RORα activator
The development of a polymethoxyflavone-based RORα activator addresses the need for novel RORα activators, providing therapeutic benefits and aligning with health promotion goals by effectively activating RORα and regulating associated biological functions.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- MARUZEN PHARMA
- Filing Date
- 2024-10-18
- Publication Date
- 2026-05-01
AI Technical Summary
There is a need for novel RORα activators, particularly those derived from natural products, to address various biological functions and potential therapeutic applications.
An RORα activator containing polymethoxyflavones, represented by a specific structural formula, is developed as an active ingredient, which can be used alone or in combination with other known RORα agonists.
The RORα activator effectively activates RORα, offering potential therapeutic benefits such as inhibiting lipid metabolism disorders, bone metabolism disorders, and regulating circadian rhythms, contributing to health promotion and aligning with Sustainable Development Goals.
Smart Images

Figure 2026073815000001 
Figure 2026073815000002 
Figure 2026073815000003
Abstract
Description
Technical Field
[0001] The present invention relates to an RORα activator.
Background Art
[0002] RORα, a nuclear receptor, is known to be involved in various biological functions including development and lipid metabolism (Non-Patent Document 1). Non-Patent Document 2 reports a synthetic compound that acts as an agonist of RORα.
Prior Art Documents
Non-Patent Documents
[0003]
Non-Patent Document 1
Non-Patent Document 2
Summary of the Invention
Problems to be Solved by the Invention
[0004] Regarding substances having RORα activation ability, there has been room for exploration including compounds derived from natural products. One aspect of the present invention aims to find a novel RORα activator.
Means for Solving the Problems
[0005] To solve the above problems, an RORα activator according to one aspect of the present invention contains, as an active ingredient, a compound represented by the following structural formula (A) or a salt thereof.
Chemical Formula
[0006] According to one aspect of the present invention, a RORα activator utilizing polymethoxyflavones can be realized. [Modes for carrying out the invention]
[0007] One aspect of the present invention is described below. The present invention is not limited to the configurations described below, and various modifications are possible within the scope of the claims. Embodiments and examples obtained by appropriately combining the technical means disclosed in different embodiments and examples are also included in the technical scope of the present invention. Furthermore, all documents mentioned herein are incorporated herein by reference. In this specification, when a numerical range is described as "A to B", the description is intended to mean "A or more and B or less", including the last number.
[0008] [Overview of RORα] RORα is a retinoic acid receptor-related orphan receptor alpha, and is the product of the RORα gene, which was identified as an orphan receptor with an unknown ligand. RORα is a nuclear receptor of the NR1 family and is sometimes referred to as NR1F1 (Nuclear receptor subfamily 1 group F members), etc.
[0009] The RORα gene is registered in the Ensembl database (https: / / www.ensembl.org / index.html) as ENSG00000069667 for humans and ENSMUSG00000032238 for mice. For organisms other than humans and mice, homologs of these genes are defined as the RORα gene in one aspect of this invention.
[0010] RORα is a protein produced by the expression of the RORα gene described above. The RORα gene may express multiple isoforms due to differences in splicing patterns, etc. All of these isoforms are defined as RORα in this embodiment.
[0011] RORα binds to the RORE (ROR response element) sequence on DNA (Deoxyribonucleic acid). The RORE sequence is a 12-base sequence containing a 6-base motif RGGTCA (where R is A or G) and a 6-base A / T rich sequence upstream (5'). When an agonist ligand binds to RORα, RORα becomes active. Activated RORα forms a complex with a coactivator to promote the expression of the target gene.
[0012] Known agonists for RORα include cholesterol, cholesterol sulfate, and 7-dehydrocholesterol (provitamin D3). Additionally, the synthetic compound SR1078 (Non-Patent Literature 2) and the naturally derived compound nobiletin (Nohara et al., Nat. Commun., 10, 3923, 2019) have also been reported as RORα agonists.
