Antisense nucleic acids that induce exon 50 skipping
Antisense oligomers with specific sequences and modifications efficiently induce exon 50 skipping of the dystrophin gene, addressing the need for effective DMD treatment by producing a functional dystrophin protein.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NIPPON SHINYAKU CO LTD
- Filing Date
- 2026-04-16
- Publication Date
- 2026-07-29
AI Technical Summary
There is a need for an antisense oligomer that efficiently induces exon 50 skipping of the dystrophin gene while maintaining excellent pharmaceutical properties, such as solubility, to treat Duchenne muscular dystrophy (DMD) effectively.
The development of antisense oligomers with specific base sequences (SEQ ID NOs: 3 to 5) or variants that induce exon 50 skipping of the human dystrophin gene, including modifications to the sugar moiety and phosphate bond moiety, and their use in pharmaceutical compositions for treating muscular dystrophy.
The antisense oligomers efficiently induce exon 50 skipping of the dystrophin gene, maintaining activity and solubility, thereby potentially treating DMD by modifying the amino acid reading frame to produce a functional dystrophin protein.
Smart Images

Figure 2026123049000026 
Figure 2026123049000027 
Figure 2026123049000028
Abstract
Description
[Technical Field]
[0001] The present invention relates to an antisense oligomer that induces skipping of the 50th exon of the human dystrophin gene, and to a pharmaceutical composition containing the antisense oligomer. [Background technology]
[0002] Duchenne muscular dystrophy (DMD) is the most common and severe hereditary progressive muscular atrophy, affecting approximately 1 in 3,500 male births. In infancy, motor function is almost indistinguishable from that of healthy individuals, but muscle weakness begins to appear around the age of 4-5. Subsequently, muscle weakness progresses in DMD patients, who become unable to walk by around the age of 12 and die in their 20s from heart failure or respiratory failure. Currently, there is no adequate treatment for DMD, and the development of effective drugs is urgently needed.
[0003] It is known that the cause of DMD is a mutation in the dystrophin gene. The dystrophin gene is located on the X chromosome and is a huge gene consisting of 2.2 million base pairs of DNA. It is transcribed from DNA into an mRNA precursor, and then spliced to remove introns and join 79 exons, resulting in an mRNA of 11,058 base pairs corresponding to the coding region. This mRNA is translated into 3,685 amino acids to produce the dystrophin protein. The dystrophin protein is involved in maintaining the membrane stability of muscle cells and is necessary to make muscle cells less susceptible to damage. Because the dystrophin gene in DMD patients has a mutation, the dystrophin protein that functions in muscle cells is hardly expressed. As a result, the structure of muscle cells cannot be maintained in the bodies of DMD patients, and a large amount of calcium ions flow into the muscle cells. This results in an inflammation-like reaction, and fibrosis progresses, making it difficult for muscle cells to regenerate.
[0004] Becker muscular dystrophy (BMD) is also caused by mutations in the dystrophin gene, but its symptoms, while presenting with muscle weakness due to muscle atrophy, are generally milder than those of DMD, the progression of muscle weakness is slower, and it often develops in adulthood. The difference in clinical symptoms between DMD and BMD is thought to be due to whether the amino acid reading frame used when dystrophin mRNA is translated into dystrophin protein is disrupted or maintained by the mutation (Non-Patent Literature 1). In other words, in DMD, due to a mutation that shifts the amino acid reading frame, almost no functional dystrophin protein is expressed, while in BMD, although part of the exon is deleted due to the mutation, the amino acid reading frame is maintained, so an incomplete but functional dystrophin protein is produced.
[0005] Exon skipping is a promising treatment for DMD. This method involves modifying splicing to repair the amino acid reading frame of dystrophin mRNA, thereby inducing the expression of a partially functional dystrophin protein (Non-Patent Literature 2). The amino acid sequence portion targeted by exon skipping is lost. As a result, the dystrophin protein expressed by this treatment will be shorter than normal, but the amino acid reading frame is maintained, partially preserving its function in stabilizing muscle cells. Therefore, it is expected that exon skipping will cause DMD to present with symptoms similar to those of milder BMD. Exon skipping has undergone animal experiments in mice and dogs, and clinical trials are currently underway on human DMD patients.
[0006] Exon skipping can be induced by the binding of antisense nucleic acids to either or both of the 5' or 3' splice sites, or to the interior of the exon. An exon is incorporated into mRNA only if both splice sites are recognized by the spliceosome complex. Therefore, exon skipping can be induced by targeting the splice site with antisense nucleic acids. Furthermore, it is thought that the binding of SR proteins to exon splicing enhancers (ESEs) is necessary for exons to be recognized by the splicing mechanism, and thus exon skipping can also be induced by targeting ESEs.
[0007] Because mutations in the dystrophin gene differ among DMD patients, antisense nucleic acids are needed that are tailored to the location and type of gene mutation. To date, Steve Wilton et al. at the University of Western Australia have created antisense nucleic acids that induce exon skipping for all 79 exons (Non-Patent Literature 3), and Annemieke Aartsma-Rus et al. in the Netherlands have created antisense nucleic acids that induce exon skipping for 39 types of exons (Non-Patent Literature 4).
[0008] It is believed that approximately 4% of all DMD patients can be treated by skipping exon 50 (hereinafter referred to as "exon 50") (Non-Patent Document 5). In recent years, several research institutions, including the applicant, have reported on studies targeting exon 50 of the dystrophin gene for exon skipping (Patent Documents 1-6 and Non-Patent Document 6). [Prior art documents] [Patent Documents]
[0009] [Patent Document 1] International Publication No. 2013 / 100190 [Patent Document 2] International Publication No. 2004 / 048570
Patent Document 3
Patent Document 4
Patent Document 5
Patent Document 6
[0010]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Non-Patent Document 6
Summary of the Invention
Problems to be Solved by the Invention
[0011] In the circumstances described above, there is a need for a novel antisense oligomer that efficiently induces exon 50 skipping of the dystrophin gene. Furthermore, there is a need for an antisense oligomer that maintains the activity to efficiently induce exon 50 skipping of the dystrophin gene while also possessing excellent pharmaceutical properties (e.g., solubility). [Means for solving the problem]
[0012] The inventors, after conducting detailed research on the technical details described in the above-mentioned literature and the structure of the dystrophin gene, found that administering an antisense oligomer having the base sequence shown in any of SEQ ID NOs: 3 to 5 efficiently induces exon 50 skipping of the human dystrophin gene. Furthermore, they found that the antisense oligomer efficiently induces exon 50 skipping of the human dystrophin gene while also possessing excellent solubility. Based on this finding, the inventors completed the present invention.
[0013] In other words, the present invention is as follows: [1] (a) to (d) below: (a) Antisense oligomers containing any of the base sequences of SEQ ID NOs. 3-5; (b) Antisense oligomers comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added to any of the nucleotide sequences of SEQ ID NOs. 3 to 5, and which have the activity to induce exon 50 skipping of the human dystrophin gene; (c) Antisense oligomers containing a nucleotide sequence having 80% or more sequence identity with any of the nucleotide sequences of SEQ ID NOs: 3-5, and having the activity to induce exon 50 skipping of the human dystrophin gene; and (d) An antisense oligomer that hybridizes under stringent conditions with an oligonucleotide having a base sequence complementary to any of the base sequences of SEQ ID NOs: 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene. An antisense oligomer selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof, or a hydrate thereof. [2] (e) to (h) below: (e) Antisense oligomers consisting of any of the base sequences of SEQ ID NOs. 3 to 5; (f) Antisense oligomers comprising a sequence in which 1 to 5 bases are deleted and / or substituted from any of the base sequences of SEQ ID NOs. 3 to 5, and which have the activity to induce exon 50 skipping of the human dystrophin gene; (g) Antisense oligomers consisting of a nucleotide sequence having 80% or more sequence identity with any of the nucleotide sequences of SEQ ID NOs: 3-5, and having the activity to induce exon 50 skipping of the human dystrophin gene; and (h) An antisense oligomer that hybridizes under highly stringent conditions with an oligonucleotide consisting of a nucleotide sequence complementary to any of the nucleotide sequences of SEQ ID NOs. 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene. An antisense oligomer selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof, or a hydrate thereof. [3] The aforementioned antisense oligomer An antisense oligomer having a nucleotide sequence with more than 90% sequence identity to any of the base sequences of SEQ ID NOs: 3-5, and having the activity to induce exon 50 skipping of the human dystrophin gene. The antisense oligomers described in [1] or [2] above, or pharmaceutically acceptable salts thereof, or hydrates thereof. [4] An oligonucleotide, an antisense oligomer as described in any of [1] to [3] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof. [5] The antisense oligomer described in [4] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the sugar moiety and / or phosphate bond moiety of at least one nucleotide constituting the oligonucleotide is modified. [6] The antisense oligomer described in [4] or [5] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the sugar portion of at least one nucleotide constituting the oligonucleotide is a ribose in which the -OH group at the 2' position is substituted with any group selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br, and I. (The above R represents alkyl or aryl, and the above R' represents alkylene.) [7] An antisense oligomer according to any one of the above [4] to [6], or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the phosphate bond of at least one nucleotide constituting the oligonucleotide is one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, and a boranophosphate bond. [8] A morpholino oligomer, the antisense oligomer described in any of [1] to [3] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof. [9] The antisense oligomer described in [8] above, which is a phosphorodiamidate morpholino oligomer, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
[10] The 5' end is represented by the following chemical formulas (1)~(3): [ka] An antisense oligomer as described in [8] or [9] above, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, which is any of the groups of the above.
