Novel inhibitors of epigenetic regulators

Therapeutic agents targeting PRMT6 and LSD1 inhibit AR-regulating cofactors, addressing the limitations of current treatments by reducing AR activity in diseases like SBMA and cancers without enhancing AR loss-of-function, thus improving long-term efficacy and minimizing side effects.

JP2026502888APending Publication Date: 2026-01-27FOND AZIONE TELETHON +6
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025537107
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-22
Filing Date
2023-12-20
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Current treatments for diseases associated with toxic gain-of-function (GOF) of the androgen receptor (AR) and/or overexpression of AR-activating cofactors, such as Kennedy's disease and certain cancers, are limited by their potential to enhance AR loss-of-function (LOF), leading to side effects like muscle atrophy and metabolic issues, and lack long-term efficacy.

Method used

Development of therapeutic agents that selectively target and inhibit overexpressed AR-regulating cofactors PRMT6 and LSD1, using RNA interference molecules, antisense oligonucleotides, or small molecule inhibitors to disrupt the feed-forward mechanism enhancing AR function.

Benefits of technology

The combination therapy effectively reduces AR activity without causing AR LOF, thereby ameliorating disease symptoms and preserving nuclear function, as demonstrated in animal models of SBMA and cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026502888000033
    Figure 2026502888000033
  • Figure 2026502888000034
    Figure 2026502888000034
  • Figure 2026502888000035
    Figure 2026502888000035
Patent Text Reader

Abstract

The present invention relates to a therapeutic agent for use in treating diseases associated with gain of function of the androgen receptor (AR) and / or overexpression of an AR-activating cofactor, such as Kennedy's disease or cancer. The therapeutic agent of the present invention comprises at least one inhibitor of an androgen receptor (AR)-activating cofactor, selected from a protein arginine methyltransferase 6 (PRMT6) inhibitor, a lysine-specific demethylase 1 (LSD1) inhibitor, or a combination thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to therapeutic agents for use in the treatment of diseases associated with gain of function (GOF) of the androgen receptor (AR) and / or overexpression of AR-activating cofactors, preferably diseases associated with toxic GOF of the AR with or without overexpression of AR-activating cofactors, such as Kennedy's disease or cancer, preferably urological cancers such as prostate cancer, bladder cancer and kidney cancer.

[0002] Therapeutic agents of the present invention include at least one inhibitor of at least one androgen receptor (AR) activating cofactor selected from an inhibitor of protein arginine methyltransferase 6 (PRMT6), an inhibitor of lysine-specific demethylase 1 (LSD1), or a combination thereof ("combination therapy"). [Background technology]

[0003] AR is a transcription factor activated by androgen. To properly exert its pleiotropic functions in various tissues, AR interacts with transcriptional regulatory cofactors. In the unliganded state, AR is primarily (but not exclusively) localized in the cytoplasm and associates with heat shock proteins. Upon androgen binding, AR dissociates from the heat shock proteins and translocates to the nucleus, where it binds to androgen response elements (AREs) present in the promoters or enhancer elements of its target genes to regulate gene expression.

[0004] Transcriptional regulation acts sequentially and combinatorially to reorganize chromatin. Central to this dynamic reorganization are modifications of core histones. The N-terminal tails of histones undergo various covalent modifications, including acetylation, phosphorylation, ubiquitination, and methylation, by specific chromatin-modifying enzymes, many of which are AR cofactors.

[0005] Cofactors (also called regulatory cofactors) are recruited for proper activation of steroid receptors. Nearly 300 AR regulatory cofactors are known, which act as activating or repressing cofactors of the AR and are essential for regulating gene expression.

[0006] PolyQ expansions alter the natural function of AR, leading to abnormal gene expression in both motor neurons and muscle cells.

[0007] Spinal-bulbar muscular atrophy (SBMA), also known as Kennedy disease, is an X-linked, late-onset neuromuscular disorder caused by a microsatellite expansion (38 or more repeats) of a glutamine (Q)-encoding CAG triplet tandem repeat in exon 1 of the androgen receptor (AR) gene, resulting in the production of ARs with abnormally expanded polyglutamine (polyQ) tracts (Non-Patent Document 1). SBMA belongs to a family of polyQ expansion-induced diseases, including Huntington's disease (HD), dentatorubral-pallidoluysian atrophy, and six types of spinocerebellar ataxia (SCA) (Non-Patent Document 2). SBMA affects 2-5 in 100,000 people worldwide and is characterized by selective degeneration of lower motor neurons (Non-Patent Documents 3, 4). Emerging research has also demonstrated primary involvement of peripheral tissues, such as skeletal muscle (Non-Patent Document 5). Clinical features of SBMA include delayed-onset progressive muscle weakness, fatigue and fasciculations, difficulty swallowing, endocrine dysfunction and mild to moderate metabolic syndrome, and, in some individuals, cardiac dysfunction. The phenotype is thought to be primarily due to a toxic gain-of-function (GOF) of polyQ-expanded AR. However, mild signs of androgen insensitivity and endocrine abnormalities also suggest partial AR loss-of-function (LOF) in this condition (Non-Patent Document 1). A necessary step toward toxicity is the binding of AR to its natural ligand, testosterone, and its more potent derivative, dihydrotestosterone (DHT) (Non-Patent Document 8). Therefore, SBMA is unique among polyQ disorders (in humans as well as in fly and mouse models) due to its sex specificity: males develop severe symptoms, whereas females, even homozygous for the mutation, develop mild or no symptoms.

[0008] There is no treatment that can cure SBMA or delay the onset and progression of the disease. The androgen-dependent nature of the disease and experimental evidence support chemical castration as a treatment strategy for SBMA, but clinical trials based on this approach have shown efficacy in only a subset of patients (Non-Patent Document 3). Furthermore, chronic androgen deprivation may enhance symptoms associated with androgen deficiency, ranging from muscle atrophy and weakness to metabolic changes and depression.

[0009] This poses limitations to clinical approaches that silence disease proteins, an aspect particularly relevant for chronic, slowly progressive diseases such as SBMA, which require long-term treatment regimens. This aspect is important for SBMA for three reasons: i) any treatment is likely to be more effective if initiated during adolescence, simultaneously with or before the onset of symptoms; ii) any treatment that suppresses mutant AR enhances AR LOF, an aspect that cannot be ignored in X-linked diseases affecting male subjects; and iii) because SBMA patients exhibit signs of androgen insensitivity syndrome, this aspect must be taken into account in the research design of new treatments administered throughout the patient's life. Enhanced AR LOF is likely to worsen sexual dysfunction, metabolic syndrome and diabetes, depression, and muscle atrophy. Therefore, alternative strategies are needed to improve clinical outcomes. In particular, novel therapeutic agents that can be administered chronically with minimal side effects, i.e., treatments that preserve AR nuclear function while eliminating toxic gain-of-function, are urgently needed.

[0010] It is known that abnormal expression of AR regulatory cofactors contributes to the development and progression of prostate cancer and other types of hormone-dependent cancers, such as bladder cancer, liver cancer, and kidney cancer. In prostate cancer, approximately 30% of cases are due to abnormal AR signaling.

[0011] Previous transcriptome analysis identified significant upregulation of protein arginine methyltransferase 6 (PRMT6) in skeletal muscle of SBMA mouse models. PRMT6 is a general transcriptional repressor cofactor, but is also an activator cofactor of AR. PRMT6 expression is associated with prostate cancer. 4 and is also frequently upregulated in hormone-dependent cancers such as breast cancer, as well as in mouse models of metabolic syndrome, diabetes, and insulin resistance—conditions also present in approximately 50% of SBMA patients.

[0012] Similar to PRMT6, lysine-specific demethylase 1 (LSD1, AOF2, or KDM1A) is a transcriptional activation cofactor of AR (Non-Patent Document 6) and is upregulated in prostate cancer (Non-Patent Document 7).

[0013] Notably, both LSD1 and PRMT6 have a steroid hormone-binding motif, LXXLL (where L is leucine and X is any amino acid). Mechanistically, both PRMT6 and LSD1 bind to the AF-2 surface of the AR, located in the AR ligand-binding domain, via their steroid hormone-binding motif, LXXLL.

[0014] Both PRMT6 and LSD1 are required to form a functional complex with the AR for a full response to androgens. Androgen binding induces numerous post-translational modifications on the AR, including phosphorylation and lysine and arginine methylation.

[0015] Transcriptional regulatory cofactors do not bind directly to DNA; rather, they often possess enzymatic activity and exert their function by modifying histone proteins, resulting in changes in chromatin structure, transcription factor accessibility to enhancers and promoters, recruitment of transcription factors and cofactors at primed genes, and interaction with the preinitiation complex. LSD1 catalyzes the demethylation of H3K4me1 / me2.

[0016] Transcription cofactors also post-translationally target non-histone proteins involved in gene transcription. PRMT6 regulates the expression of estrogen receptor alpha, CREB-regulated transcriptional activator cofactor 2, DNA topoisomerase 3B, and p16 INK4a , p21 CIP1 LSD1 methylates and transcriptionally activates DNA polymerase beta, DNA polymerase beta, and high mobility group A1a. It also targets non-histone proteins, including forkhead box A1, DNA methyltransferase 1, p53, hypoxia-inducible factor alpha, estrogen-related receptor alpha, and E2F.

[0017] LSD1 and PRMT6 synergistically transactivate AR itself. [Prior art documents] [Non-patent literature]

[0018] [Non-Patent Document 1] Dejager, S., et al. A comprehensive endocrine description of Kennedy's disease revealing androgen insensitivity linked to CAG repeat length. J Clin Endocrinol Metab 87, 3893-3901 (2002). [Non-patent document 2] Pandey, UB, et al. HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature 447, 859-863 (2007). [Non-patent document 3] Yamamoto, T., et al. An open trial of long-term testosterone suppression in spinal and bulbar muscular atrophy. Muscle Nerve 47, 816-822 (2013). [Non-Patent Document 4] Yoshimatsu, M., et al. Dysregulation of PRMT1 and PRMT6, Type I arginine methyltransferases, is involved in various types of human cancers. Int J Cancer 128, 562-573 (2011). [Non-Patent Document 5] Nicoletti L, Paoletti C, Tarricone G, Andreana I, Stella B, Arpicco S, Divieto C, Mattu C, Chiono V. Lipoplexes for effective in vitro delivery of microRNAs to adult human cardiac fibroblasts for perspective direct cardiac cell reprogramming. Nanomedicine 45, 102589 (2022) [Non-Patent Document 6] Metzger, E., et al. LSD1 demethylates repressive histone marks to promote androgen-receptor-dependent transcription. Nature 437, 436-439 (2005). [Non-Patent Document 7] Kahl, P., et al. Androgen receptor coactivators lysine-specific histone demethylase 1 and four and a half LIM domain protein 2 predict risk of prostate cancer recurrence. Cancer Res 66, 11341-11347 (2006).

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 11

[0019] The inventors found that in pathological conditions such as SBMA or cancer, a feed-forward mechanism occurs in which the toxic GOF of AR enhances the expression of its own positive regulatory cofactors, PRMT6 and LSD1, which further enhance AR function, leading to pathological dysregulation of the expression of AR target genes.

[0020] Surprisingly, the inventors have provided proof-of-principle that selectively targeting AR-regulating cofactors that are abnormally overexpressed in AR-related diseases is a valuable therapeutic strategy for patients without enhancing AR LOF. As a result, the inventors have surprisingly found that providing a therapeutic agent that targets both AR-regulating cofactors, PRMT6 and LSD1 ("combination therapy"), synergistically improves therapeutic efficacy.

[0021] The limitations of the prior art are overcome by the present invention, which provides novel therapeutic agents for the treatment of diseases associated with overexpression of GOF of AR and / or AR-activating cofactors, preferably diseases associated with toxic GOF of AR with or without overexpression of AR-activating cofactors, that act through the inhibition of overexpressed AR-activating cofactors.

[0022] The present invention particularly relates to a therapeutic agent as claimed in the present claims, which preferably comprises or consists of a gene silencer of an AR activating cofactor, or a small molecule inhibitor of an AR activating cofactor, or a combination thereof.

[0023] More preferably, the therapeutic agent comprises an RNA interference molecule (such as an artificial microRNA), an antisense oligonucleotide, a pharmacological agent (small molecule), or a genome editing agent that targets PRMT6 and / or LSD1, or a combination thereof.

[0024] Preferably, the present invention relates to a therapeutic agent comprising a combination of at least one PRMT6 inhibitor and at least one LSD1 inhibitor.

[0025] According to a preferred embodiment, the present invention relates to a therapeutic agent comprising at least one PRMT6 inhibitor and / or at least one LSD1 inhibitor for use in the treatment of diseases associated with gain-of-function of the androgen receptor (AR) and / or overexpression of AR-activating cofactors.

[0026] According to a preferred aspect, the present invention also relates to a method for treating a disease associated with gain-of-function of AR and / or overexpression of AR-activating cofactors, the method comprising administering to a subject in need thereof a therapeutic agent comprising at least one lysine-specific demethylase 1 (LSD1) inhibitor and / or at least one protein arginine methyltransferase 6 (PRMT6) inhibitor, preferably, said therapeutic agent comprising at least one LSD1 inhibitor and at least one PRMT6 inhibitor.

[0027] Furthermore, the present invention relates to novel gene silencers that target PRMT6 and / or LSD1 transcripts.

[0028] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawing figures. [Brief explanation of the drawings]

