Enzyme, strain for producing salidroside and production method

Abstract

Use of glucosyltransferase U8GT3 and / or poppy-derived tyrosine decarboxylase or a mutant thereof in yeast synthesis of salidroside is provided, as is use of poppy-derived tyrosine decarboxylase or a mutant thereof in yeast synthesis of tyrosol. The amino acid sequences of the poppy-derived tyrosine decarboxylase and its mutant are set forth in SEQ ID NOs: 7 to 8, respectively, and the nucleotide sequences of their encoding genes are set forth in SEQ ID NOs: 1 to 2, respectively. The amino acid sequence of glucosyltransferase U8GT3 is set forth in SEQ ID NO: 10, and the nucleotide sequence of its encoding gene is set forth in SEQ ID NO: 4.

Description

[Technical Field]

[0001] The present application relates to the field of biotechnology, in particular to enzymes, strains for producing salidroside, and production methods, and more particularly to the use of glucosyltransferase U8GT3 and / or poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of salidroside; the use of poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of tyrosol; strains for producing salidroside; biological materials; whole-cell catalysts; and methods for producing salidroside and / or tyrosol using enzymes. [Background technology]

[0002] Salidroside is an important active substance found in Rhodiola rosea plants, and has various physiological effects, including improving immunity, anti-aging, anti-radiation, anti-fatigue, and anti-Alzheimer's disease, and is widely used in functional cosmetics for whitening, anti-aging, and UV protection.

[0003] Currently, salidroside available on the market is extracted from the rare wild plant Rhodiola rosea, which grows mainly in unpolluted, high-temperature, and cold regions. However, its content in the plant is only 0.5% to 0.8%. The extraction process is relatively complicated, subject to seasonal weather constraints, and requires high time and labor costs. Current chemical synthesis methods are difficult to industrialize due to the complex manufacturing process. With increasing market demand, producing salidroside using microbial cell factories has become a more promising option.

[0004] All currently reported and published data on yeasts synthesizing salidroside de novo using glucose as a carbon source involve the conversion of 4-hydroxyphenylpyruvate (4-HPP) to 4-hydroxyphenylacetaldehyde (4-HPAA) via phenylpyruvate decarboxylase (ARO10), followed by the synthesis of the main precursor, tyrosol, via the Ehrlich pathway. While optimization of a series of metabolic pathways can improve the metabolic flux of the target product, further improvement of the metabolic flux of its precursor is required for industrial production.

[0005] Therefore, designing and developing a new precursor synthesis pathway and simultaneously decoupling the cell growth of engineered yeast from the product synthesis of salidroside will greatly facilitate the industrial application of the biological synthesis of salidroside and improve the economic benefits of the fermentative production of salidroside. Summary of the Invention

[0006] In view of the deficiencies of the prior art, the present application provides enzymes, strains for producing salidroside, and production methods, and in particular, relates to the use of glucosyltransferase U8GT3 and / or poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of salidroside, the use of poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of tyrosol, and methods for producing salidroside and / or tyrosol using salidroside-producing strains, biomaterials, whole-cell catalysts, and enzymes.

[0007] The purpose of this application is to overcome the existing technical difficulties. First, by knocking out the GAL80 gene of Saccharomyces cerevisiae and combining it with a galactose-inducible promoter, cell growth of the genetically engineered Saccharomyces cerevisiae strain is decoupled from the synthesis of the salidroside product, reducing the metabolic pressure of the genetically engineered strain on the target pathway and achieving efficient and rapid production of salidroside. Second, the codon encoding the 350th amino acid in the tyrosine decarboxylase (TYDC) gene from poppy (Papaver somniferum) is replaced with the codon encoding phenylalanine (TYDC Y350F ) and mutated this TYDC Y350F The mutant can directly catalyze the synthesis of 4-hydroxyphenylacetaldehyde (4-HPAA) from tyrosine, thereby constructing a new precursor synthesis pathway. By combining the two new and old metabolic pathways, metabolic flow can be further directed toward the synthesis of the target product, salidroside, thereby improving the economic profitability of fermentative production of salidroside.

