Drug therapy for cancer with UTX function deficiency
A PARP inhibitor-based pharmaceutical composition targets UTX-deficient cancers, addressing the lack of effective treatments for prostate cancer by inhibiting tumor growth and utilizing a companion diagnostic to select appropriate cancer cells.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-12
- Publication Date
- 2026-03-25
AI Technical Summary
Current technologies lack effective therapeutic agents for prostate cancer caused by UTX function deficiency, and there is a need to clarify the mechanism of prostate cancer development due to UTX deletion to develop targeted treatments.
A pharmaceutical composition containing a poly ADP-ribose polymerase (PARP) inhibitor is developed to treat UTX function-deficient cancers, along with a companion diagnostic agent to select cancer cells with UTX gene mutations but no BRCA gene mutations for targeted treatment.
PARP inhibitors demonstrate growth inhibitory effects on UTX function-deficient solid tumors, providing a targeted therapeutic option for prostate cancer and other UTX-deficient cancers, excluding those with BRCA gene mutations.
Smart Images

Figure 2026053308000001 
Figure 2026053308000002 
Figure 2026053308000003
Abstract
Description
[Technical Field]
[0001] This invention relates to a novel pharmaceutical agent for cancer cells with UTX function deficiency, for which no selective therapeutic agents have previously existed. The invention also relates to a companion diagnostic agent for use with this pharmaceutical agent. [Background technology]
[0002] It is known that methylated histone H3 at lysine position 27 (K27) suppresses transcription in the gene region to which that histone H3 binds. However, demethylation of this methylated K27 by the H3K27 demethylase enzyme activates transcription in the gene region to which that histone H3 binds. Such epigenetic regulation, including histone modifications, is important for maintaining tissue homeostasis, and its disruption is deeply involved in carcinogenesis.
[0003] UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome), a demethylase of the 27th lysine residue of histone H3 on the sex chromosome (histone H3K27), is thought to contribute to transcriptional activity by demethylating H3K27 and opening up the chromatin structure (Non-Patent Literature 1). While UTX mutations are found in many cancers, it has been reported that UTX mutations account for approximately 8% of prostate cancers (Non-Patent Literature 2), making it the second most common cancer in the urological field after bladder cancer.
[0004] However, because the mechanism of prostate cancer development due to UTX deletion has not been clarified with conventional technology, it was unknown which drugs would be effective for patients with UTX-deleted prostate cancer. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Hong S et al., Proc Natl Acad Sci U S A. 2007 Nov 20;104(47):18439-44 [Non-Patent Document 2] Joni Van der Meulen et al., Epigenetics. 2014 May 1; 9(5): 658-668 [Summary of the Invention] [Problems to be Solved by the Invention]
[0006] An object of the present invention is to clarify the mechanism of prostate cancer development due to UTX deletion, and based on the development mechanism, to develop a drug effective for the treatment of UTX deletion prostate cancer patients. [Means for Solving the Problems]
[0007] The inventors of the present invention have found that a poly ADP-ribose polymerase (PARP) inhibitor has a growth inhibitory effect on cancer having UTX functional deficiency, and as a result, by providing a pharmaceutical composition for the treatment of cancer having UTX functional deficiency, which contains a PARP inhibitor as an active ingredient, it has been shown that the above problems can be solved. The inventors of the present invention have also provided a companion diagnostic agent for selecting a PARP inhibitor as a therapeutic or preventive drug, by using, as an index, the fact that in cancer cells collected from a patient having solid cancer, there are no mutations in the BRCA gene and there are mutations in the UTX gene, whereby it has been shown that the application target of the pharmaceutical composition of the present invention can be more accurately selected.
[0008] More specifically, the present application provides the following aspects in order to solve the above-described problems: [1] A pharmaceutical composition for the treatment of solid cancer having a deficiency in the function of UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome), which contains a poly ADP-ribose polymerase (PARP) inhibitor as an active ingredient; [2]: The pharmaceutical composition according to [1], wherein the PARP inhibitor is selected from the group consisting of olaparib, niraparib, talazoparib, veliparib, lucaparib, pamiparib, stenoparib, fluzoparib, nesparib, benadaparib, salparib, and atamparib; [3]: The pharmaceutical composition according to [1], wherein the PARP inhibitor is selected from the group consisting of olaparib, veliparib, lucaparib, pamiparib, and atamparib; [4]: The pharmaceutical composition according to [1], wherein the PARP inhibitor is olaparib or pamiparib; [5]: A solid tumor having UTX function deficiency is selected from the group consisting of prostate cancer, bladder cancer, adenoid cystic carcinoma, meningioma, renal cell carcinoma, and esophageal cancer, according to any one of [1] to [4]; [6]: The pharmaceutical composition according to any one of [1] to [4], wherein the solid tumor having a UTX function deficiency is prostate cancer; [7]: The pharmaceutical composition according to any one of [1] to [4], wherein the solid tumor is a solid tumor that does not have a mutation in the BRCA gene; [8]: A method for analyzing mutations that cause functional reduction in the UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome) gene, which includes analyzing the base sequence of the UTX gene for selecting cancer cells taken from patients with solid tumors as therapeutic or prophylactic agents, and determining whether the cancer cells have mutations that cause functional reduction in the UTX gene, indicating that the cancer cells are targets for administration of PARP inhibitors as therapeutic or prophylactic agents; [9]: The method of analyzing the base sequence is selected from the group consisting of identifying mutations by real-time PCR using probes for known mutation sites of the UTX gene, identifying known or unknown mutations of the UTX gene by whole base sequencing of the UTX gene, or identifying mutations of the UTX gene by comprehensive gene analysis using NGS, as described in [8];