[11] An antisense oligomer according to any of the above [1] to
[10] , or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the antisense oligomer has a length of 19 or 20 bases.
[12] A pharmaceutical composition for the treatment of muscular dystrophy comprising an antisense oligomer or a pharmaceutically acceptable salt thereof, or a hydrate thereof, as described in any of the above [1] to
[11] .
[13] The pharmaceutical composition according to
[12] above, further comprising a pharmaceutically acceptable carrier.
[14] A pharmaceutical composition according to
[12] or
[13] above for administration to a patient with muscular dystrophy, wherein the patient has a mutation in the dystrophin gene that is subject to exon 50 skipping.
[15] The pharmaceutical composition according to
[14] , wherein the patient has a frameshift mutation due to the deletion of at least an exon near exon 50 and a dystrophin gene in which the amino acid reading frame is modified by skipping exon 50.
[16] The pharmaceutical composition according to
[14] or
[15] above, wherein the patient has a frameshift mutation in the dystrophin gene due to a deletion of exons 51, 51-53, 51-55, or 51-57.
[17] The pharmaceutical composition according to any one of
[14] to
[16] above, wherein the patient is a human.
[18] Use of any of the antisense oligomers described in [1] to
[11] above, or pharmaceutically acceptable salts thereof, or hydrates thereof, in the manufacture of pharmaceuticals for the treatment of muscular dystrophy.
[19] A method for treating muscular dystrophy, comprising the step of administering to a patient with muscular dystrophy an effective amount of an antisense oligomer or a pharmaceutically acceptable salt thereof or a hydrate thereof as described in any of [1] to
[11] above, or a pharmaceutical composition as described in any of
[12] to
[16] above.
[20] The treatment method described in
[19] above, wherein the patient is a human being. [twenty one] An antisense oligomer or a pharmaceutically acceptable salt thereof or hydrate thereof, or a pharmaceutical composition, as described in any of [1] to
[11] above, for use in the treatment of muscular dystrophy, as described in any of
[12] to
[16] above. [twenty two] In the aforementioned treatment, the patient with muscular dystrophy is a human being, and the antisense oligomer or a pharmaceutically acceptable salt thereof or hydrate thereof, or pharmaceutical composition described in
[21] above. [Effects of the Invention]
[0014] The present invention provides an antisense oligomer that efficiently induces the skipping of exon 50 of the human dystrophin gene. Furthermore, the present invention provides an antisense oligomer that maintains activity to efficiently induce the skipping of exon 50 of the human dystrophin gene while also possessing excellent solubility. [Brief explanation of the drawing]
[0015] [Figure 1] This shows the skipping efficiency of exon 50 of the human dystrophin gene in human rhabdomyosarcoma cells (RD cells) using antisense oligomers of PMO No. 1 and 2. [Figure 2] This shows the skipping efficiency of exon 50 of the human dystrophin gene in RD cells using antisense oligomers of PMO No. 1, 3, and 4. [Figure 3] This shows the skipping efficiency of exon 50 of the human dystrophin gene in RD cells using antisense oligomers of PMO No. 1, 5, 6, and 7. [Modes for carrying out the invention]
[0016] The present invention will now be described in detail. The following embodiments are illustrative for illustrating the present invention and are not intended to limit the present invention to these embodiments only. The present invention can be implemented in various forms without departing from its spirit.
[0017] 1. Antisense oligomers The present invention provides an antisense oligomer that efficiently skips the 50th exon of the human dystrophin gene (hereinafter referred to as "the antisense oligomer of the present invention").
[0018] [Exon 50 of the human dystrophin gene] In this invention, "gene" includes not only genomic genes but also cDNA, mRNA precursors, and mRNA. Preferably, the gene is an mRNA precursor, i.e., pre-mRNA. In the human genome, the human dystrophin gene is located at locus Xp21.2. The human dystrophin gene is 2.2 million base pairs in size, making it the largest known human gene. However, the coding region of the human dystrophin gene is only 14kb, and this coding region is distributed within the dystrophin gene as 79 exons (Roberts, RG., et al., Genomics, 16: 536-538 (1993); Koenig, M., et al., Cell 53 219-228, 1988). The pre-mRNA transcript of the human dystrophin gene undergoes splicing to produce a 14kb mature mRNA. The base sequence of the human wild-type dystrophin gene is publicly known (GenBank Accession No. NM_004006). Sequence ID 1 shows the nucleotide sequence containing the sequences from exon 50 and the 5' end of intron 50 of the human wild-type dystrophin gene.
[0019] [Streetsense oligomers] The antisense oligomer of the present invention was created with the aim of modifying the protein encoded by the DMD-type dystrophin gene into the BMD-type dystrophin protein by skipping exon 50 of the human dystrophin gene. Therefore, the exon 50 of the dystrophin gene targeted for exon skipping of the antisense oligomer includes not only the wild type but also the mutant type.
[0020] The antisense oligomer of the present invention is specifically an antisense oligomer selected from any of the following groups (a) to (d). (a) Antisense oligomers containing any of the base sequences of SEQ ID NOs. 3-5; (b) Antisense oligomers comprising a nucleotide sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is deleted, substituted, inserted, and / or added to any of the nucleotide sequences of SEQ ID NOs. 3 to 5, and which have activity to induce exon 50 skipping of the human dystrophin gene; (c) Antisense oligomers containing a nucleotide sequence having 80% or more, 84% or more, 85% or more, 89% or more, 90% or more, 94% or more, or 95% or more sequence identity with any of the nucleotide sequences of SEQ ID NOs: 3 to 5, and having the activity to induce exon 50 skipping of the human dystrophin gene; and (d) An antisense oligomer that hybridizes under stringent conditions with an oligonucleotide having a base sequence complementary to any of the base sequences of SEQ ID NOs: 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene.
[0021] In another embodiment, the antisense oligomer of the present invention is specifically an antisense oligomer selected from any of the following groups (e) to (h). (e) Antisense oligomers consisting of any of the base sequences of SEQ ID NOs. 3 to 5; (f) Antisense oligomers comprising a nucleotide sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is deleted and / or substituted from any of the nucleotide sequences of sequence numbers 3 to 5, and which have the activity to induce exon 50 skipping of the human dystrophin gene; (g) Antisense oligomers comprising a nucleotide sequence having 80% or more, 84% or more, 85% or more, 89% or more, 90% or more, 94% or more, or 95% or more sequence identity with any of the nucleotide sequences of SEQ ID NOs: 3-5, and having the activity to induce exon 50 skipping of the human dystrophin gene; and (h) An antisense oligomer that hybridizes under highly stringent conditions with an oligonucleotide consisting of a nucleotide sequence complementary to any of the nucleotide sequences of SEQ ID NOs. 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene.
[0022] The antisense oligomers described in (b) to (d) and (f) to (h) above are specifically variants of the antisense oligomer in (a) and the antisense oligomer in (e), respectively, and are intended to correspond to mutations (e.g., polymorphisms) in the patient's dystrophin gene.
[0023] In this specification, "antisense oligomers hybridizing under stringent conditions" refers to antisense oligomers obtained by using colony hybridization, plaque hybridization, or Southern hybridization, for example, by using all or part of an oligonucleotide consisting of a nucleotide sequence complementary to any of the nucleotide sequences of SEQ ID NOs. 2 to 3 as a probe. Hybridization methods can be those described in, for example, "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001" and "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997."
