase (NSE), placental alkaline dephosphate, synaptophycin, thyroglobulin, thyroid transcription factor 1, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin 1), CD125, CD147 (bazidine), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (heterodimeric IL-2 receptor subunit), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, sclerostin, SOST, TGFβ1, TNF-α, VEGF-A, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD The following proteins are selected: 38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, κ light chain, λ light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its iso-variants, TEM-8, sperm protein 17 (sp17), and mesothelin.

[0077] Further non-limiting examples of suitable antigens include PAP (prostatic acid dephosphate), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor γ alternating leading frame protein), Trp-p8, STEAP1 (prostate transmembrane epithelial antigen 1), abnormal ras protein, abnormal p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7H3), or IL-13Rα. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen-binding site of ECD is specific to reporter proteins such as GFP and eGFP. A non-limiting example of such an antigen-binding site is the LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding site of the ECD includes an anti-BCMA fully humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein α (SIRPα).

[0078] Further antigens suitable for targeting with the chimeric polypeptide receptors disclosed herein include, but are not limited to, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epidermal membrane protein (EMA), and epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial cell fibrous acidic protein (GFAP), coarse cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan A (T lymphocyte-recognized melanoma antigen; MART-1), myo D1, muscle-specific actin (MSA), nerve fibrils, nerve-specific enolase (NSE), placental alkaline dephosphate, synaptophycin, thyroglobulin, and thyroid transcription factor 1.

[0079] Further antigens suitable for targeting with the chimeric receptors disclosed herein include, but are not limited to, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin 1), CD125, CD147 (bazigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (heteromeric subunit of IL-2 receptor), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE Antigens associated with inflammatory diseases include the Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin 4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, sclerostin, SOST, TGFβ1, TNF-α, and VEGF-A.

[0080] Further antigens suitable for targeting by the chimeric polypeptides and hinge-notch receptors disclosed herein include, but are not limited to, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, κ light chain, λ light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its iso variants, TEM-8, sperm protein 17 (sp17), and mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid dephosphate enzyme), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor γ alternating leading frame protein), Trp-p8, STEAP1 (prostate transmembrane epithelial antigen 1), abnormal ras protein, abnormal p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is GPC2, CD19, Her2 / neu, CD276 (B7H3), IL-13Rα1, or IL-13Rα2. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen-binding site of ECD is specific to reporter proteins such as GFP and eGFP. A non-limiting example of such an antigen-binding site is the LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding site of the ECD includes an anti-BCMA fully humanized VH domain (FHVH).

[0081] Depending on the embodiment, antigens suitable for targeting by the chimeric polypeptides and hinge-notch receptors disclosed herein include ligands derived from pathogens. For example, the antigen may be HER2 produced by HER2-positive breast cancer cells. Depending on the embodiment, the antigen may be CD19 expressed in B-cell leukemia. Depending on the embodiment, the antigen may be EGFR expressed in glioblastoma multiforme (GBM) but not so much in healthy CNS tissue. Depending on the embodiment, the antigen may be CEA associated with cancer in adults, such as colorectal cancer.

[0082] In some embodiments, the antigen-binding site of ECD is specific to a cell surface target, and non-limiting examples of such cell surface targets include CD19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD11α, and α-integrin. In some embodiments, the chimeric polypeptides and hinge-notch receptors disclosed herein include an extracellular domain having an antigen-binding site that binds to CD19, CEA, HER2, MUC1, CD20, ALPPL2, BCMA, or EGFR. In some embodiments, the chimeric polypeptides (e.g., hinge-notch receptors) provided herein include an extracellular domain containing an antigen-binding site that binds to CD19. In some embodiments, the chimeric polypeptides (e.g., hinge-notch receptors) provided herein include an extracellular domain containing an antigen-binding site that binds to ALPPL2. In some embodiments, the chimeric polypeptides (e.g., hinge-notch receptors) provided herein include an extracellular domain containing an antigen-binding site that binds to BCMA. Depending on the embodiment, the chimeric polypeptides provided herein (e.g., hinge-notch receptors) include an extracellular domain containing an antigen-binding site that binds to Her2.

[0083] Depending on the embodiment, the chimeric polypeptides and hinge-notch receptors disclosed herein include an extracellular domain containing an antigen-binding site that binds to CD19, ALPPL2, BCMA, or Her2. Depending on the embodiment, the antigen-binding site includes an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with one or more of sequence numbers 9-11, 36-38, and 72 in the sequence listing. Depending on the embodiment, the antigen-binding site includes an amino acid sequence having at least 90% sequence identity with a sequence selected from the group consisting of sequence numbers 9-11, 36-38, and 72. Depending on the embodiment, the antigen-binding site includes an amino acid sequence having at least 95% sequence identity with a sequence selected from the group consisting of sequence numbers 9-11, 36-38, and 72. In some embodiments, the antigen-binding site includes an amino acid sequence having 100% sequence identity with one or more of SEQ ID NOs: 9-11, 36-38, and 72. In some embodiments, the antigen-binding site includes an amino acid sequence having a sequence selected from the group consisting of SEQ ID NOs: 9-11, 36-38, and 72, wherein one, two, three, four, or five amino acid residues in any one of SEQ ID NOs: 9-11, 36-38, and 72 are substituted with different amino acid residues. Hinged Domain

[0084] As outlined above, the N-terminal Notch extracellular domain of the chimeric polypeptide disclosed herein comprises an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomerization of the chimeric polypeptide via intermolecular disulfide bonds. In these examples, within the chimeric Notch receptor disclosed herein, the hinge domain generally comprises a flexible oligopeptide or polypeptide connector region positioned between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD and also provides a site for intermolecular disulfide bonds between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain contains motifs that promote dimerization of the chimeric polypeptide disclosed herein. In some embodiments, the hinge domain (e.g., a hinge domain derived from OX40) contains motifs that promote trimerization of the chimeric polypeptide disclosed herein.

[0085] A hinge polypeptide sequence suitable for the compositions and methods of this disclosure may be a naturally occurring hinge polypeptide sequence (e.g., a sequence from a naturally occurring immunoglobulin). Alternatively, the hinge polypeptide sequence may be a synthetic sequence equivalent to a naturally occurring hinge polypeptide sequence, or a completely synthetic hinge sequence, or may be manipulated, designed, or modified to provide desired and / or improved properties, such as transcriptional modulating properties. Suitable hinge polypeptide sequences include, but are not limited to, sequences derived from IgA, IgD, and IgG microunits, such as IgG1 hinge domains, IgG2 hinge domains, IgG3 hinge domains, and IgG4 hinge domains, or functional variants thereof. In some embodiments, the hinge polypeptide sequence includes one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence includes one or more CPPC motifs. Further information on this point can be found, for example, in the latest review by Vidarsson G. et al., Frontiers Immunol. October 20, 2014, which is incorporated in its entirety hereby by reference.

[0086] Accordingly, depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgG1 hinge domain or a functional variant thereof. Depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgG2 hinge domain or a functional variant thereof. Depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgG3 hinge domain or a functional variant thereof. Depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof. Depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgA hinge domain or a functional variant thereof. Depending on the embodiment, the hinge domain includes a hinge polypeptide sequence derived from an IgD hinge domain or a functional variant thereof.

[0087] Further hinge polypeptide sequences suitable for the compositions and methods disclosed herein include, but are not limited to, the CD8α hinge domain, the CD28 hinge domain, the CD152 hinge domain, the PD-1 hinge domain, the CTLA4 hinge domain, the OX40 hinge domain, the FcγRIIIα hinge domain, and hinge polypeptide sequences derived from functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the IgG4 hinge domain or a functional variant thereof.

[0088] In principle, there are no limitations on the length and / or amino acid composition of the hinge domain, as long as it is conferred with flexibility and oligomerization ability. However, those skilled in the art know that the length and amino acid composition of the hinge polypeptide sequence can be optimized to alter the orientation and / or proximity of the ECD and TMD relative to each other, and the orientation and / or proximity of the chimeric polypeptide monomers relative to each other, in order to achieve the desired activity of the chimeric polypeptide of this disclosure. Depending on the embodiment, any single-chain peptide containing about 1 to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acid residues, etc.) may be used as the hinge domain. Depending on the embodiment, the hinge domain may contain approximately 5-50, 10-60, 20-70, 30-80, 40-90, 50-100, 60-80, 70-100, 30-60, 20-80, or 30-90 amino acid residues. Depending on the embodiment, the hinge domain may contain approximately 1-10, 5-15, 10-20, 15-25, 20-40, 30-50, 40-60, or 50-70 amino acid residues. Depending on the embodiment, the hinge domain may contain approximately 40-70, 50-80, 60-80, 70-90, or 80-100 amino acid residues. Depending on the embodiment, the hinge domain contains approximately 1 to 10, 5 to 15, 10 to 20, or 15 to 25 amino acid residues. Depending on the embodiment, the hinge domain contains a sequence having at least 80% sequence identity with respect to a sequence selected from the group consisting of SEQ ID NOs. 12 to 16 and 39 to 42 in the sequence listing, for example, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity. Depending on the embodiment, the hinge domain contains an amino acid sequence having at least 90% sequence identity with respect to a sequence selected from the group consisting of SEQ ID NOs. 12 to 16 and 39 to 42.In some embodiments, the hinge domain includes an amino acid sequence having at least 95% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 12-16 and 39-42. In some embodiments, the hinge domain includes an amino acid sequence having approximately 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 12-16 and 39-42. In some embodiments, the hinge domain includes an amino acid sequence having a sequence selected from the group consisting of SEQ ID NOs: 12-16 and 39-42, wherein one, two, three, four, or five amino acid residues in any one of SEQ ID NOs: 12-16 and 39-42 are substituted with different amino acid residues. Transmembrane domain (TMD)

[0089] As outlined above, the chimeric polypeptides of this disclosure comprise a transmembrane domain containing one or more ligand-induced proteolytic cleavage sites.

[0090] Examples of proteolytic cleavage sites within Notch receptors (e.g., S2 or S3) are as described above. Further proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloprotease cleavage sites for MMPs selected from collagenases 1, 2, and 3 (MMP-1, 8, and 13), gelatinases A and B (MMP-2 and 9), stromelysin 1, 2, and 3 (MMP-3, 10, and 11), matrilysin (MMP-7), and membrane metalloproteases (MT1-MMP and MT2-MMP). For example, MMP-9 cleavage sequences include Pro-XX-Hy (wherein X is any residue; Hy represents a hydrophobic residue such as Leu, Ile, Val, Phe, Trp, Tyr, Val, Met, and Pro) (SEQ ID NO: 64), for example Pro-XX-Hy-(Ser / Thr) (SEQ ID NO: 65), for example Pro-Leu / Gln-Gly-Met-Thr-Ser (SEQ ID NO: 66), or Pro-Leu / Gln-Gly-Met-Thr (SEQ ID NO: 67). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase-type plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of uPA and tPA cleavage sequences include sequences containing Val-Gly-Arg (SEQ ID NO: 68). Another exemplary protease cleavage site that may be included in a proteolytically cleavable linker is the tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 69), where this protease is cleaved between glutamine and serine. Another example of a protease cleavage site that may be included in a proteolytically cleavable linker is the enterokinase cleavage site, e.g., Asp-Asp-Asp-Lys (SEQ ID NO: 70), where this cleavage occurs after the lysine residue. Another example of a protease cleavage site that may be included in a proteolytically cleavable linker is the thrombin cleavage site, e.g., Leu-Val-Pro-Arg (SEQ ID NO: 71).Further preferred linkers containing protease cleavage sites include the following proteases: PreScission. TM Proteolytic enzymes (fusion protein containing human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase I (MMP-I), urokinase-type plasminogen The sequences include those cleavable by activator factor (uPA), membrane-bound matrix metalloproteinase 1 (MT-MMP), stromelysin 3 (i.e., MMP-11), thermolysin, fibroblast collagenase and stromelysin 1, matrix metalloproteinase 13 (collagenase 3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). A protease not specific to the host cell expressing the receptor (e.g., TEV) may be used as a further regulatory mechanism, in which case activation of the hinge-notch is impossible until the protease is expressed or otherwise provided. Furthermore, the protease may be tumor-associated or disease-associated (expressed significantly more highly than in normal tissue) and may function as an independent regulatory mechanism. For example, some matrix metalloproteinases are highly expressed in certain cancers.

[0091] In general, the TMDs suitable for the chimeric polypeptides and hinge-notch receptors disclosed herein may be any transmembrane domain of type 1 transmembrane receptors containing at least one γ-secreting enzyme cleavage site. A detailed description of the structure and function of the γ-secreting enzyme complex, including amyloid precursor protein (APP) and notch, and its substrate proteins can be found, for example, in the latest overview by Zhang et al., Frontiers Cell Neurosci (2014). Non-limited suitable TMDs from type 1 transmembrane receptors include TMDs from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, which contain at least one γ-secreting enzyme cleavage site. Further TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors: IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the chimeric polypeptide or Notch receptor TMD of the Disclosure is a TMD derived from a member of the calcin-thenin family, e.g., alkadein α and alkadein γ. In some embodiments, the chimeric polypeptide or Notch receptor TMD of the Disclosure is a TMD known for the Notch receptor. In some embodiments, the chimeric polypeptide or Notch receptor TMD of the Disclosure is a TMD derived from a different Notch receptor.For example, in a human Notch 1-based hinge-notch receptor, Notch 1 TMD may be replaced with Notch 2 TMD, Notch 3 TMD, Notch 4 TMD, or Notch TMD derived from non-human animals such as zebrafish, Drosophila melanogaster, African clawed frog, or chicken.