[10] : The analytical method described in [8] or [9], in which a mutation causing a reduction in function in the UTX gene is an indicator that cancer cells have a nucleotide mutation in the UTX gene that causes any of the following: deletion, substitution, or insertion of an amino acid;
[11] : The analytical method described in
[10] , further indicating that cancer cells do not have mutations in the BRCA gene that cause functional reduction;
[12] : The analytical method described in
[11] for determining whether cancer cells taken from patients with solid tumors have mutations in the BRCA gene that cause functional reduction, and for excluding cancer cells with mutations in the BRCA gene that cause functional reduction from treatment with PARP inhibitors;
[13] : In cancer cells taken from patients with solid tumors, A process for detecting the presence or absence of mutations in the UTX gene; A step in which a PARP inhibitor is selected as a therapeutic or prophylactic agent for cancer cells, using the presence of a mutation in the UTX gene that causes functional reduction in cancer cells as an indicator. A screening method for cancer cells whose proliferation is suppressed by PARP inhibitors, including [specific example];
[14] : In cancer cells taken from patients with solid tumors, The nucleotide sequence of the BRCA gene was analyzed to detect the presence or absence of mutations in the BRCA gene; A process of selecting cancer cells to be treated with therapeutic or prophylactic drugs, including PARP inhibitors, based on the indicator that the cancer cells do not have mutations in the BRCA gene that cause functional reduction. A method for screening cancer cells whose proliferation is inhibited by the PARP inhibitor described in
[13] , including the above. [Effects of the Invention]
[0009] The present invention has found that PARP inhibitors have a growth inhibitory effect on solid tumors having UTX function deficiency, and as a result, it is possible to provide a pharmaceutical composition for the treatment of solid tumors having UTX function deficiency, which contains a PARP inhibitor as an active ingredient.
[0010] The present invention also provides a companion diagnostic agent for selecting a PARP inhibitor as a therapeutic or prophylactic agent, which is used as an indicator to select a PARP inhibitor as a therapeutic or prophylactic agent in cancer cells taken from a patient with a solid tumor, where the cancer cells do not have a mutation in the BRCA gene but do have a mutation in the UTX gene. [Brief explanation of the drawing]
[0011] [Figure 1] Figure 1 shows an overview of the mutant Utx gene used to create mice specifically lacking Utx in the prostate. [Figure 2] Figure 2 shows an overview of the genetic engineering process used to create mice lacking Uty throughout their bodies. [Figure 3] Figure 3 shows the expression of UTX and UTY proteins in prostate tissue from wild-type mice (Ctrl) and Utx-deficient and Uty-deficient mice (UtxΔ, UtyKO). [Figure 4] Figure 4 shows the results of transcriptome analysis of cDNA libraries derived from UtxΔ, UtyKO mouse prostate tissue and Utx+, UtyKO mouse prostate tissue, revealing that the ATM pathway, known as a DNA damage response pathway, was downregulated in the prostate of UtxΔ, UtyKO mice. [Figure 5] Figure 5 shows the results of an investigation into the effects of Utx gene deletion on DNA repair mechanisms. [Figure 6] Figure 6 shows the changes in the Utx gene sequence in Utx KO cell lines compared to the sequence in Mock cells where no changes occurred, and also shows that Utx protein expression was not observed in Utx KO cell lines even in Western blotting. [Figure 7] Figure 7 shows the results of in vivo testing of the effects of a PARP inhibitor (olaparib) on prostate cancer cells with UTX functional loss that were transplanted subcutaneously into mice. [Figure 8]Figure 8 shows the results of evaluating the in vitro growth inhibitory effect of the PARP inhibitor (olaparib) using UTX-deficient prostate cancer cell lines (Utx KO) and control cell lines (Ctrl). [Figure 9-1] Figure 9-1 shows the results of evaluating the in vitro growth inhibitory effects of various PARP inhibitors other than olaparib (pamiparib, atamparib) using UTX-deficient prostate cancer cell lines (Utx KO) and control cell lines (Ctrl). [Figure 9-2] Figure 9-2 shows the results of evaluating the in vitro growth inhibitory effects of various PARP inhibitors other than olaparib (veliparib, rucaparib) using UTX-deficient prostate cancer cell lines (Utx KO) and control cell lines (Ctrl). [Modes for carrying out the invention]
[0012] The inventors of this invention have developed mice in which Utx is specifically deleted from prostate tissue (Utx Δ We created a UTX-deficient molecule and investigated the mechanism of prostate cancer development. Specifically, we examined the changes in gene expression caused by UTX deletion in the prostate and found that UTX function deletion resulted in inactivation of the DNA damage repair pathway (ATM pathway). Based on these results, the inventors of this invention hypothesize that UTX function deletion may contribute to the development of prostate cancer by reducing DNA damage repair capacity.
[0013] Based on these results, we hypothesized that PARP (poly(ADP-ribose)polymerase) inhibitors, which inhibit cancer cell proliferation by utilizing synthetic lethality, possess anticancer effects, and therefore evaluated the therapeutic effect of olaparib, one of the PARP inhibitors. The results indicated that olaparib administration may be effective in prostate cancer with UTX functional loss.
[0014] Based on this finding, the present invention can, in a first aspect, provide a pharmaceutical composition for the treatment of solid tumors having UTX function deficiency, comprising a PARP inhibitor as an active ingredient.
