RNAi agents that inhibit the expression of complement component C3 (C3), pharmaceutical compositions thereof, and methods of use

Abstract

The present disclosure relates to RNAi agents, such as double-stranded RNAi agents or siRNAs, that can inhibit expression of the complement component C3 (C3) gene. Also disclosed are pharmaceutical compositions containing the C3 RNAi agents and methods of using them. The C3 RNAi agents disclosed herein can be conjugated to targeting ligands, including N-acetylgalactosamine-containing ligands, to facilitate delivery to liver cells. Delivery of the C3 RNAi agents in vivo provides inhibition of C3 gene expression. The RNAi agents can be used in methods for treating diseases, disorders, or conditions mediated in part by C3 gene expression, including IgA nephropathy, C3 glomerulopathy, paroxysmal nocturnal hemoglobinuria, and / or other complement-mediated kidney diseases.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 381,200, filed October 27, 2022, U.S. Provisional Patent Application No. 63 / 486,944, filed February 24, 2023, and U.S. Provisional Patent Application No. 63 / 493,564, filed March 31, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a sequence listing which has been submitted in XML format and is incorporated by reference in its entirety. An XML copy is available at: It is named SeqListing.xml, was created on October 25, 2023, and is 49kb in size.

[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded RNAi agents or interfering RNA molecules, pharmaceutical compositions comprising the C3 RNAi agents for the inhibition of complement component C3 (C3) gene expression, and methods of their use for the treatment of C3-related diseases and disorders, including complement-mediated renal diseases (CMRDs) such as IgA nephropathy (IgAN) and C3 glomerulopathy (C3G). [Background technology]

[0004] The complement cascade is an important part of the innate immune system and is known to consist of three distinct pathways: the alternative pathway, the classical pathway, and the lectin pathway. Each of the three major pathways of complement activity plays an important role in the development of various diseases. The main functions of the complement system include orchestrating opsonization, promoting cytotoxic destruction, forming the membrane attack complex, and releasing peptides that promote inflammatory responses. A review of the complement system, focusing on relevant targets for therapeutic inhibition, is described, for example, in Garred et al., Pharmacol. Rev. 73:792-827, April 2021 (see, for example, Figure 1 therein). Complement component C3, one of the identified complement system targets, is thought to be involved in the pathogenesis of certain diseases, including, but not limited to, paroxysmal nocturnal hemoglobinuria (PNH), complement-mediated renal diseases (CMRDs), such as IgA nephropathy (IgAN), and C3 glomerulopathy (C3G).

[0005] Currently, treatment options for various diseases associated with dysregulated complement activity are very limited or nonexistent. Neither IgAN nor C3G has a therapeutic agent approved in the United States. For other complement-related disorders, such as PNH, for which therapeutic agents are available, significant unmet medical needs remain for many patients due to limitations in the approved therapeutic agents and their respective mechanisms of action. For example, the monoclonal antibodies eculizumab and ravulizumab, inhibitors of complement component C5, are approved for the treatment of PNH. However, they require a 2–3-hour intravenous infusion every 2 weeks to 2 months and act more distally in the cascade (C5, not C3), thereby not inhibiting all effector pathways of complement activation. Furthermore, pegcetacoplan, a therapeutic peptide designed to inhibit C3, requires administration of approximately 1 gram of drug in 20 milliliters, delivered via a subcutaneous infusion pump over 1 hour, and must be administered twice weekly.

[0006] Recent clinical trials have shown that both pegcetacoplan and the factor B inhibitor iptacopan are superior to C5 blockade alone (with eculizumab) in improving hemoglobin and clinical and hematologic outcomes in patients with PNH (Hillmen, N Engl J Med. 2021, 384(11):1028-37; Peffault de Latour, Blood 2022, 140(Supplement 2):LBA-2; Risitano, Lancet Haematol. 2021, 8(5):e344-e354). These studies, along with our growing understanding of the important role of C3 and the alternative complement pathway in conditions such as PNH, C3G, and IgAN, provide a strong rationale for targeting the proximal alternative complement pathway, particularly C3, as a therapeutic strategy for these conditions.

[0007] Thus, there remains a need for highly active, durable, and safe therapeutic agents that can more closely inhibit C3 and the complement cascade. Although various publications have proposed interfering RNA molecules that target C3, prior to the present disclosure, none have demonstrated the elusive combination of sufficient gene expression inhibitory activity to provide a therapeutic effect, an adequate safety profile to be viable as a human therapy, and adequate durability to require frequent dosing to address certain patient compliance issues that pose problems with existing approved therapies. Summary of the Invention

[0008] Disclosed herein is an RNAi agent for inhibiting expression of the C3 gene, comprising: an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of one of the antisense strand sequences in Table 2; and a sense strand that contains a nucleotide sequence that is at least partially complementary to the antisense strand wherein all or substantially all of the nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand that comprises an N-acetylgalactosamine.

[0009] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides that differs by 0 or 1 nucleotide from 15 contiguous nucleotides of any one of the sense strand sequences set forth in Table 2, Table 4, Table 5C, Table 7B, or Table 8, and the sense strand has a region of at least 85% complementarity over the 15 contiguous nucleotides to the antisense strand.

[0010] In some embodiments, at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

[0011] In some embodiments, the modified nucleotide of a C3 RNAi agent disclosed herein is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0012] In other embodiments, all or substantially all of the modified nucleotides of the RNAi agents disclosed herein are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0013] In some embodiments, the antisense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified antisense strand sequences in Table 3.

[0014] In some embodiments, the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences in Table 4.

[0015] In some embodiments, the antisense strand comprises the nucleotide sequence of any one of the modified sequences in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences in Table 4.

[0016] The RNAi agent disclosed herein is linked to a targeting ligand comprising N-acetylgalactosamine.In further embodiments, the targeting ligand is linked to the sense strand.In some embodiments, the targeting ligand is linked to the 5'-end of the sense strand.

[0017] In some embodiments, the sense strand is 15-30 nucleotides in length and the antisense strand is 21-30 nucleotides in length. In other embodiments, the sense strand and antisense strand are each 21-27 nucleotides in length. In other embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In yet other embodiments, the sense strand and antisense strand are each 21 nucleotides in length.

[0018] In some embodiments, the RNAi agent has two blunt ends.

[0019] In some embodiments, the sense strand comprises one or two end caps, hi other embodiments, the sense strand comprises one or two inverted abasic residues.

[0020] In some embodiments, the RNAi agent is composed of a sense strand and an antisense strand that form a duplex sequence of a duplex structure shown in Table 5A, 5B, 5C, or 8.

[0021] In some embodiments, the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

[0022] In a further embodiment, the targeting ligand comprises or consists of:

[0023] [ka]

[0024] [ka]

[0025] Also disclosed herein are compositions comprising the disclosed RNAi agents, wherein the compositions further comprise a pharmaceutically acceptable excipient.

[0026] Further provided herein is a method for inhibiting expression of the C3 gene in liver cells of a human subject in vivo, the method comprising introducing into the subject an effective amount of a disclosed C3 RNAi agent or a disclosed composition.

[0027] Further provided herein is a method of treating a C3-associated disease, disorder, or condition, comprising administering to a human subject in need thereof a therapeutically effective amount of the disclosed composition.

[0028] In some embodiments, the disease is IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria.

[0029] In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of body weight of a human subject. In some embodiments, the C3 RNAi agent disclosed herein is administered as a single fixed dose injection containing about 25 mg, 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg of C3 RNAi agent drug substance, as set forth in Table 8.

[0030] Also provided herein are methods of using the disclosed RNAi agents or the disclosed compositions for the treatment of diseases, disorders, or conditions associated with impaired complement regulation.

[0031] Further provided herein is a method of using the disclosed RNAi agent or the disclosed composition for the preparation of a pharmaceutical composition for treating a disease, disorder, or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression. [Brief explanation of the drawings]

[0032] [Figure 1] FIG. 1 is a graph showing serum cynomolgus monkey C3 protein levels normalized to pre-dose according to the study described in Example 2. [Figure 2] FIG. 2 is a graph showing the percentage of hemolytic activity before administration in cynomolgus monkeys according to the study described in Example 2. [Figure 3] Figure 3 is the preliminary clinical trial design and dose escalation schedule for the healthy volunteer portion (Part 1) of the Phase I / II clinical trial described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 4] Figure 4 is the preliminary clinical trial design and dose escalation schedule for patient cohort (Part 2) of the Phase I / II clinical trial described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 5] FIG. 5 is a graph showing absolute serum C3a protein levels according to the study described in Example 2. [Figure 6] FIG. 6 is a graph showing the percentage of pre-dose C3a protein levels in cynomolgus monkeys according to the study described in Example 2. [Figure 7] Figure 7 is an updated clinical trial design and dose escalation schedule for the single ascending dose (SAD) normal healthy volunteer (NHV) portion (Part 1) of the Phase I / II clinical trial described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 8] Figure 8 is the updated clinical trial design and dose escalation schedule for the multiple ascending dose (MAD) NHV portion (Part 1) of the Phase I / II clinical trial described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 9] Figure 9 is an updated clinical trial design and dose escalation schedule for the PNH patient cohort (Part 2) of the Phase I / II clinical trial described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 10] Figure 10 is an updated clinical trial design and dose escalation schedule for the C3G patient cohort and the IgAN patient cohort (Part 2) of the Phase I / II clinical trial (Part 2) described in Example 3. "ARO-C3" refers to formulated C3 RNAi agent. [Figure 11] FIG. 11 is a graph showing serum human C3 protein levels in subjects from the single ascending dose (SAD) portion of the Phase I / II clinical trial described in Example 3 in normal human volunteers (NHVs). [Figure 12] FIG. 12 is a graph showing serum human C3 protein levels in subjects from the multiple ascending dose (MAD) portion of the Phase I / II clinical trial described in Example 3 in normal human volunteers (NHVs). [Figure 13] FIG. 13 is a graph showing AH50 (U / mL) in individual subjects administered 400 mg of formulated C3 RNAi agent material or placebo on days 1 and 29 from the multiple ascending dose (MAD) portion of the Phase I / II clinical trial described in Example 3 in normal human volunteers (NHVs). [Figure 14] 14 is a graph showing Wieslab® AP assay results from the single ascending dose (SAD) portion of the Phase I / II clinical trial in normal human volunteers (NHVs) described in Example 3. Results were calculated using negative and positive control samples according to the manufacturer's protocol. [Figure 15] 15 is a graph showing Wieslab® AP assay results from the multiple dose (MAD) portion of the Phase I / II clinical trial in normal human volunteers (NHVs) described in Example 3. Results were calculated using negative and positive control samples according to the manufacturer's protocol. [Figure 16A] FIG. 16A shows the chemical structure of the C3 RNAi agent shown in free acid form (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 16B] FIG. 16B shows the chemical structure of the C3 RNAi agent shown in free acid form (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 16C] FIG. 16C shows the chemical structure of the C3 RNAi agent shown in free acid form (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 16D] FIG. 16D shows the chemical structure of the C3 RNAi agent shown in free acid form (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 17A] FIG. 17A shows the chemical structure of the C3 RNAi agent shown in the form of the sodium salt (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 17B] FIG. 17B shows the chemical structure of the C3 RNAi agent shown in the form of the sodium salt (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 17C]FIG. 17C shows the chemical structure of the C3 RNAi agent shown in the form of the sodium salt (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 17D] FIG. 17D shows the chemical structure of the C3 RNAi agent shown in the form of the sodium salt (see, eg, Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)). [Figure 18] Figure 18 is a schematic diagram of modified sense and antisense strands of a C3 RNAi agent having the structure of AD09546 (see, e.g., Tables 3, 4A, and 5C), which has a tridentate N-acetylgalactosamine targeting group at the 5' end of the sense strand. In Figure 16, the following abbreviations are used: a, c, g, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see, e.g., Table 6), and NAG37s is a tridentate N-acetylgalactosamine targeting ligand having the following chemical structure: [ka] [ka] DETAILED DESCRIPTION OF THE INVENTION

[0033] The disclosed RNAi agents, compositions thereof, and methods of use can be more readily understood by reference to the following detailed description, which forms a part of this disclosure. It should be understood that the present disclosure is not limited to what is specifically described and / or shown herein, and that the terms used herein are for the purpose of describing particular embodiments by way of example only, and are not intended to be limiting.