[0092] In some embodiments, the transmembrane domain includes an amino acid sequence exhibiting at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with one or more of SEQ ID NOs: 17, 77, and 78 in the sequence listing. In some embodiments, the transmembrane domain includes an amino acid sequence having at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 77, and 78. In some embodiments, the transmembrane domain includes an amino acid sequence having at least 95% sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 77, and 78. In some embodiments, the transmembrane domain includes an amino acid sequence having approximately 100% sequence identity with one or more of SEQ ID NOs: 17, 77, and 78. In some embodiments, the transmembrane domain includes an amino acid sequence having a sequence selected from the group consisting of SEQ ID NOs: 17, 77, and 78, wherein one, two, three, four, or five amino acid residues in any one of SEQ ID NOs: 17, 77, and 78 are substituted with different amino acid residues. In some embodiments, the amino acid substitutions within the TMD include one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitutions is a substitution to alanine. For example, one, two, three, four, five, or more amino acid residues in the sequence FMYVAAAAFVLLFFVGCGVLLS (SEQ ID NOs: 17) and the sequences described in SEQ ID NOs: 77 or 78 may be substituted with different amino acid residues. In some embodiments, the amino acid residues at positions 18 and / or 19 of the "GV" motif in SEQ ID NOs: 17 are substituted with different amino acid residues. In some embodiments, the glycine residue at position 18 of SEQ ID NOs: 17 is substituted with a different amino acid residue. In some embodiments, the valine residue at position 19 of SEQ ID NO: 17 is substituted with a different amino acid residue. In some embodiments, the transmembrane domain contains an amino acid sequence having a sequence corresponding to SEQ ID NO: 17 with a mutation such as the G18A mutation at the position corresponding to position 18 of SEQ ID NO: 17.Depending on the embodiment, the transmembrane domain includes an amino acid sequence having a sequence corresponding to SEQ ID NO: 17 with a mutation such as the V19A mutation at the position corresponding to position 19 of SEQ ID NO: 17. Transport stop sequence

[0093] In some embodiments, the chimeric polypeptides and hinge-notch receptors of this disclosure include a transport termination sequence (STS) constituting a highly charged domain located at the C-terminus of the TMD. Without being bound by any particular theory, such a highly charged domain positioned between the TMD and ICD prevents the ICD from entering the membrane. The STS is ligated to the TMD and ICD in the order TMD-STS-ICD, from the N-terminus to the C-terminus. In principle, there are no particular restrictions on the length and / or amino acid composition of the STS. In some embodiments, any single-chain peptide containing about 4 to about 40 amino acid residues (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid residues) may be used as the STS. Depending on the embodiment, the STS contains approximately 4-15, 6-20, 8-25, 10-30, 12-35, 14-40, 5-40, 10-35, 15-30, 20-25, 20-40, 10-30, 4-20, or 5-25 amino acid residues. Depending on the embodiment, the STS contains approximately 4-10, 5-12, 6-14, 7-18, 8-20, 9-22, 10-24, or 11-26 amino acid residues. Depending on the embodiment, the STS contains approximately 4-10 residues, for example, 4, 5, 6, 7, 8, 9, or 10 amino acid residues.

[0094] In some embodiments, the STS includes a sequence having at least 70% sequence identity, for example, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity with respect to an STS sequence derived from Notch 1, Notch 2, Notch 3, Notch 4, CLSTN1, CLSTN2, CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, or PTPRM. In some embodiments, the STS includes a sequence containing only Lys(K) or Arg(R) in its first four residues. In some embodiments, the STS includes one, two, three, four, five, or more basic residues. STS contains 5, 4, 3, 2, 1, or 0 aromatic residues, or residues having hydrophobic and / or bulky side chains.

[0095] In some embodiments, the STS includes a sequence having at least 80% sequence identity with a sequence selected from the group consisting of SEQ ID NOs. 18-19, 43-63, 79, and 80 in the sequence listing, for example, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity. In some embodiments, the STS includes an amino acid sequence having at least 90% sequence identity with a sequence selected from the group consisting of SEQ ID NOs. 18-19, 43-63, 79, and 80. In some embodiments, the STS includes an amino acid sequence having at least 95% sequence identity with a sequence selected from the group consisting of SEQ ID NOs. 18-19, 43-63, 79, and 80. In some embodiments, the STS includes an amino acid sequence having approximately 100% sequence identity with a sequence selected from the group consisting of SEQ ID NOs. 18-19, 43-63, 79, and 80. In some embodiments, the STS comprises an amino acid sequence having a sequence selected from the group consisting of SEQ ID NOs: 18-19, 43-63, 79, and 80, wherein one, two, three, four, or five amino acid residues in any one of SEQ ID NOs: 18-19, 43-63, 79, and 80 are substituted with different amino acid residues. In some embodiments, the STS includes a sequence having at least 70% sequence identity, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to an STS sequence from notch1, notch2, notch3, notch4, CLSTN1, CLSTN2, JAG2, PTPRF, LRP1B, NRG2, KCNE2, KCNE3, KCNE4, AGER, PKHD1, GHR, PTPRM, DAG1, NRG1, EPCAM, KL, PTPRK, CXCL16, or any one of the sequences listed in Tables 3 and 4. In some embodiments, the STS includes a sequence containing only Lys(K) or Arg(R) in the first four residues. In some embodiments, the STS includes one, two, three, four, five, or more basic residues.Depending on the embodiment, the STS may include 5, 4, 3, 2, 1, or 0 aromatic residues, or residues having hydrophobic and / or bulky side chains. intracellular domain

[0096] The chimeric polypeptides and hinge-notch receptors of this disclosure include transcription factors. The transcription factors of this disclosure are polypeptide elements that act to activate or inhibit the transcription of promoter-driven DNA sequences. Transcription factors suitable for the compositions and methods of this disclosure may be naturally occurring transcription factors or may be manipulated, designed, or modified to provide, for example, desired properties and / or improved properties that modulate transcription. As described above, the artificial receptors of this disclosure are effective in that they can provide the ability to induce customized transcription programs in artificial cells. Depending on the embodiment, the transcription factors of this disclosure are specific transcription factors that drive transcription from a particular sequence that appears only once in an artificial cell.

[0097] In some embodiments, the transcription factor directly regulates cell differentiation. In some embodiments, the transcription factor indirectly regulates (e.g., regulates) cell differentiation by regulating the expression of a second transcription factor. Those skilled in the art will see that the transcription factor may be a transcription activator or a transcription repressor. In some embodiments, the transcription factor is a transcription repressor. In some embodiments, the transcription factor is a transcription activator. In some embodiments, the transcription factor may further include a nuclear localization signal. In some embodiments, the transcription factor is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcription factor is Gal4-VP64.

[0098] The chimeric polypeptides and hinge-notch receptors of the present disclosure may be chimeric polypeptides of any length, including chimeric polypeptides that are generally about 100 amino acids (aa) to about 1000 aa, for example, about 100 aa to about 200 aa, about 150 aa to about 250 aa, about 200 aa to about 300 aa, about 250 aa to about 350 aa, about 300 aa to about 400 aa, about 350 aa to about 450 aa, and about 400 aa to about 500 aa. Depending on the embodiment, the chimeric polypeptides of the disclosure generally have lengths of about 400 aa to about 450 aa, about 450 aa to about 500 aa, about 500 aa to about 550 aa, about 550 aa to about 600 aa, about 600 aa to about 650 aa, about 650 aa to about 700 aa, about 700 aa to about 750 aa, about 750 aa to about 800 aa, about 800 aa to about 850 aa, about 850 aa to about 900 aa, about 900 aa to about 950 aa, or 950 aa to about 1000 aa. In some cases, the chimeric polypeptides of the disclosure have lengths of about 300 aa to about 400 aa. In some cases, the chimeric polypeptides of the disclosure have lengths of about 300 aa to about 350 aa. In some cases, the chimeric polypeptide of the Disclosure has a length of approximately 300 AA to approximately 325 AA. In some cases, the chimeric polypeptide of the Disclosure has a length of approximately 350 AA to approximately 400 AA. In some cases, the chimeric polypeptide of the Disclosure has a length of 750 AA to approximately 850 AA. Depending on the embodiment, the chimeric polypeptide of the Disclosure has a length of approximately 525 AA, approximately 538 AA, approximately 539 AA, approximately 542 AA, approximately 550 AA, approximately 556 AA, or approximately 697 AA. Further domains

[0099] Depending on the embodiment, the N-terminal notch extracellular domain of the TMD may further include additional domains, such as membrane localization signals like the CD8A signal, or detectable markers like the myc tag or his tag. It may be beneficial to incorporate additional domains at the N-terminus of the hinge domain without being bound by any particular theory, because incorporating bulky traits (such as NRR) adjacent to the TMD will affect receptor activity unless they are sufficiently far apart. It is also considered that the chimeric polypeptides and hinge-notch receptors described herein may be further manipulated to include one or more additional traits, such as signal sequences, detectable labels, tumor-specific cleavage sites, disease-specific cleavage sites, or combinations thereof. For example, certain proteolytic enzymes (such as matrix metalloproteinases) are upregulated in cancer to enable tumor-specific cleavage specificity via higher levels of specific proteolytic enzymes without involving specific cleavage sites. Further information on this point of view is provided, for example, in JS Dudani et al., Annu. Rev. Cancer Biol. (2018), 2:353-76, which is incorporated herein by reference.

[0100] Depending on the embodiment, the chimeric polypeptide or hinge-notch receptor of the present disclosure comprises (a) a hinge domain comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 12-16 and 39-42; (b) a transmembrane domain comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 17, 77, and 78; and (c) a transport termination sequence domain comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 18-19, 43-63, 79, and 80. Depending on the embodiment, the chimeric polypeptide or hinge-notch receptor of the present disclosure comprises (a) a hinge domain comprising an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 12-16 and 39-42; (b) a transmembrane domain comprising an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17, 77, and 78; and (c) a transport termination sequence domain comprising an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 18-19, 43-63, 79, and 80. Depending on the embodiment, the chimeric polypeptide or hinge-notch receptor of the present disclosure comprises (a) a hinge domain comprising an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 12-16 and 39-42; (b) a transmembrane domain comprising an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 17, 77, and 78; and (c) a transport termination sequence domain comprising an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 18-19, 43-63, 79, and 80.

[0101] Depending on the embodiment, the chimeric polypeptides of the Disclosure comprise an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to the chimeric receptors disclosed herein. Depending on the embodiment, a chimeric polypeptide is provided herein, comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to any one of SEQ ID NOs. 1-8, 24-35, and 73-76 identified in the sequence listing. Depending on the embodiment, a chimeric polypeptide comprises an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO. 1. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 2. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 3. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 4. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 5. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 6. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 7. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 8.Depending on the embodiment, the chimeric polypeptide includes an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 24. Depending on the embodiment, the chimeric polypeptide includes an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 25. Depending on the embodiment, the chimeric polypeptide includes an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 26. Depending on the embodiment, the chimeric polypeptide includes an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 27. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 28. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 29. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 30. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 31. Depending on the embodiment, the chimeric polypeptide comprises an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 32. Depending on the embodiment, the chimeric polypeptide comprises an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 33.Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 34. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 35. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 73. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 74. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 75. Depending on the embodiment, the chimeric polypeptide contains an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 76. nucleic acid molecule

[0102] In another aspect, the foregoing provides a variety of nucleic acid molecules comprising nucleotide sequences encoding the chimeric polypeptide and hinge-notch receptor of the herein disclosure, and expression vectors comprising these nucleic acid molecules operably ligated to heterogeneous nucleic acid sequences, such as regulatory sequences, that enable in vivo expression of the receptor in host cells.

[0103] The nucleic acid molecules of this disclosure may be of any length, for example, including about 1.5 Kb to about 50 Kb, about 5 Kb to about 40 Kb, about 5 Kb to about 30 Kb, about 5 Kb to about 20 Kb, or about 10 Kb to about 50 Kb, for example, about 15 Kb to 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0104] Depending on the embodiment, the foregoing provides a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric polypeptide or a hinge-notch receptor, the chimeric polypeptide or hinge-notch receptor comprising (a) an extracellular ligand-binding domain having binding affinity to a selected ligand, (b) a hinge domain capable of promoting oligomerization of the chimeric polypeptide via intermolecular disulfide bonds, (c) a transmembrane domain comprising one or more ligand-induced proteolytic cleavage sites, and (d) an intracellular domain comprising a transcription factor, wherein when the selected ligand binds to the extracellular domain, cleavage is induced at one ligand-induced proteolytic cleavage site located between the transcription factor and the hinge domain, and the chimeric polypeptide does not contain a LIN-12-notch repeat (LNR) and / or a heterodimerization domain (HD) of the notch receptor.

[0105] Depending on the embodiment, the nucleotide sequence is incorporated into an expression cassette or expression vector. Naturally, an expression cassette generally comprises a genetic construct containing a coding sequence and sufficient regulatory information to induce proper transcription and / or translation of the coding sequence in vivo and / or in vitro within a receptor cell. Generally, an expression cassette may be inserted into a vector and / or into an organism for targeting to a desired host cell. Thus, depending on the embodiment, an expression cassette of the present disclosure comprises a coding sequence of a chimeric polypeptide disclosed herein, which is operably linked to an expression regulatory element such as a promoter, and optionally to any or a combination of other nucleic acid sequences that affect the transcription or translation of the coding sequence.

[0106] In some embodiments, the nucleotide sequence is incorporated into the expression vector. As those skilled in the art will know, the term “vector” generally refers to a recombinant polynucleotide construct designed for transfer between host cells and usable for transformation purposes, such as the introduction of heterologous DNA into host cells. Thus, in some embodiments, the vector may be a replication unit such as a plasmid, phage, or cosmid into which another DNA compartment may be inserted to cause replication of the inserted compartment. In some embodiments, the expression vector may be an integration vector.

[0107] Depending on the embodiment, the expression vector may be a viral vector. As those skilled in the art will know, the term “viral vector” is generally used broadly to refer to either a nucleic acid molecule (e.g., a transport plasmid) containing a virus-derived nucleic acid element that facilitates the transport of nucleic acid molecules or their integration into the cellular genome, or a viral particle that mediates the transport of nucleic acids. Viral particles generally contain various viral components in addition to nucleic acids, and sometimes host cell components. The term “viral vector” may also refer to either a virus or viral particle capable of transporting nucleic acids into a cell, or the transported nucleic acid itself. Viral vectors and transport plasmids contain structural and / or functional genetic elements primarily derived from viruses. The term “retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements or portions thereof primarily derived from retroviruses. The term “lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements or portions thereof, including LTRs, primarily derived from lentiviruses of the retrovirus genus.