[0015] PARP (poly-ADP-ribose polymerase) is an enzyme involved in DNA damage repair, particularly single-strand break type DNA damage repair. It binds to DNA break sites, uses NAD (nicotinamide dinucleotide) as a substrate, breaks down NAD into ADP-ribose and nicotinamide, and then binds ADP-ribose to PARP to form poly-ADP-ribose, which attracts proteins responsible for base excision repair to the damaged site.
[0016] When a single-strand break occurs in DNA, the DNA is repaired through base excision repair by the function of PARP, allowing the cell to survive. On the other hand, if a single-strand break is not repaired, a double-strand break occurs, but in such cases, it was known that the DNA is repaired through the mechanism of homologous recombination, allowing the cell to survive.
[0017] By utilizing the mechanism of DNA double-strand damage repair, it is possible to induce cell death in cells if a situation can be created in which single-strand break type DNA damage repair does not occur, and homologous recombination repair also does not occur. Such cell death is called synthetic lethality in this technology.
[0018] Based on the mechanism of action of DNA double-strand damage repair in such cells and the concept of synthetic lethality, drugs that can induce synthetic lethality in tumor cells by applying PARP inhibitors to tumor cells with mutations in the BRCA gene involved in homologous recombination repair and inhibiting the enzymatic activity of PARP (Lynparza (registered trademark, generic name: olaparib), Zejura (registered trademark, generic name: niraparib), Tarzena (registered trademark, generic name: talazoparib)) have been approved and marketed.
[0019] However, the currently approved indications for prostate cancer using PARP inhibitor monotherapy are all limited to tumor cells with mutations in the BRCA gene.
[0020] This invention is based on the finding that UTX function loss contributes to the development of prostate cancer by reducing the ability to repair double-strand DNA damage, and on the finding that PARP inhibitors exert an anticancer effect against solid cancer cells with UTX function loss. This action demonstrates that PARP inhibitors can be used as a candidate therapeutic agent for solid cancers with UTX function loss, for which no effective selective therapeutic agent has existed until now. In other words, solid cancer cells with UTX function loss are solid cancer cells with reduced ability to repair double-strand DNA damage, and such solid cancers are the target of treatment with the pharmaceutical composition of this invention.
[0021] In the pharmaceutical composition of the present invention, the PARP inhibitor that can be used as the active ingredient may be a PARP inhibitor that is currently approved as a pharmaceutical drug, or a PARP inhibitor that is not currently approved. Specifically, as PARP inhibitors that are currently approved as pharmaceutical drugs, Lynparza (registered trademark, generic name: olaparib), Zejura (registered trademark, generic name: niraparib), and Tarzena (registered trademark, generic name: talazoparib) can be used as the active ingredient in the pharmaceutical composition of the present invention, and as other PARP inhibitors, veliparib, lucaparib, pamiparib, stenoparib, fluzoparib, nesparib, benadaparib, salparib, atamparib, etc. can be used. Of these, olaparib, veliparib, lucaparib, pamiparib, and atamparib can be used more preferably, and olaparib or pamiparib can be used even more preferably.
[0022] In the pharmaceutical composition of the present invention, the target solid tumors for treatment are any solid tumors that have a UTX function deficiency. Solid tumors known to date that have a UTX function deficiency include prostate cancer, bladder cancer, adenoid cystic carcinoma, meningioma, renal cell carcinoma, and esophageal cancer, all of which are targets for treatment with the pharmaceutical composition of the present invention. Furthermore, solid tumors with a UTX function deficiency that are not currently known but may be discovered in the future are also targets for treatment with the pharmaceutical composition of the present invention. In the present invention, prostate cancer is particularly preferred as the target solid tumor with a UTX function deficiency for treatment.
[0023] As described above, the pharmaceutical composition of the present invention is characterized by its target treatment of solid tumors having UTX function deficiency. Therefore, unlike conventional approved drugs that target cancers with BRCA gene mutations, the present invention does not target cancers with BRCA gene mutations, but rather cancers with UTX function deficiency. Accordingly, the solid tumors targeted for treatment by the present invention are also characterized by being solid tumors that do not have BRCA gene mutations.
[0024] As described above, the pharmaceutical composition of the present invention is characterized in that it does not target cancers with mutations in the BRCA gene, but rather solid tumors with UTX functional deficiency. Therefore, in order to select the pharmaceutical composition of the present invention as a therapeutic agent, it is necessary to determine whether the solid tumor in a patient with solid tumor has a mutation in the UTX gene and is functionally deficient.
[0025] Therefore, based on this viewpoint, as a second aspect of the present invention, the present invention also provides a method for analyzing mutations that cause functional reduction in the UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome) gene, which includes analyzing the base sequence of the UTX gene for selecting a PARP inhibitor as a therapeutic or prophylactic agent for cancer cells collected from a patient with a solid tumor, and determining whether or not the cancer cells have a mutation that causes functional reduction in the UTX gene, indicating that the cancer cells are targets for administration of a PARP inhibitor as a therapeutic or prophylactic agent.
[0026] The analytical method in this aspect of the present invention can be used as a companion diagnostic when selecting therapeutic or prophylactic drugs for cancer cells. In other words, by analyzing the base sequence of the UTX gene in cancer cells and determining whether the cancer cells have mutations that cause a reduction in the function of the UTX gene, indicating that PARP inhibitors are targets for therapeutic or prophylactic drug administration, PARP inhibitors can be selected as therapeutic or prophylactic drugs for cancer cells collected from patients with solid tumors.
