Inductive structures

Abstract

The present disclosure provides inducible constructs comprising transcription initiation and / or transcriptional regulatory elements. These constructs can be used to drive gene expression in response to specific cellular conditions (e.g., in the context of antigenic stimulation). In some embodiments, the constructs are incorporated as part of regulatory circuits useful for controlling the expression and regulation of cells expressing the engineered receptor.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 479,176, filed January 9, 2023, U.S. Provisional Patent Application No. 63 / 479,178, filed January 9, 2023, and U.S. Provisional Patent Application No. 63 / 479,177, filed January 9, 2023, the contents of which are incorporated herein by reference in their entireties.

[0002] (Reference to sequence listing) The contents of the electronic sequence listing (OTPC_034_01WO_SeqList_ST26.xml, size: 8,670,645 bytes, and creation date: January 03, 2024) are incorporated herein by reference in their entirety. [Background technology]

[0003] Exhausted endogenous or unmodified immune cells (e.g., T cells) may lose their high proliferative capacity and cytotoxicity, ultimately leading to cell death. Numerous factors, such as persistent antigen exposure (e.g., during infection) and the presence of certain alloantigens after organ transplantation, can lead to immune cell exhaustion. In addition, some tumor- and cancer-associated cells can actively induce cell exhaustion at the tumor site, thus conferring tumor protection from endogenous or unmodified T cell activity. Immune cell exhaustion is also seen in the context of engineered T cell therapy. Engineered immune cells expressing chimeric antigen receptors (CARs) or T cell receptors (TCRs) may be subject to exhaustion in the same way as endogenous or unmodified T cells, thus potentially reducing their therapeutic efficacy.

[0004] There is an unmet need to increase the efficacy of engineered immune cell therapies by reducing exhaustion and increasing durability. The present disclosure addresses this need by providing compositions and methods for delaying or reducing immune cell exhaustion. Summary of the Invention

[0005] The present disclosure provides one or more inducible nucleic acid constructs, each construct comprising a transcription initiation factor, or a transcription initiation factor and a transcriptional regulator. In some embodiments, the constructs may not be naturally occurring, and the transcriptional regulator and transcription initiation factor each comprise concatemers of transcription factor binding motifs for binding more than one unique transcription factor or for binding the same transcription factor at more than one site. In some embodiments, the one or more nucleic acid constructs comprising the transcription initiation factor or transcriptional regulator may sense a cellular condition and have a sequence selected from any one or more of SEQ ID NOS: 175-9790. In another aspect, provided herein is the use of one or more nucleic acid constructs to select one or more sequences that respond to one or more cellular conditions, including antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

[0006] Disclosed herein are nucleic acid constructs comprising a transcription initiation factor or a transcription initiation factor and a transcriptional regulatory factor. In some embodiments, the transcriptional regulatory factor and the transcription initiation factor each comprise a concatemer of transcription factor binding motifs for binding more than one unique transcription factor or for binding the same transcription factor at more than one site, wherein the construct is not naturally occurring.

[0007] In some embodiments, the nucleic acid construct comprises a transcriptional regulatory element and a transcription initiation element. In some embodiments, the transcriptional regulatory element is located 5' of the transcription initiation element, or the transcriptional regulatory element is located 3' of the transcription initiation element.

[0008] In some embodiments, the construct does not include a combination of a transcriptional regulatory element including an NFAT sequence, an IRF4 sequence, an AICE sequence, and an ISRE sequence with a transcription initiation element including a human beta globin sequence. In some embodiments, the construct does not include the sequence of GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

[0009] In some embodiments, the construct does not include a combination of a transcriptional regulatory element comprising an NFAT sequence and a transcription initiation element comprising a YB-TATA sequence.

[0010] In some embodiments, the construct does not comprise the sequence of GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

[0011] In some embodiments, a concatemer of a transcriptional regulator comprises two or more repeat sequences, wherein the two or more repeat sequences either comprise the same sequence or do not comprise the same sequence.

[0012] In some embodiments, a concatemer of transcription factor regulators binds to more than one unique transcription factor and / or binds to the same transcription factor at more than one site.

[0013] In some embodiments, the concatemer comprises a linking sequence positioned between the repeat sequences, and the linking sequence may comprise one or more of TACGCT, TGATCT, TGCTTT, and TGCCCGT.

[0014] In some embodiments, the transcriptional regulator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0015] In some embodiments, the transcriptional regulator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0016] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0017] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0018] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0019] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0020] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0021] In some embodiments, the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0022] In some embodiments, the transcriptional regulator is inducible or the construct is inducible.

[0023] In some embodiments, the transcription initiation element comprises a classical promoter, including a minimal promoter.

[0024] In some embodiments, the minimal promoter comprises sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta globin.

[0025] In some embodiments, the minimal promoter comprises one or more of MinP1 having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788), MinP2 having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789), and MinP3 having the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0026] In some embodiments, the transcription initiation factor comprises a transcription factor binding motif.

[0027] In some embodiments, the transcription initiation element comprises a motif isolated or derived from an untranslated genomic sequence of a transcription factor or comprises a mammalian promoter sequence.

[0028] In some embodiments, the motif comprises a sequence isolated or derived from one or more of the untranslated genomic sequences of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0029] In some embodiments, the transcription initiation factor comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0030] In some embodiments, the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0031] In some embodiments, the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0032] In some embodiments, the transcription initiation element comprises a sequence derived from the untranslated genomic sequence of REL, and optionally comprises any one or more of the sequences of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0033] In some embodiments, the transcription initiation element comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

[0034] In some embodiments, the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0035] In some embodiments, the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0036] In some embodiments, the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally comprises any one or more of the sequences set forth in SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0037] In some embodiments, the transcription initiation factor comprises any one or more of the sequences of SEQ ID NOs: 175-9781, or concatemers thereof.

[0038] In some embodiments, the construct further comprises an integration sequence that can direct or increase insertion of the construct into the target site.

[0039] In some embodiments, the vector or chromosome comprises a targeting site.

[0040] In some embodiments, the integration sequence comprises a first integration sequence or a 5' integration sequence and a second integration sequence or a 3' integration sequence.

[0041] In some embodiments, the integration sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

[0042] In some embodiments, the integration sequence comprises a transposable element to facilitate transposition, and in some embodiments, the transposable element comprises an insertion sequence and / or a transposon sequence.

[0043] In some embodiments, the integration sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

[0044] In some embodiments, the integration sequence comprises a first 5' terminal repeat sequence and a second 3' terminal repeat sequence.

[0045] In some embodiments, the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR) sequence.

[0046] In some embodiments, the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat (ITR) sequence.

[0047] In some embodiments, the construct further comprises a reporter sequence.

[0048] In some embodiments, the reporter sequence comprises a fluorescent protein, including green fluorescent protein (GFP).

[0049] Also disclosed herein are vectors that can include the above-described constructs. The vectors can include mammalian expression vectors capable of expressing the constructs in mammalian cells. The vectors can also include expression vectors capable of expressing the constructs in human cells. In some embodiments, the vectors can include delivery vectors capable of delivering the constructs to mammalian or human cells.

[0050] Also disclosed herein are libraries that can include the above constructs or the above vectors.

[0051] In some embodiments, the library may comprise a plurality of the constructs described above or a plurality of the vectors described above.

[0052] Also disclosed herein are cells comprising the above constructs, vectors, or libraries. In some embodiments, the cells are immune cells, stem cells, progenitor cells, precursor or naive cells, differentiated cells, T cells, B cells, macrophages, or NK cells, in vitro or ex vivo, primary cells, or cultured cells.

[0053] Also disclosed herein is a use of the above construct, vector, and vector; the above library; or the above cell for selecting sequences that respond to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation. In some embodiments, the cell stimulation may be early stimulation or late stimulation.

[0054] In some embodiments, the antigen receptor is a chimeric antigen receptor.

[0055] In some embodiments, the cell is a T cell and the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0056] Also disclosed herein is the use of the above construct, the above vector, and the above vector; the above library; or the above cell for regulating the transcription of an exogenous protein in response to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

[0057] In some embodiments, the exogenous protein is one or more of an engineered receptor, a cytokine, or a degrader. [Brief explanation of the drawings]

[0058] Various objects and advantages of the present invention as well as a more complete understanding thereof will become apparent and will be more readily appreciated by reference to the following detailed description and appended claims, taken in conjunction with the accompanying drawings. [Figure 1A] FIG. 1 shows a schematic of an exemplary CAR degradation feedback loop initiated by signaling through CAR. [Figure 1B] 1 shows a graph of the proposed time course expression of CAR and degradation factors in immune cells in the presence of antigen stimulation, with degradation factor expression being driven by a cellular state at or near exhaustion. [Figure 1C] 1 shows a graph of the proposed time course expression of CAR and degradation factors in immune cells in the presence of antigen stimulation, with degradation factor expression being driven by a cellular state at or near exhaustion. [Figure 1D] 1 shows a graph of the proposed time course expression of CAR and degradation factors in immune cells in the presence of antigen stimulation, with degradation factor expression being driven by a cellular state at or near exhaustion. [Figure 2]Schematic diagrams showing exemplary patterns of activity induced by constructs of the present disclosure in response to either (1) pulsed T cell stimulation (left panel) or (2) sustained T cell stimulation sufficient to exhibit T cell exhaustion (right panel). Pulsed and sustained stimulation (with or without exhaustion) each represent useful transcriptional dynamics for inducible constructs of the present disclosure. As shown in the exemplary pulsed stimulation condition in the left panel, the activity of the "stimulation-on" promoter is low until T cells are stimulated with antigen, at which point activity transiently increases. In the exemplary pulsed stimulation condition, the "stimulation-on" activity of the promoter decreases as antigen available to T cells is removed, but increases again upon repeated antigen stimulation. As shown in the exemplary pulsed stimulation condition in the left panel, the activity of the "stimulation-off" promoter is high until T cells are stimulated with antigen, at which point activity transiently decreases. In the exemplary pulsed stimulation condition, the "stimulation-off" activity of the promoter increases as antigen available to T cells is removed, but decreases again upon repeated antigen stimulation. As shown in the right-hand diagram, for the constant stimulation condition, the activity of the "stim-on" promoter is low until the T cell is stimulated with antigen, at which point activity increases. As shown in the right-hand diagram, for the constant stimulation condition, the activity of the "stim-off" promoter is high until the T cell is stimulated with antigen, at which point activity decreases. In the right-hand diagram, for the constant stimulation condition, the T cell may undergo exhaustion after a period of stimulation. In some embodiments of the present disclosure, the activity of the stimulus-on promoter may be induced at or before the onset of T cell exhaustion to prevent or delay the onset of exhaustion. In some embodiments of the present disclosure, the activity of the stimulus-off promoter may be reduced at or before the onset of T cell exhaustion to prevent or delay the onset of exhaustion. [Figure 3]Figure 1 shows a schematic diagram depicting a series of exemplary constructs used in a Massively Parallel Reporter Assay (MPRA) (top panel) and the experimental design for collecting and sequencing RNA and DNA at each time point for unstimulated, stimulated, and resting conditions tested. RNA-seq was used to measure transcription, and DNA-seq was used to normalize for enhancer-promoter (EP) pair copy number. Approximately one million combinations of 50,000 different enhancer sequences were used to form unique combinations with 9,000 promoter sequences in the construct format shown in this figure. A library of over one million constructs was functionally tested to identify constructs with inducible patterns of activity under conditions such as stimulated, unstimulated, pulsed, sustained, resting, and exhausted, or under induced cellular states. Briefly, the MPRA involved thawing T cells on day 0, transduction of thawed cells with a "tool" CAR on day 1, and CD19+ enrichment on day 4 (see Example 1 for detailed protocol). Each stimulated or unstimulated condition began on day 7 for thawing on day 0. Dormancy began on day 14 for thawing on day 0. Abbreviations: long terminal repeat (LTR), barcode (BC), 5' untranslated region (UTR), green fluorescent protein (GFP). [Figure 4] 1 is a series of graphs showing four exemplary activity patterns of four EP pairs from a library containing hundreds or thousands of EP pairs. In each plot, the activity of an exemplary construct is shown as transcription rate (left) or logarithmic transcription rate (right) as a function of time (expressed in days). [Figure 5]