[0108] Depending on the embodiment, nucleic acid molecules encoding polypeptides comprising amino acid sequences having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to the chimeric receptors disclosed herein. Depending on the embodiment, nucleic acid molecules encoding polypeptides comprising amino acid sequences having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to any one of SEQ ID NOs. 1-8, 24-35, and 73-76 identified in the sequence listing are provided herein. Depending on the embodiment, the nucleic acid molecule encodes a polypeptide comprising amino acid sequences having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO. 1. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 2. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 3. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 4. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 5. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 6. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 7.In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 8. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 24. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 25. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 26. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 27. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 28. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 29. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 30. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 31. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 32.In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 33. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 34. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 35. In some embodiments, the nucleic acid molecule encodes a polypeptide containing an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 73. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 74. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 75. In some embodiments, the nucleic acid molecule encodes a polypeptide comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 76.

[0109] Nucleic acid sequences encoding chimeric receptors may be optimized for expression in a target host cell. For example, the GC content of the sequence may be adjusted to a given cell host mean level, calculated with reference to known genes expressed in the host cell. Methods for optimizing codon usage are known in the art. Codon usage in the coding sequences of the chimeric receptors disclosed herein can be optimized to enhance expression in host cells, with approximately 1%, 5%, 10%, 25%, 50%, 75%, or up to 100% of the codons in the coding sequence being optimized for expression in a particular host cell.

[0110] Some embodiments of the disclosure herein relate to vectors or expression cassettes comprising recombinant nucleic acid molecules encoding the chimeric receptor disclosed herein. These expression cassettes generally include a coding sequence and sufficient regulatory information to induce proper transcription and / or translation of the coding sequence in vivo and / or in vitro within a receptor cell. The expression cassettes may be inserted into vectors and / or organisms for targeting to desired host cells. The expression cassettes may be inserted into plasmids, cosmids, viruses, autonomously replicating polynucleotide molecules, or phages as linear or circular single- or double-stranded DNA or RNA polynucleotide molecules derived from any source capable of genomic integration or autonomous replication, comprising one or more nucleic acid sequences functionally linked in a manner that is operably linked.

[0111] Furthermore, vectors, plasmids, or viruses comprising one or more nucleic acid molecules encoding any chimeric receptor or hinge-notch receptor disclosed herein are provided herein. The nucleic acid molecules may be contained within a vector capable of inducing their expression in cells transformed / transduced with the vector, for example. Suitable vectors for use in eukaryotic and prokaryotic cells are known and commercially available in the art, or can be readily prepared by those skilled in the art. For example, Sambrook, J., & Russell, DW (2012). "Molecular Cloning: A Laboratory Manual (4th ed.)". Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, DW (2001). "Molecular Cloning: A Laboratory Manual (3rd ed.)". Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (collectively referred to as "Sambrook" in this specification); Ausubel, FM (1987). "Current Protocols in Molecular Biology". New York, NY: Wiley (including supplementary materials up to 2014); Bollag, DM et al. (1996). "Protein Methods". New York, NY: Wiley-Liss; Huang, L. et al. (2005). "Nonviral Vectors for Gene Therapy." San Diego: Academic Press; Kaplitt, MG et al. (1995). "Viral Vectors: Gene Therapy and Neuroscience Applications."San Diego, CA: Academic Press; Lefkovits, I. (1997). "The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques." San Diego, CA: Academic Press; Doyle, A. et al. (1998). "Cell and Tissue Culture: Laboratory Procedures in Biotechnology." New York, NY: Wiley; Mullis, KB, Ferre, F. & Gibbs, R. (1994). "PCR: The Polymerase Chain Reaction." Boston: Birkhauser Publisher; Greenfield, EA (2014). "Antibodies: A Laboratory Manual (2nd ed.)." New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SL et al. (2000). "Current Protocols in Nucleic Acid Chemistry." See Nucleic Acid Chemistry. New York, NY: Wiley, (including supplementary materials up to 2014); and Makrides, SC (2003). "Gene Transfer and Expression in Mammalian Cells." Amsterdam, NL: Elsevier Sciences BV. These disclosures are incorporated herein by reference.

[0112] DNA vectors may be introduced into eukaryotic cells by conventional transformation or gene transfer techniques. Suitable methods for transforming or transferring host cells, such as calcium phosphate gene transfer, DEAE-dextran-mediated gene transfer, gene transfer, microinjection, cationic lipid-mediated gene transfer, electroporation, transduction, scraping, shock introduction, nuclear perforation, dynamic shock, and transmission, can be found in Sambrook et al. (2012, as mentioned above) and other standard molecular biology laboratory manuals.

[0113] Examples of viral vectors that can be used in this disclosure include retroviral vectors, adenovirus vectors and adeno-associated virus vectors, lentiviral vectors, herpesviruses, Simian virus 40 (SV40), and bovine papillomavirus vectors (see, e.g., Gluzman (Ed.), "Eukaryotic Viral Vectors," CSH Laboratory Press, Cold Spring Harbor, NY). For example, the chimeric receptors disclosed herein may be produced in eukaryotic host cells such as mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many suppliers, including the United States Cell Culture System Preservation Organization (Manassas, VA). When selecting an expression system, care should be taken to ensure that the components are compatible with each other. Such a decision is possible for those skilled in the art. Furthermore, if guidance is needed in selecting an expression system, those skilled in the art may refer to P. Jones, "Vectors: Cloning Applications," John Wiley and Sons, New York, NY, 2009.

[0114] The nucleic acid molecules provided may include sequences of natural origin, or sequences that differ from naturally occurring sequences but, due to degeneracy of the genetic code, encode the same polypeptide, such as an antibody. These nucleic acid molecules may consist of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA produced by phosphoramidite-based synthesis), or combinations or modifications of nucleotides within these nucleic acid types. Furthermore, the nucleic acid molecules may be double-stranded or single-stranded (e.g., either a sense strand or an antisense strand).

[0115] Nucleic acid molecules are not limited to sequences encoding polypeptides (e.g., antibodies), but may further include some or all of non-coding sequences upstream or downstream of coding sequences (e.g., coding sequences for chimeric receptors). Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. These nucleic acid molecules may be generated, for example, by treatment with restriction endonucleases of genomic DNA or by performing polymerase chain reactions (PCR). If the nucleic acid molecule is ribonucleic acid (RNA), the molecule may be generated, for example, by in vitro transcription. Recombinant cells and cell cultures

[0116] The nucleic acids of this disclosure may be introduced into host cells, such as human T lymphocytes, to generate recombinant cells containing nucleic acid molecules. Accordingly, some embodiments of this disclosure relate to a method for generating recombinant cells, the method comprising (a) providing cells capable of protein expression, and (b) contacting the provided cells with the recombinant nucleic acids of this disclosure.

[0117] The introduction of nucleic acid molecules into cells according to this disclosure may be achieved by methods known to those skilled in the art, such as viral transmission, gene transfer, conjugation, plasmofusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated gene transfer, DEAE-dextran-mediated gene transfer, liposome-mediated gene transfer, particle gun technology, calcium phosphate precipitation, direct microinjection, and nanoparticle-mediated nucleic acid delivery.

[0118] Therefore, depending on the embodiment, nucleic acid molecules may be delivered by viruses or non-viral delivery media known in the art. For example, nucleic acid molecules may be stably incorporated into the host genome, replicated episomalally, or present in recombinant host cells as small circular expression vectors for transient expression. Therefore, depending on the embodiment, nucleic acid molecules are maintained and replicated within recombinant host cells as episomal units. Depending on the embodiment, nucleic acid molecules are stably incorporated into the genome of recombinant cells. Stable integration may be achieved using classical random genome recombination techniques, or guide RNA-guided CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing by NgAgo (Natronobacterium gregoryi Argonaute), or TALEN (transcriptional activator-like effector nucleases). t ranscription a ctivator- l ike e ffector n This may be achieved using more precise techniques such as genome editing. In some embodiments, the nucleic acid molecule is present in recombinant host cells as a small circular expression vector for transient expression.

[0119] Nucleic acid molecules may be encapsulated in viral capsids or lipid nanoparticles, or delivered by known viral or nonviral delivery means and methods in the art, such as electroporation. For example, the introduction of nucleic acids into cells may be achieved by viral transduction. In non-limiting examples, adeno-associated viruses (AAVs) are engineered to deliver nucleic acids to target cells by viral transduction. Several AAV serotypes have been described, but all known serotypes can transmit cells from multiple diverse tissue types. AAVs can transduce a wide range of species and tissues in vivo without showing signs of toxicity, thereby producing relatively mild innate and adaptive immune responses.

[0120] Lentiviral vector systems are also useful for nucleic acid delivery and gene therapy via viral transduction. Lentiviral vectors offer several attractive properties as gene delivery vehicles, including (i) sustained gene delivery through stable vector integration into the host genome; (ii) ability to transduce into both dividing and non-dividing cells; (iii) broad tissue targeting, including important gene therapy target cell types and cell therapy target cell types; (iv) non-expression of viral proteins after vector transduction; (v) ability to deliver complex gene elements such as polycistron-containing sequences or intron-containing sequences; (vi) potentially safer integration site characteristics; and (vii) a relatively easy system for vector manipulation and production.

[0121] Depending on the embodiment, the host cell may be, for example, a viral vector or homologous recombination vector containing a nucleic acid sequence homologous to a portion of the host cell's genome, or an expression vector for expressing the polypeptide of interest, or it may be genetically modified (e.g., transduced, transformed, or gene-transfected) with the vector construct of this application. The host cell may be either an untransformed cell or a cell that has already been gene-transfected with at least one nucleic acid molecule.

[0122] In some embodiments, recombinant cells are prokaryotic or eukaryotic cells. In some embodiments, cells are present in a living organism. In some embodiments, cells are present outside a living organism. In some embodiments, cells are present in a laboratory apparatus. In some embodiments, recombinant cells are eukaryotic cells. In some embodiments, recombinant cells are animal cells. In some embodiments, animal cells are mammalian cells. In some embodiments, animal cells are human cells. In some embodiments, cells are non-human primate cells. In some embodiments, mammalian cells are immune cells, nerve cells, epithelial cells, and endothelial cells, or stem cells. In some embodiments, recombinant cells are immune system cells, such as lymphocytes (e.g., T cells or NK cells) or dendritic cells. In some embodiments, immune cells are B cells, monocytes, natural killer (NK) cells, basophils, eosinophils, neutrophils, dendritic cells, macrophages, regulatory T cells, helper T cells (T H ), cytotoxic T cells (T CTL ), or other T cells. In some embodiments, the immune system cells are T lymphocytes.

[0123] In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells. In some embodiments, the cells are lymphocytes. In some embodiments, the cells are precursor T cells or T-regulatory (Treg) cells. In some embodiments, the cells are CD34+, CD8+, or CD4+ cells. In some embodiments, the cells are CD8+ T-cytotoxic lymphocytes selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells. In some embodiments, the cells are CD4+ T-helper lymphocytes selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells. In some embodiments, the cells may be obtained by leukocyte apheresis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient.

[0124] In some embodiments, the recombinant cells further comprise the first and second nucleic acid molecules disclosed herein, wherein the first and second nucleic acid molecules do not have the same sequence. In some embodiments, the recombinant cells further comprise the first and second chimeric polypeptides or hinge-notch receptors disclosed herein, wherein the first chimeric polypeptide or hinge-notch receptor and the second chimeric polypeptide or hinge-notch receptor do not have the same sequence. In some embodiments, the first chimeric polypeptide or hinge-notch receptor modulates the expression and / or activity of the second chimeric polypeptide or hinge-notch receptor.

[0125] In some embodiments, the recombinant cell further comprises an expression cassette encoding a protein of interest operably linked to a promoter, and the expression of the protein of interest is regulated by a chimeric receptor transcription regulator. In some embodiments, the protein of interest is heterologous to the recombinant cell. A heterologous protein is a protein not normally found in the cell, for example, not normally produced by the cell. In principle, there are no particular limitations on suitable proteins whose expression can be regulated by a chimeric receptor transcription regulator. Exemplary types of proteins suitable for use with the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, dedifferentiation factors, immune cell receptors, or reporters. In some embodiments, the immune cell receptor is a T cell receptor (TCR). In some embodiments, the immune cell receptor is a chimeric antigen receptor (CAR). In some embodiments, the expression cassette encoding the protein of interest is incorporated within the same nucleic acid molecule encoding the chimeric receptor of this disclosure. Depending on the embodiment, the expression cassette encoding the protein of interest is incorporated into a second expression vector separate from the nucleic acid molecule encoding the chimeric receptor of this disclosure. In another aspect, a cell culture comprising at least one recombinant cell and culture medium disclosed herein is provided herein. Generally, this culture medium may be any suitable culture medium for culturing the cells described herein. The techniques for transforming the wide variety of host cells and species described above are known in the art and are described in the technical and scientific literature. Accordingly, a cell culture comprising at least one recombinant cell disclosed herein is also within the scope of this application. Methods and systems suitable for generating and maintaining cell cultures are known in the art. Pharmaceutical composition

[0126] Depending on the embodiment, the nucleic acids and recombinant cells of this disclosure may be incorporated into a composition comprising a pharmaceutical composition. This composition generally comprises nucleic acids and / or recombinant cells, as well as pharmaceutically acceptable excipients such as carriers.

[0127] Pharmaceutical compositions suitable for injection include (in the case of water-soluble formulations) sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, and Cremophor EL. TM Examples include BASF, Parsippany, NJ, or phosphate-buffered saline (PBS). In any case, the composition must be sterile and fluid enough to be easily syringed. The carrier should be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerin, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. Adequate fluidity may be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants such as sodium dodecyl sulfate. Protection from microbial activity may be achieved by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, the composition commonly contains isotonic agents, such as sugars, polyhydric alcohols such as mannitol and sorbitol, and sodium chloride. The absorption of the injectable composition may be extended by including an absorption-delaying agent in the composition, such as aluminum monostearate or gelatin.