[0008] Specifically, the present application relates to the following aspects: 1. Use of glucosyltransferase U8GT3 and / or poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of salidroside. 2. Use of poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of tyrosol. 3. The tyrosine decarboxylase mutant comprises the amino acid sequence set forth in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; The glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; Item 1 or 2. Use according to item 1 or 2. 4. The tyrosine decarboxylase mutant comprises a nucleic acid molecule set forth in SEQ ID NO: 1; the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; Item 1, 2 or 3. Use according to item 1, 2 or 3. 5. A strain for producing salidroside, said strain comprising a gene encoding glucosyltransferase U8GT3 and a gene encoding tyrosine decarboxylase; Preferably, the tyrosine decarboxylase gene is a gene encoding a poppy-derived tyrosine decarboxylase or a gene encoding a poppy-derived tyrosine decarboxylase mutant, More preferably, the glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; the poppy-derived tyrosine decarboxylase mutant is a tyrosine decarboxylase in which the 350th tyrosine is mutated to phenylalanine, and comprises the amino acid sequence shown in SEQ ID NO: 7; Most preferably, the enzyme is a Saccharomyces cerevisiae strain. 6. The poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule set forth in SEQ ID NO: 2; the tyrosine decarboxylase mutant comprises the nucleic acid molecule set forth in SEQ ID NO: 1; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; The strain described in item 5. 7. Furthermore, heterologous expression of a gene encoding phenylpyruvate decarboxylase ARO10 and / or a gene encoding benzoate dehydrogenase TYR1 in yeast; Preferably, the phenylpyruvate decarboxylase ARO10 comprises the amino acid sequence set forth in SEQ ID NO: 11; the benzoate dehydrogenase TYR1 comprises the amino acid sequence shown in SEQ ID NO: 12; More preferably, the phenylpyruvate decarboxylase ARO10 comprises the nucleic acid molecule set forth in SEQ ID NO: 5; The benzoate dehydrogenase TYR1 comprises a nucleic acid molecule set forth in SEQ ID NO: 6; The strain according to item 5 or 6. 8. A biomaterial that is any of the following: A1) a nucleic acid molecule encoding a poppy-derived tyrosine decarboxylase and / or a nucleic acid molecule encoding a tyrosine decarboxylase variant; A2) an expression cassette comprising the nucleic acid molecule according to A1); A3) A recombinant vector comprising the nucleic acid molecule according to A1) or the expression cassette according to A2); Preferably, the tyrosine decarboxylase mutant comprises the amino acid sequence set forth in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; More preferably, the tyrosine decarboxylase mutant comprises the nucleic acid molecule set forth in SEQ ID NO: 1; A biological material, wherein the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2. 9. A biomaterial that is any of the following: B1) a nucleic acid molecule encoding glucosyltransferase U8GT3; B2) an expression cassette comprising the nucleic acid molecule described in B1; B3), a recombinant vector comprising the nucleic acid molecule according to B1), or a recombinant vector comprising the expression cassette according to B2); Preferably, the glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; More preferably, A biological material, wherein the glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO:4. 10. A whole-cell catalyst comprising the strain according to any one of items 5 to 7 or the biomaterial according to any one of items 8 to 9. 11. A method for producing salidroside and / or tyrosol using yeast, comprising producing salidroside and / or tyrosol by fermentation using the strain according to any one of Items 5 to 8, the biomaterial according to any one of Items 9 to 10, or the whole-cell catalyst according to Item 11; Preferably, OD 600 Adding galactose during fermentation culture until the pH reaches 8 to 15; More preferably, the concentration of the galactose is 1 to 4 g / L, More preferably, the fermentation time is 90 to 120 hours, Most preferably, the method wherein said strain is Saccharomyces cerevisiae. 12. A method for producing salidroside, comprising the steps of: synthesizing tyrosol using a carbon source; and synthesizing salidroside using tyrosol, In the step of synthesizing tyrosol using the carbon source, tyrosol is synthesized using benzoate dehydrogenase and phenylpyruvate decarboxylase; In the step of synthesizing salidroside using tyrosol, salidroside is synthesized using glucosyltransferase, Preferably, the glucosyltransferase is derived from Rhodiola rosea; More preferably, the glucosyltransferase comprises the nucleic acid molecule set forth in SEQ ID NO: 4; A method wherein the glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10. 13. The method further comprises synthesizing tyrosol using a poppy-derived tyrosine decarboxylase and / or a tyrosine decarboxylase mutant in the step of synthesizing tyrosol using the carbon source; Preferably, the tyrosine decarboxylase mutant comprises the amino acid sequence set forth in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; the glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; More preferably, the tyrosine decarboxylase mutant comprises the nucleic acid molecule set forth in SEQ ID NO: 1; the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; Item 13. The method according to item 12. [Effects of the Invention]

[0009] (1) This application realizes the decoupling of microbial growth and product synthesis, reducing the metabolic pressure on the targeted pathway for genetically engineered bacteria and further improving production efficiency while increasing cell density. (2) This application relates to a tyrosine decarboxylase mutant TYDC Y350F By introducing this technology, we will design and construct a new precursor synthesis pathway, direct the metabolic flow to the synthesis of the target product, salidroside, and improve the economic benefits of fermentative production of salidroside. (3) The genetically engineered yeast of this application can directly synthesize salidroside by metabolizing glucose, methanol, galactose, glycerol, or trehalose. Compared with traditional plant extraction methods, this method is not restricted by climate or geographical conditions, is environmentally friendly, and the fermentation substrate is common and inexpensive, meeting the strategic needs of national green biomanufacturing. Furthermore, it is free of potential pathogenic factors, ensuring product quality and safety, making it suitable for applications in medicine, cosmetics, and other fields. [Brief explanation of the drawings]

[0010] [Figure 1] FIG. 1 shows the fermentation results of a de novo synthesis strain of salidroside. [Figure 2] 1 shows liquid chromatograms of standard salidroside and salidroside produced by recombinant strains under the same conditions. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present application will be further described below by way of examples. It should be understood that these examples are only used to further explain and illustrate the present application, and are not used to limit the present application.