[0023] Figure 1 is a series of graphs showing exemplary activity patterns of EP pairs selected for deeper characterization. From over one million constructs, approximately 174 constructs were selected for further analysis. In each plot, the activity of an exemplary construct is shown as transcription rate (left) or logarithmic transcription rate (right) as a function of time (expressed in days). [Figure 6A]6A and 6B are schematic diagrams illustrating the functional characteristics of EP pairs. Figure 6A shows an experimental timeline of the procedure described in Figure 6B. The experimental protocol is provided in Example 1. This initial screening was designed to (1) determine which EP pairs can drive protein expression and (2) roughly classify EP pairs into stimulus-on, stimulus-off, and oscillatory categories based on qualitative behavioral patterns. [Figure 6B] 6A and 6B are schematic diagrams illustrating the functional characteristics of EP pairs. Figure 6A shows an experimental timeline of the procedure described in Figure 6B. The experimental protocol is provided in Example 1. This initial screening was designed to (1) determine which EP pairs can drive protein expression and (2) roughly classify EP pairs into stimulus-on, stimulus-off, and oscillatory categories based on qualitative behavioral patterns. [Figure 7] 1 is a series of graphs showing the activity of either a control construct or a construct containing an EP pair of the present disclosure under both stimulated and unstimulated conditions. For each plot, normalized fluorescence (shown in arbitrary units of fluorescence) and confluence (shown as percent) are shown as a function of time (measured in days). For the control construct, MND activity is known to be constitutive, whereas the activity of concatemerized NFkB (10×NFkB) has been shown in the present disclosure to be inducible in the presence of antigen and thus follows a stimulus-on pattern. For the EP pair constructs, the low confluence in this experiment made it difficult to identify constructs that were active under unstimulated conditions. However, some EP pair constructs were observed to have inducible activity under stimulated conditions. [Figure 8A]8A-8B are a series of plots showing the dynamic range of EP pairings characterized according to the protocol described in Figures 6A-B. Figure 8A shows the maximum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8B shows the minimum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8C shows the range of expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. In some embodiments, constructs with a larger dynamic range, including minimum expression under unstimulated conditions, are desirable constructs for stimulated ON circuits. [Figure 8B] 8A-8B are a series of plots showing the dynamic range of EP pairings characterized according to the protocol described in Figures 6A-B. Figure 8A shows the maximum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8B shows the minimum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8C shows the range of expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. In some embodiments, constructs with a larger dynamic range, including minimum expression under unstimulated conditions, are desirable constructs for stimulated ON circuits. [Figure 8C] 8A-8B are a series of plots showing the dynamic range of EP pairings characterized according to the protocol described in Figures 6A-B. Figure 8A shows the maximum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8B shows the minimum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8C shows the range of expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. In some embodiments, constructs with a larger dynamic range, including minimum expression under unstimulated conditions, are desirable constructs for stimulated ON circuits. [Figure 9]

[0023] Figure 1 is a series of figures showing both RNA and protein produced from exemplary constructs containing EP pairings of the present disclosure. As shown in the right panel, not all RNA and protein data qualitatively align. However, each construct of the present disclosure can be functionally characterized with respect to transcriptional activity as a function of cellular activity (e.g., contact with antigen) or cellular state (e.g., stimulation and / or exhaustion). In some embodiments, the presence or absence of a 5' UTR sequence, or the composition of the 5' UTR sequence, affects the translational behavior of transcripts produced under the control of a construct of the present disclosure. [Figure 10] This is a repeat of the study carried out in Figure 9. Of note, at a higher confluency compared to the Figure 9 study, this study provides data for the no stimulus condition. [Figure 11]

[0023] Figure 1 shows a pair of schematic diagrams depicting pooled screening of constructs comprising the disclosed EP pair (see SEQ ID NOS: 1-174), each driving expression of a "tool" CAR in T cells (top), and the experimental design for screening (bottom). The control construct comprises a constitutive MND promoter and an inducible lOxNFkB promoter. [Figure 12] 1 is a pair of graphs showing the selection of candidate constructs for enrichment based in part on the negative selection of exhausted T cells (identified in this embodiment as CD39+TIGIT+). [Figure 13]Figure 1 shows a schematic diagram illustrating the experimental design of a three-donor confirmatory assay using the best-performing EP pairs identified in a preliminary screen using only a single donor. In the preliminary screen, test constructs included 26 constructs containing EP pairs driving the tool CAR construct and four control constructs (MND and 10xNFkB promoters driving the expression of the tool CAR, each control promoter with and without a barcode). The preliminary screen was designed to identify constructs that showed the most effective killing of target cancer cells in vitro compared with the activity of each of the control constructs. In this confirmation screen, nine constructs containing the selected EP pairs driving the tool CAR construct (see Figures 14 and 15) and two control constructs (same as in the preliminary screen) were used. [Figure 14] 14A-14C are a series of graphs showing target cell killing data from each round of the validation study described in FIG. 13. In each round, the ability of each construct to drive expression of the tool CAR and kill target cancer cells (H1975 mKate cells) is represented as the number of target cells normalized to time = zero as a function of time (expressed in hours). The data demonstrate that the "OTP-CSF2" EP pairing exhibits comparable killing to a construct containing a control 10xNFkB promoter construct driving expression of the same CAR. The data further demonstrate that the "RPS6KA1-RSRP1" EP pairing can be used as a regulated alternative to the constitutive control promoter MND. [Figure 15]14 is a series of graphs showing cytokine secretion (IL-2 and interferon-gamma) from T cells expressing each of the test constructs described in FIG. 13 in each of three donors. The data demonstrate that the "OTP-CSF2" and "RPS6KA1-RSRP1" EP pairings exhibit functional activity at least equivalent to that of control constructs with MND and 10×NFkB promoters, respectively. Furthermore, when the "OTP-CSF2" EP pairing drives expression of a CAR, T cells exhibit higher IL-2 expression than when the MND control drives expression of the same CAR. The "RPS6KA1-RSRP1" EP pairing exhibits higher overall cytokine expression than the other seven constructs tested, which is consistent with the target cell killing data shown in FIG. 14. [Figure 16A] Figure 16A is a series of graphs showing CAR expression after one round of antigen stimulation for each of the control constructs (containing MND and 10xNFkB, respectively) and two test constructs (containing the EP pairings "OTP-CSF2" and "RPS6KA1-RSRP1," respectively). Figure 16A shows a series of cell sorting plots for both unstimulated (top) and stimulated (+H1975-mKate target cells, bottom), where the level of CD19 marker is represented on the Y-axis and the level of CAR expression is represented on the X-axis. For a schematic of the constructs / markers used, see Figure 11. Shown in this figure is representative data from donor 2. [Figure 16B] Figure 16B is a series of graphs showing CAR expression after one round of antigen stimulation for each of the control constructs (containing MND and 10xNFkB, respectively) and two test constructs (containing the EP pairings "OTP-CSF2" and "RPS6KA1-RSRP1," respectively). Figure 16B is a graph showing aggregate and quantitative data from all three donors in this study. For each condition and each construct, the data represent the mean ± SEM %tCD19+CAR+ across the three donors. The data collectively demonstrate that (1) the "OTP-CSF2" construct exhibits stimulation-on activity after one round of passage stimulation, and (2) "RPS6KA1-RSRP1" has different expression kinetics than the MND control construct, but a similar functional readout to the MND control construct. [Figure 17] 1 is a table summarizing exemplary activities of exemplary constructs of the present disclosure. For example, NFkB (either single or concatemerized into 10×NFkB) and "OTP-CSF2" both exhibit stimulus-on activity, meaning that these promoters drive expression in response to T cell stimulation or in response to a T cell-stimulated state. More specifically, both NFkB and "OTP-CSF2" exhibit early stimulus-on activity, meaning that they respond rapidly to T cell stimulation or respond rapidly after T cell recruitment to a stimulated state. Early stimulus-on and late stimulus-on are subcategories of stimulus-on behavior, with the primary difference being the time delay in the onset of activity from the late stimulus-on construct compared to the early stimulus-on construct. Notably, the data provided in this disclosure identifies at least one stimulus-off construct containing an IRF2 promoter sequence. [Figure 18] 1 is a pair of schematic diagrams and corresponding graphs showing an exemplary use of the disclosed constructs in a cellular circuit. The data demonstrate that under chronic stimulation conditions in vitro, the NFkB-regulated MSLN CAR exhibits improved killing and cytokine production when compared to the same MSLN CAR under the control of MND constitutive expression. DETAILED DESCRIPTION OF THE INVENTION

[0059] Immune cells play a role in immune responses. For example, T cells, a type of lymphocyte, play a central role in adaptive immune responses. One of the functions of T cells is immune-mediated cell death. CD8+ T cells, also known as killer T cells, are cytotoxic themselves and recruit other cell types to kill cancer cells and virus-infected host cells. CD4+ T cells, also known as helper T cells, further activate memory B cells and killer T cells via cytokines to enhance the immune response. Regulatory T cells, also known as suppressor T cells, enable immune cells to recognize invading cells from "self," thus preventing autoimmune responses.

[0060] Over time, T cells undergo a physiological change called exhaustion, characterized by a progressive loss of function and altered transcriptional profiles. T cell exhaustion is mediated by a cascade of signaling molecules that lead to transcription factors that regulate the expression of genes that regulate T cell exhaustion. Exhausted T cells lose their high proliferative capacity and cytotoxicity, ultimately resulting in cell death. Numerous factors can lead to T cell exhaustion, including persistent antigen exposure during infection and the presence of certain alloantigens after organ transplantation. In addition, some tumor- and cancer-associated cells can actively induce cell exhaustion at the tumor site, thus conferring tumor protection from T cell activity. T cell exhaustion is also seen in the context of engineered T cell therapy. Engineered T cells expressing chimeric antigen receptors (CARs) or T cell receptors (TCRs) can undergo exhaustion in the same way that endogenous T cells undergo exhaustion, thus resulting in reduced persistence.