[0029] [Figure 1A] Figures 1A-H show early and sustained androgen-dependent overexpression of LSD1 and PRMT6 in skeletal muscle of SBMA mice and patients. Figure 1A shows RT-PCR analysis of LSD1 and PRMT6 transcript levels in the indicated tissues of male WT and AR100Q mice at presymptomatic (4 weeks of age), symptomatic (8 weeks of age), and late symptomatic (12 weeks of age) stages (n = 3-5 mice / genotype). [Figure 1B] Western blot of LSD1 and PRMT6 levels in the quadriceps muscle of 12-week-old WT and AR100Q mice (n=4 mice / genotype). Quantification is shown at the bottom. [Figure 1C]RT-PCR analysis of Lsd1 and Prmt6 transcript levels in the quadriceps muscle of female WT and AR100Q mice (n = 4 mice / genotype). [Figure 1D] RT-PCR analysis of Lsd1 and Prmt6 transcript levels in EDL muscle of sham-operated and surgically castrated 8-week-old male AR100Q mice ( n = 3–4 mice / genotype). [Figure 1E] RT-PCR analysis of Lsd1 and Prmt6 transcript levels in the quadriceps muscle of 24-week-old male knock-in mice expressing AR113Q (n = 3–4 mice / genotype). [Figure 1F] RT-PCR analysis of Lsd1 and Prmt6 transcript levels in C2C12 myoblasts stably transduced with an empty lentiviral vector (control treatment) or a vector expressing AR100Q and differentiated into myotubes in the presence of DHT (10 nM, 10 days, n = 3–5 biological replicates). [Figure 1G] RT-PCR analysis of LSD1 and PRMT6 transcript levels in quadriceps biopsies from control (CTR) subjects and SBMA patients (n = 5 participants / genotype). [Figure 1H] Chromatin immunoprecipitation (ChIP) assays in C2C12 myoblasts expressing AR24Q and AR100Q and treated with vehicle and DHT (10 nM, 12 h). One experiment, representative of three technical replicates, is shown. LSD1 and PRMT6 were detected with specific antibodies, and calnexin (CNX) was used as a loading control. Graphs show mean ± SEM; Student's t-test (b, e, f, g, h) or two-way ANOVA followed by Tukey's HSD test (a, c, d). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. [Figure 2A]Figures 2A-E show that LSD1 is an activating cofactor for polyQ-expanded AR. Figure 2A shows proximity ligation assays (PLA) in motor neuron-derived MN1 cells expressing AR24Q (left graph) and AR100Q (right graph) and treated with vehicle or DHT (10 nM, 16 h). The graph shows quantification of nuclei from three biological replicates (AR24Q AR / LSD1 vehicle: n = 26; AR24Q AR / LSD1 DHT: n = 43; AR24Q AR / PRMT6 vehicle: n = 20; AR24Q AR / PRMT6 DHT: n = 8; AR100Q AR / LSD1 vehicle: n = 76; AR100Q AR / LSD1 DHT: n = 61; AR100Q AR / PRMT6 vehicle: n = 66; AR100Q AR / PRMT6 DHT: n = 43). [Figure 2B] Transcription assay in HEK293T cells expressing AR24Q or AR65Q alone (control treatment, i.e., empty vector) or together with LSD1 and treated with vehicle or DHT (10 nM, 16 h, n = 4 biological replicates). [Figure 2C] Transcription assay in MN1 cells expressing AR65Q alone (control treatment) or together with the indicated LSD1 isoforms and treated with vehicle or DHT (10 nM, 16 h, n = 3 biological replicates). [Figure 2D] (Top) Western blot of LSD1 levels in HEK293T cells expressing Cas9 with or without specific guides to silence LSD1; quantification is shown at the bottom (n=7 biological replicates). (Bottom) Transcription assay in Cas9 and g1, g2, and g2+3 cells expressing AR24Q or AR65Q and treated with DHT (10 nM, 16 h, n=3 biological replicates). [Figure 2E](Top) Western blot of LSD1 levels in MN1 cells expressing Cas9 with or without a specific guide (g4) silencing Lsd1; quantification is shown at the bottom (n = 5 biological replicates). (Bottom) Transcription assay in Cas9 and g4 cells expressing AR24Q or AR100Q and treated with DHT (10 nM, 16 h, n = 3 biological replicates). LSD1, PRMT6, and AR were detected with specific antibodies, and β-tubulin (β-Tub) was used as a loading control. Graphs show mean ± SEM; one-way (d) or two-way (b, c, e) Western blots ANOVA followed by Tukey's HSD test, or student's t-test (a, e) transcription assay. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. [Figure 3A] Figures 3A-C show that LSD1 requires the AR AF-2 surface and its catalytic activity to transactivate AR. Figure 3A shows a scheme of the AR and LSD1 modular domains and specific motifs. Numbers indicate AR NM_000044 and LSD1 NM_001009999. NTD, amino-terminal domain; DBD, DNA-binding domain; LBD, ligand-binding domain; AOD, amine oxidase domain; CTD, carboxy-terminal domain. [Figure 3B] Transcription assay in HEK293T cells expressing AR55Q or the AF-2 mutant AR55Q-E897K alone (control treatment) or together with LSD1. Cells were treated with DHT (10 nM, 16 h, n = 3 biological replicates). [Figure 3C] (Left) Transcription assay in HEK293T cells expressing AR65Q alone (control treatment) and together with either LSD1 or LSD1-LXXAA. Cells were treated with DHT (10 nM, 16 h, n = 3–6 biological replicates). (Right) Western blotting analysis of LSD1 and LSD1-LXXAA expression in HEK293T cells. One representative image of three biological replicates is shown. [Figure 3D]Transcription assay in HEK293T cells expressing AR55Q alone (control treatment) and together with either LSD1 or the catalytically inactive mutant LSD1-K685A. Cells were treated with DHT (10 nM, 16 h, n = 3 biological replicates). [Figure 3E] Transcription assay in HEK293T cells expressing AR65Q treated with DHT alone or together with SP-2509 (100 nM) and TCP (10 μM) for 16 h (n = 3 biological replicates). [Figure 3F] Western blotting analysis of H3K4me2 in C2C12 cells differentiated into myotubes for 10 days (DIV) in the presence of DHT (10 nM). H3K4me2 was detected with a specific antibody recognizing the H3-modified K residue. H3 antibody was used as a loading control. Graphs show mean ± SEM; two-way (b), one-way (c, d, e) ANOVA followed by Tukey's HSD test, or Student's t-test (f). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. [Figure 4A]Figures 4A-4E show that LSD1 and PRMT6 synergistically transactivate normal and polyQ-expanded AR. Figure 4A shows PLA analysis of MN1 cells expressing AR24Q (top graph) or AR100Q (bottom graph) and vectors for Lsd1 and Prmt6 silencing. Cells were treated with DHT (10 nM, 16 hours). Nuclei were detected with DAPI. Representative images are shown. The bar represents 17 μm. The graph shows quantification of nuclei from three independent experiments (AR24Q P6 / LSD1 solvent: n = 12; AR24Q P6 / LSD1 DHT: n = 22; AR24Q Cas9 nonspecific control AR / LSD1: n = 169; AR24Q Cas9 nonspecific control AR / LSD1: n = 198; AR24Q Cas9 AR / PRMT6: n = 184; AR24Q Cas9 g2 AR / PRMT6: n = 237; AR100Q PRMT6 / LSD1 solvent: n = 79; AR100Q PRMT6 / LSD1 DHT: n = 116; AR100Q Cas9 nonspecific control AR / LSD1: n = 302; AR100Q Cas9 nonspecific control AR / LSD1: n = 190; AR100Q Cas9 AR / PRMT6: n = 202; AR100Q Cas9 g2 AR / PRMT6: n = 164). [Figure 4B] Western blot of MN1 cells transduced with lentiviral vectors for silencing Lsd1 and Prmt6. One experiment representative of three biological replicates is shown. Quantification is shown at the bottom. [Figure 4C] Immunoprecipitation of PRMT6 and immunoblotting of the indicated proteins in skeletal muscle (quadriceps) of 24-week-old WT and AR113Q mice. One representative experiment is shown (3 mice / genotype). [Figure 4D] Transcription assays in HEK293T cells expressing AR24Q and AR65Q alone (control treatment) or together with LSD1 and PRMT6 and treated with vehicle, DHT (10 nM), TCP (10 μM), or Adox (10 μM) for 16 h ( n = 3–7 biological replicates). [Figure 4E](Left) Transcription assay in HEK293T cells expressing AR24Q or AR65Q with or without CRISPR guides silencing Lsd1 and Prmt6 (n = 3 biological replicates). (Right) Western blot of PRMT6 levels in HEK293T cells expressing Cas9 alone or with a guide silencing PRMT6. One experiment representative of three biological replicates is shown. Quantification is shown at the bottom. AR, LSD1, and PRMT6 were detected with specific antibodies, and β-tubulin (β-Tub) and calnexin (CNX) were used as loading controls. Graphs show mean ± SEM; Student's t-test (a, c) or one-way ANOVA followed by Tukey's HSD test (d, e). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. [Figure 5A] Figures 5A-5C show that silencing LSD1 and PRMT6 suppresses polyQ-expanded AR neurotoxicity. Figure 5A shows the eye phenotype of flies expressing GFP, AR0Q, or AR52Q, with or without RNAi silencing Dart8, the orthologue of dLsd1 and PRMT6 flies. Representative images of 10-15 flies / genotype are shown. [Figure 5B] RT-PCR analysis of dLsd1 mRNA transcript levels normalized to tubulin ( n = 3 flies / genotype). [Figure 5C] Disease severity in AR52Q flies with or without dLsd1 and Dart8 silencing (n = 10–15 flies / genotype). Graphs show mean ± SEM; Student's t-test (b) or one-way ANOVA followed by Tukey's HSD test (c). *p ≤ 0.05; ***p ≤ 0.001. [Figure 6A] Figures 6A-G show the RNAi strategy for silencing Lsd1 and Prmt6 in vivo. Figure 6A shows Western blots of LSD1 and Prmt6 in MN1 cells transfected with vectors expressing a nonspecific control amiR or amiRs that silence Lsd1 and Prmt6. One experiment, representative of three biological replicates, is shown. [Figure 6B]Cell viability assay in MN1 cells expressing AR24Q or AR100Q, transfected as indicated, and treated with DHT (10 nM, 48 h, n = 3 biological replicates). [Figure 6C] Schematic diagram of an AAV9 vector expressing GFP and an amiR that silences both Lsd1 and Prmt6 (amiR-Lsd1 / Prmt6). ITR (inverted terminal repeat); WPRE, (woodchuck hepatitis virus posttranscriptional regulatory element); pA (polyadenylation site). [Figure 6D] Biodistribution of virus particles in various tissues of WT mice. [Figure 6E] Western blot of GFP expression in the indicated tissues of WT mice transduced with AAV9-amiR. One experiment representative of three biological replicates in three mice is shown (Q = quadriceps; Sc = spinal cord; Bs = brainstem; L = liver; H = heart; Lg = lung; A = adipose tissue). [Figure 6F] RT-PCR analysis of transcript levels normalized to actin for Lsd1, Prmt6, mouse AR (mAR), and human AR (hAR) in the quadriceps muscle of 13-week-old AR100Q mice with or without amiR-Lsd1 / Prmt6 ( n = 7–9 mice / group). [Figure 6G] Western blot of LSD1 and PRMT6 in skeletal muscle from AR100Q mice with or without amiR-Lsd1 / Prmt6 treatment. One experiment, representative of 5 mice / group, is shown. Quantification is indicated at the bottom. GFP, LSD1, and PRMT6 were detected with specific antibodies; β-tubulin (β-Tub) and calnexin (CNX) were used as loading controls. Graphs show mean ± SEM; one-way ANOVA followed by Tukey's HSD test (a, b) or Student's t-test (d, f, g). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001. [Figure 7A]Figures 7A-7D show that silencing Lsd1 and Prmt6 alters gene expression in SBMA muscle. Figure 7A shows a Venn diagram showing the intersection of differentially expressed genes (upregulated, top; downregulated, bottom; absolute fold change >4 and adjusted p<0.01) obtained by comparing control (AR100Q) vs. amiR-treated SBMA mice; AR100Q vs. WT mice; or amiR-treated vs. WT mice. [Figure 7B] Ring plot showing the number of differentially expressed genes and the relative proportion of fully and partially restored genes in AR100Q versus WT mice by differential expression analysis. [Figure 7C] Heatmap of the top 20 clusters obtained from functional enrichment analysis of recovered genes. Colors are proportional to enrichment p-values. Each cluster name is based on the most statistically significant term within the cluster. [Figure 7D] Similarity network of enriched terms. Each node represents an enriched term and is color-coded by its cluster identifier. Node size is proportional to the number of recovered genes contained in that term. Edge width is proportional to the similarity score calculated between pairs of nodes. [Figure 8]Figure 8 shows that silencing Lsd1 and Prmt6 ameliorates the disease phenotype in SBMA mice. a) Body weight, hanging wire, and rotarod analysis of WT and AR100Q mice treated with vehicle or amiR-Lsd1 / Prmt6 (n = 7–10 mice / group). b) NADH staining of 8-week-old mice treated as indicated (n = 4 mice / group; n = 11,000 fibers / group). c) RT-PCR analysis of denervation markers normalized to actin in control or AR100Q mice treated with vehicle or amiR-Lsd1 / Prmt6 (n = 4–9 mice / group). d) Western blot of AR in skeletal muscle of AR100Q mice treated with vehicle or amiR-Lsd1 / Prmt6 (n = 3 mice / group). HMW, high molecular weight species. AR was detected with specific antibodies, and calnexin (CNX) was used as a loading control. Graphs show mean ± SEM; one-way ANOVA followed by Tukey's HSD test (a, b, c) or Student's t-test (d), *p≦0.05; **p≦0.01; ***p≦0.001. [Figure 9A] Figures 9A-9C show that silencing human LSD1 and PRMT6 alters gene expression and prostate cancer cell proliferation. Figure 9A shows Western blots of LSD1 and PRMT6 in HEK293T cells transfected with a vector expressing a nonspecific control amiR or amiR-LSD1 / PRMT6, which silences LSD1 and PRMT6. One experiment, representative of three to four biological replicates, is shown. Quantification of LSD1 (yellow) and PRMT6 (blue) levels is shown at the bottom. [Figure 9B] RT-PCR analysis of the indicated genes in HEK293T transfected with vectors expressing nonspecific control amiR or amiR-LSD1 / PRMT6 ( n = 3 biological replicates). [Figure 9C]BrdU cell proliferation assay performed on LNCaP cells transduced with lentiviral vectors expressing nonspecific control amiR or amiR-LSD1 / PRMT6 (n = 15–19 fields from three independent experiments). Graphs show mean ± SEM; one-way ANOVA followed by Tukey's HSD test (a, c) or Student's t-test (b); *p ≤ 0.05; **p ≤ 0.01. [Figure 10] We present a working model of polyQ-expanded AR and cofactors in SBMA muscle. Under physiological conditions, AR controls target gene expression. PolyQ expansion leads to aberrant transcription of AR-regulatory cofactors, such as LSD1 and PRMT6, which in turn enhances AR transcriptional activation and thus toxic GOF. Interventions that inhibit this feedforward mechanism improve disease outcomes in animal models of SBMA. [Figure 11] LSD1 interacts with normal and polyQ-expanded AR. ab) Immunoprecipitation (IP) and Western blotting (IB) analysis of Flag-tagged AR and LSD1 interaction in HEK293T cells (n=3 biological replicates). AR was detected with an anti-Flag antibody, and LSD1 was detected with a specific antibody. Molecular weights (MW) are indicated on the right. [Figure 12A] Figures 12A-12D show that LSD1 is a coactivator of normal and polyQ-expanded AR. Figure 12A shows transcription assays in HEK293T cells expressing AR12Q and AR55Q, both alone and together with LSD1, driven by the EF1α promoter and treated with vehicle and DHT (10 nM, 16 hours, n = 4 biological replicates). [Figure 12B] Transcription assay in HEK293T cells expressing AR24Q and AR65Q alone and together with the indicated LSD1 isoforms and treated with vehicle and DHT (10 nM, 16 h, n = 4 biological replicates). [Figure 12C] Transcription assay in MN1 cells expressing AR24Q alone and together with LSD1 and treated with vehicle and DHT (10 nM, 16 h, n = 3 biological replicates). [Figure 12D]Western blotting analysis of LSD1 expression in HEK293T cells stably expressing Cas9 and the indicated guides targeting LSD1. One experiment, representative of n=7 biological replicates, is shown. LSD1 was detected with a specific antibody, and β-tubulin (β-Tub) was used as a loading control. Graphs show mean ± sem, two-way ANOVA followed by Tukey's HSD test; *p ≤ 0.05, ***p ≤ 0.001. [Figure 13A] Figures 13A-C show that LSD1 and PRMT6 interact and synergistically transactivate normal and polyQ-expanded AR. Figure 13A (left) shows immunoprecipitation (IP) and immunoblotting (IB) analysis of LSD1 and PRMT6 interaction in HEK293T cells expressing EGFP-tagged PRMT6 and LSD1. Figure 13A (right) shows Western blotting analysis of LSD1 and PRMT6 in HEK293T cells transduced with lentiviral vectors that silence LSD1 and PRMT6 using CRISPR technology. One experiment, representative of three (right) and two (left) biological replicates, is shown. Quantification is shown at the bottom. [Figure 13B] Transcription assay in HEK293T cells expressing AR65Q and AR65Q-S215A, S792A alone (control treatment) and together with both LSD1 and PRMT6. Cells were treated with DHT (10 nM, 16 h, n = 3 biological replicates). [Figure 13C] Transcription assay in HEK293T cells expressing AR24Q and AR65Q alone (control treatment) and together with PRMT6, with or without a silencing guide targeting LSD1. Cells were treated with DHT (10 nM, 16 h, n = 6 biological replicates). LSD1 and PRMT6 were detected with specific antibodies, and β-Tub was used as a loading control. Graphs show mean ± sem, two-way ANOVA followed by Tukey's HSD test, ***p ≤ 0.001. [Figure 14]Efficacy of amiR-targeted silencing in vivo. Western blotting analysis of the indicated tissues from AR100Q mice treated with or without amiR-Lsd1 / Prmt6 (n = 3–5 mice / genotype). LSD1, PRMT6, and GFP were detected with specific antibodies, and CNX or actin were used as loading controls. Graphs show mean ± sem, Student's t-test, *p ≤ 0.05. [Figure 15] Effect of amiR treatment on gene expression. RT-PCR analysis of LSD1, AR, and PRMT6 target genes in AR100Q mice treated with vehicle or amiR-Lsd1 / Prmt6 (n = 3 mice / genotype). Graph, mean ± sem, Student's t-test, *p ≤ 0.05. [Figure 16] Figure 1 shows the effect of small molecule inhibition of LSD1 on the phenotype of AR100Q mice. Graphs show grip strength normalized to body weight for wild-type (WT), AR100Q transgenic (Tg), and AR100Q transgenic mice treated with phenelzine (a) or tranylcypromine (TCP) (b). Graphs show mean ± sem, Student's t-test, **p ≤ 0.01. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention relates to novel therapeutic agents comprising at least one inhibitor of at least one androgen receptor (AR) activating cofactor selected from protein arginine methyltransferase 6 (PRMT6), lysine-specific demethylase 1 (LSD1), or both.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0032] The term "therapeutic agent" refers to a substance or combination of substances that has properties for treating or preventing disease, particularly in humans.

[0033] An "inhibitor" according to the present invention is an agent that can directly or indirectly reduce or suppress the expression or activity of the molecule being inhibited. The term "expression" is used in the broadest sense herein and includes the production of RNA or RNA and protein. With respect to RNA, the terms "expression" or "translation" particularly relate to the production of peptides or proteins.

[0034] For example, an inhibitor according to the present invention can be a molecule that directly or indirectly reduces or suppresses the transcription of a gene (target gene) encoding the molecule to be inhibited (target molecule) or the translation of the target molecule from its gene transcription product (messenger RNA, mRNA). An inhibitor according to the present invention can also be a chemical substance, such as a small molecule, that can directly or indirectly reduce or suppress the biological activity of a target molecule.

[0035] As used herein, the term "androgen receptor" preferably refers to the human androgen receptor (AR) (UniProt P10275-1). Androgen receptor coactivator factors are proteins that interact with the androgen receptor to enhance the transcriptional activation of androgen receptor target genes.

[0036] The therapeutic agents of the present invention are inhibitors of PRMT6 and / or LSD1 AR activating cofactors.

[0037] As used herein, the term "PRMT6" preferably refers to the human protein arginine methyltransferase 6 protein (UniProt Q96LA8), or the gene (NCBI Reference Sequence: NC_000001.11) or transcript (NCBI Reference Sequence: NM_018137.3, SEQ ID NO: 1) encoding it.

[0038] The term "LSD1" as used herein preferably refers to the human lysine-specific demethylase 1 protein (UniProt O60341) (also known as "KDM1A"), the gene encoding it (NCBI Reference Sequence: NG_047129.1) or its transcript (NCBI Reference Sequence: NM_001009999.3, SEQ ID NO: 2), or any variants or isoforms such as LSD1-2a, LSD1-8a, and LSD1-2a / 8a isoforms derived from alternative splicing. 10 . The therapeutic agent of the present invention is preferably for use in treating a disease associated with gain of function of AR and / or overexpression of an AR-activating cofactor in a subject in need thereof, wherein the AR-activating cofactor is preferably PRMT6 or LSD1.

[0039] As used herein, "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal condition in a subject.

[0040] Diseases associated with AR "gain of function" are characterized by increased AR activity compared to physiological baseline. Such diseases can be caused by mutant AR, where the mutation increases the functionality of AR. An example of such a disease is polyglutamine (polyQ) disorder, which is associated with the "gain of function" of a mutant gene or its product, such as SBMA in the case of AR. Additional diseases associated with AR gain of function include hormone-dependent cancers such as prostate cancer, bladder cancer, liver cancer or kidney cancer, metabolic syndrome, diabetes, and insulin resistance.

[0041] Preferably, the therapeutic agent of the present invention is for use in the treatment of a disease associated with AR gain of function, more preferably SBMA or a hormone-dependent cancer such as prostate cancer, bladder cancer, liver cancer or kidney cancer, or metabolic syndrome, diabetes, or insulin resistance.

[0042] The term "overexpression" refers to increased gene expression above normal. Assays for determining gene overexpression are well known in the art and include, but are not limited to, immunological assays, nuclease protection assays, Northern blots, in situ hybridization, and real-time polymerase chain reaction (RT-PCR), expressed sequence tag (EST) sequencing, cDNA microarray hybridization or gene chip analysis, subtractive cloning, serial analysis of gene expression (SAGE), massively parallel signature sequencing (MPSS), and sequencing by synthesis (SBS). Differentially expressed genes can be overexpressed compared to the expression levels of normal or control cells or internal controls. For example, the term refers to a difference of about 1.5-fold, about 2.0-fold, about 3.0-fold, about 5-fold, about 10-fold, about 50-fold, or even more than about 100-fold compared to the expression level detected in a control sample. A "control" is used in an experiment for comparison or normalization purposes. Controls used to compare gene expression at the mRNA level include internal and external controls. Internal controls refer to genes known to be present in the sample being tested. The expression level of the gene is preferably well characterized, providing a reliable measurement of the gene expression level in the control. Examples of genes useful as internal controls include, but are not limited to, housekeeping genes such as β-actin, 18S, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and cyclophilin. External controls include the use of a subject or sample from a subject known to express the gene of interest at a specific level, or a sample from, for example, a healthy subject.