[0013] RORα-deficient mouse (RORα gene) - / - It is known that RORα-deficient mice exhibit a "staggering" phenotype due to cerebellar hypoplasia. Furthermore, it has been reported that RORα-deficient mice exhibit a variety of phenotypes, including lipid metabolism abnormalities, decreased HDL (high-density lipoprotein), bone metabolism abnormalities, delayed thymic development, increased expression of inflammatory cytokines, glucose metabolism abnormalities, increased ischemia-induced angiogenesis, increased oxidative stress, and circadian rhythm abnormalities.
[0014] That is, the RORα activator has the potential as a therapeutic agent for these phenotypes. For example, it is expected to be applied as an inhibitor of lipid metabolism disorders, an inhibitor of HDL reduction, an inhibitor of bone metabolism disorders, an inhibitor of thymus development disorders, an inhibitor of the expression of inflammatory cytokines, an inhibitor of glucose metabolism disorders, an inhibitor of angiogenesis induced by ischemia, an inhibitor of oxidative stress, and a regulator of the circadian rhythm, etc.
[0015] The inventors of the present invention conducted screening of various compounds including compounds derived from natural products using the ability to activate RORα as an index. As a result, they newly found that polymethoxyflavones that can also be extracted from natural products have the ability to activate RORα, and thus completed the present invention. That is, the RORα activator according to one aspect of the present invention contains polymethoxyflavones having a specific structure as an active ingredient.
[0016] Thus, the RORα activator according to one aspect of the present invention contains polymethoxyflavones contained in natural products as an active ingredient. Therefore, it is easy to reduce the production cost of the RORα activator, and it becomes easy to realize the improvement effects of the above-mentioned various biological functions obtained by RORα activation in various dosage forms and applications. Therefore, it can contribute to the health promotion of many humans and animals other than humans. Such effects also contribute to the achievement of, for example, Goal 3 of the Sustainable Development Goals (SDGs) proposed by the United Nations, "Ensuring healthy lives for all people".
[0017] Hereinafter in this specification, when simply referred to as "RORα activator" without special mention, it is intended to be the RORα activator according to one aspect of the present invention.
[0018] 〔Polymethoxyflavones〕 The polymethoxyflavones contained in the RORα activator according to one aspect of the present invention are a compound represented by the following structural formula (A) or a salt thereof.
[0019]
Chemical formula
[0020] Regarding the biological functions of polymethoxyflavones, for example, polymethoxyflavones derived from black ginger are known to have a fat-burning function. In addition, it has been reported that polymethoxyflavones derived from black ginger are involved in an increase in the expression level of a factor (PPARδ) involved in energy metabolism. Therefore, polymethoxyflavones derived from black ginger are considered to exhibit a fat-burning function due to the enhancing effect on energy metabolism. On the other hand, regarding the action on RORα in the polymethoxyflavones represented by the above structural formula (A), nothing has been known conventionally.
[0021] The polymethoxyflavones are preferably 5,7-dimethoxyflavone represented by the following structural formula (B), 5,7,3’,4’-tetramethoxyflavone represented by the following structural formula (C), 3,5,7,4’-tetramethoxyflavone represented by the following structural formula (D), 5,7,4’-trimethoxyflavone represented by the following structural formula (E), or 3,5,7,3’,4’-pentamethoxyflavone represented by the following structural formula (F) among the compounds represented by the structural formula (A). Among them, 5,7-dimethoxyflavone or 5,7,3’,4’-tetramethoxyflavone is more preferable.
[0022]
Chemical formula
[0023]
Chemical formula
[0024]
Chemical formula
[0025] [ka]
[0026] [ka]
[0027] In this specification, "salt" refers to a salt of the compound represented by structural formula (A) that is physiologically acceptable for administration to a living organism. Preferably, "salt" refers to a salt of the compound represented by structural formula (A) that is physiologically acceptable for administration to a living organism and that has the ability to activate RORα. The type of salt is not particularly limited. Furthermore, whether or not the salt has the ability to activate RORα can be confirmed by the method described in the examples below.