[0012] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In experimental or practical use, methods and materials similar or equivalent to those described herein may be used; however, the materials and methods are described below. In the event of a conflict, the definitions contained herein shall prevail. Furthermore, the materials, methods, and examples are for illustrative purposes only and are not limiting. The present application will be further described below based on specific embodiments, but the scope of the present application is not limited thereto.

[0013] enzyme Benzoate dehydrogenase, derived from Saccharomyces cerevisiae, catalyzes the conversion of prephenate to 4-hydroxyphenylpyruvate and can be involved in tyrosine synthesis. Overexpression of benzoate dehydrogenase can promote tyrosine synthesis, thereby facilitating metabolic flux to salidroside.

[0014] In this application, benzoate dehydrogenase is abbreviated as TYR1.

[0015] Phenyrpuvate decarboxylase from Saccharomyces cerevisiae catalyzes the decarboxylation of phenylpyruvate to phenylacetaldehyde, the first specific step in the Ehrlich pathway. Overexpression of this phenylpyruvate decarboxylase can increase the level of tyrosol in Saccharomyces cerevisiae and increase the accumulation of the salidroside precursor.

[0016] In this application, phenylpyruvate decarboxylase is abbreviated as ARO10.

[0017] Glucosyltransferase from Rhodiola rosea catalyzes the glycosylation of tyrosol with uridine diphosphate glucose (UDPG) as the glycosylation donor to produce salidroside.

[0018] The glucosyltransferase in this application is a UDP-glucosyltransferase, abbreviated as U8GT3 or RvU8G3.

[0019] Tyrosine decarboxylase is a pyridoxal phosphate (PLP)-dependent decarboxylase derived from opium poppy. Tyrosine is catalyzed by this enzyme to produce tyramine, which is then catalyzed by monoamine oxidase to produce 4-hydroxyphenylacetaldehyde (4-HPAA). 4-HPAA is reduced by 4-hydroxybenzyl alcohol dehydrogenase (areB) to synthesize tyrosol, the aglycone of salidroside.

[0020] In one embodiment of the present application, the tyrosine decarboxylase is a tyrosine decarboxylase derived from poppy. In one embodiment of the present application, the tyrosine decarboxylase is a tyrosine decarboxylase variant of the present application.

[0021] The tyrosine decarboxylase mutant (TYDC) of the present application Y350F ) refers to a mutation of the original 350th tyrosine to phenylalanine, and its function has changed from catalyzing the decarboxylation of tyrosine to form tyramine to directly catalyzing the decarboxylation of tyrosine to produce 4-hydroxyphenylacetaldehyde.

[0022] DNA In the present application, the glucosyltransferase is derived from Rhodiola rosea.

[0023] In the present application, the GeneBank number of the gene encoding said glucosyltransferase is AUI41117.

[0024] In some embodiments of the present application, the amino acid sequence of the glucosyltransferase U8GT3 is set forth in SEQ ID NO:10.

[0025] In some embodiments of the present application, the nucleic acid molecule of glucosyltransferase U8GT3 is set forth in SEQ ID NO:4.

[0026] In the present application, the tyrosine decarboxylase is derived from the poppy (Papaver somniferum).

[0027] In some embodiments of the present application, the amino acid sequence of the poppy-derived tyrosine decarboxylase is set forth in SEQ ID NO:8.

[0028] In some embodiments of the present application, the nucleic acid molecule of the poppy-derived tyrosine decarboxylase is set forth in SEQ ID NO: 2. In the present application, the tyrosine decarboxylase mutant is a mutant in which tyrosine at position 350 is mutated to phenylalanine.

[0029] In some embodiments of the present application, the amino acid sequence of the tyrosine decarboxylase mutant is set forth in SEQ ID NO:7.

[0030] In some embodiments of the present application, the tyrosine decarboxylase mutant nucleic acid molecule is set forth in SEQ ID NO:1.

[0031] In some embodiments of the present application, the tyrosine decarboxylase is derived from Arabidopsis thaliana, and the amino acid sequence of tyrosine decarboxylase derived from Arabidopsis thaliana is set forth in SEQ ID NO:9.

[0032] In some embodiments of the present application, the nucleic acid molecule of tyrosine decarboxylase from Arabidopsis thaliana is set forth in SEQ ID NO:3.

[0033] In the present application, the GeneBank number of the gene encoding said phenylpyruvate decarboxylase is 851987.

[0034] In some embodiments of the present application, the amino acid sequence of the phenylpyruvate decarboxylase ARO10 is set forth in SEQ ID NO:11.

[0035] In some embodiments of the present application, the nucleic acid molecule of phenylpyruvate decarboxylase ARO10 is set forth in SEQ ID NO:5.

[0036] In the present application, the GeneBank number of the gene encoding said benzoate dehydrogenase is 852464.

[0037] In some embodiments of the present application, the amino acid sequence of the benzoate dehydrogenase TYR1 is set forth in SEQ ID NO:12.