[0034] It will be appreciated that certain features of the disclosures contained herein, which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosed methods that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination.

[0035] definition As used herein, "RNAi agent" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent may act via the RNA interference mechanism (i.e., induce RNA interference via interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism(s) or pathway(s). Although RNAi agents, as the term is used herein, are believed to act primarily via the RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to a particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., C3 mRNA). The RNAi agents can contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0036] As used herein, the terms "silence," "reduce," "inhibition," "downregulation," or "knockdown," when referring to the expression of a given gene, means that the expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of a polypeptide, protein, or protein subunit translated from mRNA in a cell, is decreased when a cell, group of cells, tissue, organ, or subject in which the gene is transcribed is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated or is not treated.

[0037] As used herein, the terms "sequence" and "nucleotide sequence" refer to a sequence or order of nucleic acid bases or nucleotides written in consecutive letters using standard nomenclature. A nucleic acid molecule can contain unmodified and / or modified nucleotides. A nucleotide sequence can contain unmodified and / or modified nucleotides.

[0038] As used herein, "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0039] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Thus, as used herein, the term "nucleotide" refers to a glycoside containing a sugar moiety, a base moiety, and a covalently linked group (linking group), such as a phosphate or phosphorothioate internucleoside linking group, and encompasses both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides containing modified sugar moieties and / or base moieties, which are also referred to herein as nucleotide analogs. Herein, a single nucleotide can be referred to as a monomer or unit.

[0040] As used herein, unless otherwise specified, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeting mRNA) to a second nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or otherwise appropriate in vivo or in vitro conditions)) and form a duplex or double-helix structure with an oligonucleotide comprising the second nucleotide sequence under specific standard conditions. Those skilled in the art can select the most suitable set of conditions for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0041] As used herein, "fully complementary" or "sufficiently complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or part of the first or second nucleotide sequence.

[0042] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0043] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0044] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of MUC5AC mRNA.

[0045] As used herein, the term "substantially identical" or "substantial identity" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity compared to a reference sequence, e.g., at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. This percentage is calculated by determining the number of positions where the same type of nucleobase occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein.

[0046] As used herein, the terms "individual," "patient," and "subject" are used interchangeably to refer to members of any animal species, including birds, humans and other primates, and other mammals, including but not limited to, commercially relevant mammals or animal models such as mice, rats, monkeys, cows, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0047] As used herein, the terms "treat," "treatment," and the like refer to a method or procedure taken to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0048] As used herein, when referring to an RNAi agent, the phrase "introducing into cells" refers to functionally delivering the RNAi agent to cells. "Functionally delivering" refers to delivering the RNAi agent to cells in a manner that allows the RNAi agent to have expected biological activity, such as sequence-specific inhibition of gene expression.

[0049] Unless otherwise noted, symbols:

[0050] [ka]

[0051] The use of as used herein means that any group or groups according to the scope of the invention described herein can be attached thereto.

[0052] As used herein, the term "isomers" refers to compounds that have identical molecular formulas but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are sometimes called "enantiomers," or optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0053] As used herein, unless expressly identified in a structure as having a particular configuration, for each structure that has asymmetric centers and thus gives rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms. For example, the structures disclosed herein are intended to cover not only single stereoisomers but also mixtures of diastereomers.

[0054] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to those specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0055] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Correspondingly, compounds described herein having a labile proton or basic atom should be understood to represent the salt form of the corresponding compound. The compounds described herein may be in the form of a free acid, a free base, or a salt. Pharmaceutically acceptable salts of the compounds described herein are understood to be within the scope of the present invention.

[0056] As used herein, the term "linked" or "conjugated," when referring to a link between two compounds or molecules, means that the two compounds or molecules are joined by a covalent bond. Unless otherwise specified, the terms "linked" and "conjugated," as used herein, may refer to a link between a first compound and a second compound, with or without an intervening atom or group of atoms.

[0057] As used herein, the term "including" means, and is used interchangeably with, the expression "including but not limited to." As used herein, the term "or" is used to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise.

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0059] Where a value is explicitly recited, it is understood that values ​​that are approximately the same as or equal to the recited value are also within the scope of the present disclosure. Where a combination is disclosed, each subcombination of elements of that combination is also specifically disclosed and is within the scope of the present disclosure. Conversely, where different elements or groups of elements are separately disclosed, the combinations are also disclosed. Where any element of the disclosure is disclosed as having multiple alternatives, examples of that disclosure in which each alternative is excluded alone or in any combination with the other alternatives are also disclosed herein; multiple elements of the disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0060] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims.

[0061] Detailed Description RNAi agents Described herein are RNAi agents for inhibiting expression of the C3 gene. Each C3 RNAi agent includes a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 21 to 49 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 21 to 27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the RNAi agent antisense strands are each independently 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the RNAi agent sense strands are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The sense and antisense strands anneal to form a duplex, and in some embodiments the double-stranded RNAi agent has a duplex length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0062] Examples of nucleotide sequences used to form C3 RNAi agents are shown in Tables 2, 3, 4, 5C, 7A, 7B, and 8. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, 4, 5C, 7A, and 7B are shown in Tables 5A, 5B, 5C, and 8.

[0063] In some embodiments, the region of complete, substantial, or partial complementarity between the sense and antisense strands is 15 to 26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not complete, substantial, or partially complementary).

[0064] The sense strand of the C3 RNAi agent described herein comprises at least 15 contiguous nucleotides that are at least 85% identical to a core stretch sequence of the same number of nucleotides in the C3 mRNA (also referred to herein as a "core stretch" or "core sequence"). In some embodiments, the sense strand core extension sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core extension sequence in the antisense strand. Thus, the sense strand core extension sequence is typically completely identical or at least about 85% identical to a nucleotide sequence of the same length present in the C3 mRNA target (e.g., sometimes referred to as a target sequence). In some embodiments, the length of this sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the sense strand core stretch is 17 nucleotides long. In some embodiments, the sense strand core stretch is 19 nucleotides long. In some embodiments, the sense strand core stretch is 21 nucleotides long.

[0065] The antisense strand of the C3 RNAi agent described herein comprises at least 15 consecutive nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the C3 mRNA and a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length (e.g., a target sequence) present in the C3 mRNA target. In some embodiments, the length of the antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the antisense strand core stretch is 21 nucleotides long. In some embodiments, the antisense strand core extension is 19 nucleotides long. The sense strand core extension sequence may be the same length as the corresponding antisense core sequence, or may be a different length.

[0066] The sense and antisense strands of a C3 RNAi agent anneal to form a duplex. The sense and antisense strands of a C3 RNAi agent can be partially, substantially, or fully complementary. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core extension sequence comprises a sequence of at least 15, at least 16, at least 17, at least 17, at least 18, 19, 20, 21, 22, 23, 24, or at least 25 nucleotides that is at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequence of the antisense strand core extension sequence (i.e., the sense and antisense core stretch sequences of the C3 RNAi agent have at least 85% base pairs or 100% base pairs over a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides).

[0067] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0068] In some embodiments, the sense strand and / or the antisense strand can optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequence. The additional nucleotides in the antisense strand, if present, may or may not be complementary to the corresponding sequence in the C3 mRNA. The additional nucleotides in the sense strand, if present, may or may not be identical to the corresponding sequence in the C3 mRNA. The additional nucleotides in the antisense strand, if present, may or may not be complementary to the additional nucleotides in the corresponding sense strand.

[0069] As used herein, an extension includes 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of a sense strand core extension sequence and / or an antisense strand core extension sequence. The extension nucleotides of the sense strand may or may not be complementary to the core extension sequence nucleotides or extension nucleotides of the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to either the core extension sequence nucleotides or extension nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent include 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand are base-paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more 5' extension nucleotides of the other strand. In some embodiments, a C3 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotide(s) are unpaired and form an overhang. As used herein and in the art, "overhang" refers to a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form part of the hybridized or duplex portion of the RNAi agent disclosed herein.

[0070] In some embodiments, the C3 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the C3 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is complementary to the corresponding C3 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is not complementary to the corresponding C3 mRNA sequence.

[0071] In some embodiments, a C3 RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the C3 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (listed 5' to 3', respectively).

[0072] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the C3 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises a nucleotide that corresponds to or is identical to a nucleotide in the C3 mRNA sequence.

[0073] Examples of sequences for use in forming a C3 RNAi agent are provided in Tables 2, 3, 4, 5C, 7A, 7B, and 8. In some embodiments, a C3 RNAi agent antisense strand comprises any of the sequences in Tables 2, 3, 5C, 7A, or 8. In certain embodiments, a C3 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, a C3 RNAi agent antisense strand comprises the sequence of nucleotides (5' end to 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 119, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Tables 2, 3, 5C, 7A, or 8. In some embodiments, a sense strand of a C3 RNAi agent comprises any of the sequences in Tables 2, 4, 5C, 7B, or 8. In some embodiments, the C3 RNAi agent sense strand comprises the sequence of nucleotides (5' end to 3' end) 1-18, 1-19, 1-20, 121, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2, 4, 5C, 7B, or 8. In certain embodiments, the C3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

[0074] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent are not blunt ends. As used herein, "blunt ends" refers to the ends of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0075] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent are not frayed ends. As used herein, a frayed end refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides are on the sense strand or the antisense strand and form a 3' or 5' overhang. In some embodiments, the RNAi agent comprises: a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0076] The C3 RNAi agent disclosed herein may also be composed of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand of the C3 RNAi agent are modified nucleotides. The C3 RNAi agent disclosed herein may further comprise one or more modified internucleoside linkages, for example, one or more phosphorothioate linkages. In some embodiments, the C3 RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleotide is combined with a modified internucleoside linkage.

[0077] In some embodiments, the C3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the C3 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the C3 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.

[0078] Modified Nucleotides Modified nucleotides, when used in various oligonucleotide constructs, can increase the serum stability of these compounds while retaining their activity in cells and can minimize the possibility of activating interferon activity in humans upon administration of the oligonucleotide construct.

[0079] In some embodiments, the C3 RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to herein or in the art as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, one or more modifications can be incorporated into a single C3 RNAi agent, or even a single nucleotide thereof. The sense and antisense strands of a C3 RNAi agent can be synthesized and / or modified by methods known in the art.A modification at one nucleotide is independent of a modification at another nucleotide.