[0027] Mutations that cause functional reduction in the UTX gene include both known and unknown mutations, but in this invention, it is preferable to detect any mutation, whether known or unknown. Therefore, methods for analyzing the base sequence may include identifying mutations by real-time PCR using probes for known mutation sites in the UTX gene, identifying known or unknown mutations in the UTX gene by whole-base sequencing of the UTX gene, or identifying mutations in the UTX gene by comprehensive gene analysis using NGS (Next Generation Sequencing).
[0028] In the present invention, mutations that cause functional reduction in the UTX gene to be detected can be indicated by having a nucleotide mutation that causes any of the following mutations in the UTX gene: deletion, substitution, or insertion of an amino acid. The present invention is characterized by selecting a PARP inhibitor as a therapeutic or prophylactic agent when cancer cells have such mutations. Since it is a condition that cancer cells have reduced UTX function in order to apply the pharmaceutical composition of the present invention, the companion diagnostic agent needs to detect a nucleotide mutation in the UTX gene that actually causes any of the following mutations in the UTX protein: deletion, substitution, or insertion of an amino acid.
[0029] The pharmaceutical composition of the present invention needs to be differentiated from known pharmaceutical compositions that already contain approved PARP inhibitors. As mentioned above, all known pharmaceutical compositions that already contain approved PARP inhibitors target cancer cells having BRCA mutations as therapeutic targets. Therefore, the pharmaceutical composition of the present invention has the additional feature of further detecting cancer cells that do not have BRCA mutations as therapeutic targets.
[0030] To support these additional characteristics, an analytical method that can be used as a companion diagnostic can further indicate whether cancer cells have mutations in the BRCA gene that cause functional reduction. More specifically, it can determine whether cancer cells collected from patients with solid tumors have mutations in the BRCA gene that cause functional reduction, and cancer cells with such mutations can be excluded from treatment with PARP inhibitors.
[0031] The present invention also relates to cancer cells collected from patients with solid tumors, according to the features described above. A process for detecting the presence or absence of mutations in the UTX gene; A screening method for cancer cells whose proliferation is suppressed by a PARP inhibitor can also be provided, which includes a step of selecting a PARP inhibitor as a therapeutic or prophylactic agent for cancer cells, using as an indicator that the cancer cells have a mutation that causes a reduction in function in the UTX gene. The above-described analytical method is used to screen for target recipients of the pharmaceutical composition of the present invention.
[0032] The pharmaceutical composition of the present invention is characterized by excluding cancer cells having mutations in the BRCA gene from the target of treatment. Therefore, in the screening method described above, For cancer cells collected from patients with solid tumors, The BRCA gene sequence was analyzed to detect the presence or absence of mutations in the BRCA gene; The method may further include a step of selecting cancer cells as targets for treatment with a therapeutic or prophylactic agent, including a PARP inhibitor, based on the indicator that the cancer cells do not have mutations in the BRCA gene that cause functional reduction.
[0033] The present invention will be specifically illustrated below with reference to examples. The examples shown below do not limit the present invention in any way. [Examples]
[0034] Example 1: Generation of male mice that do not express prostate-specific functional UTX proteins. In this example, mice were created that specifically lacked Utx in the prostate gland.
[0035] To create mice with a Utx-deficient gene that does not express a prostate-specific functional UTX protein, we previously created a Utx gene in which exons 11 and 12 are flanked by two loxP sites. flox / floxMice (Kobatake K, et al., Clin Cancer Res. 2020, 26(8), 2065-79) were crossed with an improved Probasin Cre mouse (PB-iCre mouse) (Kanayama M, et al., Prostate Int. 2018, 6(3), 99-103) that specifically expresses Cre recombinase in the prostate (see Figure 1). As a result, Utx-deficient mice (Utx Δ ) with a Utx gene that specifically lacks exons 11 and 12 in the prostate and cannot express functional UTX protein in prostate tissue, that is, PB-iCre / Utx flox ,Uty + male mice or PB-iCre / Utx flox / flox female mice were obtained.
[0036] Furthermore, to enhance the accuracy of evaluating the loss of function of the UTX protein, in addition to prostate-specific Utx gene deletion, mice (Utx Δ , Uty KO ) with deletion of the Uty gene, which is a homolog of Utx and encoded on the Y chromosome, were generated. For this purpose, first, male mice (Utx + , Uty KO ) with global deletion of Uty were generated as follows (see Figure 2), and then, by mating with female Utx-deficient mice (Utx Δ ) with a gene that does not express functional UTX protein specifically in the prostate prepared as described above, mice (Utx Δ , Uty KO ) in which both UTX protein and UTY protein do not function properly in prostate tissue were obtained.
[0037] When a crRNA (Fasmac) targeting CCCTGATCGA CTGTAATGTC TGT, a portion of exon 7 of the Uty gene (CATTTTCAGC TGGCCCTGAT CGACTGTAAT GTCTGT (SEQ ID NO.: 1)), was microinjected into the pronucleus of mouse fertilized eggs along with tracrRNA (Fasmac) and Cas9 protein (New England Biolabs), Uty-deficient mice (Uty) with the following mutation (deletion) in the Uty gene were observed. KO The result obtained was CATTTCAGC TGGCCCTGTA ATGTCTGT (8 base deletion of ATCGACTG) (SEQ ID NO.: 2). The resulting Uty KO Mice and the above-mentioned prostate-specific Utx-deficient mice (Utx Δ ) were crossed to produce Utx-deficient and Uty-deficient mice (Utx Δ Uty KO ) was obtained.
