NEIL1 production promoter

A wet heat-treated Ganoderma lucidum product or extract promotes NEIL1 production, addressing limitations of existing promoters and providing effective treatments for metabolic and neurodegenerative diseases, as well as age-related conditions.

JP2026067165APending Publication Date: 2026-04-20NIPPON MENARD COSMETIC CO
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NIPPON MENARD COSMETIC CO
Filing Date
2024-10-08
Publication Date
2026-04-20

AI Technical Summary

Technical Problem

Current NEIL1 production promoters, such as ginsenoside Rd, have limitations, and the effectiveness of Ganoderma lucidum or its extracts in promoting NEIL1 production is unknown.

Method used

A wet heat-treated product of Ganoderma lucidum or an extract thereof, subjected to heating at 105°C or higher with pressurized steam, is used to promote NEIL1 production.

Benefits of technology

The wet heat-treated Ganoderma lucidum effectively enhances NEIL1 production, offering preventive and therapeutic benefits against metabolic syndrome, neurodegenerative diseases, mitochondrial DNA damage, and age-related conditions like hair loss and osteoporosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026067165000001
    Figure 2026067165000001
  • Figure 2026067165000002
    Figure 2026067165000002
  • Figure 2026067165000003
    Figure 2026067165000003
Patent Text Reader

Abstract

The present invention relates to a NEIL1 production promoter characterized by containing a wet heat treatment product of Ganoderma lucidum, which has been subjected to a wet heat treatment by heating to 105°C or higher with pressurized steam, or an extract thereof, and also provides a pharmaceutical composition for the prevention, improvement, or treatment of diseases in which NEIL1 is involved. [Solution] The present invention is a NEIL1 production promoter characterized by containing a wet heat-treated product of Ganoderma lucidum or an extract thereof, which has been subjected to a wet heat treatment by heating to 105°C or higher with pressurized steam. By using the wet heat-treated product of Ganoderma lucidum or an extract thereof of the present invention, the production of NEIL1, which recognizes and removes oxidatively damaged bases, can be promoted. The NEIL1 production promoter of the present invention can safely and effectively prevent, improve, or treat various diseases of metabolic syndrome, neurodegenerative diseases, mitochondrial dysfunction, etc., in which NEIL1 is involved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a NEIL1 production promoter characterized by containing a wet heat-treated product of Hericium erinaceus subjected to wet heat treatment by heating to 105°C or higher with pressurized steam or an extract of the wet heat-treated product, or to a pharmaceutical composition for preventing, ameliorating or treating diseases involving NEIL1.

Background Art

[0002] Reactive oxygen species (ROS) include superoxide, hydroxyl radical, hydrogen peroxide, singlet oxygen, etc., and are substances that cause oxidative damage to cells and tissues. Reactive oxygen species are endogenously produced by activities in the living body such as the respiratory process and detoxification in mitochondria, but are also exogenously produced by exposure to ultraviolet rays, chemical substances, etc., and constantly damage cell components including DNA. Reactive oxygen species and the accompanying oxidative damage are considered to be the main factors or strongly related to diseases such as cancer, cardiovascular diseases, immune system decline, brain function disorders such as Parkinson's disease and Alzheimer's disease, chronic inflammatory diseases such as rheumatoid arthritis, and cataracts, and are widely thought to be related to aging (Non-Patent Documents 1-3).

[0003] NEIL1 (Nei Like DNA Glycosylase 1) is a DNA damage repair enzyme, specifically a type of enzyme involved in base excision repair (BER). Specifically, it is a DNA glycosylase that mainly starts base excision repair by recognizing and removing oxidized damaged bases, and is homologous to bacterial DNA glycosylase, formamidopyrimidine DNA glycosylase (Fpg), and endonuclease VIII (Nei). Repair of oxidized damaged bases etc. via the base excision repair pathway is considered important for maintaining genomic stability against oxidative damage of DNA caused by reactive oxygen species and ultraviolet rays that occur daily.