[0024] In this specification, “stringent conditions” may be any of low-stringent, medium-stringent, or high-stringent conditions. “Low-stringent conditions” are, for example, 5×SSC, 5×Denhardt solution, 0.5% SDS, 50% formamide, and 32°C. “Medium-stringent conditions” are, for example, 5×SSC, 5×Denhardt solution, 0.5% SDS, 50% formamide, and 42°C, or 5×SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5), 50% formamide, and 42°C. "Highly stringent conditions" include, but are not limited to, the following conditions: (1) 5×SSC, 5×Denhardt solution, 0.5% SDS, 50% formamide, 50°C; (2) 0.2×SSC, 0.1% SDS, 60°C; (3) 0.2×SSC, 0.1% SDS, 62°C; (4) 0.2×SSC, 0.1% SDS, 65°C; or (5) 0.1×SSC, 0.1% SDS, 65°C. Under these conditions, it can be expected that antisense oligomers with high sequence identity can be efficiently obtained as the temperature increases. However, several factors such as temperature, probe concentration, probe length, ionic strength, time, and salt concentration can be considered as factors that affect the stringency of hybridization, and those skilled in the art can achieve similar stringency by appropriately selecting these factors. Here, "sequence identity" refers to the identity of two nucleic acid pairs across the entire range of the base sequences being compared, and is expressed by the percentage of matching bases in the optimal alignment of the base sequences created using mathematical algorithms known in the art of the present invention. For example, an antisense oligomer having "80% sequence identity" with respect to an antisense oligomer consisting of a base sequence of 20 bases means an antisense oligomer that has 16 or more identical bases to the aforementioned 20-base antisense oligomer.
[0025] If a commercially available kit is used for hybridization, for example, the Alkphos Direct Labelling and Detection System (GE Healthcare) can be used. In this case, following the protocol provided with the kit, the labeled probe is incubated overnight, and then the membrane is washed with a primary washing buffer containing 0.1% (w / v) SDS at 55°C before the hybridized antisense oligomer can be detected. Alternatively, when preparing a probe based on all or part of a nucleotide sequence complementary to any of the nucleotide sequences of SEQ ID NOs: 3-5, if the probe is labeled with digoxigenin (DIG) using a commercially available reagent (e.g., PCR labeling mix (Roche Diagnostics)), the hybridization can be detected using a DIG nucleic acid detection kit (Roche Diagnostics).
[0026] Other hybridizable antisense oligomers include those that, when calculated using homology search software such as FASTA or BLAST with default parameters, exhibit sequence identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with any of the base sequences of sequence numbers 3 to 5.
[0027] Sequence identity can be determined using FASTA (Science 227 (4693): 1435-1441, (1985)) or the BLAST (Basic Local Alignment Search Tool) algorithm by Carlin and Arthur (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993). Programs called blastn, blastx, tblastn, and tblastx have been developed based on the BLAST algorithm (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing the base sequence using blastn, the parameters should be, for example, score=100 and wordlength=12. When using the BLAST and Gapped BLAST programs, use the default parameters of each program.
[0028] "Inducing (enabling) skipping of exon 50 of the human dystrophin gene" means that the antisense oligomer of the present invention binds to the region corresponding to exon 50 and / or its adjacent intron of the transcript of the human dystrophin gene (e.g., pre-mRNA), so that when the transcript undergoes splicing, exon 50 is excluded. For example, in a DMD patient with exon 51 deletion, the base sequence corresponding to the 5' end of exon 52 is ligated to the base sequence corresponding to the 3' end of exon 49, resulting in the formation of mature mRNA without codon frameshift.
[0029] Therefore, DMD patients who have a mutation in the dystrophin gene that is suitable for exon 50 skipping can be treated by exon 50 skipping. Examples of such DMD patients include those with a frameshift mutation resulting from the deletion of at least an exon near exon 50, and whose dystrophin gene has a modified amino acid reading frame due to exon 50 skipping. More specifically, examples include DMD patients with a frameshift mutation resulting from the deletion of exons 51, 51-53, 51-55, 51-57, etc., of the dystrophin gene.
[0030] Here, "binding" means that when the antisense oligomer of the present invention and the transcript of the human dystrophin gene are mixed, they hybridize under physiological conditions to form a double helix. "Physiological conditions" means conditions adjusted to have a pH, salt composition, and temperature similar to those in a living organism. For example, conditions such as 25-40°C, preferably 37°C, pH 5-8, preferably pH 7.4, and a sodium chloride concentration of 150 mM are mentioned.
[0031] Whether or not skipping of exon 50 of the human dystrophin gene has occurred can be confirmed by introducing the antisense oligomer of the present invention into dystrophin-expressing cells (e.g., human rhabdomyosarcoma cells), RT-PCR amplification of the region surrounding exon 50 of the human dystrophin gene mRNA from the total RNA of the dystrophin-expressing cells, and performing nested PCR or sequencing analysis on the PCR amplification product. The skipping efficiency ES (unit: %) can be calculated by recovering the human dystrophin gene mRNA from the test cells, measuring the amount of polynucleotides "A" in the band where exon 50 was skipped and the amount of polynucleotides "B" in the band where exon 50 was not skipped, and using these measured values of "A" and "B" according to the following formula (1). For the calculation of skipping efficiency, refer to International Publication No. 2012 / 029986.
[0032] ES = 100 × A / (A + B) ... (1)
[0033] Preferably, the antisense oligomer of the present invention skips exon 50 with an efficiency of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.
[0034] Examples of antisense oligomers of the present invention include oligonucleotides, morpholino oligomers, or peptide nucleic acid (PNA) oligomers having a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases. Preferably, the antisense oligomer has a length of 16-25 bases, 16-23 bases, 19 bases, or 20 bases, with morpholino oligomers being preferred.
[0035] The above-mentioned oligonucleotide (hereinafter referred to as "the oligonucleotide of the present invention") is an antisense oligomer of the present invention having a nucleotide as a constituent unit, and such nucleotide may be a ribonucleotide, a deoxyribonucleotide, or a modified nucleotide.
[0036] A modified nucleotide refers to a ribonucleotide or deoxyribonucleotide in which all or part of the nucleic acid base, sugar moiety, and phosphate bond moiety are modified.
[0037] In the present invention, examples of nucleic acid bases include adenine, guanine, hypoxanthine, cytosine, thymine, uracil, or modified bases thereof. Examples of such modified bases include pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, and 5-(carboxyhydroxymethyl) Examples include, but are not limited to, uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purines, 2,6-diaminopurines, 2-aminopurines, isoguanine, indole, imidazole, xanthine, etc.
[0038] Modifications of the sugar portion include, for example, modifications of the 2' position of ribose and modifications of other parts of the sugar. Modifications of the 2' position of ribose include, for example, the substitution of the -OH group at the 2' position of ribose with OR, R, R'OR, SH, SR, NH2, NHR, NR2, N3, CN, F, Cl, Br, or I. Here, R represents alkyl or aryl, and R' represents alkylene. Other modifications of the sugar include, but are not limited to, substitution of the 4'-position O of ribose or deoxyribose with S, and bridging of the 2' and 4' positions of the sugar, such as LNA (Locked Nucleic Acid) or ENA (2'-O,4'-C-Ethylene-bridged Nucleic Acids).
[0039] Modifications of the phosphate bond include, for example, the substitution of the phosphodiester bond with a phosphorothioate bond, phosphorodithioate bond, alkylphosphonate bond, phosphoramidate bond, or boranophosphate bond (Enya et al: Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example, Japanese Patent Publication Nos. 2006 / 129594 and 2006 / 038608).
[0040] In the present invention, linear or branched alkyl groups having 1 to 6 carbon atoms are preferred. Specifically, examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, and isohexyl. The alkyl group may be substituted, and examples of such substituents include halogens, alkoxys, cyanos, and nitros, and one to three of these may be substituted. In the present invention, cycloalkyls having 5 to 12 carbon atoms are preferred. Specifically, examples include cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclodecyl, and cyclododecyl. In the present invention, examples of halogens include fluorine, chlorine, bromine, and iodine. Examples of alkoxys include linear or branched alkoxys having 1 to 6 carbon atoms, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentyloxy, n-hexyloxy, and isohexyloxy. In particular, alkoxys having 1 to 3 carbon atoms are preferred.
[0041] In the present invention, aryls having 6 to 10 carbon atoms are preferred. Specifically, examples include phenyl, α-naphthyl, and β-naphthyl. Phenyl is particularly preferred. The aryl may be substituted, and examples of such substituents include alkyl, halogen, alkoxy, cyano, and nitro atoms, and one to three of these may be substituted. In the present invention, linear or branched alkylenes having 1 to 6 carbon atoms are preferred. Specifically, examples include methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene, and 1-(methyl)tetramethylene. In the present invention, examples of acyls include linear or branched alkanoyls or aroyls. Examples of alkanoyls include formyl, acetyl, 2-methylacetyl, 2,2-dimethylacetyl, propionyl, butyryl, isobutyryl, pentanoyl, 2,2-dimethylpropionyl, and hexanoyl. Examples of aroyls include benzoyl, toluyl, and naphthoyl. Such aroyls may be substituted at substitutable positions, or they may be substituted with alkyl groups.