[0038] Both Utx and Uty are unmodified wild-type mice (Utx + Uty + Prostate tissue from ) was used as a control sample (Ctrl), and Utx Δ Uty KO Mouse prostate tissue was collected as test samples. These mouse prostate tissues were homogenized in sample buffer using a homogenizer pestle, boiled at 95°C for 5 minutes, and then subjected to Western blotting.
[0039] For Western blotting, the primary antibody is: ·Anti-KDM6A (Cell Signaling Technology, UTX (D3Q1I) Rabbit mAb #33510) diluted 1 / 1000 times, • Dilute anti-UTY (Cell Signaling Technology, UTY (E4X6V) Rabbit mAb #67886) to 1 / 500th dilution, or • Anti-α-Tublin, mouse monoclonal (SIGMA-ALDRICH, #T6199) diluted 1 / 5000 times. The secondary antibody used is, • Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (cytiva, NA934-1ML), or ·anti-Mouse IgG, HRP-Linked Whole Ab Sheep(cytiva, NA931-1ML) Each was used at a 1 / 10000 dilution. 5% skim milk (nacalai tesque) was used as the blocking agent and antibody diluent.
[0040] Samples on electrophoresed nitrocellulose membranes were reacted overnight at 4°C with either primary antibody, followed by reaction with either secondary antibody at room temperature for 1 hour. UTX or UTY expression was detected by chromogenically developing 3,3',5,5'-tetramethylbenzidine (TMB) via HRP conjugated to the secondary antibody. Chromogenic development was performed using a WSE-6300 LuminoGraph III (ATTO).
[0041] The results are shown in Figure 3. In this figure, both the genetically modified Utx and Uty are wild-type mice (Utx + Uty + When compared with prostate tissue (Ctrl) from Utx Δ Uty KO We confirmed that neither full-length UTX protein nor UTY protein were expressed in mouse prostate tissue (see Figure 3).
[0042] Example 2: Evaluation of prostate-specific UTX protein function loss In this example, the Utx prepared in Example 1 Δ Uty KO We evaluated the function of prostate-specific UTX proteins using prostate tissue collected from mice.
[0043] Utx at 16 weeks old + Uty KO Mouse and Utx Δ Uty KO From prostate tissue taken from mice, TRIzol TM Total RNA was extracted using reagents (Invitrogen) and the RNeasy Plus Micro Kit (QIAGEN). Subsequently, a cDNA library was constructed at Novogene based on the obtained total RNA, and transcriptome analysis of the cDNA library was performed using a next-generation sequencer (HiSeq 2500; Illumina). The generated sequence tags were mapped to the mouse genome sequence (Mouse Genome Browser GRCm38 / mm10). GSEA (Gene Set Enrichment Analysis) software was downloaded from Broad Institute (http: / / software.broadinstitute.org / gsea / downloads.jsp) and used for the analysis.
[0044] The results of the GSEA analysis are shown in Figure 4. In this figure, Utx Δ Uty KO In mouse prostates, Utx + Uty KO Compared to mouse prostates, the ATM pathway (PID_ATM_PATHWAY, WP_ATM_SIGNALING_DEVELOPMENT_AND_DISEASE), known as a DNA damage response pathway activated by homologous recombination during double-strand breaks, was downregulated.
[0045] The ATM pathway is a known pathway that is activated during DNA double-strand breaks caused by anticancer drug treatment and ionizing radiation, and is involved in DNA repair. Therefore, we investigated the effects of Utx gene deletion on the DNA repair mechanism.
[0046] Utx + Uty KO Mouse and UtxΔ Uty KO Mice were irradiated with gamma rays at a dose of 15 Gy, and the prostate glands were removed at 3 and 6 hours post-irradiation. The removed prostates were treated with 4% paraformaldehyde for more than 48 hours. Fixation, dehydration, defatting, replacement, and paraffin infiltration were performed using Tissue-Tec VIP6 (Sakura Seiki). Paraffin-embedded blocks were prepared using Tissue-Tec TEC 5 embedding module (Sakura Seiki). Thin section slides with a thickness of 4 μm were prepared using a Leica SM2010 R sliding microtome (Leica BIOSYSTEMS).
[0047] Each thin-section slide was deparaffinized by xylene treatment, dehydrated by ethanol treatment, and then activated with EDTA at 120°C for 10 minutes. After blocking with G-block (GenoStaff) solution at room temperature for 30 minutes, immunofluorescence staining was performed with antibody.
[0048] The primary antibody was anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301(γH2Ax)(SIGMA-ALDRICH, #05-636), diluted 1 / 200 times. The secondary antibody was anti-mouse IgG (H+L), Alexa Fluor. TM Immunofluorescence staining was performed using a 1 / 1000 dilution of 488 (Invitrogen). Counternuclear staining was performed using a 1 / 200 dilution of Hoechst 33342 (DOJINDO).
[0049] The samples on the slide were acquired using a Zeiss confocal laser microscope LSM-770, with each sample captured in three different fields of view. Image quantification was performed using ImageJ software (NIH; http: / / imagej.nih.gov / ij / ) following standard procedures. ** indicates a p-value < 0.01, and ns indicates no statistically significant difference.
[0050] Figure 5(A) shows the results of immunofluorescence staining for the samples on the slide, and Figure 5(B) shows the results of quantifying the immunofluorescence stained images. Staining with the γH2Ax antibody, which detects histone 2A phosphorylation (Figure 5(A)), showed no significant difference in fluorescence intensity in the prostate tissue of both mice at 3 hours after irradiation. However, at 6 hours after irradiation, Utx Δ Uty KO The fluorescence intensity of γH2Ax antibody in mouse prostate gland is Utx + Uty + The results were significantly higher compared to the mouse prostate (Figure 5(B)). In other words, the deletion of the Utx gene resulted in a prolonged DNA damage repair time compared to the wild type. This suggests that deletion of the Utx gene is involved in a decrease in DNA damage repair function.