[0004] NEIL1 recognizes many oxidatively damaged bases, including oxidized pyrimidines, formamidopyrimidines (FAPys), methyl-oxidized thymine residues, thymine glycol, and ring-opened purines. Among these, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), which are hydantoin lesions known as further oxidation products of 8-oxoguanine (8-OxoG), are thought to be substrates with particularly high affinity for NEIL1 (Non-Patent Literature 4-5). NEIL1 is a highly versatile DNA repair enzyme that can remove damage not only from single-stranded DNA but also from bubble DNA and fork DNA structures (Non-Patent Literature 6). In addition, NEIL1 is localized in the nucleus and mitochondria and is thought to contribute to DNA repair in both (Non-Patent Literature 7).

[0005] NEIL1 heterozygotes and knockout (KO) mice exhibit symptoms such as obesity, dyslipidemia, fatty liver, and hyperinsulinemia, suggesting that NEIL1 plays a crucial role in preventing metabolic syndrome-related diseases (Non-Patent Literature 8). Furthermore, other studies using mice have suggested that NEIL1 is also involved in learning and memory, olfaction, and protection from ischemic injury in nerve cells (Non-Patent Literature 9-10), indicating its importance in aging and associated neurodegenerative diseases.

[0006] It is well known that damage to nuclear DNA can cause cancer and various genetic diseases, but mutations in mitochondrial DNA are also known to cause maternally inherited diabetes and mitochondrial encephalomyopathy (Non-Patent Literature 11). While base excision repair is thought to play a central role in mitochondrial DNA damage repair, mitochondrial DNA has a higher mutation rate than nuclear DNA, and damage accumulates with age. It has been suggested that this accumulation of damage leads to a decline in mitochondrial function. Furthermore, in experiments with mice in which mutations were introduced into DNA polymerase γ, which replicates mitochondrial DNA, the accumulation of mitochondrial DNA damage increased tenfold, average lifespan was reduced to one-third, and age-related diseases such as hair loss, osteoporosis, and decreased cardiac function were observed early. This suggests that the accumulation of damage to mitochondrial DNA also affects aging and age-related diseases (Non-Patent Literature 12).

[0007] To date, ginsenoside Rd has been reported as a NEIL1 production promoter (Non-Patent Literature 13), but the NEIL1 production-promoting effect of wet heat-treated Ganoderma lucidum or its extract is completely unknown. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] BN Ames et.al., Proc Natl Acad Sci USA.,90(17),p7915-7922,1993 [Non-Patent Document 2] ME Gotz et.al., Pharmacol Ther., 63(1), p37-122, 1994 [Non-Patent Document 3] MA Lovell et.al.,Brain Res.,855(1),p116-123,2000 [Non-Patent Document 4] AA Nemec et.al.,Semin Cancer Biol.,5,p320-328,2010 [Non-Patent Document 5] N. Krishnamurthy et.al.,Biochemistry,47(27),p7137-7146,2008 [Non-Patent Document 6] V. Popuri et.al.,DNA repair,9(6),p636-642,2010 [Non-Patent Document 7] J. Hu et.al., J Biol Chem., 280(49), p40544-40551, 2005 [Non-Patent Document 8] V. Vartanian et.al.,Proc Natl Acad Sci USA.,103(6),p1864-1869,2006 [Non-Patent Document 9] C. Canugovi et.al.,Neurobiol Aging,36(2),p1007-1012,2015 [Non-Patent Document 10] C. Canugovi et.al.,Proc Natl Acad Sci USA.,109(37),p14948-14953,2012 [Non-Patent Document 11] Yohei Tominaga, Yusaku Nakabeppu, Chemistry and Biology, 39(4), pp. 223-231, 2001. [Non-Patent Document 12] Kang Dong-ten, Fukuoka Medical Journal, 97(12), p351-357, 2006 [Non-Patent Document 13] LX Yang et.al.,Chinese Medical Journal,129(16),p1955-1962,2016 [Overview of the project] [Problems that the invention aims to solve]

[0009] The object of this invention is to provide an effective NEIL1 production promoter with few side effects. [Means for solving the problem]

[0010] In order to solve this problem, the inventors conducted extensive research and, as a result, discovered that a wet heat-treated product of Ganoderma lucidum or an extract thereof has an excellent effect in promoting NEIL1 production, thus completing the present invention.