[0080] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-methyl-, 2-methyl-, 2-ethyl-, 2-isopropyl-, or 2-n-butyl-, and other alkyl derivatives of adenine and guanine. Examples of uracil include uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-uracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-substituted uracils and cytosines such as 5-halo (e.g., 5-bromo), 5-trifluoromethyl, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0081] In some embodiments, the 5'-end and / or 3'-end of the antisense strand may contain an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1'-position of the sugar moiety. In some embodiments, the abasic residue may be positioned within the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3'-end of the antisense strand. In some embodiments, the 5'-end of the sense strand may contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. In some embodiments, the abasic (deoxyribose) residue may be replaced with a ribitol (abasic ribose) residue.

[0082] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified) in both the sense strand and the antisense strand. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are set forth in Table 6 herein.

[0083] Modified internucleoside linkages In some embodiments, one or more nucleotides of a C3 RNAi agent are linked by a non-standard linkage or backbone (ie, a modified internucleoside linkage or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with reversed polarity in which pairs of adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 moieties.

[0084] In some embodiments, the sense strand of a C3 RNAi agent may comprise 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a C3 RNAi agent may comprise 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently comprise 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a C3 RNAi agent may comprise 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a C3 RNAi agent may comprise 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently comprise 1, 2, 3, or 4 phosphorothioate linkages.

[0085] In some embodiments, the sense strand of a C3 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and the optional inverted abasic residue end cap. In some embodiments, a targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0086] In some embodiments, the C3 RNAi agent antisense strand comprises four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the C3 RNAi agent comprises at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0087] Capping residues or moieties In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of a nucleotide sequence of an RNAi agent disclosed herein. In some embodiments, a capping residue can provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue. (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Pat. No. 5,998,203). Capping residues are commonly known in the art and include, for example, inverted abasic residues, as well as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25In some embodiments, the capping residue is present at the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain multiple inverted abasic deoxyribose moieties as capping residues.

[0088] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the activity or other desired properties of the RNAi agent can be enhanced by including one or more inverted abasic residues or inverted abasic sites at or near the end of the sense strand of the RNAi agent.

[0089] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near the end of the sense strand of the RNAi agent can enable enhanced activity or other desirable properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. The chemical structures of inverted abasic deoxyribose residues are shown in Table 6 below.

[0090] C3 RNAi Agent The C3 RNAi agents disclosed herein are designed to target specific locations on the C3 gene (eg, SEQ ID NO: 1). NM 000064.4 Human complement C3, mRNA transcript (SEQ ID NO: 1): 1 actcctcccc atcctctccc tctgtccctc tgtccctctg accctgcact gtcccagcac 61 catgggaccc acctcaggtc ccagcctgct gctcctgcta ctaacccacc tccccctggc 121 tctggggagt cccatgtact ctatcatcac ccccaacatc ttgcggctgg agagcgagga 181 gaccatggtg ctggaggccc acgacgcgca aggggatgtt ccagtcactg ttactgtcca 241 cgacttccca ggcaaaaaac tagtgctgtc cagtgagaag actgtgctga cccctgccac 301 caaccacatg ggcaacgtca ccttcacgat cccagccaac agggagttca agtcagaaaa 361 ggggcgcaac aagttcgtga ccgtgcaggc caccttcggg acccaagtgg tggagaaggt 421 ggtgctggtc agcctgcaga gcgggtacct cttcatccag acagacaaga ccatctacac 481 ccctggctcc acagttctct atcggatctt caccgtcaac cacaagctgc tacccgtggg 541 ccggacggtc atggtcaaca ttgagaaccc ggaaggcatc ccggtcaagc aggactcctt 601 gtcttctcag aaccagcttg gcgtcttgcc cttgtcttgg gacattccgg aactcgtcaa 661 catgggccag tggaagatcc gagcctacta tgaaaactca ccacagcagg tcttctccac 721 tgagtttgag gtgaaggagt acgtgctgcc cagtttcgag gtcatagtgg agcctacaga 781 gaaattctac tacatctata acgagaaggg cctggaggtc accatcaccg ccaggttcct 841 ctacgggaag aaagtggagg gaactgcctt tgtcatcttc gggatccagg atggcgaaca 901 gaggatttcc ctgcctgaat ccctcaagcg cattccgatt gaggatggct cgggggaggt 961 tgtgctgagc cggaaggtac tgctggacgg ggtgcagaac ccccgagcag aagacctggt 1021 ggggaagtct ttgtacgtgt ctgccaccgt catcttgcac tcaggcagtg acatggtgca 1081 ggcagagcgc agcgggatcc ccatcgtgac ctctccctac cagatccact tcaccaagac 1141 acccaagtac ttcaaaccag gaatgccctt tgacctcatg gtgttcgtga cgaaccctga 1201 tggctctcca gcctaccgag tccccgtggc agtccagggc gaggacactg tgcagtctct 1261 aacccaggga gatggcgtgg ccaaactcag catcaacaca caccccagcc agaagccctt 1321 gagcatcacg gtgcgcacga agaagcagga gctctcggag gcagagcagg ctaccaggac 1381 catgcaggct ctgccctaca gcaccgtggg caactccaac aattacctgc atctctcagt 1441 gctacgtaca gagctcagac ccggggagac cctcaacgtc aacttcctcc tgcgaatgga 1501 ccgcgcccac gaggccaaga tccgctacta cacctacctg atcatgaaca agggcaggct 1561 gttgaaggcg ggacgccagg tgcgagagcc cggccaggac ctggtggtgc tgcccctgtc 1621 catcaccacc gacttcatcc cttccttccg cctggtggcg tactacacgc tgatcggtgc 1681 cagcggccag agggaggtgg tggccgactc cgtgtgggtg gacgtcaagg actcctgcgt 1741 gggctcgctg gtggtaaaaa gcggccagtc agaagaccgg cagcctgtac ctgggcagca 1801 gatgaccctg aagatagagg gtgaccacgg ggcccgggtg gtactggtgg ccgtggacaa 1861 gggcgtgtc gtgctgaata agaagaacaa actgacgcag agtaagatct gggacgtggt 1921 ggagaaggca gacatcggct gcaccccggg cagtgggaag gattacgccg gtgtcttc 1981 cgacgcaggg ctgaccttca cgagcagcag tggccagcag accgcccaga gggcagaact 2041 tcagtgcccg cagccagccg cccgccgacg ccgttccgtg cagctcacgg agaagcgaat 2101 ggacaaagtc ggcaagtacc ccaaggagct gcgcaagtgc tgcgaggacg gcatgcggga 2161 gaaccccatg aggttctcgt gccagcgccg gacccgtttc atctccctgg gcgaggcgtg 2221 caagaaggtc ttcctggact gctgcaacta catcacagag ctgcggcggc agcacgcgcg 2281 ggccagccac ctgggcctgg ccaggagtaa cctggatgag gacatcattg cagaagagaa 2341 catcgtttcc cgaagtgagt tcccagagag ctggctgtgg aacgttgagg acttgaaaga 2401 gccaccgaaa aatggaatct ctacgaagct catgaatata tttttgaaag actccatcac 2461 cacgtgggag attctggctg tgagcatgtc ggacaagaaa gggatctgtg tggcagaccc 2521 cttcgaggtc acagtaatgc aggacttctt catcgacctg cggctaccct actctgttgt 2581 tcgaaacgag caggtggaaa tccgagccgt tctctacaat taccggcaga accaagagct 2641 caaggtgagg gtggaactac tccacaatcc agccttctgc agcctggcca ccaccaagag 2701 gcgtcaccag cagaccgtaa ccatcccccc caagtcctcg ttgtccgttc catatgtcat 2761 cgtgccgcta aagaccggcc tgcaggaagt ggaagtcaag gctgctgtct accatcattt 2821 catcagtgac ggtgtcagga agtccctgaa ggtcgtgccg gaaggaatca gaatgaacaa 2881 aactgtggct gttcgcaccc tggatccaga acgcctgggc cgtgaaggag tgcagaaaga 2941 ggacatccca cctgcagacc tcagtgacca agtcccggac accgagtctg agaccagaat 3001 tctcctgcaa gggaccccag tggcccagat gacagaggat gccgtcgacg cggaacggct 3061 gaagcacctc attgtgaccc cctcgggctg cggggaacag aacatgatcg gcatgacgcc 3121 cacggtcatc gctgtgcatt acctggatga aacggagcag tgggagaagt tcggcctaga 3181 gaagcggcag ggggccttgg agctcatcaa gaaggggtac acccagcagc tggccttcag 3241 acaacccagc tctgcctttg cggccttcgt gaaacgggca cccagcacct ggctgaccgc 3301 ctacgtggtc aaggtcttct ctctggctgt caacctcatc gccatcgact cccaagtcct 3361 ctgcggggct gttaaatggc tgatcctgga gaagcagaag cccgacgggg tcttccagga 3421 ggatgcgccc gtgatacacc aagaaatgat tggtggatta cggaacaaca acgagaaaga 3481 catggccctc acggcctttg ttctcatctc gctgcaggag gctaaagata tttgcgagga 3541 gcaggtcaac agcctgccag gcagcatcac taaagcagga gacttccttg aagccaacta 3601 catgaaccta cagagatcct acactgtggc cattgctggc tatgctctgg cccagatggg 3661 caggctgaag gggcctcttc ttaacaaatt tctgaccaca gccaaagata agaaccgctg 3721 ggaggaccct ggtaagcagc tctacaacgt ggaggccaca tcctatgccc tcttggccct 3781 actgcagcta aaagactttg actttgtgcc tcccgtcgtg cgttggctca atgaacagag 3841 atactacggt ggtggctatg gctctaccca ggccaccttc atggtgttcc aagccttggc 3901 tcaataccaa aaggacgccc ctgaccacca ggaactgaac cttgatgtgt ccctccaact 3961 gcccagccgc agctccaaga tcacccaccg tatccactgg gaatctgcca gcctcctgcg 4021 atcagaagag accaaggaaa atgagggttt cacagtcaca gctgaaggaa aaggccaagg 4081 caccttgtcg gtggtgacaa tgtaccatgc taaggccaaa gatcaactca cctgtaataa 4141 attcgacctc aaggtcacca taaaaccagc accggaaaca gaaaagaggc ctcaggatgc 4201 caagaacact atgatccttg agatctgtac caggtaccgg ggagaccagg atgccactat 4261 gtctatattg gacatatcca tgatgactgg ctttgctcca gacacagatg acctgaagca 4321 gctggccaat ggtgttgaca gatacatctc caagtatgag ctggacaaag ccttctccga 4381 taggacacc ctcatcatct acctggaca ggtctcacac tctgaggatg actgtctagc 4441 tttcaaagtt caccaatact ttaatgtaga gcttatccag cctggagcag tcaaggtcta 4501 cgcctattac aacctggagg aaagctgtac ccggttctac catccggaa aggaggatgg 4561 aaagctgaac aagctctgcc gtgatgaact gtgccgctgt gctgaggaga attgcttcat 4621 acaaaagtcg gatgacaagg tcaccctgga agaacggctg gacaaggcct gtgagccagg 4681 agtggactat gtgtacaaga cccgactggt caaggttcag ctgtccaatg actttgacga 4741 gtacatcatg gccattgagc agaccatcaa gtcaggctcg gatgaggtgc aggttggaca 4801 gcagcgcacg ttcatcagcc ccatcaagtg cagagaagcc ctgaagctgg aggagaaga 4861 acactacctc atgtggggtc tctcctccga tttctgggga gagaagccca acctcagcta 4921 catcatcggg aaggacactt gggtggagca ctggcccgag gaggacgaat gccaagacga 4981 agagaaccag aaacaatgcc aggacctcgg cgccttcacc gagagcatgg ttgtctttgg 5041 gtgccccaac tgaccacacc cccattcccc cactccagat aaagcttcag ttatatctca 5101 cgtgtctgga gttctttgcc aagagggaga ggctgaaatc cccagccgcc tcacctgcag 5161 ctcagctcca tcctacttga aacctcacct gttcccaccg cattttctcc tggcgttcgc 5221 ctgctagtgt g

[0091] As defined herein, the antisense strand sequence is designed to target the C3 gene at a given position on the gene, when the 5'-end nucleobase of the antisense strand is aligned with the position that is 21 nucleotides downstream (towards the 3' end) from the position on the gene when base-pairing with the gene.For example, as shown in Tables 1 and 2 herein, the antisense strand sequence designed to target the C3 gene at position 2566 requires that the 5'-end nucleobase of the antisense strand is aligned with position 2586 of the C3 gene when base-pairing with the gene.