[0128] Sterile injectable solutions may be prepared by incorporating the required amount of the active compound into a suitable solvent containing one or a combination of the components listed above, as needed, and then sterilizing by filtration. Generally, dispersions are prepared by incorporating the active compound into a sterile medium, and this dispersion contains a basic dispersion medium and other necessary components derived from the components listed above.

[0129] Depending on the embodiment, the chimeric polypeptides and Notch receptors of this disclosure may also be administered by gene transfer or transmission using methods known in the art, including, but not limited to, the methods described in McCaffrey et al. (Nature 418:6893, 2002), Xia et al. (Nature Biotechnol. 20:1006-10, 2002), or Putnam (Am. J. Health Syst. Pharm. 53:151-60, 1996, erratum at Am. J. Health Syst. Pharm. 53:325, 1996). Method of Disclosure

[0130] A patient can be treated for an associated health condition or disease, such as cancer and chronic infection, by administering any one of the therapeutic compositions described herein, such as nucleic acids, recombinant cells, and pharmaceutical compositions. Depending on the embodiment, the nucleic acids, recombinant cells, and pharmaceutical compositions described herein may be incorporated into a therapeutic agent used in a method of treating an individual who has, is suspected of having, or is at high risk of developing, one or more autoimmune disorders or diseases associated with checkpoint inhibition. Examples of autoimmune disorders and diseases include, but are not limited to, celiac disease, type 1 diabetes, Graves' disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus erythematosus.

[0131] Accordingly, in one aspect, some embodiments of this disclosure relate to methods for inhibiting the activity of target cells in an organism, the method comprising administering a first therapy to the organism comprising one or more nucleic acids, recombinant cells, and pharmaceutical compositions disclosed herein, the first therapy inhibiting target cells. For example, the target cells may be inhibited if their proliferation is reduced, if their pathological or pathogenic behavior is reduced, or if the cells are destroyed or killed. Inhibition includes a reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% of the measured pathological or pathogenic behavior. In some embodiments, the method comprises administering an effective number of recombinant cells disclosed herein to an organism, the recombinant cells inhibiting the activity of target cells in the organism. Generally, the target cells in the disclosed method may be any cell type in an individual, for example, acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B-cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, liver cancer cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T-cell lymphoma cells, kidney cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, or sarcoma cells. Depending on the embodiment, the target cells may be pathogenic cells.

[0132] In another aspect, some embodiments of the present disclosure relate to methods for treating a health condition (e.g., disease) in an individual in need thereof, the method comprising administering to the individual a first therapy comprising one or more recombinant cells comprising the chimeric polypeptide or hinge-notch receptor disclosed herein and / or a pharmaceutical composition disclosed herein, the first therapy treating the health condition of the individual. In some embodiments, the method comprises administering to the individual a first therapy comprising an effective number of recombinant cells disclosed herein, the recombinant cells treating the health condition.

[0133] In another aspect, some embodiments of the present disclosure relate to methods for assisting in the treatment of health conditions (e.g., diseases) in individuals in need thereof, the method comprising administering a first therapy and a second therapy to the individual comprising one or more of the chimeric polypeptides, hinge-notch receptors, nucleic acids, recombinant cells, and pharmaceutical compositions disclosed herein, the first and second therapies together treating the individual's disease. In some embodiments, the method comprises administering a first therapy to the individual comprising an effective number of recombinant cells disclosed herein, the recombinant cells treating the health condition. Administration of recombinant cells to an individual

[0134] Depending on the embodiment, the method of the Disclosure includes administering an effective amount of the recombinant cells of the Disclosure to an individual in need of treatment. This administration step may be achieved using any transplantation delivery method in the Art. For example, the recombinant cells of the Disclosure may be injected directly into the bloodstream of the individual or administered to the individual by other means.

[0135] Depending on the embodiment, the methods disclosed herein include administering recombinant cells into an organism by a method or route that results in at least partial localization of the cells introduced to a desired site to produce the desired effect, and the term “administering” is used interchangeably with the terms “introducing,” “implanting,” and “transplanting.” Recombinant cells or their differentiated offspring may be administered by any suitable route that results in delivery to a desired site in the organism, with at least a portion of the administered cells or components of the cells remaining viable. The survival period of the cells after administration to the organism may be as short as a few hours, e.g., 24 hours, up to a few days, up to several years, or even the lifetime of the organism, i.e., long-term engraftment.

[0136] When provided prophylactically, the recombinant cells described herein may be administered to an individual prior to any symptoms of the disease or disorder to be treated. Thus, in some embodiments, prophylactic administration of the recombinant cell population prevents the onset of symptoms of the disease or disorder.

[0137] In some embodiments, when provided therapeutically, the recombinant cells are provided at the onset (or after the onset) of symptoms or signs of the disease or disorder, e.g., at the start of the disease or disorder.

[0138] The effective amount of the recombinant cells disclosed herein for use in the various embodiments described herein is at least 10 2 cells, at least 5×10 2 cells, at least 10 3 cells, at least 5×10 3 cells, at least 10 4 cells, at least 5×10 4 cells, at least 10 5 cells, at least 2×10 5 cells, at least 3×10 5 cells, at least 4×10 5 cells, at least 5×10 5 cells, at least 6×10 5 cells, at least 7×10 5 cells, at least 8×10 5 cells, at least 9×10 5 cells, at least 1×10 6 cells, at least 2×10 6 cells, at least 3×10 6 cells, at least 4×10 6 cells, at least 5×10 6 cells, at least 6×10 6 cells, at least 7×10 6 cells, at least 8×10 6 cells, at least 9×10 6The recombinant cells may be a single cell or a multiple thereof. The recombinant cells may originate from one or more donors or may be autogenic. Depending on the embodiment, the recombinant cells are grown in culture medium before being administered to the individual in need.

[0139] Depending on the embodiment, delivery of a recombinant cell composition into an organism by method or route (e.g., a composition comprising multiple recombinant cells of any of the cells described herein) results in at least partial localization of the cell composition at a desired site. The recombinant cell composition may be administered by any suitable route that results in an effective treatment within the organism, for example, by administration of at least a portion of the delivered composition, e.g., at least 1 × 10⁶ 4 This results in delivery to a desired site within an individual, where individual cells are delivered to the desired site over a period of time. Methods of administration include injection, infusion, and intravenous infusion. “Injection” includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intracutaneous, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injections and infusions. In some embodiments, the route is intravenous. For cell delivery, delivery by injection or infusion is a preferred method of administration.

[0140] Depending on the embodiment, recombinant cells may be administered systemically, for example, by injection or injection. For example, a population of recombinant cells may be administered directly into a target site, tissue, or organ, or it may be administered to enter the individual's circulatory system, thereby undergoing metabolism and other similar biological processes.

[0141] The efficacy of a treatment comprising any of the compositions provided herein for the treatment of a disease or illness may be determined by a skilled clinician. However, a person skilled in the art will know that a treatment may be considered effective if one or all of the signs, symptoms, or markers of the disease are improved or ameliorated. Efficacy may also be assessed by the absence of deterioration in the individual, as assessed by a reduction in the need for hospitalization or medical intervention (for example, such as the cessation or at least stagnation of the progression of the disease). Methods for measuring these indicators are known to a person skilled in the art and / or are described herein. A treatment includes any treatment of a disease in an individual or an animal (in some non-limiting examples, including humans or mammals), and includes (1) suppressing the disease, e.g., blocking or delaying the progression of symptoms; or (2) mitigating the disease, e.g., causing a regression of symptoms; and (3) preventing or reducing the likelihood of the symptoms occurring.

[0142] As described above, a therapeutically effective dose includes an amount of the therapeutic composition sufficient to promote a specific beneficial effect when administered to an individual who has, is suspected of having, or is at risk of having, the disease. Depending on the embodiment, the effective dose includes an amount sufficient to prevent or delay the onset of disease symptoms, alter the course of disease symptoms (for example, but not limited to delaying the progression of disease symptoms), or reverse disease symptoms. Naturally, the appropriate effective dose in any given case may be determined by a person skilled in the art using routine testing.

[0143] Depending on the embodiment of the method disclosed, the individual is a mammal. Depending on the embodiment, the mammal is a human. Depending on the embodiment, the individual has, or is suspected of having, a disease related to the inhibition of cell signaling mediated by cell surface ligands or antigens. Diseases suitable to be treated by the compositions and methods of this disclosure include, but are not limited to, cancer, autoimmune diseases, inflammatory diseases, and infectious diseases. Depending on the embodiment, the disease is cancer or a chronic infection. Further treatments

[0144] As described above, the recombinant cells and pharmaceutical compositions described herein may be administered in combination with one or more further therapeutic agents, such as chemotherapeutic agents or anticancer agents or anticancer therapy agents. “Combined” administration with one or more further therapeutic agents includes simultaneous and sequential administration in any order. Depending on the embodiment, one or more further therapeutic agents, chemotherapeutic agents, anticancer agents, or anticancer therapies may be selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormone therapy, toxin therapy, and surgery. “Chemotherapy” and “anticancer agent” are used interchangeably herein. Various classes of anticancer agents may be used. Non-limiting examples include alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxins, antibodies (e.g., monoclonal or polyclonal antibodies), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone therapy, soluble receptors, and other anticancer agents. Methods for regulating cell activity

[0145] In another aspect, various methods for modulating cell activity are provided herein. These methods include (a) providing an effective amount of any of the recombinant cells provided herein, and (b) contacting a selected ligand with an effective amount thereof, wherein the binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of a ligand-induced proteolytic cleavage site and releases a transcription factor, which releases a transcription factor that modulates the activity of the recombinant cell. Those skilled in the art who have read this disclosure will see that the methods of this disclosure may be carried out in vivo, in vitro, or in laboratory equipment.

[0146] Examples of non-limited cellular activities that can be regulated using the methods provided herein include, but are not limited to, gene expression, proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, secretion of gene products, cell adhesion, and cell lysis reactions.

[0147] In some embodiments, the released transcription factors regulate the expression of cellular gene products. In some embodiments, the released transcription factors regulate the expression of heterologous gene products within the cell. Heterologous gene products are products not normally present in undenatured cells, such as products not normally produced by cells. For example, cells may be genetically modified with nucleic acids containing nucleotide sequences encoding heterologous gene products.

[0148] In some embodiments, the heterogeneous gene product is a secreted gene product. In some embodiments, the heterogeneous gene product is a cell surface gene product. In some cases, the heterogeneous gene product is an intracellular gene product. In some embodiments, the released transcription regulator simultaneously regulates the expression of two or more intracellular heterogeneous gene products.

[0149] Depending on the embodiment, the intracellular heterogeneous product is selected from the group consisting of chemokines, chemokine receptors, chimeric antigen receptors, cytokines, cytokine receptors, differentiation factors, growth factors, growth factor receptors, hormones, metabolic enzymes, pathogen-derived proteins, growth-inducing factors, receptors, RNA guide nucleases, site-specific nucleases, T cell receptors (TCRs), chimeric antigen receptors (CARs), toxins, toxin-derived proteins, transcription regulators, transcription activators, transcription repressors, translation regulators, translation activators, translation repressors, activated immune receptors, antibodies, apoptosis inhibitors, apoptosis inducers, artificial T cell receptors, immunoactivators, immunosuppressors, and suppressive immune receptors.

[0150] In some embodiments, the released transcription factors regulate cell differentiation, which may be immune cells, stem cells, progenitor cells, or precursor cells.

[0151] The chimeric receptors of this disclosure provide higher expression than standard synthetic Notch receptors when using the same binding domain and ICD. Depending on the ligand / binding domain pair and their affinity, the chimeric polypeptides or hinge-Notch receptors of this disclosure can provide approximately 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% higher expression enhancement than the corresponding synthetic Notch receptor.

[0152] Furthermore, the chimeric receptors of this disclosure can provide transcriptional regulation that responds to the degree of T cell activation, independently of ligand binding. For example, when expressed in T cells, some of the receptors of this disclosure provide a stronger ligand-inducing signal when T cells are activated compared to when T cells are not activated. This allows for greater adaptability in use, for example, when it is desired to enhance or suppress the T cell response when activated, even in the absence of a chimeric receptor ligand. Systems and kits

[0153] Furthermore, this disclosure provides systems and kits comprising chimeric polypeptides, hinge-notch receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions as provided and described herein, as well as written instructions for generating and using them. For example, in some embodiments, systems and / or kits comprising one or more of the chimeric polypeptides, hinge-notch receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions as described herein are provided herein. In some embodiments, the systems and / or kits of this disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer one of the provided chimeric polypeptides, hinge-notch receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual. In some embodiments, the kit may have one or more further therapeutic agents that may be administered simultaneously or sequentially with other kit components for a desired purpose, for example, to modulate the activity of cells in an individual requiring it, to inhibit target cancer cells, or to treat a health condition (e.g., disease).

[0154] Any of the systems and kits described above may further include one or more additional reagents, which may be selected from dilution buffers; reconstitution solutions; wash buffers; control reagents; control expression vectors; negative control polypeptides; positive control polypeptides; and reagents for in vitro generation of chimeric receptor polypeptides.

[0155] Depending on the embodiment, the components of the system or kit may be placed in separate containers. In some other embodiments, the components of the system or kit may be combined in a single container.

[0156] Depending on the embodiment, the system or kit may further include instructions for carrying out a method using the components of the kit. Instructions for carrying out this method are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be present within the kit as a packing insert within the label of a container (i.e., related to packaging or sub-packaging) such as the kit container or its components. The instructions may be present as an electronic storage data file on a suitable computer-readable storage medium, such as a CD-ROM, floppy disk, or flash drive. In some examples, the actual instructions may not be present within the kit, but a means of obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address from which the instructions can be viewed and / or downloaded. Along with the instructions, the means of obtaining these instructions may be recorded on a suitable substrate.