[0028] Examples of such salts include alkali metal salts (potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, etc.), ammonium salts, organic base salts (trimethylamine salt, triethylamine salt, pyridine salt, picoline salt, dicyclohexylamine salt, or N,N'-dibenzylethylenediamine salt, etc.), organic acid salts (acetate salt, maleate salt, tartrate salt, methanesulfonate salt, benzenesulfonate salt, formate salt, toluenesulfonate salt, or trifluoroacetate salt, etc.), and inorganic acid salts (hydrochloride salt, hydrobromide salt, sulfate salt, or phosphate salt, etc.).
[0029] Polymethoxyflavones may be used individually from the compounds shown in structural formula (A), or two or more may be used in combination.
[0030] The content of polymethoxyflavones in the RORα activator is not particularly limited and can be appropriately selected depending on the purpose. From the viewpoint of exhibiting RORα activating ability, the content may be, for example, 0.001% by mass or more, 0.01% by mass or more, 0.10% by mass or more, 0.25% by mass or more, 0.5% by mass or more, 0.75% by mass or more, or 1.0% by mass or more. Furthermore, from the viewpoint of formulation and manufacturing cost of the RORα activator, the content may be, for example, 50% by mass or less, 25% by mass or less, 10% by mass or less, or 5% by mass or less.
[0031] These polymethoxyflavones are known compounds, and commercially available products may be used, or those manufactured by known methods may be used.
[0032] Furthermore, as mentioned above, polymethoxyflavones are known to be extractable from natural plants, for example. Polymethoxyflavones may also be used in the form of such plant extracts. There are no particular restrictions on the plant, and they can be appropriately selected depending on the purpose, but black ginger (scientific name: Kaempferia parviflora) is preferred.
[0033] <Black Ginger Extract> RORα activators may contain black ginger extract as an active ingredient. Black ginger is a plant belonging to the genus Curcuma in the family Zingiberaceae, and is distributed in Southeast Asia, including Thailand, where it is readily available.
[0034] Black ginger extract may be prepared from the extracting site used as the raw material, or a commercially available product may be used, as long as it contains polymethoxyflavones.
[0035] (extraction site) There are no particular restrictions on the part of the black ginger used for extraction; it can be appropriately selected depending on the purpose. Examples include above-ground parts such as flowers, buds, seeds, seed coats, stems, leaves, branches, or branch leaves; and underground parts such as roots or rhizomes. These may be used individually or in combination of two or more. Among these, underground parts such as roots or rhizomes are preferred.
[0036] There are no particular restrictions on the shape, structure, and size of the black ginger extract, and they can be appropriately selected according to the purpose.
[0037] (Method for preparing the extracted part) There are no particular restrictions on the preparation method for the black ginger extract, and it can be appropriately selected depending on the purpose. For example, the extract can be dried and then either used as is or ground using a crushing machine. The dried material, either as is or ground, can be subjected to solvent extraction. Drying may be done in the sun or using a commonly used drying machine.
[0038] (extraction) Black ginger extract can be easily obtained by methods commonly used for plant extraction. There are no particular restrictions on the form of the black ginger extract, and it can be appropriately selected according to the purpose. Examples include the extract itself, a diluted extract, and a concentrated extract, and these may be dried, crude, or purified products.
[0039] There are no particular restrictions on the extraction method, and it can be appropriately selected according to the purpose. For example, extraction can be performed at room temperature (15-25°C) or under reflux heating using any extraction apparatus. More specifically, the extraction portion of black ginger, which is the raw material for extraction, is placed in a processing tank filled with extraction solvent, and the mixture is left to stand for, for example, 30 minutes to 4 hours while stirring as needed to elute the soluble components. After that, the eluted material is filtered to remove the extraction residue and obtain the extract. The extract may be further dried after removing the extraction solvent by distillation before use.