[0061] Similarly, other engineered immune cells, such as engineered NK cells, engineered B cells, and engineered macrophages, may be subject to exhaustion and face similar problems.

[0062] Cell state Provided herein are constructs that sense (e.g., respond to) cellular states. The constructs are useful in any context in which sensing of a cellular state is desirable, and in some embodiments, the constructs are particularly useful for regulating the expression of exogenous engineered receptors in therapeutic immune cells to reduce exhaustion and increase the durability of immune cell therapy.

[0063] Immune cells, e.g., T cells, can exhibit multiple cell states, including an unstimulated state (e.g., before encountering an antigen), a stimulated state (e.g., after and during antigen encounter), an exhausted state (e.g., after prolonged stimulation), and a quiescent state (e.g., after stimulation has ceased for a period of time). In some embodiments, other cell states may include, but are not limited to, a homeostatic or healthy cell state, a mitotic cell state, a migratory cell state, an apoptotic cell state, a necrotic cell state, a stem cell or stem cell-like cell state, a senescent cell state, etc. In some embodiments, cell states may be organized into different categories, including, but not limited to, a functional state, an active state, a vegetative state, a developmental / maturation state, a differentiated state, etc. In some embodiments, a cell may be defined as having characteristics of multiple cell states.

[0064] For example, engineered T cells expressing chimeric antigen receptors (CAR T cells) undergoing prolonged antigen stimulation may be in an exhausted cell state. In such embodiments, one or more constructs of the present disclosure, when included in the engineered T cells, can sense the exhausted cell state of the CAR T cells in conjunction with the CAR, and the CAR T cells undergo prolonged antigen stimulation. In some embodiments, one or more constructs of the present disclosure sense the exhausted cell state of the CAR T cells and can cause transcription of one or more genes via one or more transcription initiation factors of the one or more constructs, such that exhaustion is managed and persistence is increased, as described in more detail herein. In some embodiments, the one or more genes whose transcription is regulated can include degradation factors, and transcription of the degradation factors can result in a reduction in the level of activated CAR in the cell, resulting in a change in cell state by allowing a period of resting, potentially resulting in a change in cell state from exhausted to "resting."

[0065] FIG. 1A shows a schematic diagram of an immune cell expressing a chimeric antigen receptor (CAR). The CAR is stimulated in the presence of antigen, resulting in immune cell activation. In some embodiments, the activated response includes upregulation of one or more transcription factors, thus increasing transcription of a cascade of transcription factor-dependent genes. With prolonged antigen stimulation, activation can replace exhaustion of the CAR immune cell. However, the introduction of a feedback loop may be desirable to regulate the response to activation. In some embodiments, the feedback loop may include a CAR degradation feedback loop. The CAR degradation feedback loop may include upregulation of a polypeptide (e.g., a "degradation factor" polypeptide) that can degrade an activated CAR to reduce the activation response. In some embodiments, the CAR degradation feedback loop may include a construct in which transcription of one or more genes of the construct can be initiated by signaling through the CAR, as shown in FIG. 1A. In some embodiments, the construct may include one or more transcription initiation factors or one or more transcription initiation factors and one or more transcriptional regulatory factors that drive transcription of one or more genes of the construct in response to a cellular condition to reduce the cellular activation response, as described in more detail herein.

[0066] In some embodiments, the CAR degradation feedback loop can include a degradation factor, which is a peptide configured to degrade activated CARs. Figures 1C-1D show graphs of predicted expression of CARs and degradation factors in response to antigenic stimulation using the cell state-sensing constructs of the present disclosure. Without being bound by theory or mechanism, antigenic stimulation can result in high expression of CARs and an activated response within immune cells. In the presence of continuous antigenic stimulation, immune cells can approach an exhausted cell state, as seen in Figure 1C. The exhausted cell state can result in reduced T cell efficiency and cell viability, as well as reduced CAR expression. An activated response within immune cells can result in increased expression of the degradation factor. However, if exhaustion of CAR immune cells occurs before increased expression of the degradation factor, the CAR immune cells will be exhausted, and the presence of the degradation factor may have no effect. However, as seen in Figure ID, if an exhausted cell state can be sensed and lead to increased transcription of degradation factors before the CAR immune cells become exhausted, the CAR can be degraded before the CAR immune cells become exhausted, inducing a cell dormant state (e.g., the length of time the CAR immune cells are not activated) and extending cell viability. This length of time the CAR immune cells are in a dormant cell state (e.g., dormancy) can allow the CAR immune cells to recover from excessive antigen stimulation before further antigen stimulation leads to an activation response by the dormant CAR immune cells. Ultimately, reduced activation leads to reduced levels of degradation factors and increased CAR expression levels.

[0067] More broadly, transcriptional regulation of an engineered receptor (e.g., CAR or TCR) degradation feedback loop can be engineered to be responsive to a cellular condition. In some embodiments, one or more constructs can be engineered or generated to provide transcriptional regulation of one or more genes (e.g., degradation factors, CARs, or cytokines) in response to a cellular condition. In some embodiments, one or more constructs can provide transcriptional regulation of one or more genes in response to a cellular condition within a CAR T cell.

[0068] Dynamic transcriptional regulation can be controlled through the timing of expression, expression kinetics, expression level, or responsiveness to cellular conditions. This dynamic transcriptional regulation can occur through interactions between a transcription initiation promoter sequence and a transcriptional regulatory enhancer sequence. Figure ID shows a schematic diagram of a construct comprising a transcription initiation factor promoter sequence and one or more transcriptional regulatory factors operably linked to a gene. In some embodiments, the transcriptional regulatory factor can comprise a regulatory element ("CRE"), including enhancers, insulators, silencers, suppressors, etc. For example, if the transcription initiation factor comprises a promoter and the transcriptional regulatory factor comprises an enhancer, the enhancer can increase transcription through the promoter of the gene operably linked to the promoter.

[0069] Cell state-sensing constructs The nucleic acid constructs of the present disclosure include a transcription initiation factor, or a transcription initiation factor and a transcription regulatory factor, wherein each of the transcription regulatory factor and the transcription initiation factor comprises a concatemer of transcription factor binding motifs, and the construct does not occur in nature. The concatemer includes a sequence that can be derived from a known promoter sequence. A concatemer of transcription factor binding motifs (referred to in the examples as a concatemerized sequence) binds to more than one unique transcription factor or binds to the same transcription factor at more than one site. It is understood that non-naturally occurring sequences may include naturally occurring sequences (including those isolated from or derived from them) assembled in a non-naturally occurring manner. For example, in some embodiments, one or more naturally occurring sequences that are not adjacent in a genome may be placed adjacent in the construct, thus assembling in a non-naturally occurring manner.

[0070] As used herein, a transcription initiation factor of the present disclosure behaves in a promoter-like manner, supporting the binding of a transcription factor to initiate transcription of a downstream gene under its control. As used herein, a transcriptional regulator of the present disclosure further regulates the transcription of a downstream gene. In some embodiments, the transcriptional regulator is located 5' of the transcription initiation factor. In some embodiments, the transcriptional regulator is located 3' of the transcription initiation factor.

[0071] Transcription binding motifs can be derived from untranslated genomic regions of the following non-exhaustive list of proteins: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0072] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of NFAT, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0073] In some embodiments, the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of NFkB, and in some embodiments, the transcriptional regulatory factor may comprise any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0074] In some embodiments, when the transcription initiation element comprises one or more sequences from the untranslated genomic sequence of REL (including RELA or RELB), in some embodiments, the transcriptional regulatory element may comprise any one or more of the sequences 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0075] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of IRF2, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0076] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of GATA3, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0077] In some embodiments, when the transcription initiation factor comprises one or more sequences derived from the untranslated genomic sequence of ATF3, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0078] In some embodiments, the construct includes a transcription initiation element. In other embodiments, one or more exemplary constructs may include a transcription initiation element and a transcriptional regulatory element, as described in more detail herein. In some embodiments, one or more constructs may also include an integration sequence, which can, for example, direct or increase insertion of the construct into a target site in a vector or chromosome. The insertion sequence may include multiple insertion sequences. For example, in some embodiments, the insertion sequence may include a first integration sequence and a second integration sequence. In some embodiments, the first integration sequence may be a 5' integration sequence and the second integration sequence may be a 3' integration sequence. In some embodiments, the insertion sequence may include a homologous sequence corresponding to the insertion site to promote homologous recombination. In some embodiments, the integration sequence may include one or more transposable elements that may serve to promote transposition. In some embodiments, the transposable elements may include an insertion sequence and / or a transposon sequence. In some embodiments, the integration sequence may include a first 5' terminal repeat sequence or a second 3' terminal repeat sequence. In some embodiments, the construct may be inducible.

[0079] In some embodiments, the construct does not comprise a transcription initiation factor comprising a human beta globin sequence and a transcriptional regulator comprising any of a nuclear factor of activated T-cells (NFAT) sequence, an interferon regulatory factor 4 (IRF4) sequence, an activating protein 1 (AP-1)-IRF composite elements (AICE) sequence, or an interferon stimulation response element (ISRE) sequence. In some embodiments, the AICE sequence may comprise or encompass a sequence of or derived from IRF4 or IRF8, each of which has BATF. In some embodiments, the AICE sequence may be derived from an untranslated region of IRF4, IRF8, and / or BATF. In some embodiments, the IRSE sequence may comprise the consensus sequence "YAGTTTC(A / T)YTTTYCC," where "Y" is either C or T. In some embodiments, the construct does not comprise a sequence comprising SEQ ID NO: 9786.

[0080] In some embodiments, the construct does not include a transcription initiation factor comprising a YB-TATA sequence and a transcription regulatory factor comprising an NFAT sequence. In some embodiments, the construct does not include a sequence comprising SEQ ID NO:9787.

[0081] Various constructs may exhibit dynamic behavior over time in response to antigenic stimulation. In some embodiments, constructs that exhibit similar dynamic behavior may be categorized into similar behavioral profiles. For example, a construct may exhibit constitutive behavior in which antigenic stimulation results in transcription driven from transcription initiation factors, and transcription levels remain relatively consistent despite successive antigenic stimulation. In some embodiments, a construct may exhibit "stimulus-on" behavior in which antigenic stimulation results in a significant increase in transcription driven from transcription initiation factors. In some embodiments, "stimulus-on" behavior may cause transcription levels to remain high after an initial antigenic stimulation results in transcription driven from transcription initiation factors. In some embodiments, "stimulus-on" behavior may include an initial antigenic stimulation resulting in a significant increase in transcription driven from transcription initiation factors (referred to herein as "early stimulus-on" behavior), or a prolonged initial antigenic stimulation resulting in a significant increase in transcription driven from transcription initiation factors (referred to herein as "late stimulus-on" behavior). In some embodiments, "stimulus-on" behavior may also include an antigenic stimulation resulting in a single instance of increased transcription driven from transcription initiation factors. In some embodiments, a single instance of increased transcription driven from a transcription initiation factor may be due to epigenetic regulation (e.g., histone modifications including DNA methylation / demethylation, acetylation, methylation, phosphorylation, and ubiquitination), other epigenetic-like transcriptional changes, or cellular regulatory or transcriptional pathways. In other embodiments, "stimulus-on" behavior may also include antigenic stimulation resulting in multiple instances of increased transcription driven from a transcription initiation factor. In some embodiments, a transcription initiation factor may exhibit "stimulus-off" behavior in which an initial antigenic stimulation results in a decrease in transcription driven from the transcription initiation factor. In some embodiments, "stimulus-off" behavior may cause transcription levels to remain lower, including near or about zero transcription levels, after the initial antigenic stimulation.