[0038] In some embodiments of the present application, the benzoate dehydrogenase TYR1 nucleic acid molecule is set forth in SEQ ID NO:6.

[0039] biomaterials The present application provides a biomaterial that is either: A1) a nucleic acid molecule encoding a poppy-derived tyrosine decarboxylase and / or a nucleic acid molecule encoding a tyrosine decarboxylase variant; A2) an expression cassette comprising the nucleic acid molecule according to A1); A3) A recombinant vector comprising the nucleic acid molecule according to A1) or the expression cassette according to A2); A4) A recombinant microorganism comprising a nucleic acid molecule according to A1), or an expression cassette according to A2), or a recombinant vector according to A3), preferably the recombinant microorganism is a yeast.

[0040] See above for a description of the poppy tyrosine decarboxylase.

[0041] See above for a description of tyrosine decarboxylase mutants.

[0042] The present application provides a biomaterial that is either: B1) a nucleic acid molecule encoding glucosyltransferase U8GT3 from Rhodiola rosea; B2) an expression cassette comprising the nucleic acid molecule described in B1; B3) a recombinant vector comprising a nucleic acid molecule according to B1) or an expression cassette according to B2); B4) A recombinant microorganism comprising a nucleic acid molecule according to B1), or an expression cassette according to B2), or a recombinant vector according to B3), preferably the recombinant microorganism is a yeast.

[0043] For a description of glucosyltransferase U8GT3, see supra.

[0044] Production Process The present application provides the use of the glucosyltransferase U8GT3 and / or the poppy-derived tyrosine decarboxylase and / or the tyrosine decarboxylase mutant in increasing the yield of yeast synthesis of salidroside.

[0045] The present application provides the use of the above-mentioned poppy-derived tyrosine decarboxylase and / or the above-mentioned tyrosine decarboxylase mutant in increasing the yield of yeast synthesis of tyrosol.

[0046] The present application provides the use of the above biomaterials in the synthesis of tyrosol.

[0047] The present application provides a strain for producing salidroside, which comprises heterologously expressing one or more of the following genes a) to c) in yeast: a) the gene encoding glucosyltransferase U8GT3; b) a gene encoding tyrosine decarboxylase from poppy; c) Genes encoding tyrosine decarboxylase mutants.

[0048] See above for a description of glucosyltransferase U8GT3, poppy tyrosine decarboxylase and tyrosine decarboxylase mutants.

[0049] In some embodiments of the present application, a gene encoding phenylpyruvate decarboxylase ARO10 and / or a gene encoding benzoate dehydrogenase TYR1 are further heterologously expressed in yeast.

[0050] For a description of phenylpyruvate decarboxylase ARO10 and benzoate dehydrogenase TYR1, see above.

[0051] The present application provides a whole cell catalyst comprising the above strain or the above biomaterial.

[0052] The present application provides a method for producing salidroside and / or tyrosol using yeast, wherein the strain, the biomaterial, or the whole cell catalyst is used to ferment and produce salidroside and / or tyrosol.

[0053] The present application provides a method for producing salidroside, the method comprising the steps of: synthesizing tyrosol using a carbon source, and synthesizing salidroside using tyrosol, wherein in the step of synthesizing tyrosol using the carbon source, tyrosol is synthesized using benzoate dehydrogenase and phenylpyruvate decarboxylase, and in the step of synthesizing salidroside using tyrosol, salidroside is synthesized using glucosyltransferase.

[0054] In this application, tyrosine decarboxylase TYDC and tyrosine decarboxylase mutant TYDC Y350FThe effect of the tyrosine decarboxylase mutant TYDC on precursor synthesis was investigated. Y350F can significantly increase the accumulation of the precursor 4-HPAA, whereas tyrosine decarboxylase TYDC generates the by-product tyramine from tyrosine, reducing the synthesis of the precursor.

[0055] In some embodiments of the present application, the method for producing salidroside includes the following steps: synthesizing tyrosol using a carbon source, and synthesizing salidroside using tyrosol, wherein in the step of synthesizing tyrosol using a carbon source, tyrosol is synthesized using benzoate dehydrogenase, phenylpyruvate decarboxylase, and poppy-derived tyrosine decarboxylase and / or a tyrosine decarboxylase variant, and in the step of synthesizing salidroside using tyrosol, salidroside is synthesized using glucosyltransferase.

[0056] Tyrosine decarboxylase (TYDC) Y350F The mutant is one in which the 350th tyrosine has been mutated to phenylalanine, and its function has changed from catalyzing the decarboxylation of tyrosine to form tyramine to directly catalyzing the decarboxylation of tyrosine to produce 4-hydroxyphenylacetaldehyde.

[0057] See above for a description of glucosyltransferase U8GT3, poppy tyrosine decarboxylase and tyrosine decarboxylase mutants.

[0058] For a description of phenylpyruvate decarboxylase ARO10 and benzoate dehydrogenase TYR1, see above.