[0011] In other words, the present invention is as follows: (1) A NEIL1 production promoter characterized by containing a wet heat treatment product of Ganoderma lucidum, which has been subjected to a wet heat treatment by heating to 105°C or higher with pressurized steam, or an extract of the wet heat treatment product. (2) An agent for the prevention, improvement, or treatment of metabolic syndrome, characterized by containing the NEIL1 production promoter described in (1). (3) An agent for preventing, improving, or treating age-related neurodegenerative diseases, characterized by containing the NEIL1 production promoter described in (1). (4) An agent for preventing or improving the accumulation of mitochondrial DNA damage and mitochondrial dysfunction, characterized by containing the NEIL1 production promoter described in (1). (5)(4) A preventive, corrective, or therapeutic agent for hair loss, osteoporosis, or cardiac dysfunction, characterized by containing the preventive or corrective agent for the accumulation of mitochondrial DNA damage and mitochondrial dysfunction described in (4). [Effects of the Invention]

[0012] According to the present invention, a NEIL1 production promoter characterized by containing a wet heat-treated product of Ganoderma lucidum or an extract thereof, which has been subjected to a wet heat treatment by heating to 105°C or higher with pressurized steam, is excellent in promoting NEIL1 production, is safe, and is expected to have preventive, ameliorative, or therapeutic effects against various metabolic syndrome diseases, neurodegenerative diseases, accumulation of mitochondrial DNA damage, mitochondrial dysfunction, hair loss, osteoporosis, and cardiac dysfunction, all of which are related to NEIL1. [Modes for carrying out the invention]

[0013] NEIL1 (Nei Like DNA Glycosylase 1) of the present invention is a DNA damage repair enzyme, and more specifically, it is one of the enzymes involved in Base Excision Repair (BER). Specifically, it is a DNA glycosylase that initiates base excision repair mainly by recognizing and removing oxidized damaged bases, and is homologous to bacterial DNA glycosylase, formamidopyrimidine DNA glycosylase (Fpg), and endonuclease VIII (Nei).

[0014] The oxidized damaged base of the present invention is a nucleobase that has suffered oxidative damage and is recognized and removed by NEIL1, and includes oxidized pyrimidines, formamidopyrimidines (FAPys), thymine residues oxidized by a methyl group, thymine glycol, and nucleobases such as ring-opened purines that have suffered oxidative damage.

[0015] The metabolic syndrome of the present invention refers to various diseases such as obesity, dyslipidemia, fatty liver, and hyperinsulinemia caused by the decrease of NEIL1.

[0016] The neurodegenerative diseases associated with aging of the present invention refer to various diseases such as learning disorders, memory disorders, olfactory abnormalities, and ischemic injuries in nerve cells caused by the decrease of NEIL1.

[0017] The accumulation of mitochondrial DNA damage of the present invention refers to the accumulation of damage to mitochondrial DNA associated with the decline of base excision repair function caused by the decrease of NEIL1.

[0018] The decline of mitochondrial DNA function of the present invention refers to a state in which, as a result of the accumulation of damage to mitochondrial DNA, the number of mitochondria that cannot maintain normal function increases, leading to a decline in mitochondrial function.

[0019] The hair loss, osteoporosis, and decreased cardiac function described in this invention refer to hair loss, osteoporosis, and decreased cardiac function resulting from a decrease in base excision repair function caused by a decrease in NEIL1, and are age-related diseases that are observed early due to the decrease in NEIL1.

[0020] The Ganoderma lucidum used in this invention is a basidiomycete fungus used in the herbal medicine "Reishi," and belongs to the genus Ganoderma in the family Ganodermataceae. Regarding mushrooms of the genus Ganoderma, the ancient Chinese pharmacopoeias "Bencao Gangmu" and "Shennong Ben Cao Jing" describe the existence of red Reishi (Reishi), black Reishi (Hei Zhi), purple Reishi (Zi Zhi), blue Reishi (Qing Zhi), yellow Reishi (Yu Zhi), and white Reishi (Bai Zhi). Deer antler Reishi is also mentioned as a type of red Reishi. The Ganoderma lucidum used in this invention is not particularly limited as long as it is a mushroom of the genus Ganoderma in the family Ganodermataceae, but it is preferably red Reishi (Ganoderma lucidum) and / or black Reishi (Ganoderma sinense, Ganoderma atrum, Ganoderma japonicum), and more preferably black Reishi.