[0092] As provided herein, a C3 RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, but rather there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 15 contiguous nucleotides. For example, in the case of a C3 RNAi agent disclosed herein that is designed to target position 2566 of the C3 gene, the 5'-terminal nucleobase of the antisense strand of the C3 RNAi agent must align with position 2586 of the gene; however, the 5'-terminal nucleobase of the antisense strand must align with position 2586 of the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 15 contiguous nucleotides. As shown by the examples disclosed herein, among other things, and as is well known in the art, the specific binding site of a gene by the antisense strand of a C3 RNAi agent (e.g., whether the C3 RNAi agent targets the C3 gene at position 2566 or another position) can be determined by the C3 This is important for the level of inhibition achieved by the RNAi agent, as well as the toxicity profile achieved by the molecule (see, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0093] In some embodiments, a C3 RNAi agent disclosed herein targets the C3 gene at or near the location of the C3 gene sequence shown in Table 1. In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target C3 21-mer sequence disclosed in Table 1.

[0094] [Table 1]

[0095] In some embodiments, a C3 RNAi agent comprises an antisense strand in which position 21 (5'→3') of the antisense strand is capable of base pairing with position 1 of a 21-mer target sequence disclosed in Table 1. In some embodiments, a C3 RNAi agent comprises an antisense strand in which position 1 (5'→3') of the antisense strand is capable of base pairing with position 21 of a 21-mer target sequence disclosed in Table 1.

[0096] In some embodiments, a C3 RNAi agent comprises an antisense strand in which position 2 (5'→3') of the antisense strand can base pair with position 20 of a 21-mer target sequence disclosed in Table 1. In some embodiments, a C3 RNAi agent comprises an antisense strand in which positions 2 through 18 (5'→3') of the antisense strand can base pair with the respective complementary bases located at positions 18 through 2 of a 21-mer target sequence disclosed in Table 1.

[0097] For the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the C3 gene or can be non-complementary to the C3 gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0098] In some embodiments, the C3 RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the C3 RNAi sense strand comprises the sequence of nucleotides (5' to 3') 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0099] In some embodiments, the C3 RNAi agent antisense strand comprises the sequence of nucleotides 2-18, 2-19, 2-20, or 2-21 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the C3 RNAi sense strand comprises the sequence of nucleotides 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0100] In some embodiments, a C3 RNAi agent is comprised of (i) an antisense strand comprising the sequence of 2 to 18 or 2 to 19 nucleotides (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of 3 to 21, 2 to 21, 1 to 21, 3 to 20, 2 to 20, 1 to 20, 3 to 19, 2 to 19, 1 to 19, 3 to 18, 2 to 18, or 1 to 18 nucleotides (5' end to 3' end) of any of the sense strand sequences in Table 2 or Table 4.

[0101] In some embodiments, a C3 RNAi agent is comprised of (i) an antisense strand comprising the sequence of 2 to 18 or 2 to 19 nucleotides (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of 3 to 21, 2 to 21, 1 to 21, 3 to 20, 2 to 20, 1 to 20, 3 to 19, 2 to 19, 1 to 19, 3 to 18, 2 to 18, or 1 to 18 nucleotides (5' end to 3' end) of any of the sense strand sequences in Table 2 or Table 4.

[0102] In some embodiments, the C3 RNAi agent comprises the core 21-mer nucleotide sequence shown in Table 2 below.

[0103] [Table 2]

[0104] The sense and antisense strands of a C3 RNAi agent that comprises or consists of a sequence in Table 2 can be modified or unmodified nucleotides. In some embodiments, a C3 RNAi agent having sense and antisense strand sequences that comprise or consist of a sequence in Table 2 is all or substantially all modified nucleotides.

[0105] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0106] As used herein, each N set forth in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotide set forth in the sequences disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide set forth in the sequences disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide set forth in the sequences disclosed in Table 2 has the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide set forth in the sequences disclosed in Table 2 has a different nucleobase than the N nucleotide at the corresponding position on the other strand.

[0107] Certain modified C3 RNAi agent antisense strands and their underlying unmodified nucleobase sequences are provided in Table 3. Certain modified C3 RNAi agent sense strands and their underlying unmodified nucleobase sequences are shown in Table 4. In forming a C3 RNAi agent, each nucleotide of the underlying base sequences listed in Tables 3 and 4, and Table 2 above, can be a modified nucleotide.

[0108] The C3 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, so long as the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0109] In some embodiments, the C3 RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0110] In some embodiments, a C3 RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, a C3 RNAi agent comprises or consists of a duplex sequence prepared or provided as a sodium salt, mixed salt, or free acid.

[0111] Examples of antisense strands containing modified nucleotides are shown in Tables 3 and 5C. Examples of sense strands containing modified nucleotides are shown in Tables 4 and 5C.

[0112] As used in Tables 3, 4, 5C, 7A, 7B and 8, the following notations are used to indicate modified nucleotides and linking groups: A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3′-phosphate; U = uridine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate (invAb) = inverted abasic deoxyribonucleotide, see Table 6 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6 cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6) cPrpas = 5'-cyclopropylphosphonic acid-2'-O-methyladenosine-3'-phosphorothioate (see Table 6) cPrpu = 5'-cyclopropylphosphonic acid-2'-O-methyluridine-3'-phosphate (see Table 6) cPrpus = 5'-cyclopropylphosphonic acid-2'-O-methyluridine-3'-phosphorothioate (see Table 6)

[0113] As those skilled in the art will readily understand, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), when present in an oligonucleotide, nucleotide monomers are linked to one another by 5'-3'-phosphodiester linkages. As those skilled in the art will clearly understand, the inclusion of phosphorothioate linkages, as shown in the modified nucleotide sequences disclosed herein, replaces the phosphodiester linkages normally present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the 3' position of each of the given monomers, in place of an ex vivo phosphate moiety. Furthermore, for the embodiments disclosed herein, when viewing each strand 5'→3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer on each strand (see, e.g., Table 6). Furthermore, as those skilled in the art will readily understand and appreciate, while the chemical structures of phosphorothioates depicted herein typically show anions on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers and resonance structures (e.g., when the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless expressly indicated otherwise herein, such understanding by those skilled in the art will be used when describing the C3 RNAi agents and compositions of C3 RNAi agents disclosed herein.

[0114] Specific examples of targeting ligands, targeting groups, and linking groups for use with the C3 RNAi agents disclosed herein are provided below in Table 6. More specifically, targeting groups and linking groups (which together may form a targeting ligand) include (NAG37) and (NAG37)s, the chemical structures of which are provided below in Table 6. Each sense strand and / or antisense strand may have any of the targeting ligands, targeting groups, or linking groups listed herein, as well as other groups, conjugated to the 5' and / or 3' ends of the sequence.

[0115] [Table 3]

[0116] [Table 4A]

[0117] [Table 4B]

[0118] The C3 RNAi agent described herein is formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5C, Table 7B, or Table 8 can be hybridized with any antisense strand containing a sequence listed in Table 2, Table 3, Table 5C, Table 7A, or Table 8, provided that the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0119] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 5C. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4 or Table 5C.

[0120] In some embodiments, the C3 RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5C. In some embodiments, the C3 RNAi agent antisense strand comprises the sequence of nucleotides (5' end to 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2, Table 3, or Table 5C. In certain embodiments, the C3 RNAi agent antisense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 5C.

[0121] In some embodiments, the C3 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 4, or Table 5C. In some embodiments, the C3 RNAi agent sense strand (from the 5' end to the 3' end) comprises the sequence of 1 to 17, 2 to 17, 3 to 17, 4 to 17, 1 to 18, 2 to 18, 3 to 18, 4 to 18, 1 to 19, 2 to 19, 3 to 19, 4 to 19, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 1 to 21, 2 to 21, 3 to 21, or 4 to 21 nucleotides of any of the sequences in Table 2, Table 4, or Table 5C. In certain embodiments, the sense strand of the C3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4 or Table 5C.

[0122] For the C3 RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the C3 gene or can be non-complementary to the C3 gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT (or modified versions thereof). In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0123] A sense strand comprising a sequence listed in Table 2, Table 4, Table 5C, Table 7B, or Table 8 can hybridize to any antisense strand comprising a sequence set forth in Table 2, Table 3, Table 5C, Table 7A, or Table 8, provided that the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, a C3 RNAi agent has a sense strand consisting of a modified sequence from any of Table 4 or Table 5C, and an antisense strand consisting of a modified sequence from any of Table 3 or Table 5C. Certain representative sequence combinations are exemplified by the duplex ID numbers shown in Tables 5A, 5B, 5C, and 8.

[0124] In some embodiments, a C3 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, a C3 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, a C3 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein, and a targeting group and / or linking group, where the targeting group and / or linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, a C3 RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, a C3 RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein and a targeting group and / or linking group, wherein the targeting group and / or linking group is covalently attached to the sense strand or the antisense strand.

[0125] In some embodiments, a C3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or targeting ligand. In some embodiments, a C3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0126] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, or 5C. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5C.

[0127] In some embodiments, the C3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting ligand selected from the group consisting of (NAG37) and (NAG37)s, each as defined in Table 6.

[0128] In some embodiments, a C3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0129] In some embodiments, a C3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of a duplex in any of Tables 5A, 5B, and 5C, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0130] In some embodiments, the C3 RNAi agent comprises, comprises, or consists essentially of any of the duplexes of Tables 5A, 5B, and 5C.

[0131] [Table 5A]

[0132] [Table 5B]

[0133] [Table 5C]

[0134] In some embodiments, the C3 RNAi agents are prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knock down expression of one or more C3 genes in vivo and / or in vitro when delivered to cells expressing the C3 gene.

[0135] Targeting Ligands or Groups, Linking Groups, and Delivery Vehicles In some embodiments, the C3 RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a targeting ligand, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are shown in Table 6. The non-nucleotide group can be covalently attached to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the C3 RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the C3 RNAi agent sense strand. The non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0136] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate, hi some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0137] Targeting groups or targeting moieties improve the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or of higher valency relative to the target to which they are directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, antibody mimics with affinity for cell surface molecules, and the like.