[0082] In some embodiments, one or more nucleic acid constructs can be inducible. In some embodiments, one or more inducible nucleic acid constructs can include one or more sequences that can regulate and initiate transcription of a gene, and the constructs include one or more non-naturally occurring sequences. In some embodiments, the non-naturally occurring sequences can include naturally occurring sequences or sequences isolated or derived from non-naturally occurring sequences. A non-naturally occurring sequence can be understood to include naturally occurring sequences (including those isolated from or derived from) assembled in a non-naturally occurring manner. For example, in some embodiments, one or more naturally occurring sequences that are not adjacent in a genome can be placed adjacent in a construct and thus assembled in a non-naturally occurring manner.

[0083] In some embodiments, the construct may comprise a transcription initiation factor and a transcriptional regulator, and in some embodiments, the transcription initiation factor and the transcriptional regulator may be engineered to respond to a cellular state or a change in a cellular state, as described in more detail herein. For example, one construct may comprise an MND transcription initiation factor (e.g., a promoter) operably linked to a CAR. The MND transcription initiation factor may be constitutively active, and antigenic stimulation results in expression of the CAR. A second construct may comprise a transcriptional regulator adjacent to the transcription initiation factor operably linked to a degradation factor marked by a reporter gene. Antigenic stimulation of the CAR results in an activation response in which an endogenous signaling network can result in activation of transcription of the second construct containing the degradation factor. The second construct may "sense" a change in cellular state (e.g., activated via antigenic stimulation) or a cellular state that results in transcription of the degradation factor.

[0084] Exemplary Transcription Initiation Factors In some embodiments, the transcription initiation element of the construct may comprise a nucleotide sequence that initiates transcription of a gene. In some embodiments, it is contemplated that the transcription initiation element of the construct of the present disclosure may comprise a sequence reminiscent of a previously characterized archetypal or classical promoter. However, in other embodiments, it is contemplated that the transcription initiation element may comprise a sequence that is not reminiscent of an archetypal or classical promoter but nonetheless supports transcription initiation and may exhibit promoter-like function. In some embodiments, the transcription initiation element may comprise one or more transcription factor binding motifs. In some embodiments, the transcription factor binding motif may be isolated or derived from the untranslated region of a transcription factor or from another mammalian promoter sequence. The transcription initiation element may be engineered such that the sequence is optimized to drive transcription of the gene. In some embodiments, the transcription initiation element may be inducible.

[0085] In some embodiments, the transcription initiation element may comprise a minimal promoter sequence. A minimal promoter sequence comprises a minimal number of base pairs within a classical or non-classical promoter and can still drive transcription of a gene from that promoter. In some embodiments, a minimal promoter may comprise a sequence isolated or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta-globin. minP1 may comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, a minimal promoter may comprise a sequence isolated or derived from minimal promoter 2 ("minP2") or minimal promoter 3 ("minP3"). In some embodiments, minP2 may comprise the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). In some embodiments, minP3 may comprise the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0086] In some embodiments, the transcription initiation factor of the construct may be engineered to contain a concatemer of one or more nucleic acid sequences. In some embodiments, the transcription initiation factor may contain a concatemer of any sequence including any of SEQ ID NOs: 175-509, 9793-9800. In some embodiments, the concatemer (e.g., the transcription initiation factor of the construct) may contain any sequence including any of SEQ ID NOs: 5147-9790. In some embodiments, the concatemer (e.g., the transcription initiation factor of the construct) may advantageously drive transcription at a higher rate compared to a non-concatamerized transcription initiation factor. In some embodiments, the concatemer may contain two or more repeat sequences. The concatemer may be composed of multiple repeat sequences (e.g., multiple repeats). In some embodiments, the concatemer may comprise at least about 3 repeats, at least about 4 repeats, at least about 5 repeats, at least about 6 repeats, at least about 7 repeats, at least about 8 repeats, at least about 9 repeats, at least about 10 repeats, at least about 11 repeats, at least about 12 repeats, at least about 13 repeats, at least about 14 repeats, or at least about 15 repeats. In some embodiments, the total length of the concatemer may comprise a length of from about 20 base pairs to about 200 base pairs. In some embodiments, the total length of the concatemer may comprise a length of 150 base pairs or less. For example, the total length of the concatemer can be about 125 base pairs, about 130 base pairs, about 133 base pairs, about 134 base pairs, about 135 base pairs, about 136 base pairs, about 139 base pairs, about 140 base pairs, about 142 base pairs, about 145 base pairs, about 146 base pairs, about 147 base pairs, about 149 base pairs, or about 150 base pairs. The concatemer can include a linking sequence positioned between each of the repeat sequences. In some embodiments, the linking sequence can include one or more of the following sequences: TACGCT, TGATCT, TGCTTT, or TGCCCGT. In some embodiments, the linking sequence between each repeat sequence can be the same or different.

[0087] In some embodiments, two or more repeat sequences of a construct may contain transcription factor binding motifs or motifs derived from or isolated from untranslated genomic sequences of one or more transcription factors or one or more mammalian promoter sequences. In some embodiments, a sequence containing a transcription factor binding motif may contain transcription factor binding motifs that bind to more than one type of transcription factor, or may bind to the same type or the same transcription factor at more than one site along the sequence. For example, in a construct containing a transcription initiation element that contains four repeat sequences separated by three linking sequences, each of the four repeat sequences may contain the same transcription factor binding motif so that one type of transcription factor can bind to multiple repeat sequences, or each or some of the repeat sequences may contain different transcription factor binding motifs so that different types of transcription factors can bind to the repeat sequences.

[0088] In some embodiments, a transcription initiation factor of the present disclosure may be composed of a concatemer of transcription factor consensus binding motifs. The concatemers may be homogeneous (concatemers of the same repeated motif) or heterogeneous (concatemers of multiple different motifs). Table 1 provides exemplary transcription factor consensus binding motifs that may be used in one or more concatemers of the present disclosure. In some embodiments, a cell-sensing construct of the present disclosure may comprise a transcription initiation factor comprising any one or more of the transcription factor consensus binding motifs in Table 1 and may have the sequence of any one or more of SEQ ID NOs: 175-509, 9793-9088.

[0089] transcriptional regulators In some embodiments, the construct may include a transcriptional regulator or a transcriptional initiation factor and a transcriptional regulator. In some embodiments, the transcriptional regulator may directly or indirectly regulate transcription of one or more genes, and the transcriptional regulator may include one or more response elements. For example, in some embodiments, the transcriptional regulator may include an enhancer, a suppressor, etc. In some embodiments, the enhancer may include or have sequences reminiscent of previously characterized prototypic or classical enhancers. However, in other embodiments, it is contemplated that a transcriptional regulator including an enhancer may include sequences not reminiscent of prototypic or classical enhancers, yet may nonetheless support enhanced transcription from the promoter and exhibit enhancer function. In some embodiments, the transcriptional regulator may be inducible.

[0090] In some embodiments, suppressors may be reminiscent of previously characterized prototypical or classical suppressors, however, in other embodiments, it is contemplated that transcriptional regulators comprising suppressors may contain sequences that are not reminiscent of prototypical or classical suppressors, but nonetheless support repression of transcription from a promoter and may exhibit suppressor function.

[0091] In some embodiments, a transcriptional regulator may comprise one or more repeat sequences, in which each of the repeat sequences may be the same, or each of the repeat sequences or portions of the repeat sequences may be different sequences. In some embodiments, the transcriptional regulator may comprise one or more sequences from the untranslated genomic sequence of one or more of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D. In some embodiments, the transcriptional regulator may comprise one or more of sequences derived from the untranslated genomic sequence of one or more of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF.

[0092] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of NFAT. In some embodiments, the NFAT transcriptional regulator may comprise any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0093] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of NFkB. In some embodiments, the NFkB transcriptional regulator may comprise any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0094] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of REL (including RELA or RELB). In some embodiments, the REL transcriptional regulator may comprise any one or more of the sequences 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645. In some embodiments, the RELA transcriptional regulator may comprise any one or more of the sequences 4484-4499, 4994-5009, and 9630-9645. In some embodiments, the REL, RELA, or RELB transcriptional regulator may be used in combination with a minimal promoter. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta-globin. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from minimal promoter 2 ("minP2") or minimal promoter 3 ("minP3"). MinP1 may comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). MinP2 may comprise the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). MinP3 may comprise the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0095] In some embodiments, the transcriptional regulator comprises one or more sequences derived from the untranslated genomic sequence of IRF2. In some embodiments, the IRF2 transcriptional regulator may comprise any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607. In some embodiments, the IRF2 transcriptional regulator may be used in combination with a minimal promoter. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta-globin. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from minimal promoter 2 ("minP2") or minimal promoter 3 ("minP3"). In some embodiments, MinP1 may comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, MinP2 can comprise the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). In some embodiments, MinP3 can comprise the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0096] In some embodiments, the transcriptional regulator may comprise one or more sequences from the untranslated genomic sequence of GATA3. In some embodiments, the GATA3 transcriptional regulator may comprise any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855. In some embodiments, the GATA3 transcriptional regulator may be used in combination with a minimal promoter. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta-globin. In some embodiments, the minimal promoter may comprise sequences isolated from or derived from minimal promoter 2 ("minP2") or minimal promoter 3 ("minP3"). In some embodiments, MinP1 may comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, MinP2 can comprise the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). In some embodiments, MinP3 can comprise the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0097] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of ATF3. In some embodiments, the ATF3 transcriptional regulator can comprise any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0098] Exemplary Engineered Enhancer-Promoter Combinations Also provided herein are engineered (e.g., non-naturally occurring) enhancer-promoter ("EP") combinations or pairings ("EP pairs") of one or more cell-sensing constructs disclosed herein. In some embodiments, a particular promoter and a particular enhancer may be paired together to drive transcription from the promoter and exhibit predictable and consistent behavior, as described in more detail herein. In some embodiments, the engineered enhancer-promoter combination may include sequences isolated from or derived from transcription factors, promoters, and untranslated regions of the enhancer. In some embodiments, the enhancer-promoter pair may be composed of an enhancer sequence and a promoter sequence. The sequence of an enhancer-promoter pair may be referred to herein as an "EP pairing sequence" or an "enhancer-promoter pair sequence."

[0099] In some embodiments, the transcription initiation promoter sequence may be adjacent to a transcriptional regulatory enhancer sequence. For example, the enhancer sequence may be located 5' of the promoter sequence, or the enhancer sequence may be located 3' of the promoter sequence. In some embodiments, in exemplary constructs, the enhancer sequence may be adjacent to the promoter sequence. For example, in some embodiments, the enhancer sequence may be located 5' of the promoter sequence, but in some embodiments, the enhancer sequence may be located 3' of the promoter sequence. In some embodiments, the promoter sequence may be located 3' of the enhancer sequence, or in some embodiments, the promoter sequence may be located 5' of the enhancer sequence.