[0043] Diseases associated with overexpression of AR-activating cofactors include SBMA, prostate cancer, lung cancer, breast cancer, bladder cancer, cervical cancer, and lymphoma.

[0044] Preferably, the therapeutic agent of the present invention is for use in the treatment of a disease associated with overexpression of an AR-activating cofactor, more preferably SBMA, prostate cancer, lung cancer, breast cancer, bladder cancer, cervical cancer, or lymphoma.

[0045] More preferably, the therapeutic agents of the present invention are for use in treating diseases associated with either AR gain of function and overexpression of AR activating cofactors, such as SBMA or cancer, most preferably SBMA or prostate cancer.

[0046] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") refers to the administration of a therapeutic agent or formulation according to the present invention to achieve a desired pharmacological and / or physiological effect. The effect may be preventative, in that it completely or partially prevents a disease or its symptoms, and / or therapeutic, in that it partially or completely stabilizes or cures a disease and / or adverse effects caused by the disease, or controls disease progression. The term "treatment" includes "prevention," i.e., inhibiting or delaying the onset or reducing the occurrence of a disease in a subject. Prevention may be complete (e.g., the complete absence of pathological cells in a subject) or partial. Prevention also refers to a reduction in susceptibility to a clinical condition. Control of disease progression is understood as the achievement of beneficial or desired clinical results, including, but not limited to, alleviation of symptoms, shortening the duration of the disease, stabilization of the pathological state (especially to avoid further exacerbations), delaying disease progression, amelioration of the pathological state, and remission (both partial and complete). Control of disease progression also includes prolonging survival compared to expected survival if no treatment is applied. In particular, in accordance with the present invention, the terms "treatment," "treating," "treating," and the like used herein preferably refer to the administration of a therapeutic agent or formulation of the present invention to cure, prevent, delay, and / or control the clinical symptoms of the disease being treated.For example, in the case of cancer, treatment includes reducing cachexia, increasing survival time, extending the time to tumor progression, reducing tumor burden, reducing tumor load, and / or extending the time to tumor metastasis, each of which is measured by the standards established by the National Institutes of Health, such as the National Cancer Institute and the U.S. Food and Drug Administration, for the approval of new drugs.In the case of SBMA, treatment includes reducing or preventing SBMA symptoms, including early symptoms such as one or more of the following: muscle weakness / spasm of the arms and legs, muscle weakness of the face, mouth, and tongue, difficulty speaking and swallowing, twitching (fasciculations), tremors and shaking in certain positions, breast enlargement (gynecomastia), numbness, infertility, and testicular atrophy.

[0047] The term "effective amount" refers to an amount of a substance sufficient to achieve its intended purpose. The effective amount of a given substance will vary depending on factors such as the nature of the substance, the route of administration, the size and species of the animal receiving the substance, and the purpose for which the substance is administered. The effective amount in each individual case can be determined empirically by one of ordinary skill in the art according to methods established in the art. For example, by a "therapeutically effective dose or amount" of a compound, composition, or formulation according to the present invention is intended an amount that, when administered as described herein, results in a positive therapeutic response, such as improved recovery from a disease or improved recovery from secondary conditions of a disease.

[0048] Those in need of treatment include those already with the disease as well as those in whom prevention is desired (eg, those diagnosed with a genetic disorder but who have no symptoms).

[0049] As used herein, " patient " or " subject " refers to male or female human, non-human animal, and animal model used in clinical research.In one embodiment, the subject of treatment is the human being who has been diagnosed with the disease associated with AR gain of function and / or AR activation cofactor overexpression.In certain embodiments, the human subject is prenatal, newborn, infant, toddler, preschool child, school child, teenager, young adult or adult.Preferably, the subject is male.

[0050] According to a preferred embodiment, at least one inhibitor of at least one AR-activating cofactor for use in accordance with the present invention is a gene silencer. A "gene silencer" is an agent that specifically targets a gene or transcript and can inhibit, reduce, or disrupt the expression of the target gene or transcript. Preferably, a gene silencer according to the present invention reduces the amount or activity of its target by 90% or less, 80% or less, 70% or less, 60% or less, or 50% or less compared to the non-inhibited target; more preferably, a gene silencer according to the present invention reduces the amount or activity of its target by 10-70%, 10-60%, or 10-50% compared to the non-inhibited target.

[0051] A gene silencer according to the present invention may be an RNA interference molecule, an antisense oligonucleotide, or a genome editing agent capable of targeting and inhibiting a transcript or gene, respectively.

[0052] According to the present invention, gene or transcript is " targeted " by gene silencer, and gene silencer " targets " gene or transcript when gene silencer can selectively reduce or inhibit the expression of target gene or allele of target gene or the translation of target transcript, and / or when gene silencer hybridizes with target gene or transcript under strict conditions.For example, according to the present invention, the gene silencer of targeting AR activating cofactor (such as PRMT6 and / or LSD1) selectively reduces or inhibits the expression of the gene that codes for AR activating cofactor or the allele of this gene, or selectively reduces or inhibits the translation of the transcript of AR activating cofactor; alternatively or additionally, according to the present invention, the gene silencer of targeting AR activating cofactor (such as PRMT6 and / or LSD1) hybridizes with the gene or transcript of AR activating cofactor under strict conditions. Stringent conditions typically refer to prehybridization and hybridization in 5X SSPE, 0.3% SDS, 200 pg / ml sheared and denatured salmon sperm DNA, and 25%, 35%, or 50% formamide for low, medium, and high stringency, respectively, at 42° C. The hybridization reaction is then washed three times for 30 minutes each at 55° C., 65° C., or 75° C. for low, medium, and high stringency, respectively, using 2X SSC, 0.2% SDS.

[0053] As used herein, a "target sequence" is a nucleotide sequence that is targeted by a gene silencer according to the present invention; as used herein, a target sequence may be referred to as the sequence of a cDNA (positive strand, 5'→3') that corresponds to the RNA target transcript (sense transcript, 5'→3') of a target gene.

[0054] As used herein, a "targeting sequence" is a sequence of a gene silencer that is complementary (fully or partially) to a target sequence or its transcript and is capable of directing the gene silencer to a target gene or transcript.

[0055] The terms "sequence," "nucleotide sequence," or "isolated nucleotide sequence," or "polynucleotide sequence," or "polynucleotide," or "isolated polynucleotide sequence" are used interchangeably herein and refer to either DNA or RNA, nucleic acid molecules comprising deoxyribonucleotides or ribonucleotides, respectively. The term "sequence" may be used herein for brevity to indicate a polynucleotide or a portion of a polynucleotide having a particular sequence.

[0056] Nucleic acids can be double-stranded, single-stranded, or contain portions of both double-stranded and single-stranded sequence.

[0057] Unless otherwise indicated, the sequences of double-stranded nucleic acids shown herein are the 5' to 3' sequences of the sense (or positive) strand.

[0058] Gene silencers may be tested either in vitro or in vivo for their ability to target a gene or transcript by techniques known in the art.

[0059] Preferably, the therapeutic agent comprises at least one gene silencer that is an RNA interference (RNAi) molecule.

[0060] RNA interference is a well-known natural process in cells. In nature, i.e., in plants, animals, and some viruses, RNA silencing and post-transcriptional regulation of gene expression are influenced by miRNAs. miRNAs are small, single-stranded, non-coding RNA molecules (containing approximately 22 nucleotides). miRNAs function through base pairing with complementary sequences within mRNA molecules. As a result, these mRNA molecules are silenced by one or more of the following processes: (1) cleavage of the mRNA strand into two fragments, (2) destabilization of the mRNA by shortening its poly(A) tail, and (3) reduced efficiency of mRNA-to-protein translation by the ribosome. Each miRNA is processed from a longer precursor RNA molecule ("precursor miRNA" or "pre-miRNA"): the endogenous miRNA gene is transcribed by RNA polymerase II to generate the primary miRNA (pri-miRNA). This undergoes an initial nuclear maturation step, resulting in an approximately 70-nt imperfectly base-paired stem-loop precursor (pre-miRNA) that actually has two regions of complementarity, allowing them to form a stem-loop-like structure. After transport to the cytoplasm, the pre-miRNA undergoes further maturation steps, performed in animals by enzymes called Dicer and Drosha, which cleave the precursor loop and generate a short, imperfect double-stranded RNA (dsRNA), also known as the miRNA duplex. In the final maturation step, one of the duplex RNA strands is incorporated into the RISC complex, which is responsible for translational repression and RNA degradation. The processed miRNA (mature miRNA) then pairs with the target mRNA, resulting in its silencing.

[0061] According to the present invention, the term "RNAi molecule" includes synthetic small interfering RNA (siRNA), short hairpin RNA (shRNA), or artificial miRNA (amiR) that can inhibit a target transcript. RNAi molecules comprise or consist of a short sequence (targeting sequence) that is complementary to a target sequence within the RNA transcript of a target gene. The targeting sequence of an RNAi molecule can be a sequence that is completely complementary to the target sequence, or a degenerate RNAi sequence that targets a homologous region within the target transcript. For example, mismatches and / or wobble base pairs can provide additional targeting sequences. Preferably, the RNAi molecules of the present invention comprise or consist of a targeting sequence that is completely complementary to the target sequence or its transcript.

[0062] Assessment of the inhibition of a target transcript by an RNAi molecule can be carried out using classical molecular biology techniques such as (real-time polymerase chain reaction) qPCR, microarray, bead array, or Northern blot analysis or cloning and sequencing to quantify the RNAi molecule or the target transcript or its substrate in cells, or compounds known to be associated with the target transcript.

[0063] Gene silencer according to the present invention can be RNAi molecule itself (" mature " RNAi molecule), typically single-stranded or double-stranded RNA molecule.In addition, gene silencer can be the " precursor " of mature RNAi molecule: precursor has two self-complementary regions that allow it to form a stem-loop-like structure, which is cut by the enzymes called Dicer and Drosha in animals; processed RNAi (mature RNAi molecule), which is the active molecule that comprises or consists of targeting sequence, is typically part of stem.

[0064] Additionally, a gene silencer can be a "source" of an RNAi molecule or its precursor, which can be in the form of a DNA sequence comprising a sequence encoding the RNAi molecule, preferably extending at least 1-5 nucleotides of coding sequence upstream and / or downstream of the sequence encoding the predicted RNAi molecule. In some embodiments, the RNAi source molecule has up to 1, 2, 3, 4, 5, 6, 7 or more contiguous nucleotides, or any range derivable therein, on either or both sides (5' and / or 3' ends) flanking the sequence encoding the predominantly processed mature RNAi or its precursor.

[0065] According to a preferred embodiment of the present invention, a therapeutic agent comprises at least one gene silencer that is an RNAi molecule, or a precursor or source thereof, or an equivalent thereof, and targets an AR-activating cofactor, more preferably PRMT6. Preferably, the RNAi molecule targets any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Preferably, the RNAi molecule comprises or consists of a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Most preferably, the RNAi molecule comprises or consists of a sequence of SEQ ID NOS: 171-173, or an equivalent thereof. Optionally, a therapeutic agent comprising at least one gene silencer that is an RNAi molecule targeting PRMT6, or a precursor or source thereof, or an equivalent thereof, further comprises at least one LSD1 inhibitor, preferably a gene silencer or a small molecule, more preferably a gene silencer.

[0066] According to a preferred embodiment of the present invention, a therapeutic agent comprises at least one gene silencer that is an RNAi molecule targeting LSD1, or a precursor or source thereof, or an equivalent thereof. Preferably, the RNAi molecule targets any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcription product thereof. Preferably, the RNAi molecule comprises or consists of a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcription product thereof. Most preferably, the RNAi molecule comprises or consists of a sequence of SEQ ID NOS: 174-176, or an equivalent thereof. Optionally, a therapeutic agent comprising at least one gene silencer that is an RNAi molecule targeting LSD1, or a precursor or source thereof, or an equivalent thereof, further comprises at least one PRMT6 inhibitor, preferably a gene silencer or a small molecule, more preferably a gene silencer.

[0067] Equivalents of RNAi molecules, their precursors or sources are also encompassed by the present invention.

[0068] The term "equivalent" in relation to an RNAi molecule refers to a chemically modified RNAi molecule or RNAi nucleotide analog that maintains the same activity as the RNAi molecule, or an RNAi molecule that includes a degenerate targeting sequence or a sequence with one or more additions, substitutions (generally conservative in nature) and / or deletions, or a sequence that has a high degree of sequence homology with a reference sequence, for example, at least 80%, at least 85%, or at least 90% homology with the targeting sequence of the RNAi molecule. The term "% sequence identity," "% identity," or "% sequence homology" refers to the percentage of nucleotides or amino acids in a candidate sequence that are identical to the nucleotides or amino acids of a reference sequence after aligning the sequences to achieve the maximum % sequence identity. In a preferred embodiment, sequence identity is calculated based on the entire length of two given sequences or a portion thereof.

[0069] % sequence identity can be determined by any method or algorithm established in the art, such as ALIGN, BLAST and BLAST 2.0 algorithms.In this specification, "% sequence identity", "% identity" or "% sequence homology" is calculated by aligning the reference sequence and the candidate sequence, dividing the number of identical nucleotides or amino acids by the total number of nucleotides or amino acids in the reference sequence, and multiplying the result by 100.Preferably, the sequence of the equivalent has more than 90%, 95%, or 99% sequence identity with the sequence of the RNAi molecule.

[0070] Several chemical modifications well known in the art can be made to enhance the stability or availability of dsRNA oligonucleotides.

[0071] In addition, the RNAi molecules of the present invention are particularly intended to use modified nucleotides to enhance their activity.Such nucleotides include those at the 5' or 3' end of the RNAi molecule, as well as those within the molecule.The modified nucleotides used in the complementary strand of double-stranded RNAi molecules block the 5'OH or phosphate of RNA, or introduce internal sugar modifications that enhance the uptake of the active strand of RNAi molecules.Modifications of RNAi molecules include internal sugar modifications that enhance hybridization and stabilize the molecule in cells, and terminal modifications that further stabilize nucleic acid in cells.

[0072] Equivalents of RNAi molecules according to the present invention therefore include RNAi molecules that contain modified nucleotides. Equivalents of the RNAi molecules according to the present invention also include RNAi molecules containing modified nucleotides called UNAs (unlocked nucleic acids): UNAs are acyclic analogs of RNA in which the bond between the C2' and C3' atoms is cleaved, resulting in reduced binding affinity to complementary strands, as described in WO2008 / 147824. UNAs are compatible with RNase H recognition and RNA cleavage, improving siRNA-mediated gene silencing.

[0073] Equivalents also include the RNAi molecules of the present invention, which contain morpholino nucleic acid analogs containing both uncharged and cationic intersubunit linkages, as described in WO2008 / 036127, and Zip Nucleic Acids (ZNAs) (WO / 2007 / 069092 and EP2075342), which contain spermine derivatives as cationic moieties (Z units) attached to oligonucleotides. Additional teachings of RNAi equivalents are provided in U.S. Patent No. 5,728,525, which describes end-labeled nucleoside analogs; U.S. Patent Nos. 5,637,683 and 6,251,666, which describe L-nucleotide substitutions; and U.S. Patent No. 5,480,980, which describes 7-deaza-2'-deoxyguanosine nucleotides and their nucleic acid analogs. The use of other nucleotide analogs is specifically contemplated for use in the context of the present invention. These include, but are not limited to, ribose modifications (such as 2'F, 2'H2, 2'N3, 4'thio, or 2'O-CH3) and phosphate modifications (such as those found in phosphorothioates, methylphosphonates, and phosphoroborates). Such analogs confer stability to RNA by reducing or eliminating their ability to be cleaved by ribonucleases. When these nucleotide analogs are present in RNAi molecules, they can have profoundly positive effects on the stability of the RNAi molecules in animals.

[0074] Equivalents also include equivalents of RNAi molecule precursors or their sources, such as codon-optimized sequences and sequences containing mutated or added nucleotides, for example, due to cloning needs.

[0075] The RNAi molecules of the present invention can be obtained from commercial RNA oligo synthesis suppliers. Alternatively, the RNAi molecules of the present invention can be expressed in cells by transfecting the cells with a vector containing an RNAi source, such as a transgene for expressing an RNAi precursor under the control of an appropriate promoter.

[0076] The term "promoter" should be understood as a nucleic acid fragment that functions to control the transcription of one or more polynucleotides, such as coding sequences, and is located 5' upstream of the polynucleotide sequence and structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription initiation site, and, including but not limited to, transcription factor binding sites, repressors, and other nucleotide sequences known in the art that act to directly or indirectly regulate the amount of transcription from the promoter. A promoter is said to be operably linked to or drive the expression of a nucleotide sequence of interest if it can initiate the transcription of the nucleotide sequence in an expression system using a genetic construct comprising the promoter operably linked to the nucleotide sequence of interest using an appropriate assay, such as RT-qPCR or Northern blotting (detection of transcripts).

[0077] Preferably, the therapeutic agent comprises at least one RNAi molecule precursor in the form of a stem-loop polynucleotide, e.g., 50-80 nucleotides, 50-70 nucleotides, or 50-65 nucleotides in length, which includes a targeting sequence. Preferably, the RNAi precursor polynucleotide comprises a targeting sequence of about 5 nucleotides, preferably about 21 nucleotides, adjacent to the targeting sequence (in the 5' to 3' direction) (corresponding to the mature RNAi molecule sequence), a loop sequence of 19-22 nucleotides, and a sense target sequence of 19-21 nucleotides, optionally containing mismatches with respect to the targeting sequence; preferably, the sense target sequence is the reverse complement of the targeting sequence, mismatched by one, two, or three nucleotides; for example, the sense target sequence in the RNAi precursor molecule may comprise nucleotides 1-8 of the reverse complement of the 21-nucleotide targeting sequence, followed by nucleotides 11-21 of the reverse complement of the 21-nucleotide targeting sequence.