[0021] The Ganoderma lucidum used in this invention can be those widely available in the Chinese and Japanese markets, or it can be wild or cultivated. Fruiting bodies, mycelium, or spores may be used, but fruiting bodies are preferred. Furthermore, dried or crushed fruiting bodies can be used, or they can be used fresh.

[0022] Wet heat treatment refers to a heating method in which heat is applied to the target material (Ganoderma lucidum in this invention) using steam as a medium while applying pressure. While general heat treatments typically only apply heat below 100°C, wet heat treatment increases the boiling point of the water inside the apparatus by raising the pressure, allowing heat above 100°C to be conducted by the high-temperature pressurized steam. Wet heat treatment is believed to cause changes in chemical components such as proteins, making it possible to alter the color, taste, and aroma. The changes in chemical components also vary depending on the heating temperature and time. The water supplied to the wet heat treatment can be in either a liquid or gaseous state. That is, the treatment tank for wet heat treatment may be supplied with steam, water, or both. Since the reaction proceeds more easily in a liquid state than in a gaseous state during wet heat treatment, it is preferable to use water that has been forcibly liquefied in a sealed container. More specifically, it is preferable to use a wet heat-treated product, which is made by placing the Ganoderma lucidum, the target of treatment, and water, the treatment agent, into a pressure-resistant container made of metal or ceramics, sealing it, and heating it to 105°C or higher with pressurized steam for a certain period of time or longer.

[0023] The wet heat-treated product of Ganoderma lucidum according to the present invention refers to a product obtained by subjecting Ganoderma lucidum to the wet heat treatment described above. Furthermore, the wet heat-treated product of Ganoderma lucidum includes a mixture of Ganoderma lucidum after wet heat treatment and a water-soluble substance (such as an aqueous solution), or a dried product thereof. For the wet heat treatment, Ganoderma lucidum may be used as is, or it may be subjected to treatments such as drying, crushing, or shredding.

[0024] Wet heat treatment methods include using pressure cookers, autoclaves, steam bags, stainless steel pots, and microwave ovens, and stirring can be performed as needed. Furthermore, compared to conventional heat drying, the color of Ganoderma lucidum becomes darker, often changing to brown to dark brown depending on the circumstances.

[0025] The wet heat treatment temperature for Ganoderma lucidum is preferably 105°C or higher, more preferably 120-250°C, and most preferably between 130-160°C, because it allows for efficient extraction of the active ingredients contained in the wet heat-treated Ganoderma lucidum product or its extract. Below 105°C, the amount of active ingredients tends to decrease. Furthermore, if the wet heat treatment temperature exceeds 250°C, it is more likely to cause excessive decomposition of the active ingredients.

[0026] The wet heat treatment of Ganoderma lucidum is preferably carried out under pressurized conditions. For example, the absolute pressure is preferably between 0.11 and 4.00 MPa, more preferably between 0.20 and 1.00 MPa, and most preferably between 0.25 and 0.65 MPa. Excessive pressurization exceeding 4.00 MPa requires a large pressure vessel, which worsens the economic efficiency of the wet heat treatment.

[0027] The wet heat treatment time for Ganoderma lucidum varies depending on the temperature, but is preferably between 5 and 720 minutes. If the treatment time is less than 5 minutes, the amount of active ingredients tends to be low. If the treatment time exceeds 720 minutes, further extraction of active ingredients cannot be expected, making it uneconomical. These treatments may also be performed in stages, such as 2 to 5 times. In such cases, the total time should preferably be within the aforementioned range.