[0051] Example 3: In vivo effects of PARP inhibitors on UTX-deficient mice In this example, the in vivo effect of a PARP inhibitor on UTX-deficient prostate cancer cells was confirmed.
[0052] The mouse prostate cancer cell line RM-2 was purchased from ATCC (The Global Bioresource Center, USA) and cultured in DMEM medium (nacalai tesque) containing 10% FBS. RM-2 cells lack Uty expression, and Utx + Uty KO These are cells that function as cells. In Examples 1 and 2, the effects of prostate UTX deletion were evaluated using UTY-deficient mice, so a UTY-deficient cell line was also used. Based on these cells, RM-2 cells (Mock) without further genetic modification or Utx-deficient (Utx KO) cell lines were established and used.
[0053] To establish Utx KO cell lines, a plasmid was prepared by GenScript in which the gRNA sequence GCAGCGAAACGCACTCACTC was inserted into the gRNA insertion site of pSpCas9 BB-2A-PURO PX459. During cultivation in DMEM medium containing 10% FBS, 5 × 10⁶ cells were observed. 4 Cells were seeded in 24-well plates and transfected the following day with the plasmid described above using Lipofectamin 3000 (Thermo Fisher Scintific). The transfection procedure followed the protocol recommended by Lipofectamin 3000 (Thermo Fisher Scintific) (https: / / assets.thermofisher.com / TFS-Assets / LSG / manuals / lipofectamine3000_protocol.pdf). Opti-MEM was used as the medium for transfection. TM Reduced Serum Medium (Gibco) was used. 24 hours after transfection, the medium was replaced with DMEM medium containing 10% FBS. 48 hours after transfection, puromycin was added to the medium to a concentration of 4 μg / ml. After 2-3 days, most cells became dead, but cells that were slightly adhered to the plate were seeded into a 96-well plate at a concentration of 1 cell per well. Observations were made every 2-3 days to identify wells that appeared to contain one cell per well. Between 7 and 14 days after seeding in the 96-well plate, cells from wells that had grown to approximately 70-80% confluence were seeded into a 24-well plate. After confirming that the cells had grown sufficiently to approximately 70-80% confluence, they were seeded into a 6-well plate.
[0054] After growing the cells in a 6-well plate until 70-80% confluence, the cells were harvested, DNA was extracted using the alkaline method, and the extracted DNA was purified using a kit before being sequenced by eurofins.
[0055] To establish mock cell lines, a plasmid with an empty gRNA insertion site for pSpCas9 BB-2A-PURO PX459 was prepared at GenScript. Transfection and puromycin treatment were performed using the same procedure as above, except for the plasmid used. Since the mock cell line served as a control, it was used in the experiment in bulk form without being converted into single cells after puromycin treatment as described above.
[0056] As a result, while the Mock cell line, in which no change occurred in the Utx gene sequence, had the sequence TTCAACCTCT TATTGGAAGA T (SEQ ID NO.: 3), the obtained Utx KO cell line had TTCAACCTCT TAATTGGAAG AT (SEQ ID NO.: 4), indicating a single nucleotide insertion of A (Figure 6). Western blotting also confirmed that Utx expression was not observed in the Utx KO cell line (Figure 6).
[0057] Mock RM-2 cells or Utx KO cell line RM-2 cells were placed in 50 μL of D-PBS(-)(nacalai tesque) in a 2 × 10⁶ solution. 6 The cells were prepared to a concentration of 50 μL and mixed with 50 μL of Basement Membrane Extract, w / o Phenol Red (Cultrex) on ice immediately before transplantation. The cells were subcutaneously injected into the backs of 8-10 week old male C57BL / 6NCrSlc mice (SANKYO LABO SERVICE CORPORATION, INC.).
[0058] Olaparib (Selleck) was used as the treatment drug, administered intraperitoneally at a dose of 50 mg / kg / dose daily from day 5 after subcutaneous transplantation of tumor cells (i.e., daily from day 5 to day 12). On day 12, each animal was euthanized, and the subcutaneous tumor was excised. Dimethyl sulfoxide (DMSO) (nacalai tesque) was used as a control for olaparib. All mouse groups consisted of 10 mice each, subcutaneously transplanted with Mock and Utx KO cell lines, and drug administration was performed. During daily olaparib administration, the size of the tumor and the skin at the tumor transplantation site were measured with calipers, and the tumor volume was recorded (w 2 The estimated tumor volume was calculated using the formula ×l) / 2 (where w is width and l is length). Additionally, the tumor weight was measured at the final stage of the experiment.
[0059] In the groups transplanted with Mock and Utx KO cell lines and administered olaparib, one mouse from each group died midway through day 12 post-transplantation. For analysis, the mouse with the largest tumor weight was excluded as an outlier in all groups. Therefore, the analysis included 9 mice each from the Mock cell line transplantation with DMSO and the Utx KO cell line transplantation with DMSO, and 8 mice each from the Mock cell line transplantation with olaparib and the Utx KO cell line transplantation with olaparib. The analysis was performed using student t-tests, where ** indicates a p-value < 0.01 and ns indicates no statistically significant difference.