[0040] Alternatively, the material may be pretreated with a non-polar solvent such as hexane to remove excess fat before being used as an extraction raw material. Pretreatment such as degreasing allows for more efficient extraction using polar solvents.
[0041] There are no particular restrictions on the conditions (extraction time and temperature), extraction solvent, and amount of extraction solvent used in the extraction of black ginger; they can be appropriately selected according to the purpose.
[0042] There are no particular restrictions on the extraction solvent, and it can be appropriately selected depending on the purpose. Examples include water, hydrophilic solvents, or mixed solvents of water and hydrophilic solvents.
[0043] There are no particular restrictions on the type of water used, and it can be selected appropriately depending on the purpose. Examples include pure water, tap water, well water, mineral water, mineral water, hot spring water, spring water, and fresh water, as well as water that has undergone various treatments. Treatments applied to water include purification, heating, sterilization, filtration, ion exchange, osmotic pressure adjustment, or buffering. Water that can be used as an extraction solvent also includes purified water, hot water, ion-exchanged water, physiological saline, phosphate buffer, or phosphate-buffered physiological saline. Water may be used alone or in combination of two or more types.
[0044] There are no particular restrictions on the hydrophilic solvent, and it can be appropriately selected depending on the purpose. Examples include lower alcohols with 1 to 5 carbon atoms such as methanol, ethanol, n-propyl alcohol, or isopropyl alcohol; lower aliphatic ketones such as acetone or methyl ethyl ketone; and polyhydric alcohols with 2 to 5 carbon atoms such as 1,3-butylene glycol, propylene glycol, or glycerin. These may be used individually or in combination of two or more.
[0045] There are no particular restrictions on the amount of hydrophilic solvent used relative to water in a mixed solvent, and it can be appropriately selected according to the purpose. When using a lower alcohol as the hydrophilic solvent, it is preferable to add 1 to 90 parts by volume per 10 parts by volume of water; when using a lower aliphatic ketone, it is preferable to add 1 to 40 parts by volume per 10 parts by volume of water; and when using a polyhydric alcohol, it is preferable to add 1 to 90 parts by volume per 10 parts by volume of water.
[0046] There are no particular restrictions on the temperature of the extraction solvent, and it can be appropriately selected depending on the purpose, but it is preferable to use a temperature that is above room temperature and below the boiling point of the solvent.
[0047] The obtained black ginger extract may be subjected to dilution, concentration, drying, or purification in accordance with conventional methods in order to obtain a diluted product, concentrate, dried product, crude product, or purified product of the black ginger extract.
[0048] There are no particular restrictions on the purification method for black ginger extract, and it can be appropriately selected depending on the purpose. Examples of purification methods include activated carbon treatment, adsorption resin treatment, or ion exchange resin treatment. By purifying the extract using such methods, the concentration of active ingredients can be increased, or unwanted substances can be removed.
[0049] The obtained black ginger extract can be used as is as a RORα activator, but a concentrated liquid or dried product is preferred for ease of use. When obtaining the dried product, a carrier such as dextrin or cyclodextrin may be added to improve its hygroscopic properties.
[0050] Examples of polymethoxyflavones contained in black ginger extract include 5,7,3',4'-tetramethoxyflavone, 3,5,7,3',4'-pentamethoxyflavone, 5,7-dimethoxyflavone, 5,7,4'-trimethoxyflavone, 3,5,7-trimethoxyflavone, and 3,5,7,4'-tetramethoxyflavone. Among these, it is preferable to include 5,7-dimethoxyflavone or 3,5,7,3',4'-pentamethoxyflavone.
[0051] There are no particular restrictions on the polymethoxyflavones content in black ginger extract, and it can be appropriately selected depending on the purpose; for example, it may be 0.1 to 20% by mass.