[0028] The extract of the wet-heat-treated Ganoderma lucidum of the present invention refers to the extract obtained by adding a solvent to the wet-heat-treated Ganoderma lucidum described above, or the dried product thereof. For extraction, the Ganoderma lucidum that has undergone wet-heat treatment may be used as is, or it may be dried, crushed, or finely chopped beforehand.

[0029] The extraction method for obtaining an extract of a wet heat-treated Ganoderma lucidum is not particularly limited and can be performed by methods such as heat extraction (e.g., 40-100°C), room temperature extraction (e.g., 15-25°C), low temperature extraction (e.g., 0-15°C), stirring extraction, column extraction, continuous extraction, immersion extraction, or supercritical fluid extraction. Examples of solvents used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Among these solvents, water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol), and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin) are preferred, with water being the most preferred. These solvents may be used individually or as a mixture of two or more. In addition, a solvent whose pH has been adjusted by adding an acid or alkali to the above extraction solvent may be used.

[0030] There are no particular limitations on the amount of solvent used. For example, it should be 5 times or more, preferably 10 times or more, the amount of solvent used compared to the wet-heat-treated product (dry weight) of Ganoderma lucidum that has undergone pressurized wet heat treatment. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0031] The above-mentioned wet heat-treated product of Ganoderma lucidum or extract thereof may be used as is, either as a solution or as a solvent phase. However, if necessary, to the extent that it does not affect the effect, the obtained solution or solvent phase may be subjected to treatments such as concentration (concentration by vacuum, membrane concentration, etc.), dilution, filtration, drying (concentration to dryness, spray drying, freeze-drying, etc.), decolorization with activated carbon, deodorization, ethanol precipitation, etc., and the resulting product may be used.

[0032] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0033] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0034] For external use, the content of the above extract used in this invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, when converted to solid matter. Furthermore, 0.01 to 5% by weight is most preferable. Below 0.0001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0035] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0036] Next, in order to describe the present invention in detail, examples of the production, formulation, and experimental use of the extract in the present invention will be given as examples, but the present invention is not limited thereto. In the production examples, % refers to weight %, and in the formulation examples, parts refer to parts by weight. [Examples]

[0037] (1) Preparation of wet heat-treated Ganoderma lucidum Manufacturing Example 1: 40g of red reishi mushroom was placed in an autoclaved steam sterilizer and subjected to wet heat treatment at a temperature of 120°C, an absolute pressure of 0.20 MPa, and for 45 minutes. After the wet heat treatment was completed, 39.8g of wet heat-treated Ganoderma lucidum (Ganoderma lucidum) was obtained by freeze-drying the treated material.

[0038] For Production Examples 2 to 12 (wet heat-treated Ganoderma lucidum products 2 to 12), the wet heat treatment was carried out in the same manner as in Production Example 1, except that the raw materials, temperature, absolute pressure, and time were as shown in Table 1. The recovery amounts for Production Examples 2 to 12 are also shown in Table 1.

[0039] [Table 1]

[0040] Manufacturing Example 13: 40g of red reishi mushroom was placed in a high-pressure steam sterilizer and subjected to wet heat treatment at a temperature of 135°C, an absolute pressure of 0.33 MPa, and for a time of 45 minutes. After the wet heat treatment was completed, 10.8g of wet heat-treated Ganoderma lucidum 13 was obtained by filtering the treated material.

[0041] (2) Preparation of extract from wet heat-treated Ganoderma lucidum Production example 14A Hot water extract 10 g of a wet-heat-treated Ganoderma lucidum product (Production Example 1) was mixed with 200 mL of purified water and extracted at 95-100°C for 2 hours. The resulting extract was filtered, the filtrate was concentrated, and freeze-dried to obtain a hot water extract.

[0042] Manufacturing Example 14B: 50% Ethanol Extract 10 g of a wet-heat-treated Ganoderma lucidum product (Production Example 1) was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days to extract the contents. After filtering the resulting extract, a 50% ethanol extract was obtained by concentrating it to dryness using an evaporator.

[0043] Manufacturing Example 14C Ethanol Extract 10 g of a wet-heat-treated Ganoderma lucidum product (Production Example 1) was immersed in 200 mL of ethanol at room temperature for 7 days to extract the extract. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain an ethanol extract.