[0042] The oligonucleotide of the present invention is preferably an antisense oligomer of the present invention, comprising a group represented by the following general formula as a constituent unit, wherein the -OH group at the 2' position of ribose is substituted with methoxy, and the phosphate bond portion is a phosphorothioate bond. [ka] (In the formula, Base represents a nucleobase.)
[0043] The oligonucleotides of the present invention can be easily synthesized using various automated synthesizers (e.g., AKTA oligopilot plus 10 / 100 (GE Healthcare)), or can be produced by commissioning a third-party organization (e.g., Promega, Takara, or Nippon Bio-Service).
[0044] The morpholino oligomers of the present invention are antisense oligomers having a group represented by the following general formula as a structural unit. [Chemical formula] (In the formula, Base has the same meaning as described above; W represents a group represented by any of the following formulas.)
[0045] [Chemical formula] (In the formula, X is -CH2R
[0045] , , , , 3 , , , , 1 , , 2 , , , 1 , , 1 , , , , , 1 , , , , 2 , , , 3 , , 1 , , , , 1 , , , ,
[0046] , -O-CH2R 1 , -S-CH2R 1 , -NR 2 R 3 or F; R 1 represents H or alkyl; R 2 and R 3 are the same or different and represent H, alkyl, cycloalkyl, or aryl; Y1 represents O, S, CH2 or NR 1 ; Y2 represents O, S or NR 1 ; Z represents O or S.))
[0046] Examples of morpholino monomer compounds used in the synthesis of the morpholino oligomer of the present invention include, but are not limited to, the following morpholino monomer compounds (A), (C), (T), and (G).
[0047] [Table 1]
[0048] The morpholino oligomer is preferably an oligomer (phosphodiamide morpholino oligomer (hereinafter referred to as "PMO")) whose constituent unit is a group represented by the following formula. [ka] (In the formula, Base, R 2 , R 3 (This is synonymous with the above.) The morpholino oligomers of the present invention include those in which all or part of the nucleic acid bases, morpholino ring portion, phosphate bond portion, 3' end and / or 5' end constituting such oligomers are modified.
[0049] Modifications of the phosphate bond include substitution with phosphorodiamidate bonds, phosphorothioate bonds, phosphorodithioate bonds, alkylphosphonate bonds, phosphoramidate bonds, and boranophosphate bonds (Enya et al., Bioorganic & Medicinal Chemistry, 2008, 18, 9154-9160) (see, for example, Japanese Patent Republication Nos. 2006 / 129594 and 2006 / 038608). Morphorino oligomers can be manufactured, for example, in accordance with International Publication No. 1991 / 009033 or International Publication No. 2009 / 064471. In particular, PMOs can be manufactured in accordance with the method described in International Publication No. 2009 / 064471 or in accordance with the method shown below.
[0050] [PMO manufacturing method] One example of a PMO is a compound represented by the following general formula (I) (hereinafter referred to as PMO(I)). [ka] [In the formula, each Base, R 2 , R 3 This is synonymous with the above; n is any integer in the range of 1 to 99, preferably any integer in the range of 15 to 34, 15 to 24, or 15 to 22, and more preferably 18 or 19.
[0051] PMO(I) can be manufactured according to known methods, for example, by performing the following steps. The compounds and reagents used in the following processes are not particularly limited, as long as they are commonly used in the manufacture of PMO. Furthermore, all of the following steps can be carried out by liquid-phase or solid-phase methods (using manual or commercially available automated solid-phase synthesizers). When producing PMO by solid-phase method, it is preferable to use an automated synthesizer in terms of simplifying the operating procedure and ensuring accuracy of synthesis.
[0052] (1) Process A: A process for producing a compound represented by the following general formula (III) (hereinafter referred to as compound (III)) by reacting a compound represented by the following general formula (II) (hereinafter referred to as compound (II)) with an acid. [ka] [where n, R 2 , R 3 This is synonymous with the above; Each B P This independently represents a nucleic acid base that may be protected; T represents a trityl group, a monomethoxytrityl group, or a dimethoxytrityl group; L represents hydrogen, acyl, or a group represented by the following general formula (IV) (hereinafter referred to as group (IV)). [ka]
[0053] B P The "nucleic acid base" in relation to this can be the same "nucleic acid base" as Base. However, B P The amino group or hydroxyl group of the nucleic acid base involved may be protected. The protecting group for such an amino group is not particularly limited as long as it is used as a protecting group for nucleic acids. Specifically, examples include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene. Examples of hydroxyl group protecting groups include 2-cyanoethyl, 4-nitrophenethyl, phenylsulfonylethyl, methylsulfonylethyl, trimethylsilylethyl, phenyl, diphenylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, methylphenylcarbamoyl, 1-pyrrolidinylcarbamoyl, morpholinocarbamoyl, 4-(tert-butylcarboxy)benzyl, 4-[(dimethylamino)carboxy]benzyl, and 4-(phenylcarboxy)benzyl (see, for example, International Publication No. 2009 / 064471).
[0054] The "solid-phase support" is not particularly limited as long as it is a support that can be used in solid-phase reactions of nucleic acids. However, it is desirable that it (i) is almost insoluble in reagents that can be used in the synthesis of morpholino nucleic acid derivatives (e.g., dichloromethane, acetonitrile, tetrazole, N-methylimidazole, pyridine, acetic anhydride, lutidine, trifluoroacetic acid), (ii) is chemically stable to reagents that can be used in the synthesis of morpholino nucleic acid derivatives, (iii) can be chemically modified, (iv) can be loaded with the desired morpholino nucleic acid derivative, (v) has sufficient strength to withstand the high pressure applied during processing, and (vi) has a certain particle size range and distribution. Specifically, these include swellable polystyrene (e.g., aminomethyl polystyrene resin 1% divinylbenzene crosslinked (200-400 mesh) (2.4-3.0 mmol / g) (Tokyo Chemical Co., Ltd.), Aminomethylated Polystyrene Resin·HCl [divinylbenzene 1%, 100-200 mesh] (Peptide Research Institute Co., Ltd.)), non-swellable polystyrene (e.g., Primer Support (GE Healthcare)), PEG chain-linked polystyrene (e.g., NH2-PEG resin (Watanabe Chemical Co., Ltd.), TentaGel resin), controlled pore glass (CPG) (e.g., CPG Co., Ltd.), oxarylated controlled pore glass (e.g., see Alul et al., Nucleic Acids Research, Vol. 19, 1527 (1991)), TentaGel support-aminopolyethylene glycol derivatized support (e.g., Wright et al., Tetrahedron) Examples include Poros-polystyrene / divinylbenzene copolymers (see Letters, Vol. 34, 3373 (1993)). As a "linker," known linkers commonly used to link nucleic acids and morpholino nucleic acid derivatives can be used, but examples include 3-aminopropyl, succinyl, 2,2'-diethanolsulfonyl, and long-chain alkylamino (LCAA).
[0055] This process can be carried out by reacting compound (II) with an acid.
[0056] Examples of acids that can be used in this process include trifluoroacetic acid, dichloroacetic acid, or trichloroacetic acid. The amount of acid used is suitable in the range of 0.1 to 1000 molar equivalents per mole of compound (II), and preferably in the range of 1 to 100 molar equivalents. In addition, an organic amine can be used together with the acid. The organic amine is not particularly limited, but triethylamine is an example. The amount of organic amine used is suitable, for example, in the range of 0.01 to 10 molar equivalents per mole of acid, and preferably in the range of 0.1 to 2 molar equivalents. When using a salt or mixture of an acid and an organic amine in this process, examples include a salt or mixture of trifluoroacetic acid and triethylamine, and more specifically, a mixture of 2 equivalents of trifluoroacetic acid and 1 equivalent of triethylamine. The acid used in this process may be diluted with a suitable solvent to a concentration in the range of 0.1% to 30%. The solvent is not particularly limited as long as it does not participate in the reaction, but examples include dichloromethane, acetonitrile, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, or mixtures thereof.
[0057] The reaction temperature in the above reaction is preferably in the range of 10°C to 50°C, more preferably in the range of 20°C to 40°C, and even more preferably in the range of 25°C to 35°C. The reaction time varies depending on the type of acid used and the reaction temperature, but is usually appropriate within the range of 0.1 minutes to 24 hours. Preferably, it is within the range of 1 minute to 5 hours.