[0078] Preferably, at least one gene silencer is a source of an RNAi molecule, and the source is a DNA molecule encoding the RNAi molecule or its precursor. The DNA molecule encoding the RNAi molecule or its precursor is preferably contained in a vector. The term "vector" refers to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted and introduced into cells where it can be replicated. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, lentiviruses, and plant viruses), and artificial chromosomes (e.g., YACs). Those skilled in the art can fully construct vectors through standard recombinant techniques described in Sambrook, 2003, Sambrook, 2001, and Sambrook, 1989, which are incorporated herein by reference. According to a preferred embodiment, the DNA molecule encoding the RNAi molecule or its precursor is contained in a viral vector for delivery to cells and expression of the precursor in cells.

[0079] According to a preferred embodiment of the present invention, the source of the RNAi molecule comprises or consists of an expression cassette or a vector genome comprising an expression cassette, the expression cassette comprising a nucleic acid sequence encoding the RNAi molecule or a precursor thereof, operably linked to regulatory sequences that direct the expression of the nucleic acid sequence in a subject.

[0080] In some embodiments, the source of RNAi molecule comprises the nucleic acid that comprises multiple sequences that code for RNAi molecule or its precursor.For example, the source of RNAi molecule comprises the nucleic acid molecule that comprises the first sequence that codes for RNAi molecule or its precursor and the second sequence that codes for first RNAi molecule or its precursor, and preferably the first RNAi molecule or its precursor comprises PRMT6 targeting sequence, and the second RNAi molecule or its precursor comprises LSD1 targeting sequence.

[0081] Preferably, the source of the RNAi molecule comprises or consists of at least one vector, more preferably at least one viral vector, comprising at least one nucleic acid encoding a precursor of an RNAi molecule targeting PRMT6 and / or LSD1.

[0082] Preferably, the gene silencer of the present invention is an artificial miRNA (amiR), or a precursor or source thereof, or an equivalent thereof.

[0083] amiRs contain a target-specific siRNA insert (the sequence of which includes the targeting sequence) and a scaffold based on a natural primary miRNA (pri-miRNA). The target-specific siRNA insert serves as a guide for searching for complementary sequences in the transcript, while the pri-miRNA scaffold ensures proper processing and transport. The kinetics of siRNA maturation and siRNA levels in cells resemble those of endogenous miRNAs; therefore, amiRs are safer than other RNAi molecules. For example, amiRs delivered by viral vectors and expressed under a polymerase II (Pol II) promoter provide long-lasting silencing. Preferably, expression in selected tissues is achieved by expressing amiRs under a tissue-specific promoter.

[0084] A particular advantage of amiRs is that they can be expressed at lower levels than shRNAs that use RNApol II promoters, allowing for high expression in target cells while ensuring efficient processing and sparing neuronal damage. Furthermore, amiRs target specific proteins within the same family, providing high specificity with respect to small molecule inhibitors.

[0085] An amiR according to the present invention is typically a single-stranded molecule, whereas an amiR precursor is typically in the form of an at least partially self-complementary molecule that can form a double-stranded portion (e.g., a stem and loop structure). Typically, the targeting sequence in an amiR is at least 12 to 28 nucleotides, 20 to 26 nucleotides, about 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. Preferably, the targeting sequence of the RNAi molecule is 21 bp in length, although other lengths are possible.

[0086] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one gene silencer that is an amiR targeting PRMT6, or a precursor or source thereof, or an equivalent thereof, and preferably targets any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Preferably, the amiR comprises or consists of a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Most preferably, the amiR comprises or consists of a sequence of SEQ ID NOS: 171-173, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one LSD1 inhibitor, and preferably, the inhibitor is a gene silencer or a small molecule, more preferably a gene silencer.

[0087] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one gene silencer that is an amiR targeting LSD1, or a precursor or source thereof, or an equivalent thereof, and preferably targets any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcription product thereof. Preferably, the amiR comprises or consists of a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcription product thereof. Most preferably, the amiR comprises or consists of a sequence of SEQ ID NOS: 174-176, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one PRMT6 inhibitor, and preferably, the inhibitor is a gene silencer or a small molecule, more preferably a gene silencer.

[0088] According to a particularly preferred embodiment, the gene silencer of the present invention is an amiR source or its equivalent, comprising a nucleic acid molecule encoding the amiR of interest or its precursor, flanked by nucleic acid structural regions (such as hairpin loops) derived from natural miR precursors. Thus, the gene silencer of the present invention is preferably an amiR precursor or its equivalent, comprising the nucleic acid of the amiR of interest flanked by nucleic acid structural regions (such as hairpin loops) derived from natural miR precursors. The structural regions flanking the amiR of interest can be derived from the miR-155 precursor, for example, as described in US20040053876. Those skilled in the art will understand that the present invention is also directed to amiR precursors or sources with stem-loop structures derived from miRNAs other than miR-155, and will know how to design such amiR precursors or sources. For example, the stem-loop structure can be derived from the miR-30 precursor or source, or from others.

[0089] According to a preferred embodiment, the therapeutic agent comprises at least one gene silencer that is a precursor or source of an amiR that targets PRMT6, or an equivalent thereof, more preferably targeting any one of SEQ ID NOS: 3-53, most preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Preferably, the amiR precursor or source thereof, or an equivalent thereof, comprises or consists of a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcription product thereof. Preferably, the amiR precursor or source thereof comprises a sequence of SEQ ID NOS: 171-173, or an equivalent thereof, more preferably comprises or consists of a sequence of SEQ ID NOS: 177-179, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one LSD1 inhibitor, preferably, the inhibitor is a gene silencer or a small molecule, more preferably a gene silencer.

[0090] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one gene silencer that is a precursor or source of an amiR that targets LSD1, or an equivalent thereof. Preferably, the gene silencer is a precursor of an amiR that targets any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcript thereof, or an equivalent thereof. Preferably, the amiR precursor or source thereof, or an equivalent thereof, comprises a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcript thereof. Preferably, the amiR precursor or source thereof comprises a sequence of SEQ ID NOS: 174-176, or an equivalent thereof, more preferably comprising or consisting of a sequence of SEQ ID NOS: 180-182, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one PRMT6 inhibitor, preferably a gene silencer.

[0091] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one gene silencer that is a source of an amiR or its precursor targeting PRMT6, or an equivalent thereof. Preferably, the gene silencer is a source of an amiR or its precursor targeting any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcript thereof, or an equivalent thereof. Preferably, the amiR source or its equivalent comprises a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 3-53, more preferably any one of SEQ ID NOS: 18, 21, or 29, or a transcript thereof. Preferably, the amiR source comprises or consists of a sequence set forth in SEQ ID NOS: 183-185, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one LSD1 inhibitor, preferably a gene silencer or a small molecule, more preferably a gene silencer.

[0092] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one gene silencer that is a source of an amiR or its precursor targeting LSD1, or an equivalent thereof. Preferably, the gene silencer is a source of an amiR or its precursor targeting any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcript thereof, or an equivalent thereof. Preferably, the amiR source or its equivalent comprises a polynucleotide having a sequence completely complementary to any one of SEQ ID NOS: 54-138, more preferably any one of SEQ ID NOS: 68, 72, or 90, or a transcript thereof. Preferably, the amiR source comprises or consists of a sequence of SEQ ID NOS: 186-188, or an equivalent thereof. Optionally, the therapeutic agent further comprises at least one PRMT6 inhibitor, preferably a gene silencer.

[0093] RNAi molecules, their precursors or sources, and equivalents thereof may be produced by any technique known to those of skill in the art, such as, for example, chemical synthesis, enzymatic production, or biological production (including methods involving recombinant DNA technology).

[0094] RNAi molecules or their precursors are typically produced by chemical synthesis.

[0095] Preferably, RNAi molecule is delivered to cell as precursor or source of RNAi molecule.RNAi source is preferably produced by recombinant method for producing nucleic acid in cell, which is well known to those skilled in the art.These include the use of vector, plasmid, cosmid and other vehicle for delivering nucleic acid to cell, and cell can be target cell or simply host cell (for producing desired RNAi molecule in large quantities).

[0096] According to a preferred embodiment, the therapeutic agent may comprise at least one gene silencer that is a genome editing agent.

[0097] A "genome editing agent" is an agent that contains an engineered nuclease that can mediate targeted gene disruption. Such nucleases can be delivered to target cells using vectors, such as viral or non-viral vectors.

[0098] Examples of nucleases suitable for genome editing include zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas system (Gaj, T. et al. (2013) Trends Biotechnol.31:397-405).Meganuclease (Silve, G. et al. (2011) Cur.Gene Ther.11:11-27) can also be used as suitable nucleases for gene editing.

[0099] The term "CRISPR / Cas system" collectively refers to the transcripts and other elements involved in directing the expression or activity of CRISPR-associated ("Cas") genes, including sequences encoding the Cas genes and guide RNAs, where the guide RNAs (gRNAs or sgRNAs) can be selected to enable the Cas domain to be targeted to a specific sequence (van der Oost et al. (2014) Nat. Rev. Microbiol. 12:479-92). Methods for designing gRNAs are known in the art. Additionally, fully orthogonal Cas9 proteins, as well as modifications of the Cas9 / gRNA ribonucleoprotein complex and gRNA structure / composition that bind to different proteins, have recently been developed to simultaneously and directionally target different effector domains to desired genomic sites in cells (Esvelt et al. (2013) Nat. Methods 10: 1116-21), and are suitable for use in the present invention.

[0100] According to a preferred embodiment of the present invention, the therapeutic agent comprises or consists of at least one genome editing agent comprising at least one nuclease targeting PRMT6 and / or at least one nuclease targeting LSD1; more preferably, the at least one genome editing agent is a CRISPR / Cas system comprising at least one non-coding RNA molecule (guide RNA) comprising a guide sequence that binds sequence-specifically to the PRMT6 and / or LSD1 gene, and a Cas protein (e.g., Cas9 or an analogue thereof) having nuclease function.

[0101] According to particularly preferred embodiments, the therapeutic agent comprises or consists of at least one CRISPR / Cas system comprising at least one gRNA comprising a guide sequence complementary to a target sequence in the PRMT6 gene and / or at least one gRNA comprising a guide sequence complementary to a target sequence in the LSD1 gene; the CRISPR / Cas system further comprises a nucleic acid encoding a site-directed Cas nuclease, preferably a Cas9 nuclease or a variant thereof.

[0102] According to the most preferred embodiment, the therapeutic agent comprises or consists of at least one CRISPR / Cas system comprising at least one gRNA and at least one nucleic acid encoding a site-directed Cas nuclease, wherein said at least one gRNA comprises a guide sequence complementary to a target sequence in the PRMT6 gene, said guide sequence being selected from the group consisting of SEQ ID NOs: 236-334, and / or said at least one gRNA comprises a guide sequence complementary to a target sequence in the LSD1 gene, said guide sequence being selected from the group consisting of SEQ ID NOs: 335-431.

[0103] Preferred guide sequences for gRNAs suitable for use in accordance with the present invention are provided in Table 1 below; the PAM sequence that is cleaved in the target gene is also provided for each gRNA. Table 1 [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6]

[0104] According to a preferred embodiment, the therapeutic agent comprises at least one gene silencer that is an antisense oligonucleotide (ASO) targeting PRMT6 and / or at least one gene silencer that is an ASO targeting LSD1.

[0105] Antisense oligonucleotides useful according to the present invention can be RNA or DNA oligonucleotides.

[0106] Preferably, the ASOs disclosed herein are synthetically or recombinantly produced.

[0107] Preferably, the ASO is 10 to 22 nucleotides in length, more preferably 12 to 20, and most preferably 14 to 18 nucleotides in length.

[0108] Preferably, the ASOs disclosed herein are about 15, 16, 17, 18, 19 or 20 nucleotides in length.

[0109] Preferably, the ASOs disclosed herein comprise at least one nucleoside analog, such as a locked nucleic acid (LNA) monomer.

[0110] Preferably, the ASOs disclosed herein contain at least one modified internucleoside bond. The modified internucleoside bond can be a peptide nucleic acid bond, a morpholino bond, an N3'-P5' phosphoramidate bond, a methylphosphonate bond, or a phosphorothioate bond. More preferably, the ASOs disclosed herein contain at least one modified internucleoside bond that is a phosphorothioate bond.

[0111] Preferably, the ASO described herein comprises a gapmer oligonucleotide consisting of 10 to 22 linked nucleosides, preferably 12 to 20 nucleosides, and more preferably 15, 16, 17, 18, or 19 or 20 nucleosides. The gapmer oligonucleotide has a 5' wing region located at the 5' end of the deoxynucleotide gap and a 3' wing region located at the 3' end of the deoxynucleotide gap, wherein at least one nucleoside in at least one wing region is LNA, more preferably 2 to 4 nucleosides, and most preferably 3 nucleosides are LNA.

[0112] According to a preferred embodiment, the therapeutic agent comprises at least one gene silencer that targets PRMT6, which is an ASO, and more preferably, said ASO targets the sequence of SEQ ID NO: 432 or 433 of PRMT6.

[0113] Preferably, the ASO targeting PRMT6 has a sequence comprising or consisting of SEQ ID NO: 440 or 441, or an equivalent thereof. Preferably, the ASO targeting PRMT6 is an ASO having the sequence of SEQ ID NO: 436 or 437. According to a preferred embodiment, the therapeutic agent comprises at least one gene silencer that targets LSD1, which is an ASO, more preferably said ASO targets the sequence of SEQ ID NO: 434 or 435 of LSD1.

[0114] Preferably, the ASO targeting LSD1 has a sequence comprising or consisting of SEQ ID NO: 442 or 443, or an equivalent thereof. Preferably, the ASO targeting PRMT6 is an ASO having the sequence of SEQ ID NO: 438 or 439.

[0115] Preferred ASOs and their targets are shown in the table below, where + indicates LNA and s indicates a phosphorothioate (PS) backbone.

[0116] [Table 7]

[0117] According to a preferred embodiment, the present invention relates to a therapeutic agent comprising at least one PRMT6 inhibitor and at least one LSD1 inhibitor; more preferably, said at least one PRMT6 inhibitor and / or said at least one LSD1 inhibitor is a gene silencer targeting PRMT6 and / or LSD1.

[0118] Preferably, the therapeutic agent comprising at least one gene silencer targeting LSD1, and optionally further comprising at least one PRMT6 inhibitor, is for use in the treatment of SBMA or cancer, more preferably SBMA.

[0119] Preferably, the therapeutic agent comprising at least one gene silencer targeting PRMT6, and optionally further comprising at least one LSD1 inhibitor, is for use in the treatment of cancer or SBMA, more preferably prostate cancer.

[0120] Preferably, the therapeutic agent comprises at least two gene silencers, more preferably at least two RNAi molecules or at least two gene editing agents, at least one targeting PRMT6 and at least one targeting LSD1.

[0121] More preferably, the therapeutic agent of the present invention comprises at least one gene silencer targeting LSD1 and at least one PRMT6 inhibitor, and said therapeutic agent is for use in the treatment of SBMA or cancer, most preferably SBMA.

[0122] Optionally, the therapeutic agent of the present invention comprises at least one gene silencer targeting LSD1, at least one PRMT6 gene silencer, and at least one small molecule inhibitor of LSD1 and / or PRMT6, preferably, the therapeutic agent is for use in the treatment of SBMA or cancer, more preferably SBMA.

[0123] More preferably, the therapeutic agent of the present invention comprises at least one gene silencer targeting PRMT6 and at least one LSD1 inhibitor, and said therapeutic agent is for use in the treatment of SBMA or cancer, more preferably cancer.

[0124] Optionally, the therapeutic agent of the present invention comprises at least one gene silencer targeting LSD1, at least one PRMT6 gene silencer, and at least one small molecule inhibitor of LSD1 and / or PRMT6, preferably, the therapeutic agent is for use in the treatment of SBMA or cancer, more preferably cancer.

[0125] According to a preferred embodiment of the present invention, the therapeutic agent of the present invention comprises at least one gene silencer of AR activation cofactor, and further comprises a delivery vehicle for delivering the gene silencer to cells.Preferably, the delivery vehicle is selected from a viral vector, microsphere, liposome, nanoparticle, microparticle, colloidal gold particle, lipopolysaccharide, polypeptide, polysaccharide, collagen, PEGylated viral vehicle, graphene complex, cholesterol conjugate, cyclodextran complex, or polyethyleneimine polymer.Preferably, the delivery vehicle is a viral vector, and more preferably, is selected from an adeno-associated viral vector, a lentiviral vector, an adenoviral vector, a retroviral vector, an alphavirus vector, a vaccinia viral vector, a herpes simplex virus (HSV) vector, a rabies virus vector, and a Sindbis viral vector.

[0126] According to a preferred embodiment, the therapeutic agent comprises at least one source of RNAi molecule and a delivery vehicle comprising the source of RNAi molecule; more preferably, the delivery vehicle is a viral vector, most preferably a recombinant adeno-associated viral vector ("recombinant AAV").

[0127] Recombinant AAV is a viral particle that contains two elements: an AAV capsid and a vector genome that contains non-AAV coding sequences packaged within the AAV capsid. rAAV lacks a functional AAV rep gene or a functional AAV cap gene and cannot produce progeny, so it is a "replication-deficient virus" or "viral vector." In certain embodiments, the AAV sequence is only an AAV inverted terminal repeat (ITR), typically located at the extreme 5' and 3' ends of the vector genome, allowing the genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.

[0128] Unless otherwise specified, the AAV capsids, ITRs, and other selected AAV components described herein can be readily selected from any AAV, including, but not limited to, the AAVs identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAVhu37, AAVrh32.33, AAV8bp, AAV7M8, and AAVAnc80, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9.47, AAV9(hu14), AAV 10, AAV 11, AAV 12, AAVrh8, AAVrh74, AAV-DJ8, AAV-DJ, AAVhu68; most preferably, the viral vector is an AAV9 recombinant viral vector.

[0129] Advantageously, multiple sources of gene silencers can be cloned into the same vector, allowing the same amount of virus to be used to target two genes.

[0130] The production of viral particles for delivering gene silencers according to the present invention can be carried out by techniques known in the art (see, for example, WO 2003 / 042397; WO 2005 / 033321; WO 2006 / 110689; US 7588772 B2).