[0138] In some embodiments, the targeting group is linked to the RNAi agent using a linker, e.g., a PEG linker, or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can function as linkers in some embodiments. In some embodiments, the targeting ligand comprises a galactose derivative cluster.

[0139] The C3 RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.

[0140] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand comprising a moiety that has affinity for the asialoglycoprotein receptor. As described herein, the asialoglycoprotein receptor is highly expressed in hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose that have affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, e.g., ST Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0141] Galactose derivatives have been used to target molecules to hepatocytes in vivo by binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of an asialoglycoprotein receptor ligand to the asialoglycoprotein receptor promotes cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also known as monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art.

[0142] The preparation of targeting ligands such as galactose derivative clusters is described, for example, in International Patent Application Publication No. WO2018 / 044350 to Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated herein by reference in their entireties.

[0143] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster includes an N-acetylgalactosamine moiety. In some embodiments, the galactose derivative cluster includes three N-acetylgalactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetravalent galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster includes four N-acetylgalactosamine moieties.

[0144] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. A galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. A galactose derivative can be linked to the central branch point through the C-1 carbon of the sugar. In some embodiments, a galactose derivative is linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer such as a PEG group (see, e.g., U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branch point to an RNAi agent. Examples of branch point groups include di-lysine or di-glutamic acid. The linkage between the branch point and the RNAi agent can be achieved via a linker or spacer. In some embodiments, the linker or spacer includes, but is not limited to, a flexible hydrophilic spacer, such as a PEG spacer. In some embodiments, the linker includes a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is composed of a galactose derivative tetramer, which can be, for example, an N-acetylgalactosamine tetramer.

[0145] The present disclosure also provides a pharmaceutical composition for delivering C3 RNAi agent to hepatocytes in vivo.This pharmaceutical composition can comprise, for example, the C3 RNAi agent conjugated to galactose derivative cluster.In some embodiments, the galactose derivative cluster is composed of galactose derivative trimer, which can be, for example, N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, N-acetyl-galactosamine tetramer.

[0146] The targeting ligand or targeting group can be linked to the 3' or 5' end of the sense or antisense strand of a C3 RNAi agent disclosed herein.

[0147] Targeting ligands include, but are not limited to, (NAG37) and (NAG37)s as defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0148] In some embodiments, a linking group is attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be attached to the 3'-end and / or 5'-end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is attached to the 5'-end or 3'-end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5'-end of the RNAi agent sense strand. Examples of linking groups can include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0149] In some embodiments, the targeting group is linked internally to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0150] A linker or linking group is a linkage between two atoms that connects one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. Labile linkages include labile bonds. The linkage can optionally include a spacer that increases the distance between the two linked atoms. The spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the preceding list is not intended to limit the scope of this specification.

[0151] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents can be linked to the same targeting group or two different targeting groups (i.e., targeting groups with different chemical structures). In some embodiments, the targeting group is linked to a C3 RNAi agent disclosed herein without the use of an additional linker. In some embodiments, the targeting group itself is designed to readily include a linker or other moiety to facilitate conjugation. In some embodiments, when two or more C3 RNAi agents are included in a single molecule, each of the RNAi agents can utilize the same linker or different linkers (i.e., linkers with different chemical structures).

[0152] Any of the C3 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5C, 7A, 7B, or 8 can include a 3' and / or 5' targeting group or linking group, whether modified or not. Any of the C3 RNAi agent sequences listed in Tables 3 or 4 or otherwise described herein that include a 3' or 5' targeting group or linking group can alternatively not include a 3' or 5' targeting group or linking group, or can include a different 3' or 5' targeting group or linking group, including but not limited to, those depicted in Table 6. Any of the C3 RNAi agent duplexes listed in Tables 5A, 5B, 5C, and 8, whether modified or unmodified, can further include a targeting group or linking group, including but not limited to, those depicted in Table 6, where the targeting group or linking group can be attached to the 3' or 5' end of either the sense or antisense strand of the C3 RNAi agent duplex.

[0153] Examples of targeting groups and linking groups, which can be combined to form targeting ligands, are provided in Table 6. Tables 4, 5C, and 8 provide specific embodiments of C3 RNAi agent sense strands having a targeting group or linking group attached to the 5' or 3' end.

[0154] [Table 6A]

[0155] [Table 6B]

[0156] [Table 6C]

[0157] In each of the above structures in Table 6, NAG comprises N-acetylgalactosamine. In some embodiments, NAG as depicted in Table 6 above can comprise another galactose derivative that has affinity for the asialoglycoprotein receptor present on hepatocytes, as would be understood by one of skill in the art to be attached in light of the above structures and the description provided herein. Other linking groups known in the art may also be used.

[0158] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. The delivery vehicle can include or consist of, but is not limited to, a polymer such as an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine. In some embodiments, the RNAi agent can be combined with a lipid, a nanoparticle, a polymer, a liposome, a micelle, a DPC, or other delivery system available in the art. RNAi agents may also include targeting groups, lipids (including, but not limited to, cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141), hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or other delivery systems suitable for delivery of nucleic acids or oligonucleotides known and available in the art.

[0159] Pharmaceutical Composition The C3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, pharmaceutical compositions comprise at least one C3 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNA in a target cell, cell population, tissue, or organism.

[0160] The pharmaceutical composition can be used to treat a subject with a disease, disorder, or condition that would benefit from a reduction in the level of target C3 mRNA or inhibition of expression of the target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease, disorder, symptom, or condition that would benefit from a reduction in the level of target mRNA or inhibition of expression of the target gene. In one embodiment, the method comprises administering to the subject to be treated a C3 RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising a C3 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0161] Pharmaceutical compositions and methods including the C3 RNAi agents disclosed herein comprise administering a therapeutically effective amount of a C3 RNAi agent described herein to a subject to reduce the level of target mRNA in a cell, a group of cells, multiple cell groups, a tissue, an organ, or a subject, thereby inhibiting C3 mRNA expression or translation in the subject. In some embodiments, the subject has previously been identified as having pathogenic upregulation of a target gene in liver cells. In some embodiments, the subject has previously been identified or diagnosed as having IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the subject is suffering from symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the subject would benefit from reduced C3 gene expression in the subject's liver.

[0162] In some embodiments, the described pharmaceutical compositions comprising a C3 RNAi agent are used to treat or manage clinical symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria (PNH). Other diseases or conditions for which a C3 RNAi agent may be useful include lupus nephritis, primary membranous nephropathy (PMN), and / or autoimmune hemolytic anemia (AIHA) / cold agglutinin disease (CAD). In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed C3 RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0163] The described pharmaceutical compositions comprising a C3 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from a reduction or inhibition of C3 mRNA expression and / or a reduction in C3 protein levels. Measuring C3 levels can be performed according to established methods known in the art.

[0164] In some embodiments, a subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a C3 RNAi agent to treat a symptom, while in other embodiments, a subject is administered a prophylactically effective amount of one or more C3 RNAi agents to prevent or inhibit at least one symptom.

[0165] The administration route is the route by which the C3 RNAi agent comes into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The C3 RNAi agent disclosed herein can be administered via any suitable route in a preparation appropriately adjusted for the particular route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0166] Pharmaceutical compositions containing the C3 RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intrapleural, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0167] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0168] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., a C3 RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient may a) aid in processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the drug substance; c) aid in product identification; and / or d) act to enhance the overall safety, efficacy, or other attributes of the delivery of the drug substance during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0169] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, lubricants, oils, polymers, preservatives, salts, salts, solvents, sugars, surfactants, surfactants, flavorings, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, surfactant flavorings, lubricants, wetting agents, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonics, vehicles, water repellents, wetting agents.

[0170] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[0171] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent, optionally with one or a combination of the ingredients listed above, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients listed above. In the case of sterile powders for preparing sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying, which yield a powder of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution.

[0172] In some embodiments, pharmaceutical formulations comprising the C3 RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in aqueous sodium phosphate buffer (e.g., 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic, C3 RNAi agents formulated in water). In some embodiments, pharmaceutical formulations comprising the C3 RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in water for injection (sterile water). C3 RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in isotonic saline (0.9%).

[0173] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, such as an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymeric stems may also be used to present the drug for both intra-articular and ophthalmic administration.

[0174] The C3 RNAi agent disclosed herein can also be prepared as a formulation suitable for oral administration.In some embodiments, the C3 RNAi agent disclosed herein is orally administered.In some embodiments, the C3 RNAi agent disclosed herein is formulated into capsules for oral administration.

[0175] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, such as an implant or a microencapsulated delivery system. Biodegradable and biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and the like. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Pat. No. 4,522,811.

[0176] C3 RNAi agent can be formulated into a dosage unit form composition so that it can be easily administered and dosage is uniform.Dosage unit form refers to a physically discrete unit suitable as a unit dose for the subject to be treated, and each unit contains a predetermined amount of active compound calculated to achieve desired therapeutic effect in association with required pharmaceutical carrier.The specification of dosage unit form of the present disclosure is determined by and directly depends on the inherent characteristics of active compound and the therapeutic effect to be achieved, and the inherent limitations of the technology of compounding such active compound for individual treatment.

[0177] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Also contemplated as a "pharmaceutical composition" are cells, tissues, or isolated organs expressing or comprising an RNAi agent as defined herein. As used herein, a "pharmacologically effective amount," a "therapeutically effective amount," or simply an "effective amount" refers to the amount of an RNAi agent to produce a pharmacological, therapeutic, or preventative result.

[0178] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another C3 RNAi agent (e.g., a C3 RNAi agent that targets a different sequence within the C3 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0179] In some embodiments, the described C3 RNAi agent(s) are optionally combined with one or more additional therapeutic agents. The C3 RNAi agent and the additional therapeutic agent(s) can be administered in a single composition or separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a dosage form separate from the RNAi agent (e.g., the C3 RNAi agent is administered by subcutaneous injection, while the additional therapeutic agents involved in the treatment method administration regimen are administered orally). In some embodiments, the described C3 RNAi agent(s) are administered to a subject in need thereof by subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, which together provide a treatment regimen for diseases and conditions associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the described C3 RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered via separate subcutaneous injections. In some embodiments, the C3 RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated into a single composition for subcutaneous injection). The C3 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0180] Generally, an effective amount of a C3 RNAi agent will be in the range of about 0.1 to about 100 mg / kg body weight / dose, e.g., about 1.0 to about 50 mg / kg body weight / dose. In some embodiments, an effective amount of active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, an effective amount of active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per dose. In some embodiments, an effective amount of a C3 RNAi agent can be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of C3 RNAi agent. In some embodiments, the fixed dose is in the range of 50 mg to 400 mg of C3 RNAi agent. Administration can be weekly, biweekly, monthly, quarterly, or any other interval, depending on the dose of C3 RNAi agent administered, the activity level of the particular C3 RNAi agent, and the desired level of inhibition for a particular subject. The examples herein demonstrate appropriate levels of inhibition in particular animal species. The dosage will depend on variables such as the overall health of the patient or subject, the relative biological potency of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. It will also be understood that the initial dosage administered may be increased beyond the upper levels set forth above, or the initial dosage may be less than optimal, in order to rapidly achieve the desired blood or tissue levels.