[0058] Furthermore, after this process is completed, a base may be added as needed to neutralize any acids present in the system. The "base" is not particularly limited, but examples include diisopropylethylamine. The base may also be diluted with a suitable solvent to a concentration in the range of 0.1% (v / v) to 30% (v / v). The solvent used in this process is not particularly limited as long as it does not participate in the reaction, but examples include dichloromethane, acetonitrile, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, or mixtures thereof. The reaction temperature is preferably in the range of 10°C to 50°C, more preferably in the range of 20°C to 40°C, and even more preferably in the range of 25°C to 35°C. The reaction time varies depending on the type of base used and the reaction temperature, but is usually appropriate within the range of 0.1 minutes to 24 hours, and preferably within the range of 1 minute to 5 hours.
[0059] Furthermore, in compound (II), where n=1 and L is the group (IV), the compound represented by the following general formula (IIa) (hereinafter referred to as compound (IIa)) can be produced according to the following method. [ka] [In the formula, B P T, linker, and solid-phase support are synonymous with the above.
[0060] Step 1: A process for producing a compound represented by the following general formula (VI) (hereinafter referred to as compound (VI)) by reacting a compound represented by the following general formula (V) with an acylating agent. [ka] [In the formula, B P T and linker are synonymous with the above; R 4[This represents a hydroxyl group, halogen, carboxyl group, or amino acid.]
[0061] This process can be carried out by introducing a known linker, using compound (V) as the starting material. In particular, the compound represented by the following general formula (VIa) can be produced by carrying out a method known as an esterification reaction using compound (V) and succinic anhydride. [ka] [In the formula, B P T is synonymous with the above.
[0062] Step 2: A step to produce compound (IIa) by reacting compound (VI) with a solid support by reacting it with a condensing agent or the like. [ka] [In the formula, B P , R 4 T, linker, and solid-phase support are synonymous with the above. This process can be carried out by a method known as a condensation reaction using compound (VI) and a solid support. Compound (II) is represented by the following general formula (IIa2), where n = 2 to 99 (preferably any integer in the range of 16 to 35, 16 to 25, or 16 to 23, preferably 19 or 20), and L is the group (IV). This compound can be produced by using compound (IIa) as a starting material and repeatedly carrying out steps A and B of the PMO production method described herein a desired number of times. [ka] [In the formula, B P , R 2 , R 3T, linker, and solid support are synonymous with the above; n' represents 1 to 98 (in certain aspects, n' may be, for example, 1 to 34, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, or 1 to 15).
[0063] (2) Process B: A process for producing a compound represented by the following general formula (VII) (hereinafter referred to as compound (VII)) by reacting compound (III) with a morpholino monomer compound in the presence of a base. [ka] [In the formula, each B P , L, n, R 2 , R 3 T is synonymous with the above.
[0064] This process can be carried out by reacting compound (III) with a morpholino monomer compound in the presence of a base.
[0065] Examples of morpholino monomer compounds include those represented by the following general formula (VIII). [ka] [In the formula, B P , R 2 , R 3 T is synonymous with the above. Examples of "bases" that can be used in this process include diisopropylethylamine, triethylamine, or N-ethylmorpholine. The amount of base used is suitable in the range of 1 to 1000 molar equivalents per mole of compound (III), and preferably in the range of 10 to 100 molar equivalents. The morpholino monomer compounds and bases that can be used in this process may also be diluted with a suitable solvent to a concentration of 0.1% to 30%. The solvent is not particularly limited as long as it does not participate in the reaction, but examples include N,N-dimethylimidazolidone, N-methylpiperidone, DMF, dichloromethane, acetonitrile, telolahydrofuran, or mixtures thereof.
[0066] The reaction temperature is preferably in the range of 0°C to 100°C, and more preferably in the range of 10°C to 50°C. The reaction time varies depending on the type of base used and the reaction temperature, but is usually appropriate within the range of 1 minute to 48 hours, and preferably within the range of 30 minutes to 24 hours.
[0067] Furthermore, after the completion of this process, an acylating agent may be added as needed. Examples of acylating agents include acetic anhydride, acetic acid chloride, and phenoxyacetic anhydride. The acylating agent may also be used after being diluted with a suitable solvent to a concentration in the range of 0.1% to 30%. The solvent is not particularly limited as long as it does not participate in the reaction, but examples include dichloromethane, acetonitrile, tetrahydrofuran, alcohols (ethanol, isopropanol, trifluoroethanol, etc.), water, or mixtures thereof. Furthermore, if necessary, a base such as pyridine, lutidine, colidine, triethylamine, diisopropylethylamine, or N-ethylmorpholine can be used together with the acylating agent. The amount of acylating agent used is preferably in the range of 0.1 to 10,000 molar equivalents, and more preferably in the range of 1 to 1,000 molar equivalents. The amount of base used is, for example, appropriately in the range of 0.1 to 100 molar equivalents per mole of acylating agent, and preferably in the range of 1 to 10 molar equivalents. The reaction temperature for this reaction is preferably in the range of 10°C to 50°C, more preferably in the range of 10°C to 50°C, more preferably in the range of 20°C to 40°C, and even more preferably in the range of 25°C to 35°C. The reaction time varies depending on the type of acylating agent used and the reaction temperature, but is usually appropriate in the range of 0.1 minutes to 24 hours, preferably in the range of 1 minute to 5 hours.
[0068] (3) Process C: A step to produce a compound represented by general formula (IX) by removing the protecting group from compound (VII) produced in step B using a deprotecting agent. [ka] [In the formula, Base, B P , L, n, R 2 , R 3 T is synonymous with the above.
[0069] This process can be carried out by reacting compound (VII) with a deprotecting agent.
[0070] Examples of "deprotecting agents" include concentrated ammonia water and methylamine. The "deprotecting agents" that can be used in this process can also be used after dilution with water, methanol, ethanol, isopropyl alcohol, acetonitrile, tetrahydrofuran, DMF, N,N-dimethylimidazolidone, N-methylpiperidone, or a mixture thereof. Ethanol is preferred among these. The amount of deprotecting agent to be used is, for example, in the range of 1 molar equivalent to 100,000 molar equivalents per mole of compound (VII), and preferably in the range of 10 molar equivalents to 1,000 molar equivalents.
[0071] The reaction temperature is suitable, for example, in the range of 15°C to 75°C, preferably in the range of 40°C to 70°C, and more preferably in the range of 50°C to 60°C. The deprotection reaction time varies depending on the type of compound (VII), the reaction temperature, etc., but is suitable in the range of 10 minutes to 30 hours, preferably in the range of 30 minutes to 24 hours, and more preferably in the range of 5 hours to 20 hours.
[0072] (4) Process D: A step to produce PMO(I) by reacting compound (IX), which is produced in step C, with an acid. [ka] [where Base, n, R 2 , R 3 T is synonymous with the above.
[0073] This process can be carried out by adding an acid to compound (IX).
[0074] Examples of acids that can be used in this process include trichloroacetic acid, dichloroacetic acid, acetic acid, phosphoric acid, and hydrochloric acid. The amount of acid used should, for example, be such that the pH of the solution is within the range of 0.1 to 4.0, and more preferably within the range of 1.0 to 3.0. The solvent is not particularly limited as long as it does not participate in the reaction, but examples include acetonitrile, water, or a mixture thereof.
[0075] The reaction temperature is preferably in the range of 10°C to 50°C, more preferably in the range of 20°C to 40°C, and even more preferably in the range of 25°C to 35°C. The deprotection reaction time varies depending on the type of compound (IX), the reaction temperature, etc., but is suitable in the range of 0.1 minutes to 5 hours, preferably in the range of 1 minute to 1 hour, and more preferably in the range of 1 minute to 30 minutes.
[0076] PMO(I) is obtained from the reaction mixture obtained in this process by conventional separation and purification methods, such as extraction, concentration, neutralization, filtration, centrifugation, recrystallization, and C8 to C8. 18 It can be obtained by using methods such as reversed-phase column chromatography, cation exchange column chromatography, anion exchange column chromatography, gel filtration column chromatography, high-performance liquid chromatography, dialysis, and limiting filtration, either alone or in combination, to isolate and purify the desired PMO(I) (see, for example, International Publication No. 1991 / 09033). When purifying PMO(I) using reverse-phase chromatography, a mixed solution of, for example, 20 mM triethylamine / acetic acid buffer and acetonitrile can be used as the elution solvent. Furthermore, when purifying PMO(I) using ion exchange chromatography, for example, a mixed solution of 1 M saline solution and 10 mM sodium hydroxide aqueous solution can be used.
[0077] The peptide nucleic acid is the antisense oligomer of the present invention, having a group represented by the following general formula as its constituent unit. [ka] (In the formula, Base has the same meaning as above.)