[0131] Preferably, the vector for delivering the gene silencer to cells is a non-viral plasmid containing an expression cassette for expressing the gene silencer. Optionally, the plasmid or other nucleic acid sequence is delivered via a suitable device, such as electrospray or electroporation. In other embodiments, the gene silencer is combined with various compositions and nanoparticles, including, for example, gold or silica nanoparticles, lipids, polymers, micelles, liposomes, exosomes, cationic lipid-nucleic acid compositions (lipoplexes), polyglycan compositions and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, and others. Most preferred for delivering the gene silencer to cells is the method described by Nicoletti et al. 2022. 5 and the biocompatible lipoplexes described in

[0132] Preferably, RNAi molecules or their precursors, or their equivalents, are encapsulated in nanoparticles, more preferably lipid nanoparticles (LNPs).As used herein, the term "lipid nanoparticles" refers to a delivery vehicle that comprises one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids).Examples of suitable lipids include, for example, phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides).Also contemplated is the use of polymers as delivery vehicles, either alone or in combination with other delivery vehicles.Suitable polymers can include, for example, polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, dendrimer, and polyethyleneimine.

[0133] Useful lipid nanoparticles for RNA contain cationic lipids that encapsulate and / or enhance delivery of RNAi molecules or their precursors to target cells. As used herein, the term "cationic lipid" refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH. Contemplated lipid nanoparticles can be prepared by incorporating multi-component lipid mixtures in various ratios using one or more cationic lipids, non-cationic lipids, and PEG-modified lipids. Several cationic lipids have been described in the literature, and many are commercially available. LNP formulations can be carried out using routine procedures that include cholesterol, ionizable lipids, helper lipids, PEG-lipids, and polymers to form a lipid bilayer around the encapsulated mRNA. Preferably, the LNP comprises a cationic lipid (i.e., N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) or 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP)) and a helper lipid DOPE, or an ionizable lipid Dlin-MC3-DMA, or a diketopiperazine-based ionizable lipid (cKK-E12). Preferably, the polymer comprises polyethyleneimine (PEI) or a poly(-amino)ester (PBAE).

[0134] According to a preferred embodiment of the present invention, the therapeutic agent comprises at least one small molecule inhibitor of PRMT6 and / or LSD1; more preferably, the therapeutic agent comprises at least one LSD1 small molecule inhibitor that is a monoamine oxidase inhibitor (MAOI), most preferably phenelzine, tranylcypromine, or a mixture thereof. Optionally, the therapeutic agent of the present invention comprises a small molecule inhibitor together with a gene silencer inhibitor. Preferably, both the gene silencer and the small molecule inhibitor inhibit PRMT6, or both the gene silencer and the small molecule inhibitor inhibit LSD1; more preferably, the therapeutic agent comprises at least one LSD1 small molecule inhibitor and at least one PRMT6 gene silencer and / or at least one LSD1 gene silencer.

[0135] The therapeutic agents of the present invention may be administered to a subject alone or in the form of a pharmaceutical formulation containing one or more physiologically acceptable carriers, diluents, or excipients.

[0136] The term "pharmaceutically (or "physiologically") acceptable diluent or excipient" refers to any conventional non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation auxiliary that does not cause significant adverse toxicological effects in the patient and may optionally be included in the compositions of the present invention. Pharmaceutically acceptable excipients are essentially non-toxic to recipients at the dosages and concentrations employed and are compatible with the other ingredients of the formulation. The number and nature of pharmaceutically acceptable excipients depend on the desired form of administration. Pharmaceutically acceptable excipients are known and can be prepared by methods well known in the art.

[0137] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, such materials and combinations thereof known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference).

[0138] Appropriate formulation depends on the inhibitor to be administered and the route of administration.For example, when therapeutic agent comprises both small molecule inhibitor and gene silencer, each of them is administered to the subject who needs it in different formulations.For example, small molecule inhibitor can be administered as solid formulation.On the other hand, gene silencer can be administered as liquid formulation that contains suitable vehicle for delivering gene silencer.

[0139] Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration.

[0140] For injection, the therapeutic agent or pharmaceutical preparation of the present invention can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer. The solutions may contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.

[0141] Alternatively, the therapeutic agent or pharmaceutical preparation may be in solid form, or in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0142] For oral administration, for example, for administering therapeutic agents including small molecule inhibitors, therapeutic agents or pharmaceutical preparations can be easily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers allow the nucleic acids of the present invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc. for oral ingestion by the patient to be treated. For oral solid preparations such as powders, capsules, and tablets, suitable excipients include sugars such as lactose, sucrose, mannitol, and sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP); granulating agents; and fillers such as binders. If desired, disintegrating agents such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or its salts, such as sodium alginate, can be added. If desired, solid dosage forms can be sugar-coated or enteric-coated using standard techniques.For example, for oral liquid preparations such as suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols and the like.In addition, flavoring agents, preservatives, scavengers and the like can be added.For oral administration, therapeutic or pharmaceutical preparations can be in the form of tablets, lozenges and the like, which are formulated in a conventional manner.

[0143] For administration by inhalation, the therapeutic agent or pharmaceutical preparation for use according to the present invention can be conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer by using a suitable propellant.In addition to the above-mentioned formulations, the therapeutic agent or pharmaceutical preparation for use according to the present invention can also be formulated as a depot preparation.Such long-acting preparations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.

[0144] Therapeutic agents or pharmaceutical formulations according to the invention may be administered intravenously, intradermally, intra-arterially, intraperitoneally, intralesionally, intracranially, intra-articularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, subcutaneously, subconjunctivally, intravesically, mucosally, intrapericardially, intraumbilically, intraocularly, by inhalation (e.g., aerosol inhalation), by injection, infusion, continuous infusion, via catheter, via lavage, in a lipid composition (e.g., liposomes), or by any combination thereof, or by any other method known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).

[0145] Preferably, for administration to a human subject in need thereof, the therapeutic agent, including a vector for delivering a gene silencer, is suitably suspended in an aqueous solution containing physiological saline, a surfactant, and a physiologically compatible salt or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. Because the pH of cerebrospinal fluid is approximately 7.28 to approximately 7.32, or pH 7.2 to 7.4, a pH within this range may be desirable for intrathecal delivery; whereas, for intravenous delivery, a pH of approximately 6.8 to approximately 7.2 may be desirable. However, other pH values ​​within the broadest range and subranges may be selected for other delivery routes.

[0146] Preferably, the formulation may contain one or more penetration enhancers. Examples of suitable penetration enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.

[0147] Preferably, in addition to the vector (e.g., rAAV) and carrier, the formulation may include other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers.

[0148] Therapeutic agents, including vectors for delivering gene silencers, are administered in amounts sufficient to provide cells with sufficient levels of gene silencers to provide therapeutic benefit without undue adverse effects or with a medically acceptable physiological effect, which can be determined by those skilled in the medical arts. The dosage of vectors administered to deliver PRMT6 and / or LSD1 inhibitors according to the present invention depends primarily on factors such as the condition being treated, the patient's age, weight, and health, and therefore may vary between patients. For example, the therapeutically effective human dosage of a viral vector is generally about 1x10 (to treat an average subject weighing 70 kg). 9 ~1x10 16 The volume of the solution containing the genomic viral vector is within the range of about 25 to about 1000 microliters to about 100 mL, including all integers and decimals within the range.

[0149] The physician responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

[0150] The term "unit dosage form" or "unit dose" as used herein refers to a physically discrete unit suitable as a unitary administration for human and animal subjects, each unit containing a predetermined quantity of a compound, composition, or formulation to be administered, calculated in an amount sufficient to produce the desired effect, in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for unit dosage forms for use in the present invention depend on the particular compound used and the effect to be achieved, the pharmacodynamics associated with each compound in the host, and the like.

[0151] Preferably, a unit dose of a pharmaceutical formulation for administering a therapeutic agent may contain, for example, at least about 0.1% by weight, 1-90% by weight, 2-75% by weight, 25-60% by weight, and any range derivable therein, of the therapeutic agent based on the weight of the unit dose. In other non-limiting examples, the unit dose per administration can also include from less than 1 μg / kg / body weight, or 1 μg / kg / body weight, 5 μg / kg / body weight, to 10 μg / kg / body weight, 50 μg / kg / body weight, 100 μg / kg / body weight, 200 μg / kg / body weight, 350 μg / kg / body weight, 500 μg / kg / body weight, 1 mg / kg / body weight, 5 mg / kg / body weight, 10 mg / kg / body weight, 50 mg / kg / body weight, 100 mg / kg / body weight, 200 mg / kg / body weight, 350 mg / kg / body weight, or 500 mg / kg / body weight, or 1000 mg or more / kg / body weight, and any range derivable therein. Non-limiting examples of ranges that can be derived from the numbers set forth herein include ranges such as 5 mg / kg / body weight to 100 mg / kg / body weight, 5 μg / kg / body weight to 500 mg / kg / body weight, etc., based on the numerical values ​​set forth above.

[0152] Preferably, the pharmaceutical formulation comprising at least one small molecule inhibitor according to the present invention is administered in a daily dose of 1 to 100 mg, preferably in a daily dose of 5 to 100 mg, 10 to 100 mg, or 15 to 100 mg.

[0153] For example, a pharmaceutical formulation containing an MAOI can be administered at a dose of 15-30 mg, from once a day to three times a day, preferably with the dosage increasing over time.

[0154] As a further example, pharmaceutical formulations comprising the ASO described herein, in oral dosage forms (e.g., tablets or capsules), contain ASO in amounts ranging from about 1 mg to about 100 mg, about 5 mg to about 100 mg, about 10 mg to about 100 mg, about 20 mg to about 100 mg, or between about 20 mg and about 50 mg.

[0155] Optionally, when the therapeutic agent comprises a combination of an LSD1 inhibitor and a PRMT6 inhibitor, each inhibitor can be administered separately.Therefore, the therapeutically effective level of the therapeutic agent can be achieved by administering it multiple times a day.The amount of the therapeutic agent to be administered will naturally depend on the subject being treated, the subject's weight, the severity of the pain, the method of administration and the prescribing physician's judgment.

[0156] Preferably, the therapeutically effective dose of the molecules described herein provides therapeutic benefit without causing substantial toxicity. The toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the maximum tolerated dose (Ann.Pharm,Fr,2010,291-300). The dose ratio between toxicity and therapeutic effect is the therapeutic index.

[0157] The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is non-toxic for use in humans.

[0158] It is to be understood that all possible combinations of preferred aspects of the invention are described and therefore equally preferred.

[0159] Examples of preferred embodiments of the present invention and an analysis of their effectiveness are provided below for illustrative and non-limiting purposes.

[0160] In particular, as shown in the following examples, the therapeutic agent of the present invention can normalize the expression of AR activation cofactor in vivo.This is particularly important for LSD1, whose genetic deletion is lethal, but also important in general, because the inhibited AR activation cofactor can maintain its physiological function in treated subjects.Advantageously, the amiR that targets AR activation cofactor exerts therapeutic effect in prostate cancer and SBMA models.

[0161] Furthermore, we provide evidence that targeting overexpressed AR regulatory cofactors that enhance the toxic GOF of mutant AR also alters the expression of genes dysregulated in SBMA muscle and involved in pathways important for muscle physiology and homeostasis. These pathways include muscle contraction and myofibril assembly, glycolysis, and metabolism. Although the number of restored genes is limited relative to the total number of dysregulated genes in SBMA muscle, this effect is associated with phenotypic improvement in a severe SBMA mouse model. Furthermore, although amiR is delivered systemically, downregulation of LSD1 and PRMT6 was only significant in skeletal muscle. This is consistent with the idea that polyQ expansions in the AR induce the transcription of these regulatory cofactors, which in turn enhance AR function, and that measures to inhibit or attenuate this feedforward mechanism will have an effect in skeletal muscle. The fact that targeted gene silencing was not significant in other tissues is consistent with the idea that this pathological mechanism occurs specifically in skeletal muscle. <Example> Materials and Methods Animals and Treatments

[0162] The animal husbandry protocol complied with the appropriate national legislation (Art. 31, D.lgs.26 / 2014) and the European Community Council Guidelines (2010 / 63 / UE) and was approved by the local ethical committees (University of Trento and University of Padua, Italy) and the Italian Ministry of Health. AR100Q transgenic and AR113Q knock-in mice were genotyped. Mice were surgically castrated. Mice received intraperitoneal injections of saline or amiR-Prmt6 / Lsd1 AAV at 21 days of age and were assessed weekly for 4–14 weeks. Mice were euthanized if their body weight decreased by more than 20% relative to their highest weight reading. For the rotarod and hanging wire tasks, mice were randomized, and both genotype and AAV injection were blinded to the operator. Animals were trained to run for up to 300 s on an accelerating rotarod (4–40 rpm) (Panlab, Harvard apparatus, LE8205). The latency to fall was recorded, and the best performance of three trials was reported. In the hanging wire test, mice were placed on the lid of a wire cage and gently shaken three times to allow the mouse to grasp the wire, after which the lid was inverted. The latency to fall was recorded for up to 60 seconds. In survival analyses, mice were considered moribund when they lost 20% of their body weight or exhibited immobility, dehydration, and cachexia.

[0163] All Drosophila strains were reared on standard cornmeal medium and fed with 2 mM DHT in a light- and dark-controlled incubator at 28 °C. The Lsd1 and Dart8 strains were obtained from the Vienna Drosophila Resource Center (VDRC, stock IDs for DART8: v100228 and dLsd1: v106147). The AR52Q strain was previously described. 2 Eye images were taken with a Leica M205C dissecting microscope equipped with a Leica DFC450 camera. Ocular degeneration was quantified as previously described. 2 . <Human sample>

[0164] De-anonymized control (n = 5) and patient biopsy samples (n = 5) were obtained from the Neuromuscular Tissue and DNA Sample Bank, the Telethon Gene Biobank Network, and the Eurobiobank Network (Table 2). All muscle biopsies were collected for diagnostic purposes after obtaining written informed consent from each patient in accordance with the Declaration of Helsinki. All patients who underwent muscle biopsy were clinically affected and exhibited weakness and / or fasciculations and / or muscle atrophy. Muscle pathological changes and neurogenic atrophy were observed in the muscle biopsies. Control samples were obtained from subjects free of any neurological or neurodegenerative disease. SBMA lumbar spinal cord tissue was a gift from Dr. Lyle Ostrow (Johns Hopkins University ALS Postmortem Tissue Core).

[0165] Table 2. SBMA patient clinical information [Table 8]

[0166] <Vector> Transgenes expressing shRNAs against PRMT6 (shPRMT6 #1, SEQ ID NO: 232 and shPRMT6 #2, SEQ ID NO: 233) and the corresponding non-specific controls were cloned into a lentiviral construct (pLKO.1-puro).

[0167] Guide RNAs were cloned into lentiCRISPR v1 (Addgene Plasmid 49535).

[0168] HEK293T cells were transfected with the lentiviral vectors, along with the pCMV-dR8.91 (Delta 8.9) plasmid (containing the gag, pol, and rev genes) and the VSV-G envelope plasmid, using the calcium phosphate method. Sixteen hours after transfection, the medium was replaced with fresh medium. 24 hours later, the cells were harvested and centrifuged at 1000 x g for 10 minutes (to precipitate and remove cellular debris). The cells were then filtered through a 0.45 μM pore size and stored in aliquots at -80°C. To quantify the virus, 10 μL of virus particles were added with an equal volume of 2x lysis buffer [0.25% Triton X-100, 50 mM KCl, 100 mM Tris-HCl pH 7.4, 40% glycerol, and 0.8 U / μL RNase inhibitor (RiboLock, Fermentas)] and lysed at room temperature for 10 minutes.

[0169] Lysates were added to a one-step RT-PCR assay using 3.5 nM MS2 RNA (Roche) as template, 500 nM of each primer, and HotStart Taq (Truestart Hotstart Taq, Fermentas). All were diluted in 20 mM Tris-Cl pH 8.3, 5 mM (NH4)2SO4, 20 mM KCl, 5 mM MgCl2, 0.1 mg / ml BSA, 1 / 20,000 SYBR Green I (Invitrogen, #S7563), and 200 μM dNTPs. SG-PERT reverse transcription assays were performed according to the following program: reverse transcription at 42°C for 20 minutes, enzyme activation at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 15 seconds, and data acquisition at 80°C for 5 seconds. A standard curve was constructed using known concentrations of high titer viral supernatant (kindly provided by Dr. Massimo Pizzato, University of Trento, Italy).

[0170] The lentiviruses were tested in vitro by transducing a motor neuron cell line, and the most efficient knockdown was observed with shPRMT6#1 (SEQ ID NO: 232). Mutagenesis of the LSD1-LXXAA mutant was performed by Vector Builder (https: / / en.vectorbuilder.com / ). Cell culture, transfection, and transduction

[0171] MN1 9 Cells and HEK293T cells (ATCC) were cultured and plated in complete DMEM medium (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin (Pen / Strep), and 1% L-glutamine), and LNCaP cells were cultured in complete RPMI medium (Gibco Roswell Park Memorial Institute medium supplemented with 10% FBS, 1% penicillin / streptomycin, and 1% L-glutamine).

[0172] C2C12 cells were cultured and differentiated into myotubes. Cells were maintained at 37°C in a humidified incubator with 5% CO2. HEK293T cells were transfected with 25,000 Da linear polyethyleneimine (PEI) (Sigma-Aldrich) at a DNA:PEI (0.5% v / v) ratio of 1:1, depending on well dimensions. 24 hours after transfection, complete DMEM medium supplemented with 10% FBS was replaced with DMEM supplemented with charcoal-stripped FBS. Cells were treated with vehicle (ethanol) or 10 nM DHT and harvested for various analyses 24 hours after treatment.

[0173] For pharmacological inhibition, cells were treated with the LSD1 catalytic inhibitor tranylcypromine (TCP) and the PRMT inhibitor adenosine dialdehyde (AdOx), both at a final concentration of 10 μM. The selective LSD1 inhibitor SP-2509 was used at a final concentration of 100 nM. MN-1 cells were transfected using Lipofectamine 2000 according to the manufacturer's instructions (ThermoFisher Scientific). MN1 and LNCaP cells were transiently transduced with lentivirus (MOI 30) or transfected with 2 μg of DNA using Lipofectamine 2000 CD Transfection Reagent (ThermoFisher Scientific, 12566014).

[0174] The next day, positively transfected cells were selected with 10 μg / μL blasticidin (PanReacApplichem, A3784,0025). After 24 hours of selection, or 48 hours after transduction, cells were induced with 10 nM dihydrotestosterone (DHT) in DMEM or RPMI medium supplemented with 10% charcoal-stripped FBS, 1% pen / strep, and 1% L-glutamine.