[0052] [Other ingredients] The RORα activator may contain components other than polymethoxyflavones. The RORα activator may also contain other active ingredients that have RORα activating properties. Other active ingredients with RORα activating properties may include, for example, compounds known to function as RORα agonists. Such compounds are not particularly limited, but may include, for example, cholesterol, cholesterol sulfate, 7-dehydrocholesterol (provitamin D3), nobiletin, or SR1078.
[0053] Furthermore, the RORα activator may contain ingredients other than the active ingredient. Examples of ingredients other than the active ingredient include buffers, pH adjusters, isotonic agents, preservatives, antioxidants, high molecular weight polymers, excipients, carriers, diluents, solvents, solubilizers, stabilizers, fillers, binders, surfactants, moisture-proofing agents, strengthening agents, thickeners, emulsifiers, sweeteners, acidulants, seasonings, colorants, fragrances, whitening agents, moisturizers, oily components, UV absorbers, thickeners, alcohols, colorants, aqueous components, water, and skin nutrients. These may be used individually or in combination of two or more.
[0054] There are no particular restrictions on the content of components other than polymethoxyflavones in the RORα activator, and they can be appropriately selected depending on the purpose.
[0055] [Uses of RORα activator] There are no particular restrictions on the use of RORα activators, and they can be appropriately selected according to the purpose. Examples include pharmaceuticals, quasi-drugs, foods, beverages, and cosmetics.
[0056] While RORα activators are suitably applied to humans, they can also be applied to animals other than humans, as long as their effects are achieved. Examples of animals other than humans include mice, rats, hamsters, dogs, cats, cattle, pigs, and monkeys.
[0057] The RORα activator may be administered by any method of administration. Examples of administration methods include oral administration, parenteral administration, transdermal administration, transmucosal administration, and intravenous administration. Two or more of these administration methods may be used in combination.
[0058] There are no particular restrictions on the dosage form of the RORα activator, and it can be appropriately selected according to the purpose. Examples include oral preparations such as tablets, powders, capsules, granules, extracts, or syrups; parenteral preparations such as injections, infusions, or suppositories; and transdermal preparations such as lotions, emulsions, creams, ointments, serums, creams, packs, jellies, lip balms, lipsticks, foundations, bath additives, soaps, body washes, astringents, hair tonics, hair lotions, hair creams, hair liquids, pomades, shampoos, rinses, or conditioners. When the RORα activator is administered to animals other than humans, feed or drinking water containing the RORα activator may be administered orally.
[0059] RORα activators administered by such methods and dosage forms can be suitably used as, for example, inhibitors of lipid metabolism disorders, HDL reduction inhibitors, bone metabolism disorders inhibitors, thymic development disorders inhibitors, inflammatory cytokine expression inhibitors, glucose metabolism disorders inhibitors, ischemia-induced angiogenesis inhibitors, oxidative stress inhibitors, or circadian rhythm regulators.
[0060] There are no particular restrictions on the manufacturing method of each dosage form of RORα activator, and known methods can be appropriately selected. Furthermore, there are no particular restrictions on the method of use, such as the amount or duration of use of the RORα activator, and these can be appropriately selected according to the purpose.
[0061] Furthermore, RORα activators can also be used as reagents for research on the mechanism of action of RORα.
[0062] [Method for activating RORα] One aspect of the present invention can also be expressed as a method for activating RORα by administering a composition containing polymethoxyflavones. The composition containing polymethoxyflavones may be the RORα activator itself, or it may be a composition containing the RORα activator in addition to other components.
[0063] Other ingredients are not particularly limited and can be selected as appropriate depending on the purpose. For example, one or more ingredients other than the "active ingredients" mentioned above may be selected. [Examples]
[0064] An embodiment of the present invention is described below. The RORα-activating ability of polymethoxyflavones was investigated by a reporter assay.
[0065] (material) The samples shown in Table 1 below were used as test substances containing polymethoxyflavones.