[0078] Peptide nucleic acids can be manufactured, for example, according to the following literature. 1)PE Nielsen, M. Egholm, RH Berg, O. Buchardt, Science, 254, 1497 (1991) 2) M. Egholm, O. Buchardt, PE Nielsen, RH Berg, Jacs., 114, 1895 (1992) 3) KL Dueholm, M. Egholm, C. Behrens, L. Christensen, HF Hansen, T. Vulpius, KH Petersen, RH Berg, PE Nielsen, O. Buchardt, J. Org. Chem., 59, 5767 (1994) 4) L. Christensen, R. Fitzpatrick, B. Gildea, KH Petersen, HF Hansen, T. Koch, M. Egholm, O. Buchardt, PE Nielsen, J. Coull, RH Berg, J. Pept. Sci., 1, 175 (1995) 5) T. Koch, HF Hansen, P. Andersen, T. Larsen, HG Batz, K. Otteson, H. Orum, J. Pept. Res., 49, 80 (1997)
[0079] Furthermore, the antisense oligomer of the present invention may have a 5' end that is any of the following chemical formulas (1) to (3). Preferably, it is (3)-OH. [ka] Hereinafter, the groups indicated in (1), (2), and (3) above will be referred to as "group (1)", "group (2)", and "group (3)", respectively.
[0080] The antisense oligomer of the present invention may contain compounds with optically pure stereochemistry of the phosphorus atom, as the phosphorus atom in the phosphate bond portion acts as a chiral center. Those skilled in the art can obtain the pure optically active compound from a mixture of isomers (International Publication No. 2017 / 024264). Alternatively, the antisense oligomer of the present invention may be synthesized as a pure optically active compound. Those skilled in the art can obtain the pure optically active compound by controlling the synthesis reaction (Published Patent Application No. 2018-537952).
[0081] 2. Peptide-bonded antisense oligomers The antisense oligomer of the present invention may form a complex with a functional peptide intended to improve efficacy (for example, a membrane-permeable peptide intended to improve transport efficiency to target cells) (International Publication Nos. 2008 / 036127, 2009 / 005793, 2012 / 150960, 2016 / 187425, 2018 / 118662, 2018 / 118599, 2018 / 118627, JD Ramsey, NH Flynn, Pharmacology & Therapeutics 154, 78-86 (2015), MK Tsoumpra et al., EBioMedicine, https: / / doi.org / 10.1016 / j.ebiom.2019.06.036). The binding site is not particularly limited, but it is preferable that the 5' or 3' end of the antisense oligomer is bound to the amino or carboxyl terminus of the functional peptide. In another embodiment, the antisense oligomer and functional peptide of the present invention may form a complex via a linker. The linker is not particularly limited, but it is preferable that one end of the linker is bonded to the 5' or 3' end of the antisense oligomer, and the other end of the linker is bonded to the amino or carboxyl end of the functional peptide. Additionally, an extra amino acid may be present between the functional peptide and the linker.
[0082] 3. Pharmaceutical Compositions The antisense oligomer of the present invention can efficiently induce exon 50 skipping even when its length is shorter than that of conventional antisense oligomers. Furthermore, the antisense oligomer of the present invention maintains activity that efficiently induces exon 50 skipping while also possessing excellent solubility. Therefore, it is predicted that DMD patients with mutations in the dystrophin gene that are subject to exon 50 skipping (e.g., frameshift mutations, missense / nonsense mutations in exon 50, etc.) can be highly effectively alleviated by administering the antisense oligomer of the present invention. For example, it is predicted that administering the antisense oligomer of the present invention to DMD patients with a predetermined mutant dystrophin gene that has a deletion in at least an exon near exon 50 can be highly effectively alleviated by administering the antisense oligomer of the present invention. The specified mutant dystrophin gene refers to a dystrophin gene that has a frameshift mutation due to the deletion of at least an exon near exon 50, and whose amino acid reading frame is modified when exon 50 is omitted (skipped). Examples include DMD patients with frameshift mutations due to deletions in exons 51, 51-53, 51-55, 51-57, etc. More specifically, it is predicted that administering a pharmaceutical composition containing the antisense oligomer of the present invention to DMD patients (patients with mutations that are in-framed by exon 50 skipping, such as patients with exon 51 deletion, exon 51-53 deletion, exon 51-55 deletion, exon 51-57 deletion, etc.) can effectively alleviate the symptoms of muscular dystrophy. For example, when using a pharmaceutical composition containing the antisense oligomer of the present invention, the same level of therapeutic effect can be obtained with a smaller dose compared to oligomers in the prior art, thus reducing side effects and being more economical. Furthermore, the antisense oligomer of the present invention is useful in the preparation of pharmaceutical compositions because it maintains activity that efficiently induces exon 50 skipping while also possessing excellent solubility. Therefore, as another embodiment, we provide a pharmaceutical composition for the treatment of muscular dystrophy (hereinafter referred to as "the composition of the present invention") comprising the antisense oligomer of the present invention, a pharmaceutically acceptable salt thereof, or a hydrate thereof as an active ingredient. Furthermore, the present invention provides a method for treating muscular dystrophy, comprising the step of administering the antisense oligomer of the present invention to a DMD patient. In the said treatment method, the antisense oligomer of the present invention may be administered as the pharmaceutical composition for the treatment of muscular dystrophy. Furthermore, the present invention provides the use of the antisense oligomer of the present invention in the manufacture of pharmaceutical compositions for the treatment of muscular dystrophy, and the antisense oligomer of the present invention for use in the treatment of muscular dystrophy.
[0083] Examples of pharmaceutically acceptable salts of the antisense oligomer of the present invention included in the composition of the present invention include alkali metal salts such as sodium salt, potassium salt, and lithium salt; alkaline earth metal salts such as calcium salt and magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt; ammonium salts; t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylphenethylamine Examples include organic amine salts such as amine salts, piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salt; hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; arylsulfonates such as benzenesulfonates and p-toluenesulfonates; organic salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, and maleates; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamates, and aspartates. These salts can be produced by known methods. Alternatively, the antisense oligomer of the present invention contained in the composition of the present invention may be in the form of its hydrate.
[0084] The dosage form of the composition of the present invention is not particularly limited as long as it is a pharmaceutically acceptable dosage form and can be selected according to the treatment method. However, from the viewpoint of ease of delivery to muscle tissue, intravenous administration, intra-arterial administration, intramuscular administration, subcutaneous administration, oral administration, intratissue administration, transdermal administration, etc., are preferred. Furthermore, the dosage forms that the composition of the present invention may take are not particularly limited, but examples include various injectable preparations, oral preparations, intravenous infusions, inhalants, ointments, lotions, etc.
[0085] When the antisense oligomer of the present invention is administered to a patient with muscular dystrophy, the composition of the present invention may include a carrier that facilitates the delivery of the oligomer to muscle tissue. Such a carrier is not particularly limited as long as it is pharmaceutically acceptable, and examples include cationic carriers such as cationic liposomes and cationic polymers, or carriers utilizing a viral envelope. Examples of cationic liposomes include liposomes formed with 2-O-(2-diethylaminoethyl)carbamoyl-1,3-O-dioleoylglycerol and phospholipids as essential components (hereinafter referred to as "liposome A"), Oligofectamine® (manufactured by Invitrogen), Lipofecttin® (manufactured by Invitrogen), Lipofectamine® (manufactured by Invitrogen), Lipofectamine 2000® (manufactured by Invitrogen), DMRIE-C® (manufactured by Invitrogen), GeneSilencer® (manufactured by Gene Therapy Systems), TransMessenger® (manufactured by QIAGEN), TransIT TKO® (manufactured by Mirus), and Nucleofector II (Lonza). Among these, liposome A is preferred. Examples of cationic polymers include JetSI® (manufactured by Qbiogene) and Jet-PEI® (manufactured by Qbiogene). Examples of carriers utilizing the viral envelope include GenomeOne® (manufactured by Ishihara Sangyo Co., Ltd.) (HVJ-E liposome). Alternatively, the pharmaceutical device described in Japanese Patent No. 2924179, and the cationic carriers described in Japanese Patent Republication Publication No. 2006 / 129594 and Japanese Patent Republication Publication No. 2008 / 096690 can also be used. For further details, please refer to U.S. Patent No. 4,235,871, U.S. Patent No. 4,737,323, International Publication No. 96 / 14057, “New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990) pages 33-104,” etc.
[0086] The concentration of the antisense oligomer of the present invention contained in the composition of the present invention varies depending on the type of carrier, etc., but in one embodiment, a range of 0.1 nM to 100 μM is appropriate, and a range of 100 nM to 10 μM is preferred. Furthermore, the weight ratio of the antisense oligomer of the present invention to the carrier (carrier / antisense oligomer of the present invention) contained in the composition of the present invention varies depending on the properties of the oligomer and the type of carrier, etc., but a range of 0.1 to 100 is appropriate, and a range of 0.1 to 10 is preferred.