[0060] The results are shown in Figure 7. In this figure, the graph labeled "Utx KO" shows the results for RM-2 cells from the Utx KO cell line, and the graph labeled "Ctrl" shows the results for RM-2 cells from Mock. The line graphs on the left of each "Utx KO" and "Ctrl" graph show the changes in estimated tumor volume measured at the time of olaparib administration, and the plots on the right show the tumor volume at day 12 measured for tumors excised from each animal. The analysis was performed using the Student's t-test, where ** indicates a p-value < 0.01, and ns indicates no statistically significant difference. In mice transplanted with Mock RM-2 cells ("Ctrl"), no significant changes were observed in subcutaneous tumor growth or tumor weight at the final stage between the DMSO-administered group and the olaparib-administered group. On the other hand, in mice transplanted with Utx KO RM-2 cells that had received olaparib ("Utx KO"), the trend of subcutaneous tumor growth decreased, and tumor weight at the final stage was significantly reduced.
[0061] Example 4: Evaluation of the in vitro growth inhibitory effect of olaparib on UTX-deficient prostate cancer cell lines. In this example, the in vitro growth inhibitory effect of olaparib was evaluated using the UTX-deficient prostate cancer cell line (Utx KO) and control cell line (Ctrl) established in Example 3.
[0062] Place RM-2 cells from Mock or Utx KO cell line into a 24-well plate in a 2x10⁶ container. 4 Seeds were seeded at a density of 1 individual per well, and olaparib at a concentration of 10 μM was added. DMSO was used as a control instead of olaparib.
[0063] Cell counts were measured on days 1, 2, 3, and 4 after cell seeding using the following method. After removing the culture medium and washing once with 1×PBS, the cells were incubated in 0.05% trypsin at 37°C for 1 minute. Once the cells had detached, they were neutralized with serum-containing culture medium and pelleted by centrifugation at 1300 rpm. A cell suspension was prepared in 1 ml of PBS, and 20 μL of the suspension was mixed with 0.4% trypan blue. 10 μL of this mixture was placed in a cell counting chamber slide, and the cell count was measured using a Countess 3 automated cell counter. The results are shown in Figure 8. Analysis was performed using a Student's t-test, and in Figure 8, ns indicates no statistically significant difference.
[0064] In mock RM-2 cells (Ctrl), olaparib did not show a significant inhibitory effect on cell proliferation. On the other hand, olaparib showed an excellent inhibitory effect on Utx KO cell lines. These results indicate a correlation between the in vivo inhibitory effect on UTX-deficient prostate cancer cell lines (Utx KO) confirmed in Example 3 and the in vitro inhibitory effect on UTX-deficient prostate cancer cell lines (Utx KO) of olaparib.
[0065] Example 5: Evaluation of the in vitro growth inhibitory effect of various PARP inhibitors on UTX-deficient prostate cancer cell lines. Since it was revealed that the in vitro growth inhibitory activity of olaparib against UTX-deficient prostate cancer cells correlates with its in vivo growth inhibitory activity, in this example, the growth inhibitory effects of various PARP inhibitors other than olaparib were also evaluated in vitro using the UTX-deficient prostate cancer cell line (Utx KO) and control cell line (Ctrl) established in Example 3.
[0066] Place RM-2 cells from Mock or Utx KO cell line into a 24-well plate in a 2x10⁶ container. 4Seeds were seeded at individual grains per well, and various PARP inhibitors (pamiparib, atamparib, veliparib, and rucaparib) were added. Pamiparib was used at a concentration of 50 nM, while atamparib, veliparib, and rucaparib were used at a concentration of 1 μM each. DMSO was used as a control instead of a PARP inhibitor.
[0067] Cell counts were measured on days 1, 2, 3, and 4 after cell seeding using the following method. After removing the culture medium and washing once with 1×PBS, the cells were incubated in 0.05% trypsin at 37°C for 1 minute. Once the cells had detached, they were neutralized with serum-containing culture medium and pelleted by centrifugation at 1300 rpm. A cell suspension was prepared in 1 ml of PBS, and 20 μL of the suspension was mixed with 0.4% trypan blue. 10 μL of this mixture was placed in a cell counting chamber slide, and the cell count was measured using a Countess 3 automated cell counter. The results are shown in Figure 9. Analysis was performed using Student's t-test. In Figure 9, * indicates a p-value < 0.05, *** indicates a p-value < 0.001, **** indicates a p-value < 0.0001, and ns indicates no statistically significant difference.
[0068] In mock RM-2 cells (Ctrl), none of the PARP inhibitors showed a significant inhibitory effect on cell proliferation (Figures 9-1 and 9-2). On the other hand, in Utx KO cell lines, pamiparib showed a particularly excellent inhibitory effect on proliferation (p<0.0001), with the cell count on day 4 decreasing by approximately 75% compared to the DMSO-treated group (Figure 9-1). Atamparib (p<0.001), veliparib (p<0.05), and rucaparib (p<0.05) also showed significant inhibitory effects on proliferation (Figures 9-1 and 9-2), but their effects were weaker than those of pamiparib. These results indicate that pamiparib has a particularly excellent inhibitory effect on Utx-deficient prostate cancer cell lines in vitro, and that atamparib, veliparib, and rucaparib also have excellent inhibitory effects on Utx-deficient prostate cancer cell lines in vitro, although they are weaker than those of pamiparib.
[0069] Example 6: Analysis of the independence of UTX mutations and BRCA mutations in human prostate cancer Recent large-scale genome analyses have reported that in human prostate cancer (sample size 2260), UTX mutations are detected at a frequency of 5%, BRCA1 mutations at 1%, and BRCA2 mutations at 7% (Prostate Cancer, MSK, Clin Cancer Res 2024). In this study, the relationship between UTX mutations and BRCA mutations was analyzed using the human prostate cancer genome database described in the above-mentioned literature.