[0044] Using Production Examples 2-12, extracts of wet-heat-treated Ganoderma lucidum (Production Examples 14A-25C) were prepared in the same manner as in Production Examples 14A-14C above (Table 2).

[0045] [Table 2]

[0046] Production Example 26: 1,3-butylene glycol extract from wet heat-treated Ganoderma lucidum 10 g of wet heat-treated Ganoderma lucidum (production example 2) was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the extract. 193 g of 1,3-butylene glycol extract was obtained by filtering the resulting extract. [Examples]

[0047] Examples of formulations for products containing a wet-heat-treated product of Ganoderma lucidum or its extract are shown below.

[0048] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of wet-heat-treated Ganoderma lucidum (Production Example 15A) 0.1 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0049] (Comparative formulation example 1) Conventional lotion In Formulation Example 1, the hot water extract of the wet-heat-treated Ganoderma lucidum was replaced with purified water to create a conventional lotion.

[0050] (Prescription example 2) Cream Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum 50% ethanol extract (Production Example 18B) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. Add component 10 at 45°C, and further cool to 30°C to obtain the final product.

[0051] (Prescription example 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of wet-heat treated Ganoderma lucidum (Preparation Example 22C) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0052] (Prescription example 4) Gel Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum 1,3-Butylene glycol extract (Preparation Example 26) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0053] (Prescription example 5) Pack Formulation Content (per portion) 1. Hot water extract of wet-heat treated Ganoderma lucidum (Preparation Example 24A) 1.0 2. Wet heat treatment of Ganoderma lucidum 1,3-Butylene glycol extract (Production Example 26) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0054] (Prescription example 6) Foundation Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum 50% ethanol extract (Production Example 20B) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0055] (Prescription example 7) Bath additive Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum Ethanol extract (Production Example 15C) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0056] (Prescription example 8) Ointment Formulation Content (per portion) 1. Wet heat-treated product of Ganoderma lucidum (Production Example 13) 5.0 2. Wet heat treatment of Ganoderma lucidum 1,3-Butylene glycol extract (Preparation Example 26) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0057] (Prescription example 9) Powder Formulation Content (per portion) 1. Wet heat-treated product of Ganoderma lucidum (Production example 2) 1.0 2. Hot water extract of wet-heat treated Ganoderma lucidum (Production Example 15A) 1.0 3. Dried corn starch 38.0 4. Microcrystalline cellulose 60.0 [Manufacturing Method] Mix ingredients 1-4 to make a powder.

[0058] (Prescription example 10) Tablets Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum Ethanol extract (Production Example 19C) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0059] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Wet heat treatment of Ganoderma lucidum Ethanol extract (Production Example 14C) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0060] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of wet-heat-treated Ganoderma lucidum (Production Example 15A) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix. [Examples]

[0061] The following are experimental examples to effectively illustrate the present invention. However, the present invention is not limited thereto.

[0062] Experimental Example 1: Effect of wet heat treatment of Ganoderma lucidum on NEIL1 production in human skin keratinocytes. NEIL1 mRNA expression levels were measured. Human skin keratinocytes were placed in a 60 mm dish at a rate of 1 × 10⁶. 5Individual seeds were seeded and cultured in HuMedia-KG2 culture medium (Kurabo) at 37°C under 5% CO2 conditions. Once confluent, the cells were cultured for 24 hours in HuMedia-KB2 culture medium (Kurabo) to which a hot water extract of wet-heat-treated Ganoderma lucidum was added to a final concentration of 1 mg / mL, after which total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by the absorbance at 260 nm using a spectrophotometer (NanoDrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from the cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression level of NEIL1 mRNA was determined as a percentage of the expression level of the internal standard, 18S-rRNA. The NEIL1 expression enhancement rate was calculated as the ratio of the expression level of NEIL1 mRNA in the sample-added group to the expression level of NEIL1 mRNA in the group without the sample. The primers used to measure the expression levels of each gene are as follows.