[0087] The composition of the present invention may also be in the form of an aqueous solution. In that case, the composition of the present invention may contain the antisense oligomer of the present invention at concentrations of 2.5-500 mg / mL, 5-450 mg / mL, 10-400 mg / mL, 15-350 mg / mL, 20-300 mg / mL, 20-250 mg / mL, 20-200 mg / mL, 20-150 mg / mL, 20-100 mg / mL, 20-50 mg / mL, 20-40 mg / mL, 20-30 mg / mL, 23-27 mg / mL, 24-26 mg / mL, or 25 mg / mL. Alternatively, the composition of the present invention may contain the antisense oligomer of the present invention at concentrations of 10-100 mg / mL, 15-95 mg / mL, 20-80 mg / mL, 25-75 mg / mL, 30-70 mg / mL, 35-65 mg / mL, 40-60 mg / mL, 45-55 mg / mL, 47-53 mg / mL, 48-52 mg / mL, 49-51 mg / mL, or 50 mg / mL.
[0088] The composition of the present invention may also be in dry form. In that case, to prepare the composition of the present invention in aqueous solution form, for example, the dry composition of the present invention containing 125 mg or 250 mg of the dry antisense oligomer of the present invention may be mixed with 0.5 mL to 100 mL of water (corresponding to an antisense oligomer concentration of the present invention of 1.25 mg / mL to 250 mg / mL or 2.5 mg / mL to 500 mg / mL), preferably with 1 mL to 50 mL of water (corresponding to an antisense oligomer concentration of the present invention of 2.5 mg / mL to 125 mg / mL or 5 mg / mL to 250 mg / mL), and more preferably with 5 mL to 10 mL of water (corresponding to an antisense oligomer concentration of the present invention of 12.5 mg / mL to 25 mg / mL or 25 mg / mL to 50 mg / mL).
[0089] In addition to the antisense oligomer of the present invention and the carrier described above, the composition of the present invention may optionally contain pharmaceutically acceptable additives. Examples of such additives include emulsifying agents (e.g., fatty acids having 6 to 22 carbon atoms or their pharmaceutically acceptable salts, albumin, dextran), stabilizers (e.g., cholesterol, phosphatidic acid, sucrose, mannitol, sorbitol, xylitol), isotonic agents (e.g., sodium chloride, glucose, maltose, lactose, sucrose, trehalose, mannitol, sorbitol, xylitol), and pH adjusters (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, triethanolamine). One or more of these may be used. The content of such additives in the composition of the present invention is appropriately 90% by weight or less, preferably 70% by weight or less, and more preferably 50% by weight or less.
[0090] The composition of the present invention can be prepared by adding the antisense oligomer of the present invention to a dispersion of a carrier and stirring appropriately. Additives can also be added at an appropriate step, either before or after the addition of the antisense oligomer of the present invention. When the composition of the present invention is in the form of an aqueous solution, the aqueous solvent that can be used when adding the antisense oligomer of the present invention is not particularly limited as long as it is pharmaceutically acceptable. Examples include electrolyte solutions such as water for injection, distilled water for injection, and physiological saline, as well as sugar solutions such as glucose solution and maltose solution. Furthermore, conditions such as pH and temperature in such cases can be appropriately selected by those skilled in the art.
[0091] The composition of the present invention can be, for example, a liquid formulation or a lyophilized formulation thereof. As one embodiment of the dried form of the composition of the present invention, the lyophilized formulation can be prepared by lyophilizing the composition of the present invention, which is in the form of a liquid formulation, by a conventional method. For example, after appropriate sterilization of the composition of the present invention, a predetermined amount can be dispensed into a vial, pre-freezed at approximately -40 to -20°C for about 2 hours, primary drying can be performed under reduced pressure at approximately 0 to 10°C, and then secondary drying can be performed under reduced pressure at approximately 15 to 25°C to lyophilize the composition. Generally, the inside of the vial can then be replaced with nitrogen gas and the vial can be capped to obtain a lyophilized formulation of the composition of the present invention.
[0092] The lyophilized formulation of the composition of the present invention can generally be redissolved and used by adding any suitable solution (redissolving solution). Examples of such redissolving solutions include water for injection, physiological saline, and other general intravenous fluids. The volume of this redissolving solution varies depending on the application and is not particularly limited, but 0.5 to 2 times the volume of the solution before lyophilization, or 500 mL or less, is appropriate.
[0093] The dosage of the composition of the present invention should preferably be prepared considering the type of antisense oligomer contained in the present invention, the dosage form, the patient's condition such as age and weight, the route of administration, and the nature and severity of the disease. However, for adults, the amount of antisense oligomer of the present invention is generally in the range of 0.1 mg to 10 g / person per day, preferably in the range of 1 mg to 1 g / person. This value may vary depending on the type of disease being targeted, the form of administration, and the target molecule. Therefore, in some cases, a lower dose may be sufficient, and conversely, a higher dose may be required. It can also be administered once or several times a day, or at intervals of one to several days.
[0094] Another embodiment of the composition of the present invention is a pharmaceutical composition comprising a vector capable of expressing the oligonucleotide of the present invention and the carrier described above. Such an expression vector may be capable of expressing multiple oligonucleotides of the present invention. Similar to the composition of the present invention containing the oligomer of the present invention, pharmaceutically acceptable additives may be added to the composition. The concentration of the expression vector contained in the composition varies depending on the type of carrier, etc., but in one embodiment, a range of 0.1 nM to 100 μM is appropriate, and a range of 100 nM to 10 μM is preferred. The weight ratio of the expression vector to the carrier (carrier / expression vector) contained in the composition varies depending on the properties of the expression vector, the type of carrier, etc., but a range of 0.1 to 100 is appropriate, and a range of 0.1 to 10 is preferred. Furthermore, the amount of carrier contained in the composition is the same as in the case of the composition of the present invention containing the antisense oligomer of the present invention, and the preparation method is also the same as in the case of the composition of the present invention.
[0095] The present invention will be described in more detail below with reference to examples and test examples, but the present invention is not limited to the scope shown in the examples. [Examples]
[0096] [Example 1: Production of antisense oligomers] Following the method described in International Publication No. 2013 / 100190, antisense oligomers (PMO No. 1-7 (SEQ ID NO. 2-8)) shown in Table 1 were synthesized, targeting the nucleotide sequence of exon 50 and / or its 3' adjacent intron 50 of the human dystrophin gene. The total length of each antisense oligomer is 19-21 mers. The theoretical and experimentally measured molecular weights of each antisense oligomer by ESI-TOF-MS are also shown. In Table 1, for example, "H50_109-129" indicates that, when the 5' end of exon 50 of the human dystrophin gene is designated as the first base and the bases following at the 3' end are numbered sequentially, the antisense oligomer targets the sequence of bases 109 to 129. Since the total length of exon 50 is 109 bases, in this example, the sequence of bases 110 to 130 in the target sequence is the sequence of bases in intron 50. [Table 2]
[0097] [Example 2: Exon skipping activity test of antisense oligomers] In vitro study of human dystrophin gene exon 50 skipping (1) Test method RD cells (human rhabdomyosarcoma cell line, CCL-136, purchased from ATCC) 3.5 × 10⁻⁶ 5 For each individual cell, 0.1–1 μM of each antisense oligomer listed in Table 1 was introduced using the Amaxa Cell Line Nucleofector Kit L with Nucleofector II (Lonza). The pulse program used for introduction was T-030. The introduced RD cells were cultured for three nights at 37°C under 5% CO2 conditions in 2 mL of Eagle's minimal essential medium (EMEM) medium (Sigma-Ace, hereafter the same) containing 10% fetal bovine serum (FBS) (Invitrogen). After introducing RD cells, they were washed once with PBS (Nissui Co., Ltd., hereafter the same). Then, 350 μL of Buffer RA1 (Takara Bio Inc.) containing 1% 2-mercaptoethanol (Nacalai Tesque Inc.) was added to the cells, and the cells were allowed to lyse at room temperature for several minutes. The cells were then collected on a NucleoSpin® Filter (Takara Bio Inc.). A homogenate was prepared by centrifugation at 11,000 × g for 1 minute. Total RNA was extracted from the cells according to the protocol attached to NucleoSpin® RNA (Takara Bio Inc.). The concentration of the extracted total RNA was measured using NanoDrop ONE (Thermo Fisher Inc.).