[0181] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising a C3 RNAi agent can be combined with an excipient or can be combined with a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0182] When the described C3 RNAi agent is added to a pharmaceutically acceptable excipient or adjuvant, it can be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein can be packaged in a pre-filled syringe, pen injector, auto-injector, infusion bag / device, or vial.

[0183] C3 RNAi Agent Materials and Formulations In some embodiments, a C3 RNAi agent disclosed herein has a nucleotide sequence of the C3 RNAi agent substance set forth below in Table 8. The C3 RNAi agent nucleotide sequence found in the C3 RNAi agent substance includes the antisense strand nucleotide sequence set forth below in Table 7A, and the sense strand nucleotide sequence set forth below in Table 7B.

[0184] [Table 7A]

[0185] [Table 7B]

[0186] As used in Tables 7A, 7B, and 8 herein, the following notation is used to refer to modified nucleotides, targeting groups, and linking groups: A, C, G, and U represent adenosine, cytidine, guanosine, and uridine, respectively; A, C, G, and U represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphorothioate linkage; (invAb) represents an inverted abasic deoxyribose residue (see Table 6); and (NAG37)s represents the following structure (depicted as both the sodium salt and the free acid):

[0187] [ka]

[0188] [ka]

[0189] Each sense and / or antisense strand can have any of the targeting or linking groups described above, as well as other targeting or linking groups, attached to the 5' and / or 3' ends of the sequence.

[0190] The antisense strand sequence of the C3 RNAi agent is designed to target mRNA transcripts from the C3 gene in a human subject, thereby silencing C3 protein translation using the RNA interference mechanism in a human subject that has C3.

[0191] In some embodiments, the methods disclosed herein use the C3 RNAi agent substances shown in Table 8 below.

[0192] [Table 8A]

[0193] [Table 8B]

[0194] In some embodiments, the C3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid, hi some embodiments, the form is the sodium salt.

[0195] In some embodiments, the C3 RNAi agent substances provided in Table 8 are formulated with one or more pharmaceutically acceptable excipients to form pharmaceutical compositions suitable for administration to a human subject. In some embodiments, the C3 RNAi agent substances listed in Table 8 are formulated at 200 mg / mL (free acid / abasic) in aqueous sodium phosphate buffer (0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic) suitable for subcutaneous administration to humans.

[0196] Treatment and suppression methods The C3 RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) that would benefit from reduced and / or inhibited expression of C3 mRNA and / or C3 protein levels, such as subjects diagnosed with or suffering from symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria.

[0197] In some embodiments, a subject is administered a therapeutically effective amount of any one or more C3 RNAi agents. Treatment of a subject can include therapeutic and / or prophylactic treatment. A subject is administered a therapeutically effective amount of any one or more C3 RNAi agents described herein. A subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein can be to humans or animals.

[0198] The C3 RNAi agents described herein can be used to treat at least one symptom or manifestation of a disease in a subject with a C3-related disease or disorder, such as a disease or disorder mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression. In some embodiments, the C3 RNAi agents are used to treat or manage clinical symptoms in a subject with a disease or disorder that would benefit at least in part from reduced C3 mRNA or C3 protein levels. The subject is administered a therapeutically effective amount of one or more of the C3 RNAi agents or C3 RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein include administering a composition comprising a C3 RNAi agent described herein to a subject to be treated. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described C3 RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom or manifestation of the disease.

[0199] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by expression of the C3 gene, dysregulation of the complement cascade, or regulated complement activity in a patient in need thereof, the method comprising administering to the patient any of the C3 RNAi agents described herein.

[0200] In some embodiments, the gene expression level and / or mRNA level of the C3 gene in a subject administered a described C3 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject before administration of the C3 RNAi agent or to a subject not administered a C3 RNAi agent. C3 mRNA levels in a subject can be reduced in cells, cell groups, and / or tissues of the subject. In some embodiments, expression of the C3 gene is inhibited in hepatocytes by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65% compared to the subject before administration of the C3 RNAi agent or to a subject not administered a C3 RNAi agent.

[0201] In some embodiments, C3 protein levels in a subject administered a described C3 RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject before administration of the C3 RNAi agent or relative to a subject not administered the C3 RNAi agent. Protein levels in a subject can be reduced in cells, cell populations, tissues, blood, and / or other fluids of the subject.

[0202] The reduction of C3 mRNA levels and C3 protein levels can be assessed by any method known in the art. As used herein, a reduction or decrease in C3 mRNA levels and / or protein levels is collectively referred to herein as a reduction or decrease in C3 or an inhibition or decrease in C3 gene expression. The examples described herein illustrate known methods for assessing the inhibition of C3 gene expression. Those skilled in the art will further know suitable methods for assessing the inhibition of C3 gene expression in vivo and / or in vitro.

[0203] In some embodiments, disclosed herein are methods for treating (including prophylactic or preventative treatment) a disease, disorder, or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, the method comprising administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for treating (including prophylactic or preventative treatment) a disease, disorder, or symptom caused by complement-mediated renal disease (CMRD), the method comprising administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for treating (including preventative or prophylactic treatment) a disease or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising an antisense strand comprising a sequence in any of Table 2, Table 3, Table 5C, Table 7A, or Table 8, and a sense strand comprising a sequence in any of Table 2, Table 4, Table 5C, Table 7B, or Table 8, wherein the sense strand is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of a disease or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising a sense strand comprising any of the sequences in Table 2, 4, 5C, 7B, or 8, and an antisense strand comprising any of the sequences in Table 2, 3, 5C, 7A, or 8, wherein the antisense strand is at least partially complementary to the sense strand.

[0204] In some embodiments, disclosed herein are methods of inhibiting expression of a C3 gene in a cell, the method comprising administering to the cell a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods of inhibiting expression of a C3 gene in a cell, the method comprising administering to the cell a C3 RNAi agent comprising an antisense strand that comprises a sequence in any of Tables 2, 3, 5C, 7A, or 8, and a sense strand that comprises a sequence in any of Tables 2, 4, 5C, 7B, or 8, and that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of inhibiting expression of a C3 gene in a cell, the method comprising administering to the cell a C3 RNAi agent comprising a sense strand that comprises a sequence in Table 2, 4, 5C, 7B, or 8, and an antisense strand that comprises a sequence in Table 2, 3, 5C, 7A, or 8, and that is at least partially complementary to the sense strand.

[0205] The use of C3 RNAi agents provides a method for treating (including preventing) diseases / disorders associated with complement dysregulation, including, but not limited to, IgA nephropathy, C3 glomerulopathy, paroxysmal nocturnal hemoglobinuria, and / or elevated C3 gene expression. The described C3 RNAi agents mediate RNA interference to inhibit the expression of one or more genes required for the production of C3 protein. The C3 RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. Furthermore, compositions for delivering C3 RNAi agents to hepatocytes, particularly hepatocytes, in vivo are described.

[0206] Cells, tissues, organs, and non-human organisms Cells, tissues, organs, and non-human organisms are contemplated that comprise at least one of the C3 RNAi agents described herein, wherein the cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0207] Embodiment The following non-limiting embodiments are illustrative of the invention described herein.

[0208] Embodiment 1. An RNAi agent for inhibiting expression of the C3 gene, comprising: an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8; and a sense strand that contains a nucleotide sequence that is at least partially complementary to the antisense strand Including, wherein all or substantially all of the nucleotides of the antisense and / or sense strands are modified nucleotides, and the RNAi agent is linked to a targeting ligand that comprises an N-acetylgalactosamine.

[0209] Embodiment 2. An RNAi agent for inhibiting expression of a C3 gene, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides that differs by 0 or 1 nucleotide from 15 contiguous nucleotides of the sense strand sequence of any one of Table 2, Table 4, Table 5C, Table 7B, or Table 8, and wherein the sense strand has a region of at least 85% complementarity over the at least 15 contiguous nucleotides to the antisense strand.

[0210] Embodiment 3. The RNAi agent of any one of embodiments 1-2, wherein at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

[0211] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein the modified nucleotides are independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0212] Embodiment 5. The RNAi agent of embodiment 4, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0213] Embodiment 6. The RNAi agent of any one of embodiments 1-5, wherein the antisense strand consists of, or consists essentially of, the nucleotide sequence of any one of the modified antisense strand sequences in Table 3, Table 5C, Table 7A, or Table 8.

[0214] Embodiment 7. The RNAi agent of any one of embodiments 1-6, wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5C, Table 7B, or Table 8.

[0215] Embodiment 8. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences in Table 3, Table 5C, Table 7A, or Table 8, and the sense strand comprises the nucleotide sequence of any one of the modified sequences in Table 4, Table 5C, Table 7B, or Table 8.

[0216] Embodiment 9. The RNAi agent of any one of embodiments 1 to 8, wherein the targeting ligand comprises:

[0217] [ka]

[0218] [ka]

[0219] Embodiment 10. The RNAi agent of any one of embodiments 1 to 9, wherein the targeting ligand is linked to the sense strand.

[0220] Embodiment 11 The RNAi agent of embodiment 10, wherein the targeting ligand is linked to the 5' end of the sense strand.

[0221] Embodiment 12. The RNAi agent of any one of embodiments 1 to 11, wherein the length of the sense strand is between 15 and 30 nucleotides and the length of the antisense strand is between 21 and 30 nucleotides.

[0222] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each 21 to 27 nucleotides in length.

[0223] Embodiment 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 to 24 nucleotides in length.

[0224] Embodiment 15. The RNAi agent of embodiment 14, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0225] Embodiment 16. The RNAi agent of any one of embodiments 1 to 15, wherein the RNAi agent has two blunt ends.

[0226] Embodiment 17. The RNAi agent of any one of embodiments 1 to 16, wherein the sense strand comprises one or two terminal caps.

[0227] Embodiment 18. The RNAi agent of any one of embodiments 1 to 17, wherein the sense strand comprises one or two inverted abasic residues.

[0228] Embodiment 19. The RNAi agent of embodiment 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a duplex sequence of any of the duplexes shown in Table 5A, 5B, 5C, or 8.

[0229] Embodiment 20. The RNAi agent of any of embodiments 1-19, wherein the RNAi agent is a pharmaceutically acceptable salt.

[0230] Embodiment 21 The RNAi agent of embodiment 20, wherein the RNAi agent is a sodium salt.

[0231] Embodiment 22. A composition comprising the RNAi agent of any one of embodiments 1 to 21, wherein the composition comprises a pharmaceutically acceptable excipient.

[0232] Embodiment 23. The composition of embodiment 22, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

[0233] Embodiment 24. The composition of embodiment 22, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

[0234] Embodiment 25. A method for inhibiting expression of the C3 gene in liver cells, comprising introducing into the cells an effective amount of an RNAi agent described in any one of embodiments 1 to 21 or a composition described in any one of embodiments 22 to 24.

[0235] Embodiment 26 The method of embodiment 25, wherein C3 mRNA is reduced in hepatocytes by at least about 50%.

[0236] Embodiment 27. The method of any one of embodiments 25-26, wherein C3 protein is reduced in hepatocytes by at least about 50%.

[0237] Embodiment 28. A method for inhibiting expression of the C3 gene in a subject, comprising administering to the subject an effective amount of the RNAi agent of any one of embodiments 1 to 21 or the composition of any one of embodiments 22 to 24.

[0238] Embodiment 29. The method of embodiment 28, wherein the subject is a human subject.