[0157] All publications and patent applications described herein are incorporated herein by reference to the same extent that each individual publication or patent application is specifically and individually indicated as being incorporated by reference.

[0158] No document cited herein constitutes prior art. While the references are reviewed to explain the claims of their authors, the inventors reserve the right to object to the accuracy and validity of the cited documents. Naturally, numerous sources, including scientific journal articles, patent documents, and textbooks, are referenced herein, but this reference does not imply that any of these documents constitute common general knowledge in the art.

[0159] The consideration of general methods presented herein is for illustrative purposes only. Other alternative methods and alternatives will be obvious to those skilled in the art upon reviewing this disclosure and are included in the spirit and scope of this application.

[0160] Throughout this specification, various patents, patent applications, and other forms of publications (e.g., journal articles, entries in electronic databases, etc.) are referenced. All disclosures of patents, patent applications, and other publications cited herein are incorporated herein in their entirety by reference for all purposes.

[0161] No document cited herein constitutes prior art. While the references are reviewed to explain the claims of their authors, the inventors reserve the right to object to the accuracy and validity of the cited documents. Naturally, numerous sources, including scientific journal articles, patent documents, and textbooks, are referenced herein, but this reference does not imply that any of these documents constitute common general knowledge in the art. [Examples]

[0162] To implement this disclosure, unless otherwise specified, the methods of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology will be used, which are well known to those skilled in the art. Such methods are adequately described in the references cited above.

[0163] Further embodiments are disclosed in more detail in the following embodiments, which are provided for illustrative purposes only and are not intended to limit the spirit or scope of the claims of this disclosure.

[0164] Example 1: Design and construction of chimeric receptor and response element constructs This example describes the design and construction of the chimeric Notch receptor family. Detailed information on various exemplary receptors in this disclosure is shown in Tables 1 and 2 below. Table 1 shows a brief description of each chimeric Notch receptor, their corresponding components, and the corresponding sequence identifiers listed in the sequence listing, where ECD represents the extracellular domain; N-JMD represents the N-terminal proximity domain (i.e., hinge domain); TMD represents the transmembrane domain; STS represents the transport stop sequence; and TF represents the transcription factor. [Table 1-1] [Table 1-2]

[0165] Table 2 provides a brief description of the chimeric Notch receptor and its components (each component separated by a comma). Unless otherwise specified, the entries refer to human-derived proteins. For example, "Notch 1, Notch 1" indicates that two sequences from Notch 1 fused to form this protein module. [Table 2-1] [Table 2-2] [Table 2-3]

[0166] The chimeric receptors listed in Tables 1-2 above are CD19 (Porter DL et al., 2011), ALPPL2 (FYIA), BCMA, Her2, or anti-BCMA whole-humanized V H The receptors were constructed by fusing a domain-recognizing single-chain antigen-binding fragment (scFv) to the corresponding receptor scaffold and the synthetic transcription regulator GAL4-VP64. For the construction of these receptors, DNA fragments encoding the amino acid sequences presented in Table 1 and the sequence listing were amplified by PCR from a synthetic gene fragment or plasmid containing the DNA sequence for the presented protein, and incorporated into the BamHI cloning site of the lentiviral expression vector pHR-SIN-pGK (L. Morsut et al., Cell (2016) 164:780-91; Addgene plasmid #76120) using standard cloning techniques (e.g., overhang PCR, fusion PCR, and in-fusion cloning) with translation start and stop sequences adjacent.

[0167] The transcription factor GAL4-VP64 used in these experiments contained a DNA domain derived from the yeast GAL4 transcription factor fused with an activation domain VP64 consisting of a tetrameric repeat of the minimal activation domain (amino acids 437-447) of the herpes simplex protein VP16. As shown in Table 2, most exemplary receptors contained an N-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP) (SEQ ID NO: 21) for membrane targeting, and one exemplary receptor (pIZ343eGFP) contained a mouse IgKVIII signal peptide. Furthermore, most exemplary receptors contained a myc tag (EQKLISEEDL) (SEQ ID NO: 22) for proper determination of surface expression using an antibody conjugated to a fluorescent dye (α-myc A647®, Cell Signaling Technology, Cat #2233). Each of these receptors was cloned into a modified lentiviral pHR'SIN:CSW vector containing a phosphoglycerate kinase (PGK) promoter (KT Roybal et al., Cell 2016 Oct 6; 167(2):419-32) for all primary T cell experiments described in Examples 3-4 below.

[0168] The pHR'SIN:CSW vector was further modified to generate a response element plasmid. For this purpose, five copies of the target sequence for binding to the GAL4 DBD domain (GGAGCACTGTCCTCCGAACG) (SEQ ID NO: 23) were cloned into the 5' position of the minimal pybTATA promoter. The response element plasmid also contains a PGK promoter that constitutively drives the expression of a yellow fluorescent reporter protein (mCitrine) to suitably identify successfully transduced T cells.

[0169] For the construction of all induced BFP vectors, the coding sequence for the blue fluorescent reporter protein (BFP) was cloned via the BamHI site within the multiplexing site located at 3' of the GAL4 response element. For the construction of all induced CAR vectors, the CAR was C-tagged with a green fluorescent reporter protein (GFP) and cloned via the BamHI site within the multiplexing site located at 3' of the GAL4 response element. All constructs were cloned using a cloning kit (In-Fusion® cloning, Clontech #ST0345) according to the manufacturer's instructions.

[0170] Example 2: Isolation and culture of primary human T cells This example describes the isolation and culture of primary human T cells used following the various cell introduction experiments described in Example 3 below.

[0171] In these experiments, primary CD4+ and CD8+ T cells were isolated from blood after component removal and enriched by negative selection using human T cell isolation kits (human CD4+ or CD8+ enriched mixture; STEMCELL Technologies, Cat#15062 and 15063). Blood was obtained from the Blood Centers of the Pacific (San Francisco, CA), approved by the university institutional review board. The T cells were cryopreserved in growth medium (RPMI-1640, Cell Culture Core, University of California, San Francisco) containing 20% ​​human AB serum (Valley Biomedical, #HP1022) and 10% DMSO. After thawing, the T cells were subjected to X-VIVO. TM For all experiments, cells were cultured in human T cell medium containing 15 (Lonza, #04-418Q), 5% human AB serum, and 10 mM neutralized N-acetyl-L-cysteine ​​(Sigma-Aldrich, #A9165) supplemented with 30 units / mL of IL-2 (NCI BRB: Preclinical Stock from the National Cancer Institute's Bio-Sources Branch).

[0172] Example 3: Human T cells were stably transduced using a lentiviral vector. This example illustrates a general procedure used for lentiviral transduction of human T cells, unless otherwise specified herein.

[0173] Generally, a lentiviral vector (general affinity vector) pseudotyped with the vesicular stomatitis virus envelope G protein (VSV-G) is used to create a pHR'SIN:CSW transgene expression vector and a viral packaging plasmid pCMVdR8.91 and pMD2.G using Mirus TransIT®-Lenti (Mirus, #MIR 6606) to create Lenti-X TM T cells were produced via gene transfer from 293 T cells (Clontech, #11131D). Normally, primary T cells were thawed on the same day, cultured for 24 hours, and then stimulated with beads containing anti-CD3 and anti-CD28 antibodies bound to the surface in a 1:3 cell-to-bead ratio (Dynabeads®, Life Technologies, #11131D, which attach human T-activator CD3 / CD28). After 48 hours, the viral supernatant was collected, and primary T cells were exposed to this virus for 24 hours. Five days after T cell stimulation, the beads were removed, and the T cells were grown and rested until day 14 before being used for measurement. The T cells were processed using FACSAria from Beckton Dickinson (or BD Biosciences). TM Cells were selected for measurement using a flow cytometer (II flow cytometer). AND-gate T cells expressing basal CAR were excluded during the selection process.

[0174] Example 4: In vitro stimulation of primary T cells This embodiment describes experiments performed to demonstrate the in vitro stimulation of primary T cells with the chimeric hinge-notch polypeptide described herein, unless otherwise specified herein.

[0175] In all in vitro T cell stimulation tests, 1 × 10⁶ cells were observed in a flat-bottomed 96-well tissue culture plate. 5 T cells were co-cultured with transmitting cells in a 1:1 ratio. This culture was then processed by BD Fortessa. TMReporter activity was analyzed using X-50 after 24 hours. All flow cytometry analyses were performed using FlowJo TM This was performed using software (developed by TreeStar).

[0176] Example 5: Design, expression, and activation of the CD8 hinge-notch receptor in primary T CD4+ T cells. This example describes the design of the CD8 hinge-notch receptor and the results of experiments conducted to evaluate its expression and activation in primary T CD4+ T cells. Two variants of the CD8 hinge-notch receptor were constructed. As shown in Figure 2A, an exemplary synthetic Notch 1 receptor is shown in the left figure, which was designed based on the human Notch 1 protein. The center figure schematically shows the CD8 hinge-notch 1 receptor. Compared to the synthetic Notch 1 receptor in the left figure, the CD8 hinge-notch 1 receptor has the NRR substituted with the CD8 hinge domain and contains a cysteine ​​residue known to form a disulfide bond. The right figure schematically shows an exemplary truncated CD8 hinge-notch 1 receptor (truncCD8 hinge-notch 1). Compared to the CD8 hinge-notch 1 receptor, the truncCD8 hinge-notch 1 receptor contains a C-terminal deletion of the CD8 hinge sequence, with one cysteine ​​residue and a shorter extracellular region remaining. Figure 2B summarizes the flow cytometry data of receptor expression. In these experiments, primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs expressing either the receptor or a transcription reporter construct. Receptor expression was measured using an AlexaFluor647-tagged anti-myc antibody (Cell Signaling). Reporter expression was measured by the constitutive mCitrine gene found on the surface of the reporter plasmid. Double-positive cells were selected 5 days after primary T cell stimulation and further grown for activation testing. Figure 2C summarizes the results of the receptor activation test. In these experiments, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 A single double-positive T cell, without additives (as shown in the upper diagram), or 1 × 10⁶ 5 1 K562 cell (middle diagram) or 1 × 10 5The cells were co-cultured with individual CD19+K562 cells (shown in the lower panel) for 24 hours. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). The results described in this example indicate that both the CD8 hinge-notch receptor and truncCD8 hinge-notch 1 were expressed in primary T CD4+ T cells.

[0177] Example 6: Activation of CD8 hinge receptors by T cell stimulation This example describes the results of experiments conducted to demonstrate gene activation mediated by the CD8 hinge-notch receptor described herein, accompanied by simultaneous T cell activation. These experiments were performed using the same CD8 hinge-notch receptor mutant described above as in Example 5. The results of receptor activation tests accompanied by simultaneous T cell activation are shown in Figure 3B. In these experiments, anti-MCAM and anti-CD3 bispecific T cell engagers (MCAM BiTE) that activate the T cell receptor in the presence of K562 cells were used to mimic T cell activation. 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 A single double-positive T cell, MCAM BiTE (upper diagram), 1 × 10 5 K562 cells + MCAM BiTE (middle diagram), 1 × 10 5 The cells were co-cultured for 24 hours with CD19 cells, K562 cells, and MCAM BiTE (see diagram below). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). The results described in this example demonstrate that both the CD8 hinge-notch receptor and truncCD8 hinge-notch 1 can activate transcription regardless of the presence or absence of simultaneous T cell activation.

[0178] Example 7: Optimization of CD8 hinge This example describes the results of experiments conducted to optimize the CD8 hinge domain in the chimeric Notch receptor environment. Four variants of the CD8 hinge domain—truncCD8 hinge 1, truncCD8 hinge 2, truncCD8 hinge 3, and truncCD8 hinge 4—were tested. The structural differences between these CD8 hinge domain variants are shown in Figure 4A, where the hinge components are denoted as "a," "b," "c," and "d." Component "a" represents the N-terminal region of the first cysteine ​​residue. Component "b" represents the first cysteine ​​residue. Component "c" represents the region between the first and second cysteine ​​residues. Component "d" represents the second cysteine ​​residue and the region from the second cysteine ​​residue to the receptor transmembrane domain. Figure 4B summarizes the results of receptor activation tests in Jurkat T cells. Next, transcriptional activation of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). Figure 4C shows the quantification of %BFP-positive cells from the data in Figure 4B. The results described in this example demonstrate that all four variants of the CD8 hinge domain can activate transcription as measured by BFP expression levels. However, the trunkCD8 hinge 1 and hinge 2 notch 1 receptors are optimal in that they activate transcription to high levels with ligands while exhibiting minimal ligand-independent transcriptional regulation (Figure 4B).

[0179] Example 8: Activation test of the TruncCD8 hinge 2 receptor accompanied by simultaneous PKC signaling. This example describes the results of experiments conducted to test gene activation mediated by the trunkCD8 hinge 2 receptor described in Example 7, which is accompanied by PKC signaling. In these experiments, a DAG analogue, phorbol 12-myristate 13-acetate (PMA), was added to mimic PKC signaling. As shown in Figure 5, 1 × 10⁶ cells expressing the anti-CD19 receptor were added. 5 1 x 10⁶ double-positive T cells were compared under conditions with and without PMA, without additional cells (upper figure), or 1 x 10⁶. 5 1 K562 cell (middle diagram) or 1 × 10 5The cells were co-cultured with individual CD19+K562 cells (shown in the lower panel) for 24 hours. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). The results described in this example demonstrate that the trunkCD8 hinge 2-notch 1 can activate transcription regardless of the presence or absence of simultaneous PKC signaling.