[0059] In some embodiments of the present application, yeast is used as a starting strain, and the above-mentioned benzoate dehydrogenase TYR1, phenylpyruvate decarboxylase ARO10, tyrosine decarboxylase TYDC, Y350FGenetically engineered yeast cells are constructed by introducing nucleic acid molecules encoding the galactose-inducible promoter U8GT3 and the glucosyltransferase U8GT3, and all of the introduced genes are controlled by a galactose-inducible promoter.

[0060] In some embodiments of the present application, the method for producing salidroside is fermentation using a genetically engineered fungus.

[0061] In some embodiments of the present application, the strain is any yeast suitable for the system of the present application, such as Saccharomyces cerevisiae, Candida, Rhodotorula, Pichia, brewer's yeast, Candida, wine yeast, Saccharomyces pastorianus, aromatic yeast, Geotrichum candidum, etc., and is preferably Saccharomyces cerevisiae.

[0062] In some embodiments of the present application, OD 600 Galactose is added during fermentation until the OD of the fermentation culture reaches 8 to 15. 600 can be 8, 9, 10, 11, 12, 13, 14, 15, or any range therebetween. In some embodiments of the present application, the galactose concentration is 1 to 4 g / L. For example, the galactose concentration can be 1 g / L, 2 g / L, 3 g / L, 4 g / L, or any range therebetween.

[0063] In some embodiments of the present application, the fermentation time is 90 to 120 hours, for example, 90 hours, 95 hours, 100 hours, 105 hours, 110 hours, 115 hours, 120 hours, or any range therebetween.

[0064] The present application provides a combination of enzymes, the combination of enzymes comprising benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase, or the combination of enzymes comprising benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase.

[0065] In this application, the term "enzyme combination" refers to a combination of benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase, or a combination of benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase. In this application, the term "enzyme combination" refers to a combination of enzyme functions, i.e., a physical mixture of three or four enzyme proteins, such as a direct mixture of purchased pure enzymes, or a direct mixture of crude enzyme solutions or purified enzymes produced by recombinant expression using molecular biology methods. The enzyme combination may also be a fusion protein formed by fusing three or four enzymes into a three-dimensional protein structure, as long as each enzyme can perform its corresponding function. Similarly, the enzyme combination may be a simple mixture of any two-enzyme fusion protein with two other enzymes, or a simple mixture of any three-enzyme fusion protein with one other enzyme, or a simple mixture of any two-enzyme fusion protein with two other enzymes. Alternatively, it may be a simple mixture of a fusion protein of any two enzymes and one other enzyme, or it may be a fusion protein of any three enzymes, or it may be a fusion protein of any three enzymes.

[0066] Similarly, the present application does not limit the process for producing enzymes by recombinant gene expression using molecular biological techniques, and any known method can be used. In the present application, four enzymes or a fusion protein of three enzymes can be simultaneously expressed in one plasmid using the same host, or one or two enzymes or enzyme fusion proteins can be produced using different hosts.

[0067] In some embodiments of the present application, the combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase; or the combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, and a glucosyltransferase; or the combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase, or the combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase, or the combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase, or The combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, and a fusion protein formed by glucosyltransferase and tyrosine decarboxylase.

[0068] In some embodiments of the present application, the combination is a mixture of a fermentation crude enzyme solution of benzoate dehydrogenase, a fermentation crude enzyme solution of phenylpyruvate decarboxylase, and a fermentation crude enzyme solution of glucosyltransferase.

[0069] In some embodiments of the present application, the combination is a mixture of a fermentation crude enzyme solution of benzoate dehydrogenase, a fermentation crude enzyme solution of phenylpyruvate decarboxylase, a fermentation crude enzyme solution of glucosyltransferase, and a fermentation crude enzyme solution of tyrosine decarboxylase.

[0070] In some embodiments of the present application, the combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase, or a composition of a fusion protein of benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase, or a composition of a fusion protein of benzoate dehydrogenase, phenylpyruvate decarboxylase, and a fusion protein of glucosyltransferase and tyrosine decarboxylase.

[0071] The present application provides a whole cell catalyst comprising the genetically engineered fungus or a combination of the genetically engineered fungi.

[0072] The present application provides a method for producing salidroside, which includes using the above enzyme combination. [Example]

[0073] Example 1 Cloning of the genes required for salidroside synthesis. Regarding the enzymes from plants or microorganisms required for the synthesis pathway of salidroside, various plant sources were identified through the National Library of Medicine (NCBI) (https: / / www.ncbi.nlm.nih.gov / ) and literature searches, and the corresponding amino acid sequences or gene sequences were found.

[0074] The obtained gene sequence was codon-optimized to match the corresponding yeast host using a codon optimization algorithm developed by Genscript Biotech, and the resulting gene sequence was identified as tyrosine decarboxylase TYDC as shown in the sequence listing. Y350F The nucleic acid molecule of this gene is shown in SEQ ID NO: 1, and the nucleic acid molecule of glucosyltransferase U8GT3 is shown in SEQ ID NO: 4. Furthermore, the gene of interest was directly synthesized in the universal plasmid pESC series equipped with a galactose promoter (pGAL1 or pGAL10) to obtain a recombinant plasmid with the gene of interest ligated thereto. Details are shown in Table 1.