[0175] SBMA iPSCs were established and differentiated. iPSCs were maintained in E8 Flex medium (Thermo Fisher Scientific, A2858501) on tissue culture dishes coated with Matrigel (Corning, 354277). The medium was changed every 2 days, and iPSCs were passaged every 4–6 days using Accutase (StemCell Technology, 07922).

[0176] On the day of passaging, 10 μM ROCK inhibitor (Tocris, 1254) was added to the culture medium. For differentiation, stably transfected iPSCs were induced in neural induction medium (NIM) containing 2 μg / mL doxycycline and 10 nM R1881. Forty-eight hours after doxycycline treatment, motor neurons were dissociated into single cells with Accutase and replated on PDL / laminin-coated surfaces in neural differentiation medium (NDM) containing 2 μg / mL doxycycline and 10 nM R1881. On day 4, half of the cell culture medium was removed and replaced with neuronal medium (NM) containing 10 nM R1881. <Immunocytochemistry>

[0177] Immunofluorescence analysis was performed on MN1 cells. For iPSC-derived MNs, day 6 iMNs were washed with DPBS and fixed with 4% paraformaldehyde for 10 min at room temperature, then washed again with DPBS before antibody labeling. Cells were first permeabilized with 0.1% Triton X-100 and 0.01% Tween-20 for 10 min at room temperature, followed by blocking with 10% BSA in 0.1% Triton X-100 and 0.1% Tween (PBST) for 1 h at room temperature. Samples were then incubated overnight at 4°C with primary antibodies (anti-PRMT6 (Santa Cruz), anti-LSD1 (Abcam), anti-HB9 (DSHB), and anti-AR (GeneTex)) diluted in 3% BSA in PBST.

[0178] After overnight incubation, samples were washed twice with DPBS and incubated with fluorescent secondary antibodies (ThermoFisher) diluted in 3% BSA in PBST for 1 hour at room temperature. Slides were mounted using ProLong Diamond Antifade Mountant (ThermoFisher) containing DAPI. For immunofluorescence analysis of autopsy spinal cord tissue, frozen sections were fixed in 4% PFA and incubated overnight at 4°C with antibodies as described above for anti-LSD1 (Abcam), anti-AR[H280] (SantaCruz), and DAPI. Digital images were acquired with a Zeiss LSM 880 confocal microscope equipped with a 40x objective. <Cell viability and proximity ligation assay (PLA)>

[0179] MN1 AR24Q and AR100Q cells were seeded in a 24-well plate at a density of 50,000 cells / well in DMEM complete medium. DHT was added to the medium 24 hours after transfection, and the MTT assay was performed the next day. Briefly, MTT was added directly to the medium at a ratio of 1:10 (50 μL / well), and the plate was left in an incubator at 37 °C and 5% CO2 for 30 - 45 minutes until a purple precipitate formed.

[0180] Next, the medium was replaced with 200 μL of dimethyl sulfoxide (DMSO) to dissolve the formazan product into a purple solution. The plate was shaken for 10 minutes to completely dissolve the precipitate. Finally, the solution was transferred to a 96-well plate, and the absorbance at 570 nM and 690 nM was quantified using a Tecan Infinite™ 200 PRO spectrophotometer. The final absorbance was obtained by subtracting the 690 nM signal from the 570 nM signal.

[0181] For PLA, cells were fixed with 4% PFA for 20 minutes, washed 3 times with 1X PBS, permeabilized with 0.1% Triton X-100 in PBS for 5 minutes, and PLA analysis [Duolink In Situ Red Starter Kit Mouse / Rabbit, Sigma (Merck), DUO92101] was performed. The following primary antibodies were incubated overnight at 4 °C: anti-KDM1 / LSD1 (Abcam, ab17721, 1:2000), anti-AR (AR 441, Santa Cruz Biotechnology, sc-7305, 1:2000), anti-PRMT6 (Bethyl, A300-929A, 1:2000), and anti-PRMT6 (Abcam, ab151191, 1:2000). Slides were imaged using a 63x oil immersion objective lens on a Zeiss Axio Observer Z1 inverted microscope, and PLA-positive red dots were quantified using ImageJ 1.51 software. <EdU staining>

[0182] LNCaP cells were seeded on poly-d-lysine-pretreated coverslips in 12-well plates at a density of 160,000 cells / well in RPMI complete medium. 24 hours after transfection, positively transfected cells were selected with 10 μg / μL blasticidin (PanReacApplichem, A3784,0025). DHT was added to the medium, and the next day, cells were first incubated with 10 μM EdU for 30 minutes to perform an EdU assay (Click-iT™ Plus EdU Alexa Fluor 594 Imaging Kits, Invitrogen, C10639).

[0183] The medium was then replaced with fresh RPMI complete medium, and after 10 min, the cells were washed with PBS prewarmed to 37°C. Cells were then fixed with 4% cold PFA for 10 min, washed twice with 3% BSA in PBS for 5 min, and permeabilized with 0.5% Triton X-100 in PBS for 20 min.

[0184] Finally, the cells were washed twice, and the Click-iT™ Plus reaction cocktail was added to each coverslip for 30 minutes at room temperature, protected from light. The cells were washed once with 3% BSA / PBS and once with PBS for 5 minutes, and Hoechst™ 33342 (Component G, 5 μg / mL) was added for 30 minutes at room temperature, protected from light. The cells were washed twice with PBS, and the coverslips were mounted on slides. The slides were imaged using a Zeiss Axio Observer Z1 inverted microscope with a 20x objective, and EdU-positive red cells were quantified using ImageJ 1.51 software. <Quantitative real-time PCR>

[0185] Total RNA was extracted using TRIzol (Thermo Fisher Scientific), and the RNA was reverse transcribed using Superscript Reverse Transcriptase III (Invitrogen, 18080093) according to the manufacturer's instructions. Gene expression was measured by RT-qPCR using SsoAdvanced Universal Sybr green supermix (1725274 Bio-Rad) and a C1000 Touch Thermal Cycler-CFX96 Real-Time System (Bio-Rad). Gene expression was normalized to actin expression levels. A complete list of primer sequences is shown in Table 3.

[0186] Table 3. RT-PCR primer list [Table 9]

[0187] <rna-seq> Samples were subjected to RNA extraction using Trizol according to the manufacturer's protocol. RNA was quantified using Nanodrop and Qubit, and quality was assessed using an Agilent 2100 Bioanalyzer. Purified RNA was used as input for cDNA library preparation using TruSeq Stranded mRNA (Illumina) according to the manufacturer's protocol. The fragment size of the cDNA library was determined using the BioAnalyzer 2100 HS DNA Assay (Agilent, Santa Clara, CA, USA). The library was sequenced as paired-end reads on a NovaSeq 6000. <Computational analysis>

[0188] RNA-seq data analysis was performed using Rosalind (https: / / rosalind.onramp.bio / ) with HyperScale architecture developed by Rosalind Inc. (San Diego, CA). Reads were trimmed using cutadapt (DOI: 10.14806 / ej.17.1.200). Quality scores were assessed using FastQC. Reads were aligned to the Mus musculus genome (mm10) using STAR (PMID: 23104886). Individual sample reads were quantified using HTseq and DEseq2. 13 DEseq2 was also used for differential expression analysis.

[0189] p-values ​​were adjusted for multiple testing using the Benjamini-Hochberg method. Differentially expressed genes between untreated (AR100Q) and treated (amiR-Lsd1 / Prmt6) SBMA mouse models and WT controls were those with absolute changes greater than fourfold and adjusted p-values ​​less than 0.01. Genes showing significant but opposite direction changes in differential expression analyses between AR100Q vs. WT and amiR-Lsd1 / Prmt6 vs. AR100Q were defined as "recovered genes." Furthermore, the subset of recovered genes that did not show significant differential expression between amiR-Lsd1 / Prmt6 and WT were referred to as "fully recovered" genes.

[0190] The difference between the recovered and fully recovered genes was the "partially recovered" genes. Functional enrichment analysis of the recovered genes was performed using Metascape 14 The following gene lists were used: GO Biological Processes, KEGG Pathways, and Reactome gene sets. All genes in the genome were used as the background for enrichment. Terms with a p-value less than 0.01, a minimum count of 3, and an enrichment factor greater than 1.5 were collected and grouped into clusters based on membership similarity. The most statistically significant term within each cluster was selected to represent the cluster. When comparing gene lists A and B using overlap coefficient measurements, the concentration of the intersection of A and B was divided by the minimum concentration of A and B. <Biochemistry>

[0191] For Western blot analysis, cells were lysed in RIPA buffer (6 mM NaHPO, 150 mM NaCl, 4 mM NaHPO, 150 mM NaCl, 2 mM EDTA pH 8.0, 1% Na-deoxycholate, 0.5% Triton X-100) supplemented with fresh protease inhibitors (Sigma, P8340). Samples were incubated on ice for 20 min and then centrifuged at 21,000 x g for 15 min at 4°C. The supernatant was collected and either stored at -80°C or further processed for Western blotting.

[0192] Frozen tissue was pulverized using a mortar and pestle on dry ice, transferred to a chilled Eppendorf tube, and resuspended in 2% SDS-RIPA buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP40, 0.5% Na-deoxycholate, 2% SDS) containing fresh protease inhibitors (Sigma, P8340). The lysate was then sonicated and centrifuged at 15,000 rpm for 15 minutes at room temperature (RT).

[0193] Protein concentrations were measured using the bicinchoninic acid (BCA) assay (Pierce™ BCA™ Protein Assay, Thermo Scientific). For Western blotting, equal amounts of protein extracts from tissue or cell lysates were boiled at 95°C for 5 minutes in 5X sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 25% glycerol, 0.05% bromophenol blue, 5% β-mercaptoethanol) and separated by SDS-PAGE. Proteins were transferred to 0.45 mm nitrocellulose membranes (Bio-Rad, 162-0115) and blocked with bovine serum albumin (BSA) / 0.1% Tween in 5% nonfat dry milk / TBS buffer for 1 hour, followed by incubation with primary antibodies for 2 hours at room temperature or overnight at 4°C. HRP-conjugated secondary antibodies were incubated for 1 h at room temperature (1:5,000 dilution in blocking solution), and signals were detected with a Chemidoc (Bio-Rad) or Alliance Mini (Uvitec).

[0194] For immunoprecipitation assays, cells were washed twice with ice-cold PBS, scraped, and then centrifuged at 1,200 x g for 3 minutes at 4°C. The pellet was dissolved in IP buffer (50 mM HEPES, 250 mM NaCl, 5 mM EDTA, 0.1% NP40) containing 1 mM PMSF and fresh protease inhibitors (Sigma, P8340). The cell pellet was homogenized using a 2.5 mL 22G x 1 1 / 4-inch and 1 mL 25G x 5 / 8-inch syringe, incubated on ice for 45 minutes, and then centrifuged at 21,000 x g for 30 minutes at 4°C. The supernatant was transferred and quantified using the Pierce™ BCA™ Protein Assay (Thermo Scientific). Protein extracts (1.5–4 mg) were incubated with primary antibodies overnight at 4°C on a rotator. The complexes were then incubated with Protein A / G Plus-Agarose (sc-2003) beads for 2 hours at 4°C on a rotator. The antigen-antibody complexes were washed three times with lysis buffer and once with wash buffer. Bound proteins were eluted with 35 μL of 2X SDS buffer and denatured at 95°C for 5 minutes before being subjected to SDS-PAGE.

[0195] For tissue immunoprecipitation assays, quadriceps muscles were lysed in IP buffer (50 mM HEPES, 250 mM NaCl, 5 mM EDTA, 0.1% NP40) with fresh protease inhibitors (Sigma, P8340), incubated on ice for 30 minutes, and then centrifuged at 21,000 x g for 45 minutes at 4°C. The supernatant was transferred and quantified using the Pierce™ BCA™ Protein Assay (Thermo Scientific). Protein extracts (2 mg) were precleared with prewashed Pierce™ Protein A Magnetic Beads (30 μL, Thermo Fisher Scientific, cat#88845) for 1 hour at 4°C.

[0196] The beads were then discarded, and the precleared lysate was incubated with 2 μg of primary antibody (PRMT6, Bethyl, A300-929A) or non-immune rabbit immunoglobulin G (IgG) overnight at 4°C on a rotator. The next day, the antigen-antibody complexes were incubated with fresh, pre-washed Pierce™ Protein A Magnetic Beads (20 μL, Thermo Fisher Scientific, cat#88845) for 2 hours at 4°C on a rotator. The antigen-antibody complexes were washed four times with lysis buffer. Bound proteins were eluted with 30 μL of NuPAGE™ LDS Sample Buffer (4X) and 0.1 M DTT and heated at 70°C for 5 minutes before loading onto a 10% SDS-PAGE gel.

[0197] The following antibodies were used for various analyses: anti-KDM1 / LSD1 (Abcam, ab17721, 1:1000), anti-PRMT6 (Proteintech, 15395-1-AP, 1:1000), anti-PRMT6 (Bethyl, A300-929A, 1:2000), anti-AR (for immunoprecipitation: 441, Santa Cruz, sc-7305), anti-AR (for immunoblotting: H-280, Santa Cruz, sc-13062, 1:1000), anti-FLAG (Sigma, 7425), anti-GFP (Roche, 11814460001, 1:1000), anti-calnexin (Enzo, ADI-SPA-860, 1:2500), anti-tubulin (Sigma, T7816, 1:10000). Quantification was performed using ImageJ 1.51 software.

[0198] Nicotinamide adenine dinucleotide (NADH) staining and analysis were performed as previously described.

[0199] ChIP assays were performed using 6x10 cells expressing AR24Q or AR100Q. 7 The experiment was performed using C2C12 myoblasts. AR was immunoprecipitated using an anti-AR antibody (Millipore #06-680, 14 μg) (the primer list is shown in Table 4).

[0200] Table 4. ChIP primer list [Table 10]

[0201] For histone purification, cells were cultured at 7000 cells / cm 2 Cells were seeded at a density of 1000 μg / ml and cultured in 10% FBS. When the cells reached 70-80% confluency, they were switched to differentiation medium [DMEM, 2% horse serum, penicillin / streptomycin (100 U / ml), L-glutamine (2 mM)] and cultured at 37°C in a humidified atmosphere containing 5% CO2. Cells were replaced every 3 days. Histones were extracted from myotubes by the acid extraction method. Briefly, cells were washed twice with ice-cold phosphate-buffered saline (PBS) and cultured in 1 ml (5 x 10 6 cells / ml) in hypotonic lysis buffer (10 mM Tris-HCl pH 8.0, 1 mM KCl, 1.5 mM MgCl2, 1 mM DTT, 0.5 mM PMSF, 1x protease and phosphatase inhibitors) and incubated at 4°C on a rotator for 30 min.

[0202] Nuclei were resuspended in 400 μL of 0.4 N H2SO4 and incubated on ice for 30 minutes. The supernatant containing histones was precipitated overnight on ice with 132 μL of TCA. After centrifugation, the pellet was washed twice with 1 mL of ice-cold acetone and air-dried. Histones were suspended in water and stored at -80°C. Histones were quantified using a colorimetric DC Protein Assay (Biorad, Cat. #5000111) according to the manufacturer's instructions, and 5–10 μg of protein was used for further analysis.

[0203] Antibodies used: anti-H3K3me2 (Ab7766) and anti-H3 (Ab1791). A luciferase assay was performed. Briefly, HEK293T cells were co-transfected with vectors expressing non-expanded and expanded polyglutamine AR and a vector expressing a luciferase reporter gene under the control of a standard androgen response element (ARE-Luc). To normalize the transfection efficiency data, cells expressing a Renilla reporter gene (TK-Ren) under the control of thymidine kinase were co-transfected with ARE-Luc at a ratio of 1:10. After treating the cells with vehicle and DHT for 16 hours, a luciferase assay was performed according to the manufacturer's instructions (Promega). <Generation of artificial miRNAs (amiRs) targeting LSD1 and PRMT6>

[0204] Amis targeting PRMT6 or LSD1 in mouse and human cells were designed using the online tool BLOCK-iT RNAi Designer: The upper and lower oligonucleotides were synthesized, annealed, and then cloned into the pcDNA6.2-GW / EmGFP-miR plasmid (SEQ ID NO: 231) using the BLOCK-iT Pol II miR RNAi kit (Invitrogen) to generate an amiR source that expresses the desired amiR in the cells that received the plasmid. The plasmid contains a spectinomycin resistance cassette.

[0205] The upper and lower oligonucleotides were prepared according to the instructions of Invitrogen. Briefly, the upper oligonucleotide sequence is generated by combining the following elements from the 5'-end to the 3'-end: 1. 5’TGCTG 2. The reverse complementary strand of the 21-base sense target sequence of interest. This is the sequence encoding the mature miRNA. 3. The terminal loop sequence. 4. From the 8th nucleotide to the 5'-end (5'-3') of the sense target sequence. 5. From the 11th nucleotide to the 21st nucleotide (5'-3') of the sense target sequence.

[0206] To generate the lower oligo sequence, perform the following steps: 1. Remove the 5'TGCT from the top oligo sequence (the new sequence starts with a G). 2. Take the reverse complement of the sequence from step 1. 3. Add CCTG to the 5' end of the sequence from step 2.

[0207] Table 5 below shows the 5'-3' sequences of the upper and lower oligonucleotides used to generate the example amiR precursors. In the upper oligonucleotide, the reverse complement of the intended 21-nucleotide sense target sequence is underlined, and the terminal loop-encoding sequence is shown in bold.

[0208] The expression cassette for amiR then contains the following consecutive regions (5'→3'): a 5' miR flanking region, a target-specific stem, a terminal loop, a stem-complementary region, and a 3' miR flanking region.

[0209] This amiR cassette can be cloned into the 3' untranslated region of any reporter gene end from which it is expressed under the control of an RNA polymerase II promoter.

[0210] As a negative control, we used the control amiR sequence from the pcDNA6.2-GW / EmGFP-miR-neg-control plasmid (provided in the kit). This sequence does not target any known vertebrate genes. (Control amiR: SEQ ID NO: 169: AAATGTACTGCGCGTGGAGAC) Top-10 competent E. coli was transformed, and positive clones were selected using the EGFP forward primer 5'GTCCTGCTGGAGTTCGTG-3' (SEQ ID NO: 170).