[0066] The black ginger extract of Sample S1 is a black ginger extract (60% ethanol extract) obtained using the roots and rhizomes of black ginger as the extraction sites. The extraction method used was the known method described above. Black ginger extract obtained from black ginger by this method is known to contain polymethoxyflavones as its main component. The black ginger extract was dried into a powder and dissolved in 100% DMSO for use. The concentrations of Sample S1 shown in Table 1 below were calculated based on the mass of the black ginger powder.
[0067] The polymethoxyflavones in samples S2, S4, and S6 were reagent products manufactured by Tokiwa Botanical Chemical Co., Ltd. The polymethoxyflavones in samples S3 and S5 were reagent products manufactured by INDOFINE Chemical Company, Inc. All of these polymethoxyflavones in samples S2 to S6 were dissolved in 100% DMSO before use. The polymethoxyflavones in samples S2 to S6 each have the chemical structures represented by the structural formulas (B) to (F) described above.
[0068] [Table 1]
[0069] (Luciferase assay) HEK293 cell line was co-introduced using Lipofectamin2000 (Thermo Fisher Scientific) with a vector containing a sequence (SEQ ID NO: 1) consisting of three repetitions of the RORα-recognition sequence RORE (AGATGGAAAATGGGTCACCACA) inserted into the multi-cloning site of pMetLuc2 (Takara Bio Inc.), and a RORα transient expression vector containing the RORα gene inserted into the multi-cloning site of pSG5 (Agilent Technologies Inc.). The resulting cell line is referred to as the HEK293Luc strain. pMetLuc2 possesses a secretory luciferase gene derived from Metridia longa downstream of its multi-cloning site and promoter region. In the HEK293Luc strain, binding of active RORα to the RORE sequence promotes the secretion of luciferase into the culture medium.
[0070] HEK293Luc strain was cultured in 200 μL of liquid medium (D-MEM containing 1% fetal bovine serum) containing S1 at a final concentration of 50 μg / mL or 5 μg / mL and S2-S6 at a final concentration of 50 μM or 5 μM in a 96-well plate using a CO2 incubator at 37°C for 48 hours under a 5% CO2 concentration.
[0071] The luminescence intensity of the culture supernatant after culturing was measured using a secreted luciferase reporter assay kit (Takara Bio Inc.) and a multi-plate reader Infinite 200 PRO MPlex (Tecan Japan Inc.). Three trials were performed for each sample, and the mean and standard deviation were calculated.
[0072] When a substance with activating properties acts on RORα transiently expressed in the HEK293Luc strain, RORα is activated, and the activated RORα binds to the RORE sequence to form a transcriptional activation complex. This promotes the expression of the luciferase gene located downstream of the RORE sequence, and an increase in luminescence derived from luciferase secreted from the HEK293Luc strain is observed in the culture supernatant.
[0073] (result) The results obtained from the luciferase assay described above are shown in Table 2 below. In Table 2 below, the numerical values showing the results for each sample represent the relative luminescence intensity when the luminescence intensity of the blank control (using 100% DMSO without the test substance, with a final concentration of 0.5% DMSO in the culture medium) is set to 1.0. The "±" shown in Table 2 below indicates the standard deviation.
[0074] [Table 2]
[0075] As shown in Examples 1-6, an increase in luminescence intensity was observed in all samples containing polymethoxyflavones, at least at a final concentration of 50 μM. Furthermore, as shown in Examples 1-3, a clear increase in luminescence intensity was observed in sample S1 at a final concentration of 5 μg / mL, and in samples S2 and S3 at a final concentration of 5 μM. These results indicate that all polymethoxyflavones used in each example possess RORα activating ability. [Industrial applicability]
[0076] This invention can be used in pharmaceuticals and food products as a RORα activator.
Claims
[Claim 1] A RORα activator containing the compound represented by the following structural formula (A), or a salt thereof, as an active ingredient. 【Chemistry 1】 In the above structural formula (A), R 1 ~R 6 These are hydrogen (-H), a hydroxyl group (-OH), and a methoxy group (-OCH), respectively. 3 ) and R 1 ~R 6 It contains two or more methoxy groups.