[0098] One-step RT-PCR was performed on 400 ng of extracted total RNA using the QIAGEN OneStep RT-PCR Kit (QIAGEN) and a thermal cycler. The reaction mixture was prepared according to the protocol provided with the kit. The thermal cycler used was the TaKaRa PCR Thermal Cycler Dice Touch (Takara Bio). The RT-PCR program used is as follows: 50°C, 30 minutes: Reverse transcription reaction 95°C for 15 minutes: Polymerase activation, reverse transcriptase inactivation, cDNA thermal denaturation. [94°C, 30 seconds; 60°C, 30 seconds; 72°C, 1 minute] × 35 cycles: PCR amplification 72°C, 10 minutes: Final extension reaction
[0099] The nucleotide sequences of the forward and reverse primers used in RT-PCR are as follows. Forward primer: 5'-AACAACCGGATGTGGAAGAG-3' (SEQ ID NO: 9) Reverse primer: 5'- TTGGAGATGGCAGTTTCCTT -3' (SEQ ID NO: 10)
[0100] One μL of the reaction product from the above PCR was analyzed using Bioanalyzer (Agilent Corporation) and MultiNA (Shimadzu Corporation). The polynucleotide amount "A" of the band where exon 50 was skipped and the polynucleotide amount "B" of the band where exon 50 was not skipped were measured as the signal intensity of the bands. Based on these measured values of "A" and "B", the skipping efficiency was determined according to equation (1) above.
[0101] (2) Test results Figures 1-3 show the results of the exon 50 skipping efficiency obtained for each antisense oligomer. Furthermore, the effective concentration (EC) at which each antisense oligomer exhibits a 50% skipping efficiency (ES) was calculated from these results. 50 The values of ) are shown in Tables 2-4 below. In this test, PMO No. 1-4 had high skipping efficiency ES among the antisense oligomers and EC 50 Because the value was low, it was found that Exxon 50 could be effectively skipped. Furthermore, among antisense oligomers with a short total length of 19mer, similar to PMO No. 3 and 4, PMO No. 5-7 have low skipping efficiency and EC 50 The values were high. Given the significant overlap in the target base sequences between PMO No. 3 and 4 and PMO No. 5-7, the effectiveness of PMO No. 3 and 4 for exon 50 skipping is particularly noteworthy. These results demonstrate that the antisense oligomer of the present invention can efficiently induce exon 50 skipping even when its length is shorter than that of the prior art. [Table 3] [Table 4] [Table 5]
[0102] [Example 3: Solubility test of antisense oligomer] Solubility test of antisense oligomers in physiological saline Among the antisense oligomers that showed high skipping efficiency ES in Example 2, PMO No. 2, 3, and 4, which have a short total length of 19-20 mer and are easy to synthesize, were subjected to solubility tests in physiological saline to further verify their usefulness for pharmaceutical applications.
[0103] (1) Test method 45 μL of physiological saline was added to a sample vial containing 4.5 mg of each of the above antisense oligomers, and the mixture was stirred using ultrasound and vortexing to obtain a 100 mg / mL physiological saline solution. The solution was left at room temperature for 24 hours, and sequences that did not produce precipitate were evaluated as having high solubility.
[0104] (2) Test results All of the tested antisense oligomers showed solubility of 100 mg / mL or more in physiological saline. These antisense oligomers have high exon 50 skipping efficiency and high solubility in physiological saline, making them highly valuable for pharmaceutical use. The results above demonstrate that the antisense oligomer of the present invention maintains activity that efficiently induces the skipping of exon 50 of the dystrophin gene, while also possessing excellent physical properties as a pharmaceutical agent. [Industrial applicability]
[0105] The experimental results shown in the test examples demonstrate that the antisense oligomer of the present invention induces exon 50 skipping with remarkably high efficiency in RD cells. Therefore, the antisense oligomer of the present invention is extremely useful in the treatment of DMD. [Sequence Listing Free Text]
[0106] Sequence IDs 1-10: Synthetic nucleic acids
Claims
1. (a) to (d) below: (a) Antisense oligomers containing any of the base sequences of SEQ ID NOs: 3 to 5; (b) Antisense oligomers comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted, substituted, inserted, and / or added to any of the nucleotide sequences of SEQ ID NOs. 3 to 5, and which have the activity to induce skipping of exon 50 of the human dystrophin gene; (c) an antisense oligomer having a sequence identity of 80% or more with respect to any of the sequences of Sequence ID No. 3 to 5, and having the activity to induce skipping of exon 50 of the human dystrophin gene; and (d) An antisense oligomer that hybridizes under stringent conditions with an oligonucleotide having a base sequence complementary to any of the base sequences of SEQ ID NOs: 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene. An antisense oligomer selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
2. (e) to (h) below: (e) Antisense oligomers consisting of any of the base sequences of Sequence ID No. 3 to 5; (f) Antisense oligomers comprising a nucleotide sequence in which 1 to 5 nucleotides are deleted and / or substituted from any of the nucleotide sequences of SEQ ID NOs: 3 to 5, and which have the activity to induce skipping of exon 50 of the human dystrophin gene; (g) an antisense oligomer consisting of a nucleotide sequence having 80% or more sequence identity with any of the nucleotide sequences of SEQ ID NOs: 3 to 5, and having the activity to induce exon 50 skipping of the human dystrophin gene; and (h) An antisense oligomer that hybridizes under highly stringent conditions with an oligonucleotide having a base sequence complementary to any of the base sequences of SEQ ID NOs: 3 to 5, and which has the activity to induce skipping of exon 50 of the human dystrophin gene. An antisense oligomer selected from the group consisting of the following, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
3. The aforementioned antisense oligomer An antisense oligomer having a nucleotide sequence with 90% or more sequence identity to any of the base sequences of SEQ ID NOs: 3-5, and having the activity to induce exon 50 skipping of the human dystrophin gene. The antisense oligomer according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
4. An oligonucleotide, an antisense oligomer according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
5. The antisense oligomer according to claim 4, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the sugar moiety and / or phosphate bond moiety of at least one nucleotide constituting the oligonucleotide is modified.
6. The sugar portion of at least one nucleotide constituting the oligonucleotide has a -OH group at the 2' position that is OR, R, R'OR, SH, SR, NH 2 NHR, NR 2 , N 3 The antisense oligomer according to claim 4 or 5, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, which is ribose substituted with any group selected from the group consisting of CN, F, Cl, Br, and I. (The above R represents alkyl or aryl, and the above R' represents alkylene.)
7. The antisense oligomer according to any one of claims 4 to 6, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the phosphate bond of at least one nucleotide constituting the oligonucleotide is one selected from the group consisting of a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, a phosphoramidate bond, and a boranophosphate bond.
8. A morpholino oligomer, the antisense oligomer according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, or a hydrate thereof.
9. The antisense oligomer according to claim 8, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, which is a phosphorodiamidate morpholino oligomer.
10. The 5' end is represented by the following chemical formulas (1) to (3): 【Chemistry 1】 An antisense oligomer according to claim 8 or 9, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, which is any of the groups.
11. An antisense oligomer according to any one of claims 1 to 10, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, wherein the antisense oligomer has a length of 19 or 20 bases.
12. A pharmaceutical composition for the treatment of muscular dystrophy, comprising an antisense oligomer according to any one of claims 1 to 11, a pharmaceutically acceptable salt thereof, or a hydrate thereof.
13. The pharmaceutical composition according to claim 12, further comprising a pharmaceutically acceptable carrier.
14. A pharmaceutical composition according to claim 12 or 13 for administration to a patient with muscular dystrophy, wherein the patient has a mutation in the dystrophin gene that is subject to exon 50 skipping.
15. The pharmaceutical composition according to claim 14, wherein the patient has a frameshift mutation due to the deletion of at least an exon near exon 50, and the dystrophin gene is modified by skipping exon 50 to alter the amino acid reading frame.
16. The pharmaceutical composition according to claim 14 or 15, wherein the patient has a frameshift mutation in the dystrophin gene due to a deletion of exon 51, 51-53, 51-55, or 51-57.
17. The pharmaceutical composition according to any one of claims 14 to 16, wherein the patient is a human.
18. Use of an antisense oligomer or a pharmaceutically acceptable salt thereof or a hydrate thereof according to any one of claims 1 to 11 in the manufacture of a pharmaceutical product for the treatment of muscular dystrophy.
19. A method for treating muscular dystrophy, comprising the step of administering to a patient with muscular dystrophy an effective amount of an antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, or a pharmaceutical composition according to any one of claims 12 to 16.
20. The treatment method according to claim 19, wherein the patient is a human being.
21. An antisense oligomer according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, or a hydrate thereof, for use in the treatment of muscular dystrophy, or a pharmaceutical composition according to any one of claims 12 to 16.
22. The antisense oligomer or a pharmaceutically acceptable salt thereof or hydrate thereof, or pharmaceutical composition according to claim 21, wherein the muscular dystrophy patient is a human in the aforementioned treatment.