[0100] In some embodiments, enhancer-promoter pairs can be combined together in an EP pairing sequence. In some embodiments, the enhancer-promoter pairing sequence can comprise from about 25 base pairs to about 5000 base pairs, including from about 100 base pairs to about 1500 base pairs, from about 200 base pairs to about 1400 base pairs, from about 300 base pairs to about 1300 base pairs, from about 400 base pairs to about 1300 base pairs, from about 500 base pairs to about 1250 base pairs, from about 600 base pairs to about 1250 base pairs, from about 700 base pairs to about 1250 base pairs, from about 800 base pairs to about 1200 base pairs, or from about 900 base pairs to about 1100 base pairs. In some embodiments, the EP pairing sequence may comprise at least about 25 base pairs, including about 50 base pairs, about 100 base pairs, about 150 base pairs, about 200 base pairs, about 300 base pairs, about 350 base pairs, about 400 base pairs, about 450 base pairs, about 500 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, about 1000 base pairs, or any number of base pairs between 25 and about 1000 base pairs. In some embodiments, the enhancer sequence and the promoter sequence may be linked together by a linker. In some embodiments, the linker may comprise one or more of the following sequences: TACGCT, TGATCT, TGCTTT, or TGCCCGT. In some embodiments, one or more constructs may further comprise an adapter sequence located 5' and / or 3' of the enhancer-promoter pairing sequence. In some embodiments, the adapter sequence may comprise the sequence AAAGCACTCTTAGGCCTCTGCGTCTCATTCTGAAGACTCACGA (SEQ ID NO: 9801) or AACGGAGTCTTCAACGTGAGACGGCTCGATGCCATAGTTCCTT (SEQ ID NO: 9801), although other linkers known in the art are also contemplated.

[0101] In some embodiments, one or more nucleic acid constructs may further comprise a barcode sequence operably linked to each EP pairing sequence. In some embodiments, operably linked may include that the barcode sequence may be located 3' of the EP pairing sequence, while in other embodiments, the barcode sequence may be located 5' of the EP pairing sequence. In some embodiments, the barcode sequence may be located 3' of the promoter sequence, while in other embodiments, the barcode sequence may be located 5' of the promoter sequence. Similarly, in some embodiments, the barcode sequence may be located 3' of the enhancer sequence, while in other embodiments, the barcode sequence may be located 5' of the enhancer sequence.

[0102] In some embodiments, the nucleic acid construct may further comprise a 5' untranslated region (UTR) located 3' to either the EP pairing sequence or the barcode sequence. In some embodiments, the 5' UTR may be located 3' to the enhancer sequence, 3' to the promoter sequence, or 3' to the barcode sequence. In some embodiments, the 5' UTR may be located 5' to the enhancer sequence, 5' to the promoter sequence, or 5' to the barcode sequence. In some embodiments, the promoter sequence, enhancer sequence, or combinations thereof may comprise sequences that can be isolated or derived from the sequence of one or more human chromosomes, including at least chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19, chromosome 20, chromosome 21, chromosome 22, or chromosome 23. In some embodiments, an enhancer sequence may comprise a minimal sequence that exhibits active enhancer function. In some embodiments, a promoter sequence may comprise a minimal promoter sequence that exhibits promoter function or activity. In some embodiments, a minimal promoter sequence may comprise:

[0103] The gene may include any one or more of MinP1 having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788), MinP2 having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789), or MinP3 having the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0104] In some embodiments, the enhancer sequence and promoter sequence, each or in combination, can comprise a sequence of at least about 25 base pairs, at least about 50 base pairs, at least about 100 base pairs, at least about 150 base pairs, at least about 200 base pairs, at least about 250 base pairs, at least about 300 base pairs, at least about 350 base pairs, at least about 400 base pairs, at least about 450 base pairs, at least about 500 base pairs, at least about 600 base pairs, at least about 700 base pairs, at least about 800 base pairs, at least about 900 base pairs, at least about 100 base pairs, or any number of base pairs in between.

[0105] In some embodiments, the enhancer-promoter pair sequence can comprise any sequence in Table 1, including any one of SEQ ID NOs: 1-174, or a sequence having at least about 90% sequence identity thereto. For example, the enhancer-promoter pair sequence can comprise a sequence having at least about 90% sequence identity, at least about 91% sequence identity, at least about 92% sequence identity, at least about 93% sequence identity, at least about 94% sequence identity, at least about 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any one of SEQ ID NOs: 1-174.

[0106] As described herein, each of SEQ ID NOs: 1-174 is composed of a promoter sequence and an enhancer sequence. Thus, in some embodiments, sequences independently having at least about 70% sequence identity to each of the promoter sequences or enhancer sequences are also provided herein. For example, the sequences of the EP pairs of the present disclosure may include sequences having at least about 70% sequence identity, at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any of the promoter sequences of SEQ ID NOs: 1-174. Similarly, the EP pairing sequence of the present disclosure may include a sequence having at least about 70% sequence identity, at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any of the enhancer sequences of SEQ ID NOs: 1-174.

[0107] [Table 1-1] TIFF2026503018000003.tif219167

[0108] (Continuation of the above table) [Table 1-2] TIFF2026503018000005.tif219167

[0109] (Continuation of the above table) [Table 1-3] TIFF2026503018000007.tif219167

[0110] (Continuation of the above table) [Table 1-4] TIFF2026503018000009.tif219167

[0111] (Continuation of the above table) [Table 1-5] TIFF2026503018000011.tif219167

[0112] (Continuation of the above table) [Table 1-6] TIFF2026503018000013.tif219167

[0113] (Continuation of the above table) [Table 1-7] TIFF2026503018000015.tif219167

[0114] (Continuation of the above table) [Table 1-8] TIFF2026503018000017.tif219167

[0115] (Continuation of the above table) [Table 1-9] TIFF2026503018000019.tif219167

[0116] (Continuation of the above table) [Table 1-10] TIFF2026503018000021.tif219167

[0117] (Continuation of the above table) [Table 1-11] TIFF2026503018000023.tif219167

[0118] (Continuation of the above table) [Table 1-12] TIFF2026503018000025.tif219167

[0119] (Continuation of the above table) [Table 1-13] TIFF2026503018000027.tif219167

[0120] (Continuation of the above table) [Table 1-14] TIFF2026503018000029.tif219167

[0121] (Continuation of the above table) [Table 1-15] TIFF2026503018000031.tif219167

[0122] (Continuation of the above table) [Table 1-16] TIFF2026503018000033.tif219167

[0123] (Continuation of the above table) [Table 1-17] TIFF2026503018000035.tif219167

[0124] (Continuation of the above table) [Table 1-18] TIFF2026503018000037.tif219167

[0125] (Continuation of the above table) [Table 1-19] TIFF2026503018000039.tif219167

[0126] (Continuation of the above table) [Table 1-20] TIFF2026503018000041.tif219167

[0127] (Continuation of the above table) [Table 1-21] TIFF2026503018000043.tif219167

[0128] (Continuation of the above table) [Table 1-22] TIFF2026503018000045.tif219167

[0129] (Continuation of the above table) [Table 1-23] TIFF2026503018000047.tif219167

[0130] (Continuation of the above table) [Table 1-24] TIFF2026503018000049.tif219167

[0131] (Continuation of the above table) [Table 1-25] TIFF2026503018000051.tif219167

[0132] (Continuation of the above table) [Table 1-26] TIFF2026503018000053.tif219167

[0133] (Continuation of the above table) [Table 1-27] TIFF2026503018000055.tif219167

[0134] (Continuation of the above table) [Table 1-28] TIFF2026503018000057.tif219167

[0135] (Continuation of the above table) [Table 1-29] TIFF2026503018000059.tif219167

[0136] (Continuation of the above table) [Table 1-30] TIFF2026503018000061.tif219167

[0137] (Continuation of the above table) [Table 1-31] TIFF2026503018000063.tif219167

[0138] (Continuation of the above table) [Table 1-32] TIFF2026503018000065.tif219167

[0139] (Continuation of the above table) [Table 1-33] TIFF2026503018000067.tif219167

[0140] (Continuation of the above table) [Table 1-34] TIFF2026503018000069.tif219167

[0141] (Continuation of the above table) [Table 1-35] TIFF2026503018000071.tif219167

[0142] (Continuation of the above table) [Table 1-36] TIFF2026503018000073.tif219167

[0143] (Continuation of the above table) [Table 1-37] TIFF2026503018000075.tif219167

[0144] (Continuation of the above table) [Table 1-38] TIFF2026503018000077.tif219167

[0145] (Continuation of the above table) [Table 1-39] TIFF2026503018000079.tif219167

[0146] (Continuation of the above table) [Table 1-40] TIFF2026503018000081.tif219167

[0147] (Continuation of the above table) [Table 1-41] TIFF2026503018000083.tif219167

[0148] (Continuation of the above table) [Table 1-42] TIFF2026503018000085.tif219167

[0149] (Continuation of the above table) [Table 1-43] TIFF2026503018000087.tif219167

[0150] (Continuation of the above table) [Table 1-44] TIFF2026503018000089.tif85169

[0151] In some embodiments, the nucleic acid construct may include a reporter gene having a reporter sequence operably linked to the EP pairing sequence. For example, when the nucleic acid construct is used in a screening assay, the reporter gene may be used as a readout of transcription via the EP pairing sequence, where the reporter gene can be tracked and measured. In some embodiments, the reporter sequence may include a fluorescent protein, including green fluorescent protein (GFP), red fluorescent protein (RFP), or may include blue, orange, far-red, cyan, or yellow fluorescent protein.

[0152] Observable behavior of nucleic acid constructs Various nucleic acid constructs of the present disclosure may exhibit dynamic behavior over time in response to antigenic stimulation. In some embodiments, nucleic acid constructs that exhibit similar dynamic behavior may be classified into similar dynamic behavior profiles. For example, some nucleic acid constructs may exhibit constitutive behavior in which antigenic stimulation results in transcription driven from EP pairing, and transcription levels remain relatively consistent despite continued antigenic stimulation. In some embodiments, some nucleic acid constructs may exhibit "stimulus-on" behavior in which antigenic stimulation results in a significant increase in transcription driven from EP pairing. In some embodiments, "stimulus-on" behavior may allow transcription levels to remain high even after initial antigenic stimulation results in transcription driven from transcription initiators. In some embodiments, "stimulus-on" behavior may include cases in which initial antigenic stimulation results in a significant increase in transcription driven from EP pairing (referred to herein as "early stimulus-on" behavior) or in which prolonged initial antigenic stimulation results in a significant increase in transcription driven from EP pairing (referred to herein as "late stimulus-on" behavior). In some embodiments, "stim-on" behavior can include cases where antigenic stimulation results in a single instance of increased transcription over time driven from EP pairing. In some embodiments, a single instance of increased transcription driven from EP pairing can be due to epigenetic regulation (e.g., histone modifications including DNA methylation / demethylation, acetylation, methylation, phosphorylation, and ubiquitination), other epigenetic-like transcriptional changes, or cellular regulatory or transcriptional pathways. In other embodiments, "stim-on" behavior can also include cases where antigenic stimulation results in multiple instances of increased transcription over time driven from EP pairing. In some embodiments, a transcription initiation factor can exhibit "stim-off" behavior, where an initial antigenic stimulation results in a decrease in transcription driven from EP pairing. In some embodiments, "stim-off" behavior can result in transcription levels near or about zero after an initial antigenic stimulation.