[0063] Primer set for NEIL1 CTATGTTTCGTGGACATCCG(Sequence ID 1) TAGCACATTCTCCCTGAACTG (Sequence ID 2) Primer set for 18S-rRNA CCGAGCCGCCTGGATAC(Sequence ID 3) CAGTTCCGAAAACCAACAAAATAGA (Sequence ID 4)

[0064] The results obtained are shown in Table 3. Addition of a hot water extract of a wet-heat-treated Ganoderma lucidum to human skin keratinocytes increased NEIL1 mRNA expression. Therefore, the hot water extract of a wet-heat-treated Ganoderma lucidum promoted NEIL1 production. The hot water extract of a wet-heat-treated Ganoderma lucidum promoted NEIL1 production more effectively than the hot water extract of a wet-heat-treated Ganoderma lucidum.

[0065] [Table 3]

[0066] Experimental Example 2: Effect of wet heat treatment of Ganoderma lucidum on NEIL1 production in human dermal fibroblasts. NEIL1 mRNA expression levels were measured. Human dermal fibroblasts were placed in a 60 mm dish at a rate of 1 × 10⁶. 5Individual seeds were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, the cells were cultured for 24 hours in DMEM(-) culture medium to which a hot water extract of wet heat-treated Ganoderma lucidum was added to a final concentration of 1 mg / mL, followed by total RNA extraction. Total RNA extraction from cells was performed using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (NanoDrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from the cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures were performed according to the prescribed method, and the expression level of NEIL1 mRNA was determined as a percentage of the expression level of the internal standard, 18S-rRNA. The NEIL1 expression enhancement rate was calculated as the ratio of the expression level of NEIL1 mRNA in the sample-added group to the expression level of NEIL1 mRNA in the group without the sample. The primers used to measure the expression levels of each gene were the same as those used in Experimental Example 1.

[0067] The results are shown in Table 4. Addition of a hot water extract of a wet-heat-treated Ganoderma lucidum to human dermal fibroblasts increased NEIL1 mRNA expression. Therefore, the hot water extract of a wet-heat-treated Ganoderma lucidum promoted NEIL1 production. The hot water extract of a wet-heat-treated Ganoderma lucidum promoted NEIL1 production more effectively than the hot water extract of a wet-heat-treated Ganoderma lucidum.

[0068] [Table 4] [Industrial applicability]

[0069] A wet heat treatment product of Ganoderma lucidum, heated to 105°C or higher with pressurized steam, or an extract thereof, has the effect of promoting the production of NEIL1, which recognizes and removes oxidatively damaged bases. A composition containing a wet heat treatment product of Ganoderma lucidum, heated to 105°C or higher with pressurized steam, or an extract thereof, can prevent, improve, or treat various metabolic syndrome diseases such as obesity, dyslipidemia, fatty liver, and hyperinsulinemia, as well as neurodegenerative diseases, caused by a decrease in NEIL1, by promoting the production of NEIL1. Furthermore, it suppresses the accumulation of mitochondrial DNA damage associated with a decrease in NEIL1, and prevents or improves mitochondrial dysfunction. In addition, it can prevent, improve, or treat age-related diseases such as hair loss, osteoporosis, and decreased cardiac function, which are associated with the accumulation of mitochondrial DNA damage.

Claims

1. A NEIL1 production promoter characterized by containing a wet heat treatment product of Ganoderma lucidum, which has been subjected to a wet heat treatment by heating to 105°C or higher with pressurized steam, or an extract of the wet heat treatment product.

2. A preventive, ameliorative, or therapeutic agent for metabolic syndrome, characterized by containing the NEIL1 production promoter described in claim 1.

3. An agent for preventing, improving, or treating age-related neurodegenerative diseases, characterized by containing the NEIL1 production promoter described in claim 1.

4. An agent for preventing or improving mitochondrial DNA damage accumulation and mitochondrial dysfunction, characterized by containing the NEIL1 production promoter described in claim 1.

5. An agent for preventing, improving, or treating hair loss, osteoporosis, or cardiac dysfunction, characterized by containing the agent for preventing or improving the accumulation of mitochondrial DNA damage and mitochondrial dysfunction described in claim 4.