[0075] [Table 1]

[0076] Example 2 Construction of genetically engineered bacteria. 2.1 Experimental materials The experimental materials used in this example were primers 1-F and 1-R, and primers 2-F and 2-R. Primer 1-F: ttaacgtcaaggagaaaaaaccccggatccatggtatcagaggataagattgagc (SEQ ID NO: 13) Primer 1-R: tagctagccgcggtaccaagcttactcgagttatgtatttcttttttcagcggcc (SEQ ID NO: 14) Primer 2-F: tccttgtaatccatcgatactagtgcggccgcctattttttatttcttttaagtgccgct (SEQ ID NO: 15) Primer 2-R: tcgaattcaaccctcactaaagggcggccgcatggcacctgttacaattgaaaag (SEQ ID NO: 16)

[0077] 2.2 Construction of pESC-TYR1-Aro10 recombinant plasmid 1) Construction of vector fragment The pESC vector was simultaneously treated with the endonucleases NotI and BamHI (purchased from NEB) according to the enzyme digestion system shown in Table 2, and the prepared enzyme digestion system was placed in a 37°C water bath for 1 hour. After enzyme digestion, the backbone and promoter were purified and recovered using a gel recovery kit (purchased from Thermo Fisher Scientific), yielding purified Backbone1 fragment and Gal1-Gal10 dual promoter fragment.

[0078] [Table 2]

[0079] 2) Amplification and recovery of target genes

[0080] [Table 3]

[0081] [Table 4]

[0082] 2x Phanta Flash Master Mix purchased from Nanjing Vazyme Biotech Co., Ltd. was used as the amplification enzyme, and primers 1-F, 1-R, 2-F, and 2-R were used to clone the TYR1 and Aro10 genes, respectively. The PCR reaction system and reaction procedures are shown in Tables 3 and 4. The amplified genes Aro10 and TYR1 were DNA purified and recovered using a gel recovery kit purchased from Thermo Fisher Scientific.

[0083] 3) In vitro multi-fragment ligation by SOE-PCR

[0084] [Table 5]

[0085] The purified TYR1, Aro10, and Gal1-Gal10 promoter fragments were ligated and amplified by SOE-PCR. The resulting TYR1, Aro10, and Gal1-Gal10 promoter fragments were used as templates for PCR using 2x Phanta Flash Master Mix (purchased from Nanjing Vazyme Biotech Co., Ltd.) as the amplification enzyme and primers 1-F and 2-R. The PCR reaction system is shown in Table 5, and the PCR procedure is shown in Table 4. The ligated and amplified gene, TYR1-Gal1-Gal10-Aro10, was purified and recovered using a gel recovery kit (purchased from Thermo Fisher Scientific).

[0086] 4) Gibson ligation The TYR1-Gal1-Gal10-Aro10 fragment was ligated to the Backbone1 fragment using the Gibson ligation method to construct the recombinant plasmid pESC-TYR1-Aro10. The NEBuilder® HiFi DNA Assembly Master Mix used was obtained from NEB. The ligation reaction system is shown in Table 6, with a vector to insert ratio of 1:2. The prepared ligation system was placed in a 50°C water bath, and after 60 minutes, the ligation product was removed and transformed into E. coli DH5α.

[0087] [Table 6]

[0088] 5) Chemical transformation of E. coli Competent E. coli DH5α cells were removed from the ultra-low temperature refrigerator and placed on ice to thaw. 10 μL of Gibson ligation product was added to the thawed competent cells, mixed by gently flicking, and placed in an ice bath for 30 minutes. The cells were heat shocked in a 42°C water bath for 90 seconds, removed, and placed in an ice bath for 2 minutes. 200 μL of LB liquid medium was added and cultured at 37°C and 220 rpm for 60 minutes. In a clean bench, an appropriate amount of the bacterial suspension was spread on LB solid medium containing ampicillin (100 mg / L) and cultured overnight in an incubator at 37°C, inverted.

[0089] 6) Sequencing verification After single colonies grew on the plates, colony PCR was used to screen and identify the recombinant plasmids. 2x Rapid Taq Master Mix (purchased from Nanjing Vazyme Biotech Co., Ltd.) was used as the amplification enzyme, and the colony PCR reaction system is shown in Table 7. After preparation was complete, a single E. coli colony was picked up in a clean bench using a sterile pipette tip and added to 10 μL of sterile water. It was then completely dissolved. 1 μL of the mixture was added as template to the colony PCR reaction system, and gene amplification was performed according to the reaction procedure in Table 8.

[0090] [Table 7]

[0091] [Table 8]

[0092] The PCR product was verified by agarose gel electrophoresis, and a single colony containing the desired band was selected and inoculated into LB medium containing ampicillin (100 mg / L) and grown overnight at 37°C and 220 rpm. The corresponding plasmid was extracted using a plasmid miniprep kit purchased from Tiangen Biotech (Beijing) Co., Ltd. and sent to Suzhou Genewiz for gene sequencing verification.