[0180] Example 9: Testing of hinge domains from an alternative source This example describes the results of experiments conducted with hinge-notch receptors containing different hinge domains derived from other sources. In these experiments, hinge-notch receptors were constructed using hinge domains derived from CD28, OX40, and IgG4 (see, for example, Figure 6A). Four exemplary hinge-notch receptors were tested: pIZ343 (truncate CD8 hinge 2-notch), pIZ358 (CD28 hinge-notch), pIZ360 (OX40 hinge-notch), and pIZ359 (IgG4 hinge-notch). A brief description of each hinge-notch receptor is further provided in Table 2. As shown in Figure 6B, each of the hinge-notch constructs pIZ343 (truncate CD8 hinge-notch), pIZ358 (CD28 hinge-notch), pIZ360 (OX40 hinge-notch), and pIZ359 (IgG4 hinge-notch) was capable of stimulating primary T cells as determined by the expression of the BFP reporter gene. The previously generated reporter-positive Jurkat T cell line was transduced with the receptor construct. Receptor expression was measured using an AlexaFluor647-tagged anti-myc antibody (Cell Signaling). For the receptor activation test, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 Jurkat T cells, without additives (top diagram), or 1 × 10⁶ 5 1 K562 cell (middle diagram) or 1 × 10 5The cells were co-cultured for 24 hours with CD19+K562 cells (shown in the lower panel). Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). Figure 6B shows the quantification of %BFP-positive cells from the test results in Figure 6A. The experiments described in this example demonstrate that, in addition to CD8A, other usable hinge domains may be derived from other sources such as CD28, OX40, and IgG4.

[0181] Example 10: Testing of a hinge-notch receptor containing an alternative ligand-recognition domain This example describes the results of experiments conducted to test a hinge-notch receptor containing a different ligand-recognition domain.

[0182] As shown in Figure 7A, in addition to anti-CD19 scFV, anti-ALPPL2 scFV and eGFP were further used as ligand recognition domains. As shown in Figure 7B, the previously generated reporter-positive Jurkat T cell line was transduced with the receptor construct. Receptor expression was measured using AlexaFluor647-tagged anti-myc antibody (Cell Signaling). For receptor activation testing, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 Jurkat T cells, without additives (top diagram), or 1 × 10⁶ 5 1 × 10¹ K562 cells (middle diagram) or cells expressing anti-GFP antibody on the cell surface 5 ALPPL2+K562 cells / 1×10 5 The cells were co-cultured with individual K562 cells (shown in the lower panel) for 24 hours. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). The experiment described in this example demonstrates that, in addition to CD19, other usable ligand recognition domains may originate from other sources.

[0183] Example 11: Testing of a hinge-notch receptor containing an alternative transport termination sequence (STS). This example describes the results of experiments conducted to test hinge-notch receptors, including another STS.

[0184] As shown in Figure 8A, in addition to Notch 1 STS, other STSs (e.g., Notch 2 STS, Notch 4 STS, DAG STS, PTPRF STS, and KL STS) can be used to influence receptor behavior. In these experiments, primary human T cells were activated with Dynabeads (Gibco) to which anti-CD3 / anti-CD28 was added, and then transduced with two lentiviral constructs expressing either the receptor or a transcription reporter construct. Receptor / reporter-positive cells were selected 5 days after primary T cell stimulation and further grown for activation testing. For testing, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 A single double-positive T cell, without additives (as shown in the upper diagram), or 1 × 10⁶ 5 1 K562 cell (middle diagram) or 1 × 10 5 The cells were co-cultured with individual CD19+K562 cells (shown in the lower panel) for 24 hours. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). Figure 8B shows the quantification of the activation data from Figure 8A. The experiment described in this example demonstrates that, in addition to Notch 1 STS, other usable transport termination sequences may be derived from other sources.

[0185] Example 12: Generation of reporter Jurkat T cells This example describes the generation of reporter Jurkat T cells subsequently used for testing various hinge-notch receptors described herein.

[0186] In these experiments, E6-1 Jurkat T cells (ATCC# TIB-152) were transduced by lentivirus using a reporter plasmid containing the induced BFP reporter gene and the constitutive mCitrine reporter gene, as described above (KT Roybal et al., Cell, 164:1-10, 2016). Reporter-positive Jurkat cells were transferred to a FACSAria from Beckton Dickinson (BD Biosciences). TMmCitrine expression was selected and the cells were grown using a flow cytometer (II flow cytometer).

[0187] Lentiviral particles were generated using receptor transgene expression vectors as described above (L. Morsut et al., Cell (2016) 164:780-91). Reporter-positive Jurkat cells were transduced with individual receptors and grown in 96-well plates for the experiment.

[0188] Example 13 This example describes experiments performed to demonstrate the in vitro stimulation of Jurkat T cells with the chimeric hinge-notch polypeptide described herein.

[0189] Four types of CD8 hinge-notch mutants were tested. Figure 4A schematically shows four types of CD8 hinge-notch truncated mutants containing one or more hinge components. Figure 4B summarizes the results of experiments conducted to test receptor activation in Jurkat T cells. In these experiments, the previously generated reporter-positive Jurkat T cell line was transduced with each of the CD8 hinge-notch mutants. Receptor expression was measured using an AlexaFluor647-tagged anti-myc antibody (Cell Signaling). For the receptor activation test, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 Jurkat T cells, without additives (top diagram), or 1 × 10⁶ 5 1 K562 cell (middle diagram) or 1 × 10 5Individual CD19+K562 cells (bottom panel) were co-cultured for 24 hours. Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). From this test, it was determined that the trunkCD8 hinge 2 was the optimal configuration and was used for subsequent studies. Figure 4C shows the quantification of %BFP-positive cells from the data in Figure 4B (no additives, with K562 cells, with CD19+K562 cells). Figure 4D is a graph of the signal-to-noise ratio from the data in Figure 4B. The values ​​from Jurkat T cells stimulated with CD19+K562 were divided by the values ​​from Jurkat T cells stimulated with K562 cells.

[0190] Example 14 This example describes experiments conducted to optimize the chimeric CD8 hinge-notch polypeptide described herein.

[0191] Several exemplary CD8 hinged truncated mutants were prepared. As shown in Figure 9A, exemplary mutants were prepared containing either the full-length or truncated form of TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD (SEQ ID NO: 12), which corresponds to the N-JMD domain of construct pIZ341. The black bars indicate the amino acids that make up each mutant. As a result, the mutants for comparison in Figures 9A-9C are: the "Full" mutant containing SEQ ID NO: 12; the "Trunc 1" mutant containing SEQ ID NO: 39; the "Trunc 2" mutant containing SEQ ID NO: 13; the "Trunc 3" mutant containing SEQ ID NO: 40; and the "Trunc 4" mutant containing SEQ ID NO: 41. A comparison of the expression of these CD8 hinged mutants is shown in Figure 9B. Specifically, primary human CD4+ T cells were activated with Dynabeads (Gibco) to which anti-CD3 / anti-CD28 was added. These cells were then transduced with two lentiviral constructs: one expressing a hinged truncated mutant receptor and the other expressing a BFP transcription reporter + anti-ALPPL2 CAR. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. The five figures on the left of Figure 9B show the relative expression levels of each receptor (y-axis) measured by anti-myc tag staining versus the expression levels of the reporter construct (x-axis) measured by GFP. The figure on the far right of Figure 9B shows the quantification of MFI of receptor expression in the CD8 hinge mutant within double-positive cells. As shown from top to bottom in each figure of Figure 9C, T cells expressing the anti-CD19 receptor were co-cultured either without additives (top figure) or with ALPPL2+K562 cells (second figure from top), CD19+K562 cells (third figure from top), and ALPPL2+CD19+ cells (bottom figure). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences).

[0192] Example 15 This example describes experiments conducted to demonstrate the activation of hinge-notch constructs having various ligand-binding domains and their dependence on the proteolytic activity of ADAM proteases and γ-secreting enzymes.

[0193] Three exemplary hinge-notch constructs were prepared, including a first construct with anti-CD19 scFv and a Notch 2 STS domain as ligand-recognition domains, a second construct with anti-LaG17 nanobody and a Notch 2 STS domain as ligand-recognition domains, and a third construct with an eGFP extracellular domain and a Notch 1 STS domain. Primary human CD4+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs, one expressing a hinge receptor with a specified binding head truncated mutant receptor and the other expressing a transcription reporter (Figure 10). Cells containing both constructs were sorted 5 days after primary T cell stimulation and further grown for activation testing. For testing, 1 × 10⁶ cells expressing the receptor were used. 5 A number of double-positive T cells, 1 × 10⁶ 5 K562 cells (figure at the top), 1 × 10 5 1 x 10⁶ ligands + K562 cells (second figure from the top), containing ADAM10 inhibitor 5 1 × 10¹ ligands + K562 cells (third figure from the top), or 1 × 10¹⁶ cells containing DAPT, a gamma secretion enzyme inhibitor. 5 The ligand was co-cultured with K562 cells (shown in the diagram at the bottom). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences).

[0194] Example 16 This example describes experiments conducted to demonstrate the activation properties of an exemplary Notch 2 STS hinge-notch construct having an augmented assembly of ligand-binding domains.

[0195] Tests were conducted using various binding heads for the BCMA antigen. Primary CD4+ human T cells were activated with Dynabeads (Gibco) to add anti-CD3 / anti-CD28, and then transduced with two lentiviral constructs, one expressing a specified binding head hinge-notch receptor and the other expressing a transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. For the test, 1 × 10⁶ cells expressing the receptor were used. 5 A single double-positive T cell, without additives (see diagram above), or 1 × 10⁶ 5 Individual K562 cells (the figure in the center) or 1 × 10 5 The cells were co-cultured with BCMA+K562 cells (bottom figure) for 2 days (Figure 11A). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). In Figure 11A, the left figure shows the construct with an anti-BCMA scFv binding head, the center figure shows the construct with an anti-BCMA whole-humanized VH binding head, and the right figure shows the construct with an anti-BCMA whole-humanized VH binding head (Hinge 5) that has a hinge domain optimized for the binding domain.

[0196] SIRPα-binding heads were similarly tested. Primary CD8+ human T cells were activated with Dynabeads (Gibco) to add anti-CD3 / anti-CD28, and then transduced with two lentiviral constructs, one expressing the specified binding head hinge-notch receptor and the other expressing a transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. For testing, 1 × 10⁶ cells expressing the receptor were used. 5 The number of double-positive T cells was measured without additives (blue), or in the specified 1 × 10⁶ 5 The cells were co-cultured with K562 cells (red) for two days (Figure 11B). Subsequently, transcriptional activation of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences).

[0197] Various scFvs against the HER2 antigen were tested and compared. Primary CD4+ human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco), and then transduced with two lentiviral constructs: one expressing a hinge receptor with a specified binding head hinge receptor, and the other expressing a transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. For testing, 1 × 10⁶ cells expressing the receptor were used. 5 100 bipositive T cells were co-cultured for 2 days either without additives (top figure) or with adherent HEK293 T cells (second figure from the top), adherent MBMDA-468 cells (third figure from the top), adherent MCF7 cells (fourth figure from the top), or adherent SKBR3 cells (bottom figure) (Figure 11C). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). In Figure 11C, the left figure shows the anti-HER2 4D5-7 scFv binding head, and the right figure shows the anti-HER2 4D5-8 scFv binding head.

[0198] Example 17 This example describes an experiment conducted to compare the activation of hinge-notch mutants having various promoters and STS domains. For the test, 1 × 10⁶ cells expressing the anti-CD19 receptor were used. 5 A single double-positive T cell, without additives (figure at the top), or 1 × 10⁶ 5 ALPPL2+K562 cells (second figure from the top), 1 × 10 5 A single CD19+K562 cell (third figure from the top), or 1 × 10⁶ 5 The cells were co-cultured with individual ALPPL2+CD19+K562 cells (bottom diagram) (Figure 12). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). For comparison, activation using original synthetic Notch constructs from mouse and human cells was also included.

[0199] Example 18 This example describes the mutation analysis of the Notch 1 transmembrane domain (TMD) within a hinge-notch construct.

[0200] Mutants containing various alanine mutations within the TMD domain of the hinge-notch construct were prepared. Each amino acid residue from position 301 (F) to 322 (S) within the TMD of the hinge-notch construct was individually mutated to alanine. Primary human CD4+ T cells were activated with Dynabeads to add anti-CD3 / anti-CD28, and transduced with two lentiviral constructs: one expressing the TMD mutant and the other containing a BFP transcription reporter. Cells containing both constructs were selected 5 days after primary T cell stimulation and further grown for activation testing. In Figure 13A, the left panel shows the relative expression (y axis) of various receptors (x axis) versus the expression of reporter construct markers (y axis) as measured by anti-myc tag staining, and the right panel shows the quantification of MFI of receptor expression in the TMD mutant in double-positive cells.

[0201] As shown in Figure 13B, T cells expressing the anti-CD19 receptor were co-cultured in a 1:1 ratio with control CD19(-) or CD19(+) K562 cells. Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). The figure on the left is a flowchart of the activation characteristics. The figure on the right is a line graph showing the BFP%. These results suggest the importance of the glycine (G) and valine (V) residues located at the C-terminus of TMD.

[0202] Example 19 This example describes mutation analysis of the transmembrane domain (TMD) and STS domain in a hinge-notch construct.

[0203] Four exemplary hinge-notch receptors (SEQ ID NOs. 73-76) are used in this embodiment, all of which contain an anti-CD19 scFv domain, a truncated CD8 hinge domain, and a Gal4VP64 domain. For the selection of STS and TMD domains, four constructs are included: CLSTN1 TMD and CLSTN1 STS (SEQ ID NOs. 73), CLSTN2 TMD and CLSTN2 STS (SEQ ID NOs. 74), CLSTN1 TMD and Notch 1 STS (SEQ ID NOs. 75), and CLSTN2 TMD and Notch 1 STS (SEQ ID NOs. 76). Primary human CD4+ T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs, one expressing a hinge receptor with a specified TMD / STS combination and the other expressing a transcriptional reporter with a constitutively expressed anti-ALPPL2 CAR. Cells containing both constructs were selected 5 days after primary T cell stimulation and further proliferated for activation testing. As shown in Figure 14, 1 × 10⁶ cells expressing the receptor were selected. 5 A number of double-positive T cells, 1 × 10⁶ 5 1 x 10¹ K562 cells (Figure "-CAR", blue), or 1 x 10¹ 5 They were co-cultured with 1 × 10⁶ CD19+K562 cells (indicated in red in the "-CAR" diagram). Similarly, 1 × 10⁶ receptor-expressing cells were co-cultured with 1 × 10⁶ 5 A number of double-positive T cells, 1 × 10⁶ 5 ALPPL2+K562 cells (indicated as "+CAR" in the diagram, blue), or 1 × 10⁶ 5 The cells were tested in the presence of CAR activity by co-culturing with individual ALPPL2+CD19+K562 cells (indicated in red in the "+CAR" diagram). Subsequently, the transcriptional activity of the induced BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences).