[0211] The amiR sequences for PRMT6 and LSD1 were determined as previously described. 15 , and subcloned downstream of EGFP under the control of the CAG promoter in an adeno-associated virus (AAV) vector derived from pAAV-CAG-EGFP (Addgene #37825).

[0212] Table 5. Oligonucleotides (oligos) for generating amiR [Table 11] [Table 12] [Table 13] [Table 14]

[0213] It is predicted that when the oligonucleotides used to generate amiRs #1, #2, and #3 targeting human PRMT6 are cloned into a vector and introduced into cells, amiRs with the sequences set forth in SEQ ID NOs: 171, 172, and 173, respectively, will be generated in the cells, and when the oligonucleotides used to generate amiRs #1, #2, and #3 targeting human LSD1 are cloned into a vector and introduced into cells, amiRs with the sequences set forth in SEQ ID NOs: 174, 175, and 176, respectively, will be generated in the cells. <Virus production and titer measurement>

[0214] AAV serotype 9 (AAV9) was produced using a slightly modified adenovirus-free transient transfection method. Briefly, adherent HEK293 cells cultured in roller bottles were transfected with three plasmids containing adenovirus helper proteins, AAV Rep and Cap genes, and a transgene expression cassette flanked by ITRs. Three days after transfection, cells were harvested, lysed by sonication, and treated with benzonase (Merck-Millipore).

[0215] The vector was purified by two successive ultracentrifugations in a cesium chloride density gradient. Intact capsids were recovered. The final product was prepared in sterile phosphate-buffered saline containing 0.001% Pluronic F-68 (Sigma) and stored at -80°C. The titers of the AAV vector samples were as follows: control amiR: 3.8 x 10 12 vg / mL, amiR-Prmt6: 4.18 × 10 13 vg / mL, amiR-Lsd1: 9.8 × 10 12 vg / mL; amiR-Prmt6 / Lsd1: 3.3 × 10 13 vg / mL. <Statistical analysis>

[0216] To compare measurements between groups, we used Student's two-sample t-test for two-group comparisons and one-way analysis of variance (ANOVA) test followed by Tukey's honestly significant difference post-hoc test for comparisons of more than two groups. To assess differences in weight and behavior by genotype group and treatment over time, we used two-way ANOVA with genotype, injection, and time as predictors followed by post-hoc tests. For all tests, the significance threshold was set at p<0.05. [Example]

[0217] We examined the expression of LSD1 and PRMT6 in tissues from SBMA transgenic mice expressing the human AR100Q mutant, SBMA knock-in mice in which AR exon 1 was replaced with human AR exon 1 encoding a 113Q polyQ-expanded AR, and available patient biopsy samples. Tissues analyzed included skeletal muscle, liver, spinal cord, brainstem, and heart. AR100Q male mice are asymptomatic at 4 weeks of age (presymptomatic stage), begin to show signs of muscle atrophy and motor dysfunction by 8 weeks of age (onset stage), and show signs of denervation by 12 weeks of age (late stage). Real-time PCR analysis demonstrated that transcript levels of LSD1 and PRMT6 were significantly increased twofold in the skeletal muscle (quadriceps) and liver of presymptomatic male SBMA mice compared with wild-type (WT) male mice (Figure 1A).

[0218] In the brainstem, spinal cord, and heart, transcript levels of LSD1 and Prmt6 were significantly elevated only in the brainstem at 4 weeks of age, but to a lesser extent than in skeletal muscle and liver. In muscle, upregulation was detected before the onset of motor dysfunction and denervation and remained constant and sustained throughout all disease stages (4–12 weeks). Western blotting confirmed upregulation of LSD1 and Prmt6 protein levels in SBMA quadriceps muscle, but not in the spinal cord, compared with controls (Figure 1B).

[0219] In the muscles of female AR100Q mice, Lsd1 and Prmt6 transcript levels increased only in the late stage of the disease, and to a lesser extent than in male mice (1.5-fold for Lsd1 and 1.8-fold for Prmt6) (Figure 1C). Furthermore, Lsd1 and Prmt6 were significantly elevated 5-10-fold in the fast-twitch extensor digitorum longus (EDL) muscles of male AR100Q mice, and their overexpression was normalized by surgical castration, consistent with the androgen-dependent nature of SBMA (Figure 1D). In addition, Lsd1 and Prmt6 transcript levels were significantly elevated 4-fold and 3-fold, respectively, in the skeletal muscle of AR113Q male knock-in mice compared to WT controls (Figure 1E).

[0220] Similar results were obtained when AR100Q-overexpressing C2C12 myoblasts were differentiated into myotubes, suggesting that this phenomenon occurs cell-autonomously in muscle (Fig. 1F). Importantly, transcript levels of LSD1 and PRMT6 were also elevated by 1.5- and 2.5-fold in SBMA patient muscle (Fig. 1G), supporting the disease relevance of these findings. [Example]

[0221] To investigate whether polyQ-expanded AR directly affects the transcription of Lsd1 and Prmt6, we searched for putative androgen response elements (AREs) in the enhancers and distal / core promoters of Lsd1 and Prmt6. Bioinformatics analysis revealed putative AREs in the promoters of both genes (Figure 1H). Chromatin immunoprecipitation (ChIP) assays in C2C12 myoblasts expressing AR with a normal (AR24Q) or pathogenic (AR100Q) polyQ tract detected occupancy of the unexpanded AR at the Lsd1 ARE, which was enhanced by polyQ expansion.

[0222] The Prmt6 ARE specifically bound to the polyQ-expanded AR. These results provide a molecular mechanism underlying the overexpression of Lsd1 and Prmt6 in SBMA muscle fibers.

[0223] Taken together, these results indicate that Lsd1 and Prmt6 are overexpressed in a muscle cell-autonomous manner, primarily as a consequence of androgen-dependent AR toxic GOF. [Example]

[0224] We further investigated the relationship between AR, PRMT6, and LSD1 in SBMA pathology. To determine whether LSD1 forms a complex with polyQ-expanded AR, we expressed Flag-tagged AR24Q or AR65Q in human embryonic kidney 293T (HEK293T) cells with or without LSD1 and subjected the cells to co-immunoprecipitation assays. Importantly, under these experimental conditions, LSD1 overexpression by itself did not alter AR expression (Figure ​(Figure11a). 11a).

[0225] LSD1 was co-immunoprecipitated by pull-down of Flag-tagged normal and polyQ-expanded AR (Fig. ​(Fig.11a).11a). In addition to LSD1, at least three protein isoforms derived from alternative splicing of Lsd1 (LSD1-2a, LSD1-8a, and LSD1-2a / 8a) formed complexes with normal and polyQ-expanded AR, regardless of the presence or absence of DHT (Fig. ​(Fig.11b).11b).

[0226] Immunofluorescence analysis showed that normal AR and polyQ-expanded AR colocalized with endogenous LSD1 in vehicle- or DHT-treated motor neuron-derived MN1 cells, patient-derived IPSCs differentiated into motor neurons, and the spinal cord of SBMA patients. Notably, AR, LSD1, and PRMT6 were all present in the nuclei of human IPSC-derived motor neurons. To assess protein-protein interactions in the subcellular compartment of intact cells, we used a proximity ligation assay (PLA) based on oligonucleotide-conjugated secondary antibodies that detect protein-protein interactions in situ (Figure 2A). The interaction between polyQ-expanded AR and PRMT6 was also assessed, and it was enhanced in the presence of dihydrotestosterone (DHT). AR24Q and AR100Q formed complexes with endogenous LSD1 in a DHT-independent manner.

[0227] Although LSD1 is a coactivator of the normal AR, it is unclear whether it also functions as a coactivator of the polyQ-expanded AR. To address this question, we expressed AR24Q and AR65Q driven by the cytomegalovirus promoter and assessed AR activity by measuring the activity of a luciferase reporter under the control of an androgen response element (ARE). Both GOF (overexpression on first fusion) and LOF (knockdown on first fusion) approaches were applied. In HEK293T cells, overexpression of LSD1 enhanced the transcriptional activation of AR24Q and AR65Q by 1.4-fold in DHT-treated cells but had no effect in vehicle-treated cells, indicating that LSD1 functions as a coactivator of the AR (Figure 2B).

[0228] Similar results were obtained when AR12Q and AR55Q were expressed under the control of the eukaryotic promoter elongation factor 1α (Fig. S1A). Furthermore, LSD1-2a, LSD1-8a, and LSD1-2a / 8a transactivated normal and polyQ-expanded AR to a similar extent as LSD1 in HEK293T cells (Fig. S1B) and MN1 cells (Fig. S2C, S1B). [Example]

[0229] We silenced endogenous LSD1 using CRISPR / Cas9 technology. Using Cas9 with different single gRNAs in HEK293T cells resulted in partial knockdown of LSD1, whereas using two gRNAs simultaneously resulted in a large in-frame deletion of the LSD1 exon encoding the essential catalytic domain, resulting in the generation of an enzymatically inactive LSD1 fragment (Figure 2D, Figure 12D). Partial (50%-70%) and complete knockout of LSD1 reduced the transcriptional activation of AR24Q and AR65Q by 40%-50% and 80%, respectively, demonstrating a dose-dependent effect of endogenous LSD1 on androgen-induced AR transcriptional activation (Figure 2D).

[0230] Consistent with this finding, transcriptional activation of polyQ-expanded AR was also reduced by LSD1 knockdown. Furthermore, CRISPR-Cas9 knockdown of Lsd1 in MN1 cells significantly reduced the transcriptional activation of AR24Q and AR100Q (Figure 2E). Taken together, these results indicate that LSD1 forms a complex with polyQ-expanded AR and functions as its coactivator, and that CRISPR-Cas9 knockdown of Lsd1 can reduce the transcriptional activation of polyQ-expanded AR. [Example]

[0231] Both LSD1 and PRMT6 contain an LXXLL motif (Figure 3A). This motif mediates the interaction of transcriptional cofactors with steroid receptors via the activation function-2 (AF-2) surface in the ligand-binding domain. Consistent with this finding, LSD1 did not transactivate AR carrying the E897K (E is glutamine, K is lysine) mutation, which inhibits AF-2-mediated cofactor recruitment (Figure 3B). LSD1 with a deleted LXXLL motif (mutated to LXXAA, A is alanine) also did not transactivate AR (Figure 3C). The catalytically inactive LSD1 mutant K685A did not transactivate normal or polyQ-expanded AR (Figure 3D).

[0232] Furthermore, treatment of control-treated transfected cells with the LSD1 catalytic inhibitor tranylcypromine (TCP) reduced DHT-induced transcriptional activation of polyQ-expanded AR (Figure 3E). Treatment of cells with the selective LSD1 inhibitor SP-2509, which inhibits the association of LSD1 with CoREST but does not affect LSD1 enzymatic activity, did not alter transcriptional activation of polyQ-expanded AR, further supporting the relevance of LSD1 catalytic activity in AR transcriptional activation. Notably, decreased histone 3 lysine 4 methylation (H3K4me2) was observed in C2C12 myotubes expressing AR100Q, confirming LSD1 hyperactivation in SBMA myotubes (Figure 3F). Together, these observations demonstrate that LSD1 requires its catalytic activity and the AR AF-2 surface to transactivate both normal and polyQ-expanded AR via a mechanism involving histone modifications. [Example]

[0233] Herein, we show that PRMT6 and LSD1 are both activating cofactors of AR and are overexpressed in SBMA skeletal muscle. Therefore, we investigated whether PRMT6 and LSD1 synergistically contribute to the toxic GOF of polyQ-expanded AR. First, we confirmed that neither PRMT6 overexpression nor silencing altered the expression of endogenously and exogenously expressed LSD1, and vice versa (Figure 13A). Then, we investigated whether LSD1 and PRMT6 interact in HEK293T cells. Immunoprecipitation of PRMT6 reduced LSD1, indicating that PRMT6 and LSD1 interact in HEK293T cells.

[0234] Furthermore, PLA in MN1 cells expressing AR24Q and AR100Q demonstrated that endogenous PRMT6 interacted with endogenous LSD1, and this interaction was not altered by DHT (Figure 4A). Thus, LSD1 and PRMT6 interact with each other and with AR via the AF-2 surface. MN1 Lsd1 CRISPR-Cas9 knockdown cells were transduced with lentiviruses expressing a nonspecific control shRNA or two shRNAs against Prmt6: shPRMT6 #1 (SEQ ID NO: 232) and shPRMT6 #2 (SEQ ID NO: 233) to silence endogenous Prmt6.

[0235] Western blotting confirmed that knockdown of Lsd1 or Prmt6 did not alter PRMT6 or LSD1 levels, respectively, or affect AR levels (Figure 4B). Next, we assessed protein-protein interactions in MN1 cells by PLA. Surprisingly, silencing Prmt6 significantly reduced the interaction of LSD1 with normal AR and polyQ-expanded AR. Similarly, silencing Lsd1 also reduced the interaction of AR with PRMT6, even when this interaction was abnormally enhanced by polyQ expansion (Figure 4A). Immunoprecipitation assays confirmed the AR / LSD1 / PRMT6 interaction in the quadriceps muscles of WT and knock-in SBMA mice expressing AR113Q (Figure 4C).

[0236] Next, we evaluated whether LSD1 and PRMT6 cooperatively transactivate AR. Overexpression of LSD1 alone, PRMT6 alone, and both coactivators simultaneously enhanced transcriptional activation of normal AR by 1.3-, 3.1-, and 4.5-fold, respectively, and that of polyQ-expanded AR by 1.5-, 3.4-, and 6.6-fold, respectively (Fig. 4D). Notably, transcriptional activation of polyQ-expanded AR by LSD1 / PRMT6 was increased compared with normal AR. AR transcriptional activation by PRMT6 was enhanced by the AKT consensus site. 210 RXRXXS 215 and 787 RXRXXS 792 (R is arginine and S is serine). Interestingly, transcriptional activation of AR by LSD1 and PRMT6 was significantly enhanced by phosphorylation-deficient substitutions of S215 and S792 to alanine (S215A, S792A) compared with AR65Q, in which the S215 and S792 residues were intact, suggesting that transcriptional activation of AR by LSD1 and PRMT6 is negatively regulated by phosphorylation of the AKT consensus site (Figure 13B). [Example]

[0237] Using pharmacological and genetic LOF approaches, we assessed the effects of inhibition of endogenous (control-treated transfected cells) and overexpressed LSD1 and PRMT6 on AR activity via transcriptional assays. TCP and the PRMT inhibitor adenosine dialdehyde (AdOx) reduced DHT-induced transcriptional activation of normal and polyQ-expanded AR (Figure 4D), indicating that AR requires the function of both LSD1 and PRMT6 for full transcriptional activation. Notably, the effect of LSD1 overexpression on AR transcriptional activation was not only reduced by TCP, as expected, but also by AdOx. Similarly, the effect of PRMT6 overexpression was attenuated not only by AdOx but also by TCP. Combined treatment with TCP / AdOx further attenuated AR transcriptional activation in both control-treated transfected cells and cells overexpressing LSD1, PRMT6, and LSD1 / PRMT6. However, AdOx is a pan-inhibitor of PRMTs, and TCP may have additional effects on enzymes other than LSD1. [Example]

[0238] Endogenous LSD1 and PRMT6 were genetically silenced by CRISPR / Cas9 technology (Figure 2D, Figure 4E).

[0239] Knockdown of LSD1 and PRMT6, both individually and simultaneously, using two independent guide RNAs attenuated DHT-induced transcriptional activation of normal and polyQ-expanded AR (Figure 4E).Furthermore, genetic silencing of endogenous LSD1 significantly reduced PRMT6-induced transcriptional activation of normal and polyQ-expanded AR (Figure S13C). [Example]

[0240] To determine whether LSD1 synergistically cooperates with PRMT6 to alter SBMA phenotypes and enhance toxicity in vivo, SBMA flies were crossed with flies expressing RNA interference (RNAi) targeting the Drosophila homolog of LSD1, dLsd1, and the Drosophila homolog of PRMT6, Dart8, obtained from the Vienna Drosophila Resource Center (VDRC, stock IDs for DART8: v100228, dLsd1: v106147). As a control, flies expressing AR without a polyQ tract (AR0Q) were used. AR0Q flies did not show any phenotypes even when fed DHT (Figure 5A). To model SBMA, flies expressing AR at 52Q (AR52Q) were used. AR52Q flies developed posterior eye degeneration.

[0241] Silencing dLsd1 by approximately 40% did not alter the toxicity of polyQ-expanded AR, whereas silencing Dart8 by approximately 50% had a significant but modest effect on the toxicity of polyQ-expanded AR (Figure 5A-C). Consistent with their synergistic effects on the transcriptional activation of polyQ-expanded AR, simultaneous silencing of both dLsd1 and Dart8 strongly suppressed the DHT-induced degenerative phenotype caused by polyQ-expanded AR. This evidence supports the idea that LSD1 and PRMT6 cooperate synergistically to enhance the toxic GOF of polyQ-expanded AR in vivo, and that silencing both activating cofactors synergistically reduces the toxic GOF of mutant AR. [Example]

[0242] The above results support the development of therapeutic strategies targeting AR-modulating cofactors according to the present invention.

[0243] We designed 83 and 51 artificial miRNAs (amiRs) to silence mouse Lsd1 and Prmt6, respectively. Using the best alignment targeting all known mouse Lsd1 isoforms and Prmt6, we selected the top-ranked amiRs for in vitro validation (Figure 6A, Table 5). In MN1 cells, amiR-Lsd1#1 silenced Lsd1 expression by 50%, whereas amiR-Lsd1#2 and #3 silenced expression by 70%. Because Lsd1 knockout is embryonic lethal in mice, but its haploinsufficiency does not have significant effects, amiR-Lsd1#1 was selected for further analysis. Prmt6 amiR#2, #6, and #7 significantly silenced Prmt6 to a similar extent (approximately 50%). amiR-Prmt6#6 was selected for further analysis.

[0244] MN1 cells expressing AR100Q exhibited reduced cell viability compared with MN1 cells expressing AR24Q in the presence of DHT, whereas simultaneous silencing of Lsd1 and Prmt6 significantly increased cell viability, consistent with the results in SBMA flies ( Figure 6B ).

[0245] For in vivo transfer, adeno-associated virus subtype 9 (AAV9) expressing green fluorescent protein (GFP) was used as the amiR source (Figure 6C). 10 and 8 10 A single intraperitoneal injection of amiR-Lsd1 / Prmt6 at a concentration of 1000 virions was performed. Biodistribution analysis of AAV9 expressing a control amiR revealed that viral particles were detected in several tissues, including the liver, heart, quadriceps, and spinal cord (Figure 6D). Western blotting detected GFP expression in several tissues, including skeletal muscle (Figure 6E).