[0093] 2.2 Construction of SAD1, SAD2, SAD3, SAD4, and SAD5 strains Using the genes listed in Table 9 as templates for the integration plasmids, linearized fragments for integration into the yeast genome were amplified by PCR (the reaction system and procedures are shown in Tables 3 and 4). The target gene fragments containing the homologous arms of the integration site were isolated by agarose gel electrophoresis and gel recovery. Yeast was then transformed according to the method described in Application Example 1. The transformed yeast underwent homologous recombination with the chassis host genome using the 40-bp homologous arms on either side of the integration site on the target fragment, resulting in the integration of the expression cassette containing the fusion gene into the target site in the yeast chassis genome. ARO10 and TYR1 were integrated into the UAR3 deletion site of Saccharomyces cerevisiae (designated CEN.PK2-ΔURA3::ARO10-TYR1, and the yeast was named SAD1). Based on this chassis strain (SAD1), U8GT3 was integrated into the GAL80 site (designated SAD2-ΔGAL80::U8GT3, and the yeast was named SAD2). Y350F was inserted into the HIS3 site (SAD2-ΔHIS3::TYDC Y350F(The yeast was designated SAD3.) Based on this chassis fungus (SAD2), a tyrosine decarboxylase from poppy (abbreviated as TYDC) was inserted into the HIS3 site (SAD2-ΔHIS3::TYDC, and the yeast was designated SAD4.) Based on this chassis fungus (SAD2), a tyrosine decarboxylase from Arabidopsis (abbreviated as AtTYDC) was inserted into the HIS3 site (SAD2-ΔHIS3::AtTYDC, and the yeast was designated SAD5.

[0094] PCR verification of yeast transformants After transformation, the coated plates were inverted and cultured at 30°C for 2–3 days. After single colonies grew on the plates, they were picked and inoculated into SC liquid medium and cultured overnight at 30°C and 220 rpm. The genome of the overnight yeast culture was extracted using a yeast genome extraction kit and used as a template for PCR verification. The PCR method and procedure are listed in Tables 3 and 4. For transformants on the plates, cells were disrupted at selected spots, and two genomic primers were selected (see Table 10 for details). PCR was performed to confirm whether the target gene had been integrated into the genome. Correct band size and sequencing results indicated successful genome integration.

[0095] [Table 9]

[0096] [Table 10]

[0097] Example 3 Genetically engineered strains of Saccharomyces cerevisiae capable of de novo synthesis of salidroside were fermented in shake flasks. SAD1, SAD2, SAD3, SDA4, and SAD5 were all cultured under the same conditions. First, a YPD plate was streaked to obtain a single colony, which was then inoculated into 50 mL of YPD liquid medium. SAD1, SAD2, SAD3, SDA4, and SAD5 were cultured at 30°C and 250 rpm until the OD of the strain reached 100 μg. 600 The culture was continued until the initial OD was approximately 6. 600 When the OD was 0.4, the cells were transferred to 20 mL of YPD liquid medium (glucose concentration 2%). 600 When the β-glucan concentration reached about 12, the concentration of added galactose had to be stabilized at 2 g / L, and the whole fermentation cycle was maintained for about 120 h.

[0098] [Table 11]

[0099] One mL of the fermentation supernatant was collected and filtered through a 0.22 μm organic filter. Next, 10 μL of the sample was separated using a Shimadzu LC-20A (Shimadzu) HyPURITY™ C18 HPLC (250 mm x 4.6 mm, 3 μm, Ultimate LP-C18) column. Mobile phase A was 0.1% formic acid in water, and mobile phase B was 0.1% acetonitrile. Each intermediate and product were separated by isocratic separation using 8% mobile phase B and 92% mobile phase A. Salidroside was detected at a wavelength of 224 nm using a UV detector.

[0100] The results are shown in Figures 1 and 2. As can be seen from the yields of salidroside obtained by fermentation with the SAD3, SDA4, and SAD5 strains, TYDC Y350F When RvU8G3 and AtTYDC were heterologously expressed in the strain, the yield of salidroside reached 803.1 mg / L. Compared with SDA4, which heterologously expresses AtTYDC and RvU8G3 derived from Arabidopsis, and SAD5, which heterologously expresses TYDC and RvU8G3 derived from poppy, the yield increased by 18% and 22%, respectively, significantly improving the yield of salidroside.

[0101] The present application has been disclosed through the above examples, but the present application is not limited to them. A person skilled in the art can make some changes and modifications without departing from the spirit and scope of the present application. Therefore, the scope of protection of the present application shall be determined by the scope of the patent application attached hereto.

[0102] JPEG2026502945000012.jpg212170JPEG2026502945000013.jpg220170JPEG2026502945000014.jpg215170JPEG2026502945000015.jpg204170 JPEG2026502945000016.jpg211170JPEG2026502945000017.jpg204170JPEG2026502945000018.jpg212170JPEG2026502945000019.jpg167170

Claims

1. Use of glucosyltransferase U8GT3 and / or poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of salidroside.

2. Use of poppy-derived tyrosine decarboxylase and / or tyrosine decarboxylase mutants in increasing the yield of yeast synthesis of tyrosol.