[0204] Example 20 This example describes Table 3, which illustrates the activation characteristics of the hinge-notch STS mutant without further T cell stimulation.

[0205] Primary human CD4+ T cells were activated with Dynabeads (Gibco) supplemented with anti-CD3 / anti-CD28, and were transduced with two lentiviral constructs, one expressing the hinge receptor and the other expressing a transcriptional reporter with constitutive eGFP-tagged anti-ALPPL2 CAR. Cells containing both constructs were sorted 5 days after primary T cell stimulation and further expanded for activation assays. For the assays, T cells expressing the receptor were co-cultured with K562 cells or CD19+ K562 cells. Subsequently, the BFP reporter gene was measured using Fortessa X-50 (BD Biosciences). The signal-to-noise ratio from the MFI of BFP+ cells under the CD19+ K562 vs K562 conditions was plotted against the Δ change in MFI between the two conditions in the table as shown in Table 3 below.

[0206] Table 3 presents data without stimulation by ALPPL2+ K562 of co-expressed anti-ALPPL2 CAR. "Reporter alone" represents the reporter plasmid and was expressed in all samples.

Table 3

[0207] Example 21 This example describes Table 4 showing the activation characteristics of the hinge-notch STS mutant by T cell stimulation.

[0208] Primary human CD4+ T cells were activated with Dynabeads (Gibco) supplemented with anti-CD3 / anti-CD28 and transduced with two lentiviral constructs, one expressing the hinge receptor and the other expressing a transcriptional reporter with constitutive eGFP+ anti-ALPPL2 CAR expression. Cells containing both constructs were sorted 5 days after primary T cell stimulation and further expanded for activation assays. For the assays, T cells expressing the receptor were co-cultured with K562 cells or CD19+ K562 cells. Subsequently, the BFP reporter gene was measured using a Fortessa X-50 (BD Biosciences). The signal-to-noise ratio from the MFI of BFP+ cells under the CD19+ K562 vs K562 conditions was plotted against the Δ change in MFI for the two conditions in the table. Activation was tested as in Example 19, but co-culture with ALPPL2+ K562 was added for CAR activation.

[0209] Table 4 shows data on anti-ALPPL2 CAR co-expressed and stimulated with ALPPL2+ K562. "Reporter alone" represents the reporter plasmid and was expressed in all samples.

Table 4

[0210] Example 22 This example describes an experiment conducted to demonstrate controlled IL-2 production by T cells engineered with a hinge-notch STS mutant.

[0211] Figure 15A shows T cells engineered with a hinge-notch STS mutant to provide ligand-induced secretion of artificial cytokines for autocrine and paracrine proliferation of T cells. The expression characteristics of the anti-CD19 hinge-notch receptor with specified STS modification are shown in Figure 15B. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs: one expressing a CAR against the MCAM antigen and the other expressing a hinge-notch receptor with an induced super IL2 under Gal4-UAS regulation. Cells containing both constructs were sorted 5 days after primary T cell stimulation and further grown for activation testing. Receptor expression was measured by anti-myc tag staining (y-axis).

[0212] Example 23 This example describes experiments conducted to demonstrate that ligand-induced expression of super IL2 improves the cell viability of CAR-T cells.

[0213] 1×10⁶ cells express the anti-CD19 hinge-notch Notch 1 STS receptor. 5 100 bipositive T cells were co-cultured in media free of IL-2 and K562 cells (upper left), containing CD19+K562 cells that induce hinge-notch (upper right), containing MCAM+K562 cells that induce CAR activation (lower left), or containing MCAM+ cells and CD19+K562 cells that induce activation of both receptors (lower right) (Figure 16). After 9 days, the percentage of viable T cells was evaluated by forward and side scattering measurements using Fortessa X-50 (BD Biosciences). Co-activation of both receptors resulted in the highest cell viability, followed by viability with hinge-notch activity (and subsequent induction of super IL-2), CAR-only activity, and inactivity of both receptors.

[0214] Example 24 This example describes experiments conducted to demonstrate regulated T cell proliferation using a hinge-notch STS mutant.

[0215] Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with two lentiviral constructs: one expressing a CAR against the MCAM antigen, and the other expressing a hinge-notch receptor with a super-IL2 induced under Gal4-UAS regulation (four right-hand figures in Figure 17). The hinge-notch receptor, containing three different STS variants (NRG1, Notch 1, Notch 2), was tested against a hinge-notch-free control. Similarly, primary human T cells were generated without CAR expression (left-hand figure in Figure 17). The T cells were stained with CellTrace Violet reagent (Invitrogen) according to the manufacturer's instructions and co-cultured with CD19+K562 target cells in IL-2-free medium. Proliferation was evaluated by the attenuation of the CTV signal, measured at specified time points using Fortessa X-50 (BD Biosciences).

[0216] Example 25 This example describes experiments conducted to demonstrate the regulated secretion of super IL2 by a hinge-notch STS mutant.

[0217] Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (Gibco) and transduced with the hinge-notch receptor, a lentiviral construct containing induced super IL-2, under Gal4-UAS control (Figure 18A). Three different STS variants (NRG1, Notch 1, Notch 2) of the hinge-notch receptor were tested against a hinge-notch-free reference. T cells were co-cultured with MCAM+CD19+K562 cells in IL-2-deficient medium, and IL-2 in the supernatant was measured at specified time points using an Instant ELISA Kit (Invitrogen) according to the manufacturer's procedure with a microplate reader (Tecan). The red dotted line indicates the standard concentration of IL-2 used in T cell culture. Stepwise secretion of super IL-2 was achieved by activation of the hinge-notch receptor regulated by STS.

[0218] In Figure 18B, primary human T cells were generated by a further lentiviral vector expressing CAR in relation to MCAM. Increased IL-2 uptake by CAR-expressing cells resulted in a loss of supernatant IL2 in CAR alone and in NRG1-STS hinge-notch T cells. In contrast, greater induction of super IL2 by receptors based on notch1-STS and notch2-STS initially overwhelmed this uptake before proliferation and K562 elimination reduced supernatant levels.

[0219] Example 26 This example describes experiments conducted to demonstrate that the regulated secretion of super IL2 by a hinge-notch STS mutant promotes the proliferation of bystander T cells.

[0220] Primary human T cells were activated with Dynabeads (Gibco) to add anti-CD3 / anti-CD28 and transduced with a lentiviral construct containing a hinge-notch receptor with induced super IL2 under Gal4-UAS control (right panel in Figure 19). The hinge-notch receptor, containing three different STS mutants (NRG1, Notch 1, Notch 2), was tested against a hinge-notch-free reference. Hinge-notch T cells were co-cultured with "bystander" T cells stained with CellTrace Far Red (Invitrogen) expressing CAR for MCAM (left panel in Figure 19), or without CAR (right panel in Figure 19). T cells were co-cultured with MCAM+CD19+K562 cells in IL-2-deficient medium, and bystander T cell proliferation was evaluated by measuring signal attenuation on Fortessa X-50 (BD Biosciences). In bystander T cells, regardless of CAR expression, proliferation was progressively enhanced by the STS variant of hinge-notch activated T cells.

[0221] Example 27 This example describes experiments conducted to test a single lentiviral vector construct containing a hinge-notch receptor CAR circuit.

[0222] Primary human T cells were activated with Dynabeads (Gibco) supplemented with anti-CD3 / anti-CD28 and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an inducible anti-MCAM CAR cassette under Gal4-UAS control. These cells were sorted for the expression of the hinge-notch receptor via the myc tag 5 days after primary T cell stimulation and further expanded for activation assays. Three STS mutants were tested as indicated using the constitutively expressed CAR as a control (Figure 20). For the test, 1 × 10 5 T cells expressing the anti-CD19 receptor were co-cultured without additives (upper figure) or with 5 × 10 5 K562 cells (middle figure) or 5 × 10 4 CD19+ K562 cells (lower figure). Subsequently, the transcriptional activity of the inducible CAR was measured by the GFP tag using Fortessa X-50 (BD Biosciences).

[0223] Example 28 This example describes an experiment conducted to demonstrate the killing of specific dual antigen target cells by T cells engineered with a single lentivector containing a hinge-notch CAR circuit.

[0224] Primary human T cells were activated with Dynabeads (Gibco) supplemented with anti-CD3 / anti-CD28 and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an inducible anti-MCAM CAR cassette under Gal4-UAS control. These cells were sorted for the expression of the hinge-notch receptor via the myc tag 5 days after primary T cell stimulation and further expanded for activation assays. Three STS mutants were tested as indicated using the constitutively expressed CAR as a control. For the test, 1 × 10 5 T cells were co-cultured with 5 × 10 5 MCAM+ K562 cells or 5 × 10 4It was co-cultured with individual MCAM+CD19+K562 cells. The killing of target cells was evaluated by forward scatter / side scatter of the K562 population using Fortessa X-50 (manufactured by BD Biosciences). As shown in Figure 21, the hinge-notch circuit effectively and specifically eliminates target cells containing both the MCAM+ antigen and the CD19+ antigen.

[0225] Example 29 This example describes an experiment conducted to test a single lentiviral vector construct containing a hinge-notch receptor for the control of T cell activation and exhaustion.

[0226] Primary human T cells were activated with Dynabeads (Gibco) supplemented with anti-CD3 / anti-CD28 and transduced with a single lentiviral construct containing a constitutively expressed hinge-notch receptor with an inducible anti-MCAM CAR cassette under the control of Gal4-UAS. These cells were sorted for the expression of the hinge-notch receptor via the myc tag 5 days after primary T cell stimulation and further expanded for activation testing. Three STS mutants were tested as indicated using the constitutively expressed CAR as a control. For the test, 1×10 5 individual T cells expressing the anti-CD19 receptor were co-cultured with 5×10 4 individual CD19+K562 cells. Subsequently, the transcriptional activity of the inducible CAR was measured by the GFP tag using Fortessa X-50 (manufactured by BD Biosciences) (the leftmost figure in Figure 22). The activation and exhaustion of T cells were measured by the expression of CD25 and CD39, respectively (Figure 22).

[0227] Example 30 This example describes an experiment conducted for the in vivo test of the hinge-notch vs CAR circuit.

[0228] As shown in Figure 23, in the case of the unilateral tumor, NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NSG) mice were injected with 1×106 Individual K562-BCMA / CD19 tumor cells were subcutaneously transplanted into the left flank. In contralateral tumors, 1 × 10⁶ cells were transplanted into NSG mice. 6 Individual K562-BCMA / CD19 tumor cells were transplanted to the left flank, and 1 × 10⁶ cells were transplanted. 6 A number of K562-CD19 tumor cells were transplanted into the right flank. Four days after tumor transplantation, 2.5 × 10⁶ cells were observed. 6 Individual manipulated primary human CD4+ cells and CD8+ T cells (total 5 x 10⁶ cells) 6 T cells were intravenously injected via tail vein injection. Tumor size was monitored with calipers 2-3 times a week, and the mouse was considered to have reached its endpoint when the tumor size exceeded 20 mm. For immunophenotypic analysis, the tumor and spleen were harvested 10 days after T cell transplantation. The tumor was manually dissected and digested at 37°C for 30 minutes in RPMI-1640 containing 4 mg / mL collagenase IV (Worthington Biochemical) and 0.1 mg / mL DNase I (MilliporeSigma). The spleen was manually dissected and subjected to erythrocyte lysis (ACK; KD medical). Antibodies against CD45 (2D1, 368516, Biolegend), CD3 (UCHT1, 300464, Biolegend), CD4 (SK3, 563552, BD Biosciences), and CD8 (RPA-T8, 563823, BD Biosciences) were used. Dead cells were removed using Draq7 (Abcam). These samples were analyzed using FACSymphony X50 SORP (BD Biosciences), and the data were analyzed using FlowJo software (BD Biosciences).

[0229] Example 31 This example summarizes the experimental results for the Notch receptor described in Table 1, as provided and discussed herein. [Table 5-1] [Table 5-2]

[0230] While specific alternatives to those described herein have been disclosed, it is understood that various modifications and combinations are possible, and that they fall within the true intent and scope of the appended claims. Therefore, no limitation is intended to the exact gist and content of the disclosures presented herein.

[0231] References Dudani JS, Warren AD, and Bhatia SN, Harnessing Protease Activity to Improve Cancer Care. Annu. Rev. Cancer Biol. 2018. 2:353-76. David L. Porter, MD, Bruce L. Levine, Ph.D., Michael Kalos, Ph.D., Adam Bagg, MD, and Carl H. June, MD. Chimeric Antigen Receptor-Modified T Cells in Chronic Lymphoid Leukemia. N. Engl J Med. 2011 Aug 25; 365(8):725-33. Gordon WR et al., The molecular logic of Notch signaling - a structural and biochemical perspective. J. Cell Sci. (2008) 121:3109-19. Gordon WR et al., Mechanical Allostery: Evidence for a Force Requirement in the Proteolytic Activation of Notch. Dev Cell (2015) 33:729-36. Morsut L, Roybal KT, Xiong X, Gordley RM, Coyle SM, Thomson M, and Lim WA. Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors. Cell. 2016 February 11; 164(4):780-91. Naso MF, Tomkowicz B, Perry WL 3rd, Strohl WR. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs. 2017; 31(4):317-34. Nasri M, Karimi A, Allahbakhshian Farsani M. Production, purification and titration of a lentivirus-based vector for gene delivery purposes. Cytotechnology. 2014; 66(6):1031-38. Roybal KT, Jasper Z. Williams, Leonardo Morsut, Levi J. Rupp, Isabel Kolinko, Joseph H. Choe, Whitney J. Walker, Krista A. McNally, and Wendell A. Lim. Engineering T cells with Customized Therapeutic Response Programs Using Synthetic Notch Receptors. Cell. 2016 Oct 6; 167(2):419-32. Samulski and Muzyczka (2014). AAV-Mediated Gene Therapy for Research and Therapeutic Purposes. Annu. Rev. Virol. 1:427. Sakuma, et al. (2012). Lentiviral vectors: basic to translational. Biochem. J. 443:603. Watson DJ, Wolfe JH. Viral vectors for gene therapy: methods and protocols. Totowa, NJ, USA: Humana Press; 2003. pp. 383-404. Vidarsson G. et al., IgG subclasses and allotypes: from structure to effector functions. Frontiers Immunol. (2014) Oct 20; 5:520.