[0153] In some embodiments, one or more nucleic acid constructs can contribute to a resting cell state, and antigen stimulation is removed for a period of time. Transcription of the constructs via EP pairing can still occur. In some embodiments, in the resting cell state, transcription via EP pairing can still occur at a reduced rate of transcription or an increased rate of transcription compared to the rate of transcription occurring in a non-resting cell state.

[0154] In some embodiments, cells containing one or more nucleic acid constructs may exhibit an exhausted cell state with chronic or consistent antigen stimulation. In some embodiments, one or more constructs may sense the exhausted cell state and increase or decrease transcription through EP pairing. Each unique EP pair of a construct may exhibit many types of behavior (e.g., behavioral profiles) depending on the EP pair, and it can be understood that each type of behavior resulting from the EP pairs disclosed herein is contemplated within this application. Advantageously, each of these behavioral profiles of different EP pairs may provide dynamic transcriptional regulation of a reporter gene or gene operably linked to the EP pair of the construct in response to the cellular state.

[0155] Library of constructs In some embodiments, a library can be generated containing a plurality of nucleic acid constructs, each construct comprising a different enhancer-promoter (EP) pair and a unique barcode sequence specific to the EP pair. Each enhancer-promoter pair can be operably linked to a unique barcode sequence and a reporter gene. In some embodiments, the library can be used to screen or test EP pairs that exhibit a particular behavior or behavioral profile, as described in more detail herein. For example, the library can be used to screen for EP pairs that result in a large increase in transcription of a reporter gene over time via the EP pair's promoter. In some embodiments, the library can be used to screen for EP pairs that result in a sharp decrease in transcription of a reporter gene over time via the EP pair's promoter. In some embodiments, the library can be used to screen for EP pairs that result in a gradual increase in transcription over time via the EP pair's promoter. In some embodiments, the library can be used to screen for EP pairs that result in a gradual decrease in transcription over time via the EP pair's promoter. In some embodiments, the library can be used to screen for EP pairs that result in an increase in transcription over time via the EP pair's promoter. In some embodiments, the library can be used to screen for EP pairs that result in multiple increases in transcription over time via the EP pair's promoter, etc. In some embodiments, the library comprises a nucleic acid construct comprising an EP pairing sequence of any of the sequences of SEQ ID NOs: 1 to 174. In some embodiments, the library comprises a plurality of vectors, each vector comprising a nucleic acid construct having a different enhancer-promoter pair and a unique barcode.

[0156] Cell state-sensing constructs and expression of engineered receptors As described above, one or more nucleic acid constructs of the present disclosure may induce transcription via one or more promoters of the present disclosure in response to a cellular state and / or a change in a cellular state. In some embodiments, the transcriptional regulatory enhancer sequence and / or transcriptional initiation promoter sequence of one or more nucleic acid constructs may be operably linked to a sequence encoding one or more of a CAR, an exogenous T cell receptor (TCR), a cytokine, a degradation factor, etc. For example, a transcriptional regulatory enhancer sequence ("enhancer") and a transcriptional initiation factor promoter sequence ("promoter") are operably linked to a sequence encoding a degradation factor marked by a reporter gene.

[0157] In some embodiments, the cell state-sensing construct may drive expression of an engineered antigen receptor, including a T cell receptor ("TCR"), a chimeric antigen receptor ("CAR"), including all generations, a B cell receptor ("BCR"), a co-receptor of a TCR or BCR, and / or any combination or hybrid thereof. In some embodiments, the engineered receptor may signal or generate other results (e.g., a dominant-negative antigen sink). In some embodiments, the engineered receptor may include one or more of a DHD and / or binding site for a degradation factor, a binding site for an effector protein of a LOCKR switch, or a binding site for a direct or indirect signaling transducer of a safety switch. In some embodiments, the antigen receptor may comprise fully human sequences, humanized sequences, sequences isolated from or derived from mammalian or non-human sequences (including murine sequences), syngeneic sequences, chimeric sequences, recombinant sequences, or sequences derived from any species.

[0158] An example of an antigen receptor may include a chimeric antigen receptor (CAR), as seen in FIG. 1A. In some embodiments, a CAR may include an extracellular domain containing a binding agent that specifically and selectively binds to a target antigen, a transmembrane domain, and an intracellular domain containing at least one signaling domain. In some embodiments, one or more sequences of a CAR may be naturally occurring or non-naturally occurring. In some embodiments, one or more sequences of a CAR may be endogenous or exogenous to the cell expressing it. In some embodiments, one or more sequences of a CAR may be fully human, humanized, isolated from or derived from mammalian or non-human sequences (including mouse sequences), and / or syngeneic sequences. In some embodiments, a CAR may be specific for one or more target antigens. For example, some CARs may have one or more binding agents, each specific for a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance in the immune synapse. The extracellular domain of a CAR may include a spacer positioned between the T cell surface and the binding agent. When more than one binding agent is present, a spacer may be positioned between the T cell surface and the first binding agent. In some embodiments, the binding agent may have any structure, including, but not limited to, (1) an antibody or any fragment thereof, (2) an antibody mimetic or any portion thereof, and / or (3) a de novo designed protein. Exemplary binding agents may include, but are not limited to, scFv, VH, VHH, monoclonal antibody, and any combination thereof. In some embodiments, the transmembrane domain may be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains may include sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, the CAR may be of any CAR "generation," including, but not limited to, Gen I, Gen II, Gen III, Gen IV, and Gen V.In some embodiments, the intracellular domain of the CAR may comprise one or more of immunoreceptor tyrosine-based activation motif (ITAM) repeats (e.g., a single CD3ζ intracellular domain) (Gen I), ITAM repeats and one costimulatory molecule (e.g., a CD27 or CD137 sequence) (Gen II), ITAM repeats, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD134 or CD137) (Gen III), ITAM repeats, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., WT IL-12) (Gen IV; also referred to as T cell redirected for universal cytokine-mediated killing (TRUCK)), and / or ITAM repeats, a costimulatory molecule, and the intracellular domain of a cytokine receptor (e.g., a WT IL-2R β chain fragment) (Gen V).

[0159] In some embodiments, the CAR can signal or generate other outcomes (e.g., dominant-negative antigen sinks). CARs may include DHDs and / or binding sites for degradation factors, binding sites for effector proteins of a LOCKR switch, binding sites for direct or indirect signaling transducers of a logic gate or switch, or safety switch. In some embodiments, the CAR may be a split CAR whose ultimate activity depends on the binding and interaction of two domains or two receptors.

[0160] To avoid CAR T cell exhaustion, it would be beneficial to have a system comprising one or more exemplary nucleic acid constructs that can sense exhaustion and shut down CAR stimulation. Disclosed herein are one or more exemplary engineered (non-naturally occurring) constructs and methods of use that can be used to shut down stimulating antigen receptors, including chimeric antigen receptors, in response to sensing a cellular condition that includes exhaustion.

[0161] In some embodiments, the cell state-sensing construct may drive expression of a fusion protein having an engineered receptor (e.g., a CAR or TCR) and a degradation domain. For example, in some embodiments, the polypeptide may be fused to a degradation domain (DHD) (e.g., a degrader) for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element of a protein sufficient for cell-mediated degradation. In some embodiments, cell-mediated degradation may be ubiquitin-dependent. In some embodiments, cell-mediated degradation may be ubiquitin-independent.

[0162] In some embodiments, one or more nucleic acid constructs can comprise a polynucleotide set comprising a polynucleotide encoding a degradation initiator fused to a binding element specific for a native motif on an endogenous molecule of interest. The binding domain can, for example, recognize and bind to a specific region on the molecule of interest or a specific modification on the molecule of interest. Interaction of the binding element with the native motif on the molecule recruits the degradation initiator to the molecule, initiating degradation.

[0163] In some embodiments, the degradation domain comprises a ligase or ligase binding domain. In some embodiments, one or more polypeptides of the construct may be used as binding elements, where the polypeptides are fused to a ligase domain (or a functional variant thereof). Binding of the polypeptides of one or more nucleic acid constructs to a protein of interest brings the modified ligase into proximity with the target protein, thereby facilitating ubiquitination and subsequent degradation of the protein target.

[0164] In some embodiments, the ligase of one or more nucleic acid constructs may comprise an E3 ligase or a variant thereof. E3 ligases may control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin proteasome system, E3 ligase proteins recruit ubiquitin-loaded E2 ubiquitin-conjugating enzymes, recognize protein substrates, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof may be selected based on the intended protein to be targeted for degradation. For example, E3 ligases and / or sets of E3 ligases may be selected to modulate the stability and / or half-life of a target transmembrane protein. In another example, E3 ligases and / or sets of E3 ligases may be selected to modulate the stability and / or half-life of a cytoplasmic protein (e.g., a transcription factor). In some embodiments, one or more nucleic acid constructs may comprise one or more synthetic degradation factors, which may be useful for modulating the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degradation factors may be used in cell therapy applications to program cell populations to perform and / or modulate a therapeutic function.

[0165] In some embodiments, one or more synthetic degradation factors can be used to regulate and / or degrade T cell receptor (TCR) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degradation factor systems of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, which can lead to the undesirable exhaustion phenotype observed in many existing immune cell therapies.

[0166] In some embodiments, the cell state-sensing nucleic acid construct may drive expression of one or more cytokines. For example, in some embodiments, the transcription initiation factor and / or transcriptional regulator may be operably linked to one or more cytokines. The one or more cytokines may include IL-2, IL-12, IL-15, IL-18, IL-21, IL-23, interferon alpha (α), interferon beta (β), interferon gamma (γ), and interferon omega (ω).

[0167] Inducible receptor system Provided herein are inducible receptor systems engineered to drive the expression and degradation of cell surface receptors, including antigen receptors. In some embodiments, the inducible receptor systems disclosed herein can be used to drive the expression or degradation of antigen receptors, such as CARs and TCRs. In some aspects, the inducible receptor systems disclosed herein can be used to drive the expression or degradation of engineered receptors in response to sensing a cellular condition. In some embodiments, the inducible receptor system can include one or more of the exemplary constructs disclosed herein. In some embodiments, the inducible receptor system can include a circuit, and one or more of the exemplary constructs can include different circuit components, including a response component and an effector component, and the response component can be capable of modifying the activity of the effector component in response to a signal from a receptor, including an antigen receptor, as described in more detail herein.

[0168] Disclosed herein are one or more nucleic acid constructs that constitute the inducible receptor system of the present disclosure. The nucleic acid constructs of the present disclosure may not be naturally occurring and may contain a response element that includes a transcription initiation factor or a transcription initiation factor and a transcription regulator (e.g., a transcription initiation factor-transcription regulator pair). In the inducible receptor system of the present disclosure, the response element is operably linked to an effector element (e.g., a gene of interest).