3. the tyrosine decarboxylase mutant comprises the amino acid sequence shown in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; The glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; 3. Use according to claim 1 or 2.

4. the tyrosine decarboxylase mutant comprises a nucleic acid molecule set forth in SEQ ID NO: 1; the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; 4. Use according to claim 1 or 2 or 3.

5. A strain for producing salidroside, the strain comprising a gene encoding glucosyltransferase U8GT3 and a gene encoding tyrosine decarboxylase; Preferably, the tyrosine decarboxylase gene is a gene encoding a poppy-derived tyrosine decarboxylase or a gene encoding a poppy-derived tyrosine decarboxylase mutant, More preferably, The glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; the poppy-derived tyrosine decarboxylase mutant is a tyrosine decarboxylase in which the 350th tyrosine is mutated to phenylalanine, and comprises the amino acid sequence shown in SEQ ID NO: 7; Most preferably, the strain from which the enzyme is derived is Saccharomyces cerevisiae.

6. the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2; the tyrosine decarboxylase mutant comprises a nucleic acid molecule set forth in SEQ ID NO: 1; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; The strain of claim 5.

7. Furthermore, a gene encoding phenylpyruvate decarboxylase ARO10 and / or a gene encoding benzoate dehydrogenase TYR1 are heterologously expressed in yeast, Preferably, the phenylpyruvate decarboxylase ARO10 comprises the amino acid sequence shown in SEQ ID NO: 11; the benzoate dehydrogenase TYR1 comprises the amino acid sequence shown in SEQ ID NO: 12; More preferably, the phenylpyruvate decarboxylase ARO10 comprises a nucleic acid molecule set forth in SEQ ID NO: 5; The benzoate dehydrogenase TYR1 comprises a nucleic acid molecule set forth in SEQ ID NO: 6; The strain according to claim 5 or 6.

8. 1. A biomaterial, which is any of the following: A1) a nucleic acid molecule encoding a poppy-derived tyrosine decarboxylase and / or a nucleic acid molecule encoding a tyrosine decarboxylase variant; A2) an expression cassette comprising the nucleic acid molecule according to A1); A3) A recombinant vector comprising the nucleic acid molecule according to A1) or the expression cassette according to A2); Preferably, the tyrosine decarboxylase mutant comprises the amino acid sequence shown in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; More preferably, the tyrosine decarboxylase mutant comprises a nucleic acid molecule set forth in SEQ ID NO: 1; A biological material, wherein the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO:

2.

9. 1. A biomaterial, which is any of the following: B1) a nucleic acid molecule encoding glucosyltransferase U8GT3; B2) an expression cassette comprising the nucleic acid molecule described in B1; B3) A recombinant vector comprising the nucleic acid molecule according to B1) or the expression cassette according to B2); Preferably, The glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; More preferably, A biological material, wherein the glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO:

4.

10. A whole cell catalyst comprising the strain according to any one of claims 5 to 7 or the biomaterial according to any one of claims 8 to 9.

11. A method for producing salidroside and / or tyrosol using yeast, comprising producing salidroside and / or tyrosol by fermentation using the strain according to any one of claims 5 to 8, the biomaterial according to any one of claims 9 to 10, or the whole cell catalyst according to claim 11, Preferably, OD ６００ adding galactose during fermentation culture until the pH reaches 8 to 15; More preferably, the concentration of the galactose is 1 to 4 g / L, More preferably, the fermentation time is 90 to 120 hours; Most preferably, the method wherein said strain is Saccharomyces cerevisiae.

12. 1. A method for producing salidroside, comprising the steps of: synthesizing tyrosol using a carbon source; and synthesizing salidroside using tyrosol, In the step of synthesizing tyrosol using the carbon source, tyrosol is synthesized using benzoate dehydrogenase and phenylpyruvate decarboxylase; In the step of synthesizing salidroside using tyrosol, salidroside is synthesized using glucosyltransferase, Preferably, the glucosyltransferase is derived from Rhodiola rosea; More preferably, the glucosyltransferase comprises the nucleic acid molecule set forth in SEQ ID NO:4; The method, wherein the glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO:

10.

13. the method further comprises synthesizing tyrosol using a poppy-derived tyrosine decarboxylase and / or a tyrosine decarboxylase mutant in the step of synthesizing tyrosol using the carbon source; Preferably, the tyrosine decarboxylase mutant comprises the amino acid sequence shown in SEQ ID NO: 7; the poppy-derived tyrosine decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 8; The glucosyltransferase U8GT3 comprises the amino acid sequence set forth in SEQ ID NO: 10; More preferably, the tyrosine decarboxylase mutant comprises a nucleic acid molecule set forth in SEQ ID NO: 1; the poppy-derived tyrosine decarboxylase comprises the nucleic acid molecule shown in SEQ ID NO: 2; The glucosyltransferase U8GT3 comprises a nucleic acid molecule set forth in SEQ ID NO: 4; The method of claim 12.

Images