Claims

1. It is a chimeric polypeptide, and from the N-terminus to the C-terminus a) Extracellular ligand-binding domain having binding affinity to a selected ligand; b) Hinge domains that can promote oligomer formation of the chimeric polypeptide via intermolecular disulfide bonds; c) Transmembrane domains containing one or more ligand-induced proteolytic cleavage sites; and d) Containing an intracellular domain that includes a transcription regulator, When the selected ligand binds to the extracellular ligand-binding domain, cleavage is induced at a ligand-induced proteolytic cleavage site located between the transcription factor and the hinge domain, and The chimeric polypeptide is a chimeric polypeptide that does not contain the LIN-12-Notch repeat (LNR) and / or the heterodimerization domain (HD) of the Notch receptor.

2. The chimeric polypeptide according to claim 1, wherein the transmembrane domain further comprises a transport termination sequence.

3. The chimeric polypeptide according to claim 1 or 2, wherein the extracellular domain includes an antigen-binding moiety capable of binding to a ligand on the surface of a cell.

4. The chimeric polypeptide according to claim 3, wherein the cells are pathogens.

5. The chimeric polypeptide according to claim 3, wherein the cells are human cells.

6. The chimeric polypeptide according to claim 5, wherein the human cells are tumor cells.

7. The chimeric polypeptide according to claim 5, wherein the human cells are terminally differentiated cells.

8. The chimeric polypeptide according to any one of claims 1 to 7, wherein the ligand comprises a protein or a carbohydrate.

9. The ligands include CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD 52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, C D95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2) A chimeric polypeptide according to any one of claims 1 to 8, selected from the group consisting of CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphate defoliation, placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), and signal regulatory protein α (SIRPα).

10. The chimeric polypeptide according to any one of claims 1 to 9, wherein the ligand is selected from cell surface receptors, adhesive proteins, integrins, mucins, lectins, tumor-associated antigens, and tumor-specific antigens.

11. The chimeric polypeptide according to any one of claims 1 to 10, wherein the ligand is a tumor-associated antigen or a tumor-specific antigen.

12. The chimeric polypeptide according to any one of claims 1 to 11, wherein the extracellular ligand-binding domain includes a ligand-binding portion of the receptor.

13. The antigen-binding portion is an antibody, nanobody, diabody, triabody, minibody, F(ab'). 2 A chimeric polypeptide according to any one of claims 3 to 12, selected from the group consisting of a fragment, an F(ab)v fragment, a single-chain variable fragment (scFv), a single-domain antibody (sdAb), and functional fragments thereof.

14. The chimeric polypeptide according to claim 13, wherein the antigen-binding portion includes scFv.

15. The antigen-binding portion includes CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, C D38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, EphrinB2, FAP, FLT3, GD2, GD3, GM3, GPR A chimeric polypeptide according to any one of claims 3 to 14, which specifically binds to a tumor-associated antigen selected from the group consisting of C5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

16. The chimeric polypeptide according to claim 15, wherein the tumor-associated antigen is CD19, BCMA, CEA, HER2, MUC1, CD20, ALPPL2, SIRPα, or EGFR.

17. The chimeric polypeptide according to claim 16, wherein the tumor-associated antigen is CD19, BCMA, HER2, or ALPPL2.

18. The chimeric polypeptide according to any one of claims 1 to 17, wherein the one or more ligand-induced proteolytic cleavage sites include a γ-secreting enzyme cleavage site.

19. The chimeric polypeptide according to any one of claims 1 to 18, wherein the transcription regulator comprises a transcription activator or a transcription repressor.

20. The chimeric polypeptide according to any one of claims 1 to 19, wherein the intracellular domain comprises a nuclear localization sequence and a transcription regulatory factor sequence selected from the group consisting of Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16.

21. A chimeric polypeptide according to any one of claims 1 to 20, further comprising: further proteolytic cleavage sites, signal sequences, detectable labels, tumor-specific cleavage sites, disease-specific cleavage sites, and combinations thereof.

22. The chimeric polypeptide according to any one of claims 1 to 21, wherein the hinge domain is derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant thereof.

23. The chimeric polypeptide according to any one of claims 1 to 22, wherein the hinge domain is derived from a CD8α hinge domain or a functional variant thereof.

24. The chimeric polypeptide according to any one of claims 1 to 22, wherein the hinge domain is derived from a CD28 hinge domain or a functional variant thereof.

25. The chimeric polypeptide according to any one of claims 1 to 22, wherein the hinge domain is derived from an OX40 hinge domain or a functional variant thereof.

26. The chimeric polypeptide according to any one of claims 1 to 22, wherein the hinge domain is derived from an IgG4 hinge domain or a functional variant thereof.

27. The chimeric polypeptide according to any one of claims 1 to 26, wherein the hinge domain comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 12-16 and 39-42.

28. The chimeric polypeptide according to any one of claims 1 to 27, wherein the transport termination sequence comprises an amino acid sequence having at least 80% sequence identity with any one of sequence numbers 18-19, 43-63, 79, and 80.

29. The chimeric polypeptide according to any one of claims 1 to 28, wherein the transmembrane domain comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 17, 77, and 78.

30. a) The hinge domain comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 12-16 and 39-42; b) The transmembrane domain comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 17, 77, and 78; and c) The chimeric polypeptide according to any one of claims 1 to 29, wherein the transport termination sequence domain comprises an amino acid sequence having at least 80% sequence identity with any one of sequence numbers 18-19, 43-63, 79, and 80.

31. The chimeric polypeptide according to any one of claims 1 to 30, wherein the chimeric polypeptide comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 1 to 8, 24 to 35, and 73 to 76.

32. Recombinant nucleic acids comprising a nucleotide sequence encoding a chimeric polypeptide according to claims 1 to 31.

33. The recombinant nucleic acid according to claim 32, wherein the nucleotide sequence is incorporated in an expression cassette or expression vector.

34. The recombinant nucleic acid according to claim 33, wherein the expression vector is a viral vector.

35. The recombinant nucleic acid according to claim 34, wherein the viral vector is a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a retroviral vector.

36. a) The chimeric polypeptide according to any one of claims 1 to 31; and / or b) Recombinant cells comprising the recombinant nucleic acid described in any one of claims 32 to 35.

37. The recombinant cell according to claim 36, wherein the recombinant cell is a eukaryotic cell.

38. The recombinant cell according to claim 37, wherein the eukaryotic cell is a mammalian cell.

39. The recombinant cell according to claim 38, wherein the mammalian cell is an immune cell, nerve cell, epithelial cell, endothelial cell, or stem cell.

40. The recombinant cell according to claim 39, wherein the immune cell is a B cell, monocyte, natural killer cell, basophil, eosinophil, neutrophil, dendritic cell, macrophage, regulatory T cell, helper T cell, cytotoxic T cell, or other T cell.

41. a) the first chimeric polypeptide and the second chimeric polypeptide according to any one of claims 1 to 31; and / or b) comprising the first nucleic acid and the second nucleic acid according to any one of claims 32 to 35, Recombinant cell according to any one of claims 36 to 40, wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence, and / or the first nucleic acid or the second nucleic acid do not have the same sequence.

42. The recombinant cell according to claim 41, wherein the first chimeric polypeptide modulates the expression and / or activity of the second chimeric polypeptide.

43. Recombinant cell according to any one of claims 36 to 42, further comprising an expression cassette encoding a protein operably linked to a promoter, wherein the expression of the protein is regulated by the transcription factor.

44. The recombinant cell according to claim 43, wherein the protein is heterogeneous to the cell.

45. The recombinant cell according to claim 44, wherein the promoter is the yeast GAL4 promoter.

46. The recombinant cell according to any one of claims 43 to 45, wherein the protein is a cytokine, cytotoxin, chemokine, immunomodulator, pro-apoptotic factor, anti-apoptotic factor, hormone, differentiation factor, dedifferentiation factor, immune cell receptor (e.g., TCR or CAR), or reporter.

47. A cell culture comprising at least one recombinant cell and culture medium according to any one of claims 36 to 46.

48. A pharmaceutically acceptable carrier, and a) Recombinant nucleic acids according to any one of claims 32 to 35; and b) A pharmaceutical composition comprising one or more recombinant cells as described in any one of claims 36 to 46.

49. The pharmaceutical composition according to claim 48, comprising a recombinant nucleic acid according to any one of claims 32 to 35 and a pharmaceutically acceptable carrier.

50. The pharmaceutical composition according to claim 49, wherein the recombinant nucleic acid is encapsulated within a viral capsid or lipid nanoparticles.

51. A method for regulating cell activity, a) A step of providing recombinant cells according to any one of claims 36 to 46; and b) The step of bringing the recombinant cells into contact with a selected ligand, A method comprising: when the selected ligand binds to the extracellular ligand-binding domain, it induces cleavage of a ligand-induced proteolytic cleavage site, releasing a transcription regulator, and the released transcription regulator modulates the activity of the recombinant cell.

52. The method according to claim 51, wherein the contact is performed in vivo, in vitro, or within a laboratory apparatus.

53. The method according to claim 51 or 52, wherein the regulated cellular activity is selected from the group consisting of selected gene expression, proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, molecular secretion, cell adhesion, and cytolytic activity.

54. The method according to any one of claims 51 to 53, wherein the released transcription factor regulates the expression of the gene product of the cell.

55. The method according to any one of claims 51 to 53, wherein the released transcription factor regulates the expression of a heterologous gene product.

56. The method according to claim 54 or 55, wherein the gene product of the cell is selected from the group consisting of chemokines, chemokine receptors, chimeric antigen receptors, cytokines, cytokine receptors, differentiation factors, growth factors, growth factor receptors, hormones, metabolic enzymes, pathogen-derived proteins, growth-inducing factors, receptors, RNA guide nucleases, site-specific nucleases, T cell receptors, toxins, toxin-derived proteins, transcription regulators, transcription activators, transcription repressors, translation regulators, translation activators, translation repressors, activated immune receptors, antibodies, apoptosis inhibitors, apoptosis inducers, artificial T cell receptors, immunoactivators, immunosuppressors, and suppressive immune receptors.

57. The method according to any one of claims 51 to 56, wherein the released transcription factor regulates the differentiation of the cells, and the cells are immune cells, stem cells, progenitor cells, or precursor cells.

58. A method for inhibiting the activity of target cells in an individual, A method comprising the step of administering an effective number of recombinant cells according to any one of claims 36 to 46 to the individual, wherein the recombinant cells inhibit the activity of the target cells in the individual.

59. The method according to claim 58, wherein the target cells are pathogenic cells.

60. The method according to claim 59, wherein the pathogenic cells are cancer cells.

61. The method according to claim 57, wherein the target cancer cells are acute myeloma leukemia cells, undifferentiated lymphoma cells, astrocytoma cells, B-cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, liver cancer cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T-cell lymphoma cells, kidney cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, or sarcoma cells.

62. A method of treating the health condition of an individual that requires it, A method comprising the step of administering a first therapy to an individual, comprising an effective number of recombinant cells according to any one of claims 36 to 46, wherein the recombinant cells treat the health condition of the individual.

63. The method according to claim 62, further comprising the step of administering a second therapy to the individual.

64. The method according to claim 63, wherein the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormone therapy, and toxin therapy.

65. The method according to claim 63 or 64, wherein the first therapy and the second therapy are administered together with the same composition or with separate compositions.

66. The method according to claim 65, wherein the first therapy and the second therapy are administered simultaneously.

67. The method according to claim 63 or 64, wherein the first therapy and the second therapy are administered sequentially.

68. The method according to claim 67, wherein the first therapy is administered before the second therapy.

69. The method according to claim 67, wherein the first therapy is administered after the second therapy.

70. The first therapy and the second therapy are administered alternately. The method according to claim 67.

71. A system that modulates cell activity, inhibits target cancer cells, or treats the health condition of an individual that requires such a system, a) The chimeric polypeptide according to any one of claims 1 to 31; b) Recombinant nucleic acid according to any one of claims 32 to 35; c) Recombinant cells according to any one of claims 36 to 46; and d) A system comprising at least one of the pharmaceutical compositions described in any one of claims 48 to 50.

72. A method for generating recombinant cells according to any one of claims 36 to 46, a) A step of providing cells capable of expressing proteins; and b) A method comprising the step of contacting the provided cells with the recombinant nucleic acid described in any one of claims 32 to 35.

73. The method according to claim 72, wherein the cells are collected by a leukocyte apheresis performed on a sample obtained from a subject, and the cells are brought into contact with the body in vitro.

74. The method according to claim 72, wherein the recombinant nucleic acid is encapsulated within a viral capsid or lipid nanoparticles.

75. For the treatment of health conditions a) The chimeric polypeptide according to any one of claims 1 to 31; b) Recombinant nucleic acid according to any one of claims 32 to 35; c) Recombinant cells according to any one of claims 36 to 46; and d) Use of at least one of the compositions described in any one of claims 48 to 50.

76. The use according to claim 75, wherein the aforementioned health condition is cancer.

77. The use according to claim 76, wherein the cancer is a solid tumor, a soft tissue tumor, or a metastatic lesion.

78. Use of the invention according to any one of claims 1 to 74 for the manufacture of a pharmaceutical product for treating a health condition.

Images