[0169] In some embodiments, each of the transcriptional regulatory factor and the transcription initiation factor may comprise a concatemer of transcription factor binding motifs. The concatemer may comprise a sequence that may be derived from a known promoter sequence. A concatemer of transcription factor binding motifs (referred to in the examples as a concatemerized sequence) may bind to more than one unique transcription factor or may bind to the same transcription factor at more than one site. It may be understood that a non-naturally occurring sequence may include a naturally occurring sequence (including one isolated from or derived from) that has been assembled in a non-naturally occurring manner. For example, in some embodiments, one or more naturally occurring sequences that are not adjacent in a genome may be placed adjacent in a construct and thus assembled in a non-naturally occurring manner.

[0170] As used herein, a transcription initiation factor of the present disclosure behaves in a promoter-like manner, supporting the binding of a transcription factor to initiate transcription of a downstream gene under its control. As used herein, a transcriptional regulator of the present disclosure can further regulate the transcription of a downstream gene. In some embodiments, the transcriptional regulator is located 5' of the transcription initiation factor. In some embodiments, the transcriptional regulator is located 3' of the transcription initiation factor.

[0171] Transcription binding motifs can be derived from untranslated genomic regions of the following non-exhaustive list of proteins: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0172] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of NFAT, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0173] In some embodiments, the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of NFkB, and in some embodiments, the transcriptional regulatory factor may comprise any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0174] In some embodiments, when the transcription initiation element comprises one or more sequences from the untranslated genomic sequence of REL (including RELA or RELB), in some embodiments, the transcriptional regulatory element may comprise any one or more of the sequences 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0175] In some embodiments, the transcription initiation element comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

[0176] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of IRF2, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0177] In some embodiments, when the transcription initiation factor comprises one or more sequences from the untranslated genomic sequence of GATA3, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0178] In some embodiments, when the transcription initiation factor comprises one or more sequences derived from the untranslated genomic sequence of ATF3, in some embodiments, the transcription regulatory factor may comprise any one or more of the sequences set forth in SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0179] In some embodiments, one or more constructs may also include an integration sequence that can, for example, induce or increase insertion of the construct into a target site in a vector or chromosome. The insertion sequence may include multiple insertion sequences. For example, in some embodiments, the insertion sequence may include a first integration sequence and a second integration sequence. In some embodiments, the first integration sequence may be a 5' integration sequence, and the second integration sequence may be a 3' integration sequence. In some embodiments, the insertion sequence may include a homologous sequence corresponding to the insertion site to promote homologous recombination. In some embodiments, the integration sequence may include one or more transposable elements that may serve to promote transposition. In some embodiments, the transposable elements may include an insertion sequence and / or a transposon sequence. In some embodiments, the integration sequence may include a first 5' terminal repeat sequence or a second 3' terminal repeat sequence. In some embodiments, the construct may be inducible.

[0180] In some embodiments, the nucleic acid construct does not include a transcription initiation factor comprising a human beta globin sequence and a transcriptional regulatory factor comprising any of an NFAT sequence, an IRF4 sequence, an AICE sequence, or an ISRE sequence. In some embodiments, the AICE sequence may include or encompass a sequence of or derived from IRF4 or IRF8, respectively, with BATF. In some embodiments, the AICE sequence may be derived from an untranslated region of IRF4, IRF8, and / or BATF. In some embodiments, the IRSE sequence may include the consensus sequence "YAGTTTC(A / T)YTTTYCC," where "Y" is either C or T. In some embodiments, the construct does not include a sequence comprising SEQ ID NO: 9786.

[0181] In some embodiments, the construct does not include a transcription initiation factor comprising a YB-TATA sequence and a transcription regulatory factor comprising an NFAT sequence. In some embodiments, the construct does not include a sequence comprising SEQ ID NO:9787.

[0182] Methods for identifying nucleic acid constructs that drive gene expression Provided herein are methods for identifying transcription initiation factors of nucleic acid constructs that drive gene expression in response to a cellular condition. In some embodiments, the methods can be used to identify promoters that may exhibit certain behaviors, such as delayed activity (e.g., after antigen stimulation), oscillation after antigen stimulation, reduced promoter-driven transcription after antigen stimulation, or increased promoter-driven transcription after antigen stimulation. In some embodiments, the oscillation can include a change in the expression of a reporter gene driven by the promoter. Promoters can be identified from a library of constructs, where each construct contains one or more unique promoters. In some embodiments, the promoter library can contain multiple concatemers. In some embodiments, a method for identifying transcription initiation factors that drive gene expression in response to a cellular condition can be seen in the exemplary schematic diagram. In some embodiments, a library of constructs can be generated, where each construct contains one or more concatemerized sequences that drive the expression of a reporter gene (e.g., a fluorescent protein). In some embodiments, the library of constructs can be transduced into different types of cells, including primary T cells, and stimulated with antigen. The primary T cells can be sorted for reporter gene expression and sequenced for verification. It will be appreciated that screening of the library of constructs may use high-throughput protocols known in the art, and it will also be appreciated that the design of the library of constructs as well as the analysis of the screening results may use high-throughput analysis or machine learning techniques.

[0183] In designing a promoter library to generate one or more constructs, consensus motifs can be identified. In some embodiments, each consensus motif can comprise a sequence containing one or more transcription factor binding sites or a sequence isolated or derived from the untranslated genomic sequence of one or more transcription factors. After a consensus motif is identified, the 5' and 3' nucleotides can be truncated to leave the consensus motif. At nucleotide positions within a consensus motif that have variability, an "N" can be placed in the sequence so that any nucleotide can be used. At nucleotide positions within a consensus motif that have some variability, another letter (e.g., S, R, or W) can be used to indicate that only a particular nucleotide can be placed there. For example, the letter "S" can indicate that A or T can be substituted at that position, the letter "W" can indicate that G or C can be substituted at that position, the letter "R" can indicate that A or G can be substituted there, etc. In some embodiments, the reverse complement of the consensus motif can be added to the construct. In some embodiments, multiple copies of the consensus motif can be generated and linked together by a linking sequence or spacer to create a concatemer. In some embodiments, the spacer can comprise at least 2 base pairs, at least 3 base pairs, at least 4 base pairs, at least 5 base pairs, at least 6 base pairs, at least 7 base pairs, at least 8 base pairs, at least 9 base pairs, at least 10 base pairs, etc. In some embodiments, the spacer can comprise a 6-base pair spacer. Exemplary spacers can include the sequences TACGCT, TGATCT, TGCTTT, or TGCCCG. In some embodiments, the same spacer can separate each copy of the consensus motif in a concatemer, or different spacers can separate each copy of the consensus motif in a concatemer.

[0184] In some embodiments, the construct can include an adapter sequence located 5' and / or 3' of the transcription initiation element and / or transcriptional regulator. In some embodiments, the adapter sequence can include the sequence AAAGCACTCTTAGGCCTCTGCGTCTCATTCTGAAGACTCACGA (SEQ ID NO: 9801) or AACGGAGTCTTCAACGTGACGCTCGATGCCATAGTTCCTT (SEQ ID NO: 9801).

[0185] In some embodiments, a consensus motif may be identified after isolation or originating from the untranslated genomic sequence of one or more transcription factors. In some embodiments, a consensus motif may be identified after isolation or originating from the untranslated genomic sequence of one or more sequences to which the transcription factor binds. For example, a consensus motif may comprise any one or more sequences in Table 1, including any one or more of SEQ ID NOs: 175-509, 9793-9800. A transcription initiation factor may comprise any one or more sequences in Table 1, including any one or more of SEQ ID NOs: 175-509, 9793-9800.

[0186] Table 1: Exemplary consensus motifs [Table 2-1] TIFF2026503018000091.tif71169

[0187] (Continued from Table 1) [Table 2-2] TIFF2026503018000093.tif93169

[0188] (Continued from Table 1) [Table 2-3] TIFF2026503018000095.tif77169

[0189] (Continued from Table 1) [Table 2-4] TIFF2026503018000097.tif108169

[0190] (Continued from Table 1) [Table 2-5] TIFF2026503018000099.tif98169

[0191] (Continued from Table 1) [Table 2-6] TIFF2026503018000101.tif87169

[0192] (Continued from Table 1) [Table 2-7]

[0193] The identified consensus motifs of Table 1 include some variability within the identified sequence. In some embodiments, the identified consensus motifs of Table 1 may allow for one or more nucleotide substitutions within the identified consensus motif. For example, within a consensus motif of Table 1, "N" may allow any nucleotide, including A, G, C, or T, to be substituted at that position. "S" may allow either G or C to be substituted at that position. "R" may allow either A or G to be substituted at that position, and "W" may allow A or T to be substituted at that position.

[0194] Within each identified consensus motif, specific motifs were identified that reduce the variability of the consensus motif. Table 2 lists exemplary specific motifs present within the identified consensus motifs of Table 1. Transcription initiation and regulatory factors of the present disclosure can include any one or more of the specific exemplary motifs of Table 2.

[0195] Table 2: Exemplary motifs of consensus motifs [Table 3-1] TIFF2026503018000104.tif250165 TIFF2026503018000105.tif97169

[0196] (Continued from Table 2) [Table 3-2] TIFF2026503018000107.tif250165 TIFF2026503018000108.tif97169

[0197] (Continued from Table 2) [Table 3-3] TIFF2026503018000110.tif250165 TIFF2026503018000111.tif97169

[0198] (Continued from Table 2) [Table 3-4] TIFF2026503018000113.tif250165 TIFF2026503018000114.tif97169

[0199] (Continued from Table 2) [Table 3-5] TIFF2026503018000116.tif250165 TIFF2026503018000117.tif97169

[0200] (Continued from Table 2) [Table 3-6] TIFF2026503018000119.tif250165 TIFF2026503018000120.tif97169

[0201] (Continued from Table 2) [Table 3-7] TIFF2026503018000122.tif250165 TIFF2026503018000123.tif97169

[0202] (Continued from Table 2) [Table 3-8] TIFF2026503018000125.tif118169

[0203] In some embodiments, the transcription initiation factor or transcriptional regulator may comprise a sequence comprising or having at least about 70% sequence identity to any of SEQ ID NOs: 175-9800. For example, the transcription initiation factor or transcriptional regulator may comprise a sequence having at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 100% sequence identity to any of SEQ ID NOs: 175-9800.

[0204] Cell state-sensing constructs and expression of engineered receptors In some embodiments, the cell state-sensing construct may drive expression of an engineered antigen receptor, including a T cell receptor ("TCR"), a chimeric antigen receptor ("CAR"), including all generations, a B cell receptor ("BCR"), a co-receptor of a TCR or BCR, and / or any combination or hybrid thereof. In some embodiments, the engineered receptor may or may not be capable of signaling (including a dominant negative antigen sink). In some embodiments, the engineered receptor may include one or more of a DHD and / or binding site for a degradation factor, a binding site for an effector protein of a LOCKR switch, or a binding site for a direct or indirect signaling transducer of a safety switch. In some embodiments, the antigen receptor may comprise fully human sequences, humanized sequences, sequences isolated from or derived from mammalian or non-human sequences (including murine sequences), syngeneic sequences, chimeric sequences, recombinant sequences, or sequences derived from any species.