[0239] Embodiment 30 The method of embodiment 28 or 29, wherein C3 mRNA is reduced in the subject by at least about 50%.

[0240] Embodiment 31 The method of any one of embodiments 28-30, wherein C3 protein is reduced in the subject by at least about 50%.

[0241] Embodiment 32. A method for treating a disease, disorder, condition, or other symptom of a disease associated with C3, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of embodiments 22-24.

[0242] Embodiment 33. The method of embodiment 32, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

[0243] Embodiment 34. The method of any one of embodiments 25-33, wherein the level of serum C3 protein is reduced in the subject.

[0244] Embodiment 35. The method of any one of embodiments 25-34, wherein the alternative complement pathway hemolytic activity (AH50) is reduced by at least about 50% in the subject.

[0245] Embodiment 36 The method of embodiment 35, wherein AH50 is reduced by at least about 75%.

[0246] Embodiment 37. The method of embodiment 36, wherein AH50 is reduced by about 90% or more.

[0247] Embodiment 38. The method of any one of embodiments 25-37, wherein the RNAi agent is administered to the human subject at a dose of from about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

[0248] Embodiment 39. The method of any one of embodiments 25-37, wherein the RNAi agent is administered to a human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0249] Embodiment 40. The method of embodiment 39, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

[0250] Embodiment 41. The RNAi agent of any one of embodiments 1 to 21, or the composition of any one of embodiments 22 to 24, for use in treating a disease, disorder, or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

[0251] Embodiment 42. The RNAi agent or composition of embodiment 41, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

[0252] Embodiment 43. The RNAi agent of any one of embodiments 1 to 21, or the composition of any one of embodiments 22 to 24, for use in the preparation of a pharmaceutical composition for treating a disease, disorder, or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

[0253] Embodiment 44. The RNAi agent or composition of any one of embodiments 41 to 43, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

[0254] Embodiment 1a. A method of treating a C3-related disease, disorder, or condition in a human subject in need thereof, comprising administering to the human subject a therapeutically effective amount of a pharmaceutical composition comprising an RNAi agent for inhibiting expression of the C3 gene, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand comprises the nucleotide sequence (5'→3')UUUCGAACAACAGUAGGGU (SEQ ID NO: 3) and the sense strand has the nucleotide sequence (5'→3')ACCCUACUCUGUUGUUCGAAA (SEQ ID NO: 8), wherein all or substantially all of the modified nucleotides in the sense strand and the antisense strand are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof, and wherein the RNAi agent is linked to a targeting ligand comprising an N-acetylgalactosamine.

[0255] Embodiment 2a. A method of treating a C3-related disease, disorder, or condition in a human subject in need thereof, comprising administering to the human subject a therapeutically effective amount of a pharmaceutical composition comprising an RNAi agent for inhibiting expression of the C3 gene, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand has the nucleotide sequence (5'→3')usUfsusCfgAfacaacAfgAfgUfaGfGfgsu (SEQ ID NO: 13), and the sense strand has the nucleotide sequence (5'→3')(NAG37)s(invAb)sacccuacuCfUfGfuugu ucgaaas(invAb) (SEQ ID NO: 14), where a is 2'-O-methyladenosine; c is 2'-O-methylcytidine; g is 2'-O-methylguanosine; u is 2'-O-methyluridine, Af is 2'-fluoroadenosine, Cf is 2'-fluorocytidine; Gf is 2'-fluoroguanosine; Uf is 2'-fluoroadenosine; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; (NAG37)s comprises the following chemical structure:

[0256] [ka]

[0257] Embodiment 3a. The method of embodiment 2a, wherein the RNAi agent is a pharmaceutically acceptable salt.

[0258] Embodiment 4a. The RNAi agent of embodiment 2a, wherein the RNAi agent is a sodium salt.

[0259] Embodiment 5a. The method of embodiment 2a, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

[0260] Embodiment 6a. The method of embodiment 5a, wherein the disease is IgA nephropathy (IgAN) or C3 glomerulopathy (C3G).

[0261] Embodiment 7a. The method of embodiment 2a, wherein the pharmaceutical composition comprises a sodium phosphate buffer.

[0262] Embodiment 8a. The method of embodiment 2a, wherein the pharmaceutical composition comprises isotonic saline.

[0263] Embodiment 9a. The method of embodiment 2a, wherein the pharmaceutical composition comprises water for injection.

[0264] Embodiment 10a. The method of embodiment 2a, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

[0265] Embodiment 11a. The method of embodiment 2a, wherein the RNAi agent is administered to the human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0266] Embodiment 12a. The method of embodiment 10a, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

[0267] Embodiment 13a. The method of embodiment 2a, wherein the level of serum C3 protein is reduced in the subject.

[0268] Embodiment 14a. The method of embodiment 2a, wherein the alternative complement pathway hemolytic activity (AH50) is reduced by at least about 50% in the subject.

[0269] Embodiment 15a. The method of embodiment 13a, wherein AH50 is reduced by about 90% or more.

[0270] Embodiment 16a. The method of embodiment 6a, wherein the RNAi agent is formulated at 200 mg / mL in an aqueous sodium phosphate buffer, wherein the aqueous sodium phosphate buffer has a concentration of sodium phosphate monobasic of about 0.5 mM and a concentration of sodium phosphate dibasic of about 0.5 mM.

[0271] Embodiment 17a. The method of embodiment 11a, wherein the RNAi agent is administered to the human subject no more frequently than once every 12 weeks.

[0272] Embodiment 18a. The method of embodiment 11a, wherein the RNAi agent is administered to the human subject no more than four times per year.

[0273] The above embodiments and items will now be illustrated using the following non-limiting examples. [Example]

[0274] Example 1. Synthesis of C3 RNAi Agent The C3 RNAi agent duplexes shown in Tables 5A, 5B, 5C, and 8 above were synthesized according to the following general procedure.

[0275] A.Synthesis The sense and antisense strands of the RNAi agents were synthesized according to the solid-phase phosphoramidite technique used in oligonucleotide synthesis. Such standard synthesis methods are commonly known in the art. Depending on the scale, MerMade 96E® (Bioautomation), MerMade 12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. Synthesis was performed on a solid support made of controlled-pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). The monomer located at the 3' end of each strand was attached to the solid support as the starting point for synthesis. All 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, China). 2'-O-methyl phosphoramidites included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N 2The protecting groups were 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The 2'-deoxy-2'-fluorophosphoramidite had the same protecting groups as the 2'-O-methylamidite. 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (VA) or Hongene Biotech. Cyclopropylphosphonate phosphoramidite was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St. Louis, MO, USA). 5'-O-dimethoxytrityl-N 2 ,N 6 -(phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was obtained from ChemGenes or Hongene Biotech.

[0276] Phosphoramidites containing targeting ligands were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM). All other amidites were dissolved in anhydrous acetonitrile (50 mM) or anhydrous dimethylformamide, with molecular sieves (3 Å) added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activation solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 s (2'OMe), and 60 s (2'F). To introduce phosphorothioate bonds, 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Each of the C3 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetylgalactosamine as the "NAG" in the targeting ligand chemical structures depicted in Table 6. The (NAG37) and (NAG37)s targeting ligand phosphoramidite compounds can be synthesized according to International Patent Application Publication No. WO2018 / 044350 to Arrowhead Pharmaceuticals.

[0277] B. Cleavage and deprotection of support-bound oligomers After final preparation for solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt % methylamine in water and 28% aqueous ammonium hydroxide (Aldrich) for 1.5 h at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0278] C. Purification The crude oligomer was purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A contained 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was the same as buffer A but with the addition of 1.5 M sodium chloride. The UV trace was recorded at 260 nm. Appropriate fractions were pooled and subjected to size-exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G25 fine, running with either filtered purified water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0279] D. Annealing. Equimolar RNA solutions (sense and antisense) of complementary strands were mixed in 1x phosphate-buffered saline (Corning, Cellgro) to prepare RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x phosphate buffer using a UV-Vis spectrometer. The absorbance at 260 nm was multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor was calculated from 0.050 mg / (mL cm) or the experimentally determined extinction coefficient.

[0280] Example 2. In vivo testing of C3 RNAi agents in cynomolgus monkeys The C3 RNAi agent AD09546 was evaluated in cynomolgus monkeys (cynos). On days 1 and 29, three male cynomolgus monkeys (n=3) per group received a subcutaneous injection of 0.3 mL / kg (approximately 1.5 mL depending on animal weight) of either 0.5 mg / kg (mpk), 1.5 mg / kg, or 4.5 mg / kg of C3 RNAi agent formulated in isotonic saline.

[0281] [Table 9]

[0282] The C3 RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand containing three N-acetylgalactosamine groups (tridentate ligand) with the modified sequence described in the duplex structure herein. (See Tables 3, 4, 5A, 5B, 5C, 6, 7A, 7B, and 8 for specific modification and structural information regarding C3 RNAi agents containing the (NAG37)s ligand.) The C3 RNAi agent contained a nucleotide sequence designed to inhibit expression of the human C3 gene at position 2566. (See, e.g., SEQ ID NO: 1).

[0283] Serum was collected on days -7 (pre-dose), 1 (pre-dose), 8, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85. Figure 1 shows serum C3 protein normalized to pre-dose levels, with each serum collection date measured weekly (e.g., in Figure 1, week 0 is day 1, week 4 is day 29, and week 12 is day 85).

[0284] Furthermore, hemolytic activity was also assessed. Hemolytic activity is sensitive to the reduction, absence, or inactivation of key components of the complement system. As previously mentioned, there are three pathways of complement activation: the alternative pathway, the classical pathway, and the lectin pathway. All three activation pathways of the complement system require the involvement of C3 to cause tissue injury in vivo (see, for example, Thurman, J. & Holers, VM, J. Immunol. February 1, 2006, 176(3) 1305-1310). To evaluate the effect of C3 knockdown on the complement system, activation of the alternative pathway (AP) of complement was measured. AP is a Mg 2+ The classical and lectin pathways require only Ca 2+ and Mg 2+ Taking advantage of this difference, we assayed AP alone in the presence of classical and lectin pathway proteins. We used rabbit erythrocytes, which are known to spontaneously activate AP in most mammalian species.

[0285] To perform the hemolytic activity assay, 10 μL of cynomolgus monkey serum was first diluted with 10 μL of GVB buffer (Cat. No. B103, Complement Technology, Inc.) and then further diluted with 50 μL of the same buffer. To this was added 5 μL of 0.1 M MgEGTA (Cat. No. B106, Complement Technology, Inc.) and 25 μL of rabbit red blood cells (Cat. No. B302, Complement Technology, Inc.). Thus, this mixture was a 10-fold dilution of each serum sample (10% of the final serum concentration; at this stage, the total volume was 100 μL, with 1.25 × 10 rabbit red blood cells). 7 ). Lysis of rabbit erythrocytes was assessed after 15 minutes of incubation with serum at 37°C. At the end of the reaction, 100 μL of cold GVBE (catalog no. B104, Complement Technology, Inc.) was added to stop the reaction (final volume = 200 μL). Maximum lysis was determined by the same number of rabbit erythrocytes completely lysed with 2% Tween 20 after 60 minutes of incubation at 37°C. The supernatant of each reaction was transferred to a new ELISA plate and read at 412 nm. Hemolytic activity was determined using the following formula: (background reading) / (maximum hemolysis background reading) × 100%. Figure 2 shows the percentage of pre-dose hemolytic activity (AP) up to week 8 (day 57). For each individual animal, the percentage of remaining hemolytic activity in samples taken at all time points in this study was normalized to the average hemolysis levels of the corresponding animal on days -7 and 1.