[0246] Introduction of amir-Lsd1 / Prmt6 into AR100Q mice significantly reduced Lsd1 and Prmt6 transcript levels in skeletal muscle without affecting the transcript levels of mouse or human AR (Figure 6F). Western blotting confirmed reduced expression of LSD1 and PRMT6 proteins in skeletal muscle, but not in the spinal cord, liver, white adipose tissue, or lung. Only LSD1 was significantly reduced in the heart (Figure 6G and Figure S14).

[0247] Because LSD1 and PRMT6 are epigenetic regulators that alter gene expression, and AR is a transcription factor active in several tissues, we measured transcript levels of AR, LSD1, and PRMT6 target genes in tissues other than skeletal muscle. Treatment did not alter expression of selected target genes in most tissues, ruling out a general effect on gene transcription (Figure 15). These observations indicate that AAV9-mediated delivery of amiR-Lsd1 / Prmt6 is an effective strategy for silencing AR-regulatory cofactors in vivo without affecting AR gene expression. [Example]

[0248] The efficacy of the amiR of Example 10 was examined in AR100Q mice.

[0249] First, we performed transcriptome analysis by RNA-seq in the quadriceps muscles of 13-week-old control and amiR-Lsd1 / Prmt6-treated AR100Q mice and WT mice. We identified 6,583 differentially expressed genes (DEGs) (4,158 up-regulated genes and 2,425 down-regulated genes, GSE193539) in untreated SBMA muscles compared to WT muscles (absolute log2-fold change >2, corrected p-value <0.01) (Figure 7A). This result is consistent with recent observations that a large number of differentially expressed genes were observed in the tibialis anterior muscle of the same SBMA mouse model at 11 weeks of age. Analysis of the effects of treatment in WT and AR100Q mice revealed 1,129 DEGs (488 up-regulated genes and 641 down-regulated genes) specifically in AR100Q mice. Notably, 285 genes were fully restored, showing transcription levels comparable to those in WT mice, and 389 genes were partially restored ( Fig. 7B ).

[0250] We also performed functional enrichment analysis of the recovered genes and found statistical significance for several terms, including "skeletal muscle contraction," "muscle structural development," "myofibril assembly," "sarcoplasmic reticulum calcium ion transport," "collagen chain trimerization," "myofibril assembly and metabolism," "fructose-glycogen metabolism," "protein nitrosylation," "precursor metabolite production and energy," and "purine nucleoside monophosphate metabolic process" (Figure 7C, Figure 7D). Interestingly, most (approximately 80%) of the GO biological processes previously identified as enriched in muscle from androgen-treated female mice expressing polyQ-expanded AR were found to have overlap coefficients of 0.5 or higher with the GO biological processes enriched by the recovered genes (65% had an overlap coefficient of 1). This suggests that the transcriptional regulation of genes in these categories is disrupted by mutant AR and partially or completely normalized by silencing Lsd1 and Prmt6.

[0251] AR113Q (knock-in model), AR97Q (another transgenic model), or expressing WT AR only in muscle (HSA-AR) 11 Comparison with published transcriptome analysis data for SBMA muscle revealed that 52 of 153 genes (34%) dysregulated in the HSA-AR model were restored by silencing Lsd1 and Prmt6. Similarly, 58 of 204 genes (28%) and 31 of 159 genes (20%) dysregulated in the AR97Q and AR113 models, respectively, were restored. Furthermore, AR LOF models 12 Only 17% of dysregulated genes in α- and β-terminal nucleotides were restored by amiR treatment, indicating limited reduction in AR physiological function. Overall, the present data demonstrate that genetic silencing according to preferred embodiments of the present invention is effective against the toxic GOF of polyQ-expanded AR. [Example]

[0252] We next conducted a preclinical study to assess the effect of Lsd1 / Prmt6 silencing on disease phenotypes in mice. Randomized cohorts of male transgenic AR100Q mice and wild-type littermates were assigned to either control amiR or amiR-Lsd1 / Prmt6. First, we confirmed that the genetic silencing strategy did not alter the body weight or motor function of WT mice, ruling out undesirable effects of genetic manipulation of the target gene (Figure 8A). This is particularly important for Lsd1, as its deletion in mice is embryonic lethal. Next, we analyzed the effect of treatment on the SBMA phenotype. AR100Q mice exhibit weight loss and motor dysfunction from around 8 weeks of age. amiR-Lsd1 / Prmt6 treatment significantly increased the body weight of these mice at 9–11 weeks of age and improved muscle strength in the hanging wire test and motor coordination in the rotarod test (Figure 8A).

[0253] SBMA muscles are characterized by a muscle fiber type switch from glycolytic to oxidative. Consistent with the role of LSD1 on muscle metabolism, amiR-Lsd1 / Prmt6 reduced the number of oxidative fibers from 49% in vehicle-treated mice to 37% in amiR-Lsd1 / Prmt6-treated mice (p = 0.05) (Figure 8B). A key aspect of skeletal muscle pathology in SBMA is functional denervation associated with the upregulation of genes such as muscle-associated receptor tyrosine kinase (Musk), myogenin (MyoG), and neural cell adhesion molecule (NCAM), which are induced when communication between motor neurons and innervating muscle fibers is impaired. 8 Musk, MyoG, and NCAM were upregulated in muscle of AR100Q mice and were significantly reduced by treatment (Figure 8C).

[0254] It is noteworthy that these genes are regulated by LSD1. AR100Q forms 2% SDS-resistant aggregates in muscle, which can be detected as high molecular weight (HMW) species that accumulate in the stacked region of polyacrylamide gels. 8 Consistent with the finding that PRMT6 promotes the aggregation of polyQ-expanded AR, Western blotting showed that silencing Lsd1 and Prmt6 reduced the accumulation of HMW species in muscle while increasing the amount of monomeric AR (Figure 8D). Taken together, these results demonstrate that silencing Lsd1 and Prmt6 alleviates the phenotype of a severe SBMA mouse model. [Example]

[0255] We also tested the genetic silencing strategy in human cells, designing three amiRs to silence human LSD1 and PRMT6 (Table 5). Because LSD1 and PRMT6 are overexpressed in prostate cancer and correlate with tumor aggressiveness, we validated targeted silencing in HEK293T and the androgen-sensitive prostate cancer cell line LNCaP (Figure 9A). 4,7 In HEK293T cells, silencing of both LSD1 and PRMT6 resulted in the expression of two genes regulated by AR and its regulatory cofactors, namely ATP2A2, which encodes SERCA2, and p21 CIP1 The expression of CDKN1A, which encodes LSD1, was altered (Figure 9B). In LNCaP cells, a significant decrease in proliferation was observed in cells targeting either LSD1 or PRMT6, indicating that these amiRs exert their biological effects in prostate cancer cells (Figure 9C).

[0256] These observations demonstrate amiR-mediated silencing of two important AR regulatory cofactors in human cells and suggest the potential application of this strategy to patients with SBMA and possibly other AR-associated GOF diseases, such as prostate cancer and gender-specific cancer types. [Example]

[0257] Further preclinical studies were conducted to evaluate the effects of pharmacological inhibition of Lsd1 on disease phenotypes in mice. Randomized cohorts of male transgenic AR100Q mice and wild-type littermates were assigned to either control or treatment groups.

[0258] We investigated the efficacy of two safe MAO-B inhibitors, phenelzine and tranylcypromine (TCP), clinically used antidepressants, in ameliorating the SBMA-like phenotype in AR100Q mice. These two drugs covalently bind to FAD, a cofactor of LSD1, and irreversibly inhibit LSD1. Treatment was initiated between 4 weeks of age (presymptomatic stage, when upregulation of LSD1 and PRMT6 is already detectable) and death.

[0259] Phenelzine was administered in drinking water at 30 mg / kg three times a week, and TCP was administered intraperitoneally at 6 mg / kg three times a week.

[0260] Mice were randomized and blinded to genotype and treatment.

[0261] Phenotypes were analyzed by examining muscle strength using a grip strength test.

[0262] From 10 weeks of age onwards, AR100Q mice (Tg) showed significant muscle weakness compared to wild-type mice (WT). The phenotype of AR100Q mice was improved by both phenelzine and TCP (Figures 16a and 16b, respectively). Thus, small molecule LSD1 inhibition demonstrated beneficial effects, supporting the efficacy of small molecule inhibitors of AR cofactors, alone or in combination with gene silencers, to treat diseases associated with AR gain of function and / or overexpression of AR cofactors.

[0263] array SEQ ID NO: 1 >NM_018137.3 Homo sapiens protein arginine methyltransferase 6 (PRMT6), mRNA

[0264] SEQ ID NO: 2 >NM_001009999.3 Homo sapiens lysine demethylase 1A (KDM1A), transcript variant 1, mRNA

[0265] SEQ ID NOs: 3-53: Human PRMT6 target sequence of amiR (cDNA) [Table 15]

[0266] SEQ ID NOs: 54-138: Human LSD1 target sequence of amiR (cDNA) [Table 16] [Table 17]

[0267] SEQ ID NOs: 139-168, 234-235: Oligos cloned to generate precursor amiRs targeting mouse and human Prmt6 and Lsd1 (see Table 5) SEQ ID NO: 169: control amiR aaatgtactgcgcgtggagac SEQ ID NO: 170: EGFP forward primer gtcctgctggagttcgtg SEQ ID NOs: 171-173: Mature amiR (5'->3') targeting hPRMT6: [Table 18]

[0268] SEQ ID NOs: 174-176: Mature amiR (5'->3') targeting hLSD1: [Table 19]

[0269] SEQ ID NOs: 177-179: amiR precursor (5'->3') targeting hPRMT6; target sequence is underlined. [Table 20]

[0270] SEQ ID NOs: 180-182: amiR precursor (5'->3') targeting hLSD1; target sequence is underlined. [Table 21]

[0271] SEQ ID NOs: 183-185: Source (5'->3') of amiR targeting hPRMT6; target sequence is underlined. [Table 22]

[0272] SEQ ID NOs: 186-188: Sources (5'->3') of amiRs targeting hLSD1; target sequences are underlined. [Table 23]

[0273] SEQ ID NOs: 189-224: RT-PCR primers [Table 24] [Table 25]

[0274] SEQ ID NOs: 225-230: ChIP primers [Table 26]

[0275] SEQ ID NO: 231 pcDNA6.2-GW / EmGFP-miR (BLOCK-iT™ Pol II miR RNAi Expression Vector)

[0276] SEQ ID NO: 232: shPRMT6 #1 caccggcauucugagcaucuu. SEQ ID NO: 233: shPRMU6 #2 cgcauacuucugcgcuacaaa

[0277] SEQ ID NOs: 236-334: gRNA guide sequences targeting human PRMT6 [Table 27] [Table 28] [Table 29]

[0278] SEQ ID NOs: 335-431: gRNA guide sequences targeting human PRMT6 [Table 30] [Table 31] [Table 32]

[0279] SEQ ID NO: 432 (PRMT6 target of ASO1) tgtactacgagtgcta SEQ ID NO: 433 (PRMT6 target of ASO2) tgcacgagtccatgct SEQ ID NO: 434 (LSD1 target of ASO3) tactgtgcttgtccac SEQ ID NO: 435 (LSD1 target of ASO4) ctatgtagctgatcttg SEQ ID NO: 436 (ASO1) +Ts+As+GsCsAsCsTsCsGsTsAsGsTs+As+Cs+A SEQ ID NO: 437 (ASO2) +As+Gs+CsAsTsGsGsAsCsTsCsGsTs+Gs+Cs+A' SEQ ID NO: 438 (ASO3) +Gs+Ts+GsGsAsCsAsAsGsCsAsCsAs+Gs+Ts+A SEQ ID NO: 439 (ASO4) +Cs+As+AsGsAsTsCsAsGsCsTsAsCsAs+Ts+As+G SEQ ID NO: 440 (ASO1 unmodified) tagcactcgtagtaca SEQ ID NO: 441 (ASO2 unmodified) agcatggactcgtgca SEQ ID NO: 442 (ASO3 unmodified) agcatggactcgtgca SEQ ID NO: 443 (ASO4 unmodified) caagatcagctacatag

Claims

1. 1. A therapeutic agent for use in the treatment of a disease associated with gain of function of the androgen receptor (AR) and / or overexpression of an AR-activating cofactor, comprising: A therapeutic agent comprising at least one inhibitor of lysine-specific demethylase 1 (LSD1) AR-activating cofactor and at least one inhibitor of protein arginine methyltransferase 6 (PRMT6) AR-activating cofactor.

2. The therapeutic agent for use according to claim 1, wherein the disease associated with gain of function of AR and / or overexpression of AR-activating cofactors is spinal and bulbar muscular atrophy (SBMA).

3. The therapeutic agent for use according to claim 1, wherein the disease associated with gain of function of AR and / or overexpression of AR-activating cofactors is cancer, preferably prostate cancer, lung cancer, breast cancer, bladder cancer, cervical cancer, or lymphoma.

4. The therapeutic agent for use according to any one of claims 1 to 3, wherein the at least one inhibitor of LSD1 is a gene silencer that targets LSD1, and / or the at least one inhibitor of PRMT6 is a gene silencer that targets PRMT6.

5. 5. The therapeutic agent for use according to claim 4, wherein the at least one LSD1-targeting gene silencer and / or the at least one PRMT6-targeting gene silencer is selected from the following: an RNA interference (RNAi) molecule, or a precursor or source thereof, or an equivalent thereof; a genome editing agent; an antisense oligonucleotide (ASO); or a combination thereof.

6. 5. The therapeutic agent for use according to claim 4, wherein the at least one LSD1-targeting gene silencer and / or the at least one PRMT6-targeting gene silencer is an RNAi molecule, or a precursor or source thereof, or an equivalent thereof.

7. 7. A therapeutic agent for use according to claim 6, comprising: - at least one RNAi molecule targeting any one of SEQ ID NOs: 54 to 138 of LSD1, preferably any one of SEQ ID NOs: 68, 72 or 90, or a transcript thereof, or a precursor or source thereof, or an equivalent thereof; and - at least one RNAi molecule targeting any one of SEQ ID NOs: 3 to 53 of PRMT6, preferably any one of SEQ ID NOs: 18, 21 or 29, or a transcript thereof, or a precursor or source thereof, or an equivalent thereof.

8. - at least one RNAi molecule targeting LSD1 is an artificial miRNA (amiR) comprising or consisting of a sequence of SEQ ID NO: 174-176, or an amiR precursor comprising or consisting of a sequence of SEQ ID NO: 180-182, or an amiR source comprising or consisting of a sequence of SEQ ID NO: 186-188, or an equivalent thereof; and / or - at least one RNAi molecule targeting PRMT6 is an artificial miRNA (amiR) comprising or consisting of the sequence of SEQ ID NO: 171-173, or an amiR precursor comprising or consisting of the sequence of SEQ ID NO: 177-178, or an amiR source comprising or consisting of the sequence of SEQ ID NO: 183-185, or equivalents thereof; The therapeutic agent for use according to claim 6, wherein

9. The therapeutic agent for use according to claim 4, wherein the at least one LSD1-targeting gene silencer and / or the at least one PRMT6-targeting gene silencer is a CRISPR / Cas system.

10. The therapeutic agent for use according to claim 4, wherein the at least one LSD1-targeting gene silencer and / or the at least one PRMT6-targeting gene silencer is an ASO.

11. 11. A therapeutic agent for use according to claim 10, comprising: - at least one ASO targeting SEQ ID NO: 434 or 435 of LSD1 or a transcript thereof; and - at least one ASO targeting SEQ ID NO: 432 or 433 of PRMT6 or a transcript thereof.

12. - at least one ASO targeting LSD1 comprises or consists of the sequence of SEQ ID NO: 438, 439, or an equivalent thereof; and / or - at least one ASO targeting PRMT6 comprises or consists of the sequence of SEQ ID NO: 436, 437, or an equivalent thereof; The therapeutic agent for use according to claim 10, wherein

13. comprising at least one gene silencer of LSD1 and / or at least one gene silencer of PRMT6, and further comprising a delivery vehicle for delivering said gene silencer to a cell; Preferably, the delivery vehicle is selected from a viral vector, a microsphere, a liposome, a lipoplex, a nanoparticle, a microparticle, a colloidal gold particle, a lipopolysaccharide, a polypeptide, a polysaccharide, a collagen, a pegylated viral vehicle, a graphene conjugate, a cholesterol conjugate, a cyclodextran conjugate, and a polyethyleneimine polymer; More preferably, the delivery vehicle is a viral vector, even more preferably selected from an adeno-associated viral vector, a lentiviral vector, an adenoviral vector, a retroviral vector, an alphaviral vector, a vaccinia viral vector, a herpes simplex viral (HSV) vector, a rabies viral vector, and a Sindbis viral vector. A therapeutic agent for use according to any one of claims 1 to 12.

14. The therapeutic agent for use according to any one of claims 1 to 3, wherein the at least one inhibitor of LSD1 is a small molecule inhibitor of LSD1, and / or the at least one inhibitor of PRMT6 is a small molecule inhibitor of PRMT6.

15. A therapeutic agent for use according to any one of claims 1 to 3, comprising at least one gene silencer of LSD1 and at least one small molecule inhibitor of PRMT6.

16. A therapeutic agent for use according to any one of claims 1 to 3, comprising at least one small molecule inhibitor of LSD1 and at least one gene silencer of PRMT6.

17. 17. The therapeutic agent for use according to claim 16, wherein the at least one small molecule inhibitor of LSD1 is a monoamine oxidase inhibitor, preferably phenelzine, tranylcypromine, or a mixture thereof.

18. An artificial miRNA targeting LSD1 comprising or consisting of the sequences of SEQ ID NOs: 174 to 176, or their sources or precursors, or their equivalents.

19. An artificial miRNA targeting PRMRT6 comprising or consisting of the sequences of SEQ ID NOs: 171 to 173, or their sources or precursors, or their equivalents.

20. An ASO targeting LSD1 comprising or consisting of a sequence selected from SEQ ID NOs: 438, 439, or an equivalent thereof.

21. An ASO targeting PRMRT6 comprising or consisting of a sequence selected from SEQ ID NOs: 436, 437, or an equivalent thereof.