[0070] From 2260 human prostate cancer samples, UTX mutations (115 samples), BRCA1 mutations (25 samples), and BRCA2 mutations (154 samples) were extracted to check for mutation overlap.
[0071] When the mutations in the UTX gene or the BRCA gene were compared for each sample, it was shown that the UTX mutations and BRCA mutations hardly overlapped, indicating that the UTX mutations and BRCA mutations are independent. To evaluate the co-occurrence of UTX mutations and BRCA2 mutations, χ 2 Although a statistical test was performed, no significant difference was found (p=0.126). However, because BRCA1 mutations are infrequent and the sample size is small, the χ² of UTX mutations and BRCA1 mutations is not significant. 2 The test was not conducted.
[0072] This analysis indicates that prostate cancer patients with UTX mutations are a different patient group from existing BRCA mutation-positive patients. Currently, some PARP inhibitors are approved for use in "castration-resistant prostate cancer with distant metastases and BRCA gene mutations," but this analysis suggests that PARP inhibitors could be a treatment option for a new patient group (UTX gene mutation-positive). [Industrial applicability]
[0073] The present invention has found that PARP inhibitors have a growth inhibitory effect on solid tumors having UTX function deficiency, and as a result, it is possible to provide a pharmaceutical composition for the treatment of solid tumors having UTX function deficiency, which contains a PARP inhibitor as an active ingredient.
[0074] The present invention also provides a companion diagnostic agent for selecting a PARP inhibitor as a therapeutic or prophylactic agent, which is used as an indicator to select a PARP inhibitor as a therapeutic or prophylactic agent in cancer cells taken from a patient with a solid tumor, where the cancer cells do not have a mutation in the BRCA gene but do have a mutation in the UTX gene.
Claims
1. A pharmaceutical composition for the treatment of solid tumors with UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome) function deficiency, comprising a poly-ADP-ribose polymerase (PARP) inhibitor as an active ingredient.
2. The pharmaceutical composition according to claim 1, wherein the PARP inhibitor is selected from the group consisting of olaparib, niraparib, talazoparib, veliparib, lucaparib, pamiparib, stenoparib, fluzoparib, nesparib, benadaparib, salparib, and atamparib.
3. The pharmaceutical composition according to claim 1, wherein the PARP inhibitor is selected from the group consisting of olaparib, veliparib, lucaparib, pamiparib, and atamparib.
4. The pharmaceutical composition according to claim 1, wherein the PARP inhibitor is olaparib or pamiparib.
5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the solid tumor having UTX function deficiency is selected from the group consisting of prostate cancer, bladder cancer, adenoid cystic carcinoma, meningioma, renal cell carcinoma, and esophageal cancer.
6. The pharmaceutical composition according to any one of claims 1 to 4, wherein the solid tumor having a UTX function deficiency is prostate cancer.
7. The pharmaceutical composition according to any one of claims 1 to 4, wherein the solid tumor is a solid tumor that does not have a mutation in the BRCA gene.
8. A method for analyzing mutations that cause functional reduction in the UTX (ubiquitously transcribed tetratricopeptide repeat, X chromosome) gene, which includes analyzing the base sequence of the UTX gene for selecting a PARP inhibitor as a therapeutic or prophylactic agent for cancer cells collected from patients with solid tumors, and determining whether the cancer cells have mutations that cause functional reduction in the UTX gene, indicating that the cancer cells are targets for administration of a PARP inhibitor as a therapeutic or prophylactic agent.
9. The analytical method according to claim 8, wherein the method for analyzing the base sequence is selected from the group consisting of identifying mutations by real-time PCR using probes for known mutation sites of the UTX gene, identifying known or unknown mutations of the UTX gene by whole base sequence determination of the UTX gene, or identifying mutations of the UTX gene by comprehensive gene analysis using NGS.
10. The analytical method according to claim 8 or 9, wherein a mutation causing a reduction in function in the UTX gene is indicated by the fact that cancer cells have a nucleotide mutation in the UTX gene that causes any of the following: deletion, substitution, or insertion of an amino acid.
11. The analytical method according to claim 10, further comprising the indicator that cancer cells do not have mutations in the BRCA gene that cause functional reduction.
12. The analytical method according to claim 11, for determining whether cancer cells collected from a patient with a solid tumor have a mutation in the BRCA gene that causes functional reduction, and for excluding cancer cells having a mutation in the BRCA gene that causes functional reduction from treatment with a PARP inhibitor.
13. In cancer cells collected from patients with solid tumors, A process for detecting the presence or absence of mutations in the UTX gene; A step in which a PARP inhibitor is selected as a therapeutic or prophylactic agent for cancer cells, using the presence of a mutation in the UTX gene that causes functional reduction in cancer cells as an indicator. A screening method for cancer cells whose proliferation is suppressed by a PARP inhibitor, including [specific PARP inhibitor].
14. In cancer cells collected from patients with solid tumors, The nucleotide sequence of the BRCA gene was analyzed to detect the presence or absence of mutations in the BRCA gene; A process of selecting cancer cells to be treated with therapeutic or prophylactic drugs, including PARP inhibitors, based on the indicator that the cancer cells do not have mutations in the BRCA gene that cause functional reduction. A method for screening cancer cells whose proliferation is suppressed by the PARP inhibitor according to claim 13, including the above.