[0286] As shown in Figures 1 and 2, the maximum decrease in serum C3 was approximately 84.3%, consistent with the decrease in hemolytic activity. Furthermore, the effect was long-lasting, supporting the possibility of administering AD09546 every 3 or 6 months.

[0287] Additionally, serum samples were evaluated for C3a. Complement C3a consists of 75 amino acid residues and is released from complement C3 upon complement activation, stimulating the immune system (Yoshikawa, Handbook of Biologically Active Peptides, Second Edition, 2013, Chapter 214: 1570-1576). Therefore, serum C3a levels serve as an indicator of complement C3-related activity. Serum C3a concentrations were quantified by ELISA using the BD OptEIA Human C3a ELISA Kit (Cat#: 550499, BD Biosciences). The standard measurement procedure was as provided by BD Biosciences. Samples were diluted 500-fold and 2000-fold.

[0288] Figure 5 shows absolute C3a levels over time. Figure 6 shows the relative C3a values ​​as a percentage of pre-treatment C3a values. As shown in Figure 6, a maximum serum C3a reduction of approximately 85% was achieved at 7 weeks after injection of 4.5 mg / kg of the RNAi agent AD09546, accompanied by associated C3-related activity.

[0289] Example 3. Phase I / IIa Clinical Trial of C3 RNAi Agents in IgA Nephropathy (IgAN) and C3 Glomerulopathy (C3G) in Healthy Human Volunteers and Adult Subjects A single- and multiple-ascending-dose Phase 1 / 2a study was initiated in adult healthy volunteers and subjects with IgA nephropathy (IgAN) and C3 glomerulopathy (C3G) to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of the C3 RNAi agents formulated in the sodium phosphate buffer listed in Table 8. The C3 RNAi agents listed in Table 8 were formulated at 200 mg / mL in aqueous sodium phosphate buffer (0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic) ("Formulated C3 RNAi Agent"). Figure 3 shows the preliminary clinical trial design for healthy adult volunteers, and Figure 4 shows the preliminary clinical trial design for adult C3G and IgAN subjects. The clinical trial design was modified as shown in Figures 7, 8, 9, and 10. Prior to dosing any patients, it was decided not to include patients with paroxysmal nocturnal hemoglobinuria (PNH) at this time.

[0290] Five single-dose (SAD) cohorts enrolled six normal healthy volunteers (NHVs) each (randomized 2:1 to drug:placebo) and administered 25 mg, 50 mg, 100 mg, 200 mg, 400 mg, or placebo (i.e., four subjects in each cohort received the C3 RNAi agent and two subjects received placebo). Two dose levels (200 mg and 400 mg) were also investigated in multiple-ascending-dose (MAD) cohorts. Six NHVs each enrolled six NHVs (randomized 2:1 to drug:placebo) and administered either the C3 RNAi agent or placebo on days 1 and 29.

[0291] In NHVs, the C3 RNAi formulation was generally considered well tolerated, with no drug-related serious adverse events (SAEs), no study discontinuations due to adverse events (SEs), no clinically significant laboratory findings, and no adverse patterns of change in laboratory parameters reported.

[0292] Total C3 protein levels in serum samples were measured by nephelometry: a known amount of anti-C3 antibody was included in the assay matrix, and C3 was measured using a Beckman Immage 800 Immunochemistry System by measuring the increase in light scattered from particles suspended in solution as a result of complexes formed during the antigen-antibody reaction.

[0293] Alternative complement pathway hemolytic activity (AH50) was also assessed using a typical hemolysis assay based on the lysis of rabbit erythrocytes (RA) by cell surface complement activation. AH50 (50% complement hemolysis) was determined for each component by adding a limiting volume of test sample. Serial dilutions of the test sample were mixed with an equal volume of RA. The amount of hemoglobin released upon hemolysis of target cells by complement action was measured, and the percentage of hemolyzed cells was calculated from this. At the cell concentration used in this example, the most sensitive wavelength used was 415 nm, which is the dominant peak in the hemoglobin spectrum. For each assay, five standards and five characterized QC controls were used to validate the run.

[0294] Furthermore, the decrease in C3 correlated with a decrease in alternative complement pathway (AP) activity, as measured by the Wieslab® AP assay. The Wieslab® AP assay is an ELISA-based assay that detects the complement membrane attack complex (MAC), an immune cytolytic effector at the final stage of the complement cascade. The commercially available kit (COMPLAP330RUO, SVAR Life Sciences, Sweden) is alternative pathway-specific because the plate is coated with a specific activator of the alternative pathway. The results described here were calculated using negative and positive control samples according to the manufacturer's protocol.

[0295] Preliminary data from NHV showed consistent reductions in C3 serum protein levels across all SAD cohorts, with the 400 mg cohort achieving a mean reduction of 80.7% at day 29 that was sustained through week 16 (see, e.g., Figure 11). AH50 was also evaluated, with a mean reduction of 68.8% in AH50 in the 400 mg cohort (see Figure 13). Wieslab® AP was also evaluated, with a mean reduction of approximately 85% to 90% observed in the 400 mg group that was sustained through week 16 (see Figure 15).

[0296] In the NHV MAD cohort, mean C3 reductions of 79.5% and 87.8% were achieved at 200 mg and 400 mg doses, respectively, 4 weeks after the final dose (see, e.g., Figure 12). This was associated with mean AH50 reductions of 67% and 91.3%, with greater than 95% reductions in AH50 observed in three of four subjects in the 400 mg cohort. The maximum reduction in serum C3 protein levels in a single subject was approximately 86% in the 200 mg cohort and approximately 92% in the 400 mg cohort. Wieslab® AP was also evaluated in the MAD cohort, demonstrating a mean reduction of approximately 87.2% in the 200 mg cohort and approximately 99% in the 400 mg cohort at week 8 (see Figure 15). Given the observed duration of suppressive effects, quarterly or possibly less frequent dosing may be justified, particularly at the 400 mg dose.

[0297] These data are the first reported clinical data in humans using an inhibitor of C3 gene expression, and more specifically, are the first reported clinical inhibition of the alternative pathway by inhibiting C3 gene expression in humans.

[0298] Other embodiments While the invention has been described in conjunction with the detailed description thereof, it is to be understood that the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. An RNAi agent for inhibiting expression of a C3 gene, comprising: an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8; and a sense strand that contains a nucleotide sequence that is at least partially complementary to the antisense strand Including, An RNAi agent wherein all or substantially all of the nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand that comprises an N-acetylgalactosamine.

2. 1. An RNAi agent for inhibiting expression of a C3 gene, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides that differs by 0 or 1 nucleotide from 15 contiguous nucleotides of a sense strand sequence of any one of Table 2, Table 4, Table 5C, Table 7B, or Table 8, and wherein the sense strand has a region of at least 85% complementarity over the at least 15 contiguous nucleotides to the antisense strand.

3. 3. The RNAi agent of claim 1 or 2, wherein at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

4. 4. The RNAi agent of any one of claims 1 to 3, wherein the modified nucleotides are independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

5. 5. The RNAi agent of claim 4, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

6. 6. The RNAi agent of any one of claims 1-5, wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences in Table 3, Table 5C, Table 7A, or Table 8.

7. 7. The RNAi agent of any one of claims 1-6, wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences in Table 4, Table 5C, Table 7B, or Table 8.

8. 2. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences in Table 3, Table 5C, Table 7A, or Table 8, and the sense strand comprises the nucleotide sequence of any one of the modified sequences in Table 4, Table 5C, Table 7B, or Table 8.

9. The targeting ligand is 【Chemistry 1】 【Chemistry 2】 The RNAi agent of any one of claims 1 to 8, comprising:

10. The RNAi agent of any one of claims 1 to 9, wherein the targeting ligand is linked to the sense strand.

11. The RNAi agent of claim 10 , wherein the targeting ligand is linked to the 5′ end of the sense strand.

12. The RNAi agent of any one of claims 1 to 11, wherein the sense strand is 15 to 30 nucleotides in length and the antisense strand is 21 to 30 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand each have a length of 21 to 27 nucleotides.

14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand each have a length of 21 to 24 nucleotides.

15. The RNAi agent of claim 14, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

16. The RNAi agent of any one of claims 1 to 15, wherein the RNAi agent has two blunt ends.

17. The RNAi agent of any one of claims 1 to 16, wherein the sense strand comprises one or two terminal caps.

18. The RNAi agent of any one of claims 1 to 17, wherein the sense strand comprises one or two inverted abasic residues.

19. 2. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex sequence of any of the duplexes listed in Tables 5A, 5B, 5C, or 8.

20. The RNAi agent of any one of claims 1 to 19, wherein the RNAi agent is a pharmaceutically acceptable salt.

21. 21. The RNAi agent of claim 20, wherein the RNAi agent is a sodium salt.

22. 22. A composition comprising the RNAi agent of any one of claims 1 to 21, wherein the composition comprises a pharmaceutically acceptable excipient.

23. 23. The composition of claim 22, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

24. 23. The composition of claim 22, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

25. 26. A method for inhibiting expression of the C3 gene in liver cells, comprising introducing into the cells an effective amount of an RNAi agent according to any one of claims 1 to 21 or a composition according to any one of claims 22 to 24.

26. 26. The method of claim 25, wherein C3 mRNA is reduced by at least about 50% in hepatocytes.

27. 27. The method of any one of claims 25 to 26, wherein C3 protein is reduced in hepatocytes by at least about 50%.

28. 26. A method of inhibiting expression of the C3 gene in a subject, comprising administering to the subject an effective amount of an RNAi agent as defined in any one of claims 1 to 21 or a composition as defined in any one of claims 22 to 24.

29. 29. The method of claim 28, wherein the subject is a human subject.

30. 30. The method of claim 28 or 29, wherein C3 mRNA is reduced in the subject by at least about 50%.

31. 31. The method of any one of claims 28 to 30, wherein C3 protein is reduced in the subject by at least about 50%.

32. 25. A method of treating a C3-related disease, disorder, symptom, or other manifestation of disease, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 22-24.

33. 33. The method of claim 32, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

34. The method of any one of claims 25 to 33, wherein serum C3 protein levels are reduced in the subject.

35. 35. The method of any one of claims 25-34, wherein the alternative complement pathway hemolytic activity (AH50) is reduced in the subject by at least about 50%.

36. 36. The method of claim 35, wherein AH50 is reduced by at least about 75%.

37. 37. The method of claim 36, wherein AH50 is reduced by about 90% or more.

38. 38. The method of any one of claims 25-37, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

39. 38. The method of any one of claims 25-37, wherein the RNAi agent is administered to a human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

40. 40. The method of claim 39, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

41. 25. The RNAi agent of any one of claims 1 to 21, or the composition of any one of claims 22 to 24, for use in treating a disease, disorder, or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

42. 42. The RNAi agent or composition of claim 41, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

43. 25. The RNAi agent of any one of claims 1 to 21, or the composition of any one of claims 22 to 24, for use in the preparation of a pharmaceutical composition for treating a disease, disorder, or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

44. 44. The RNAi agent or composition of any one of claims 41-43, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

Images