[0205] An example of an antigen receptor may include a chimeric antigen receptor (CAR), as seen in FIG. 1A. In some embodiments, a CAR may minimally comprise an extracellular domain containing a binding agent that specifically and selectively binds to a target antigen, a transmembrane domain, and an intracellular domain containing at least one signaling domain. In some embodiments, one or more sequences of a CAR may be naturally occurring or non-naturally occurring. In some embodiments, one or more sequences of a CAR may be endogenous or exogenous to the cell expressing it. In some embodiments, one or more sequences of a CAR may be fully human, humanized, isolated from or derived from mammalian or non-human sequences (including mouse sequences), and / or syngeneic sequences. In some embodiments, a CAR may be specific for one or more target antigens. For example, some CARs may have one or more binding agents, each specific for a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance in the immune synapse. The extracellular domain of a CAR may include a spacer positioned between the T cell surface and the binding agent. When more than one binding agent is present, a spacer may be positioned between the T cell surface and the first binding agent. In some embodiments, the binding agent may have any structure, including, but not limited to, (1) an antibody or any fragment thereof, (2) an antibody mimetic or any portion thereof, and / or (3) a de novo designed protein. Exemplary binding agents may include, but are not limited to, scFv, VH, VHH, monoclonal antibody, and any combination thereof. In some embodiments, the transmembrane domain may be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains may include sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, the CAR may be of any CAR "generation," including, but not limited to, Gen I, Gen II, Gen III, Gen IV, and Gen V.In some embodiments, the intracellular domain of the CAR may comprise one or more of an immunoreceptor tyrosine-based activation motif (ITAM) repeat (e.g., a single CD3ζ intracellular domain) (Gen I), an ITAM repeat and one costimulatory molecule (e.g., a CD27 or CD137 sequence) (Gen II), an ITAM repeat, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD134 or CD137) (Gen III), an ITAM repeat, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., WT IL-12) (Gen IV; also referred to as universal cytokine killing redirected T cells (TRUCK)), and / or an ITAM repeat, a costimulatory molecule, and the intracellular domain of a cytokine receptor (e.g., a WT IL-2R β chain fragment) (Gen V).

[0206] In some embodiments, the CAR may or may not be capable of signaling (dominant negative antigen sink). The CAR may comprise a DHD and / or binding site for a degradation factor, a binding site for an effector protein of a LOCKR switch, a binding site for a direct or indirect signaling transducer of a logic gate or switch, or a safety switch. In some embodiments, the CAR may be a split CAR whose ultimate activity depends on the binding and interaction of two domains or two receptors.

[0207] To avoid CAR T cell exhaustion, it would be beneficial to have a system that includes one or more exemplary constructs that can sense exhaustion and shut down CAR stimulation. Disclosed herein are one or more exemplary engineered (non-naturally occurring) constructs and methods of use that can be used to shut down stimulating antigen receptors, including chimeric antigen receptors, in response to sensing a cellular condition that includes exhaustion.

[0208] Cell state-sensing constructs and expression of fusion proteins In some embodiments, the cell state-sensing construct may drive expression of a fusion protein having an engineered receptor (e.g., a CAR or TCR) and a degradation domain. For example, in some embodiments, a polypeptide may be fused to a degradation domain for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element of a protein sufficient for cell-mediated degradation. In some embodiments, cell-mediated degradation is ubiquitin-dependent. In some embodiments, cell-mediated degradation is ubiquitin-independent.

[0209] In some embodiments, one or more constructs can include a polynucleotide set comprising a polynucleotide encoding a degradation initiator fused to a binding element specific for a natural motif on an endogenous molecule of interest. The binding domain can recognize and bind, for example, to a particular region on the molecule of interest or a particular modification on the molecule of interest. Interaction of the binding element with the natural motif on the molecule recruits the degradation initiator to the molecule, initiating degradation.

[0210] In some embodiments, the degradation domain comprises a ligase or ligase binding domain. In some embodiments, one or more polypeptides of the construct may be used as binding elements, where the polypeptide is fused to a ligase domain (or a functional variant thereof). Binding of one or more polypeptides of the construct to a protein of interest brings the modified ligase into proximity with the target protein, thereby facilitating ubiquitination and subsequent degradation of the protein target.

[0211] In some embodiments, the ligase of one or more constructs can include an E3 ligase. E3 ligases control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin proteasome system, E3 ligase proteins recruit ubiquitin-loaded E2 ubiquitin-conjugating enzymes, recognize protein substrates, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof can be selected based on the intended protein to be targeted for degradation. For example, E3 ligases and / or sets of E3 ligases can be selected to modulate the stability and / or half-life of a target transmembrane protein. In another example, E3 ligases and / or sets of E3 ligases can be selected to modulate the stability and / or half-life of a cytoplasmic protein (e.g., a transcription factor). In some embodiments, one or more constructs may comprise one or more synthetic degradation factors that may be useful for modulating the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degradation factors may be used in cell therapy applications to program cell populations to perform and / or modulate a therapeutic function.

[0212] In some embodiments, one or more synthetic degradation factors can be used to regulate (degrade) T cell receptor (TCR) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degradation factor system of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, which can lead to the undesirable exhaustion phenotype observed in many existing immune cell therapies.

[0213] Cell state-sensing constructs and cytokine expression In some embodiments, the cell state-sensing construct may drive expression of one or more cytokines. For example, in some embodiments, the transcription initiation factor and / or transcriptional regulator may be operably linked to one or more cytokines. The one or more cytokines may include IL-2, IL-12, IL-15, IL-18, IL-21, IL-23, interferon alpha (α), interferon beta (β), interferon gamma (γ), and interferon omega (ω).

[0214] Exemplary Constructs Comprising Circuit Components The constructs of the present disclosure are not naturally occurring and comprise one or more circuits that together regulate the expression of a selected protein of interest (hereinafter referred to as an effector component). In some embodiments, the circuit may comprise a response component (e.g., any one of the transcription initiation factor / transcriptional regulator / EP pair / promoter / enhancer provided above) and an effector component. The response component can modify the activity of the effector component. The response component can modify the activity of the effector component in response to a signal from a receptor, including an antigen receptor, in response to an epigenetic change, in response to induction or repression of transcription, or in response to a change in cellular state. In some embodiments, the activity of the response component can induce a change in the activity of the effector component. For example, the response component may comprise a transcription initiation component comprising a concatemer comprising one or more sequences from an untranslated region of a transcription factor, the transcription initiation component operably linked to a CAR, and the effector component may comprise a CAR. Transcription initiation factors and response elements can modify the activity of CARs and effector components, and the activity of the transcription initiation factors can induce changes in CAR activity by increasing CAR transcription. In another example, the response element can include a constitutive transcription initiation factor operably linked to the CAR, and the effector component can include an inducible transcription initiation factor operably linked to a degradation factor. Antigen stimulation can result in an activated response through the CAR response component, and the endogenous signaling network can induce expression of the degradation factor and effector component, thereby reducing CAR expression. It can be understood that any of the constructs in the present disclosure can be configured to encode a circuit component and are considered contemplated. For example, the response element can include one or more of a sequence of an untranslated region of a transcription factor, a sequence containing a binding site for the transcription factor, a promoter, an enhancer, and a suppressor. In some embodiments, the response element can include a promoter containing an epigenetic modifier, a minimal promoter. In some embodiments, the minimal promoter can include a sequence of any one or more of SEQ ID NOs: 9788, 9789, or 9790.In some embodiments, the response element may comprise a transcription initiation factor comprising a concatenated promoter comprising the sequence of any one or more of SEQ ID NOs: 175-9781. In some embodiments, the response element may comprise a transcription initiation factor and a transcriptional regulatory element comprising an enhancer-promoter pair. In some embodiments, the response element may comprise the sequence of any one or more of SEQ ID NOs: 1-174. In some embodiments, the effector element may comprise a degradation factor. In some embodiments, the effector element may comprise a degradation factor operably linked to a transcription initiation factor comprising the sequence of any one or more of SEQ ID NOs: 1-9781. In some embodiments, the signal from the receptor comprises a signal from a CAR. In some embodiments, the cellular state or change in cellular state may comprise any cellular state, including unstimulated, stimulated, stimulated, exhausted, or resting.

[0215] Inducible CAR system In some embodiments, the circuit is an inducible receptor system, e.g., an inducible CAR system. Within one or more constructs of the inducible CAR system, components of a response element are combined to regulate the transcription of one or more genes (e.g., CAR and a degradation factor). For example, the response element can be operably linked to one or more genes of the construct, and the one or more genes can include a CAR and / or a degradation factor, and the response element regulates the transcription of either the CAR or the degradation factor, or both.

[0216] Table 4 lists four different constructs of the inducible CAR system and the expression profiles produced by the four different CAR constructs.

[0217] Table 4: CAR constructs of inducible CAR systems [Table 4]

[0218] For example, the first CAR ("CAR-1") may have a transcription initiation factor that exhibits "constitutive on behavior," which drives CAR after antigen stimulation. In the absence of any dynamic regulation of CAR, CAR expression may remain at a consistent level over time. However, consistent CAR expression in the presence of consistent antigen stimulation may result in an exhausted cell state. A degradation factor may be added to the CAR-1 construct ("CAR-1D"), and expression of the degradation factor reduces or pulses CAR expression, allowing the cells to transition to a resting cell state. After the resting cell state, reactivation of the CAR by antigen stimulation may result in increased CAR expression. The CAR-1D construct may cycle through multiple pulses of CAR expression over time.

[0219] The presence of a degradation factor may allow CAR expression to be reduced to various levels, including almost completely, to baseline, a slight reduction compared to peak CAR expression levels, or any level in between.

[0220] The second CAR construct ("CAR-2") may have a promoter that exhibits a stimulatory behavior, where stimulation of the CAR drives increased CAR expression through a regulated promoter. The CAR-2 promoter may drive transcription at a higher level than the CAR-1 promoter, resulting in a significant increase in overall CAR transcription levels. In the absence of any CAR regulation, CAR expression may also remain at a consistent level over time without decreasing to baseline levels. Introduction of a degradation factor into the inducible receptor-based construct ("CAR-2D") may result in CAR expression pulses over time. Addition of a degradation factor to CAR-2 may result in a decrease in CAR expression to approximately baseline levels.

[0221] The level of pulsing (e.g., the change in CAR expression from a maximum CAR expression value to a minimum CAR expression value) and the rate of pulsing (e.g., the frequency of the change in CAR expression) can be varied. In some embodiments, the level of pulsing and the rate of pulsing can be varied using different transcription initiation factors, different transcriptional regulators, or different enhancer-promoter pairs.

[0222] Inducible constructs containing transcription initiation and transcriptional regulatory factors or EP pairs and expression of fusion proteins In some embodiments, the circuitry may drive expression of engineered antigen receptors, including T cell receptors ("TCRs"), chimeric antigen receptors ("CARs," including all generations), B cell receptors ("BCRs"), co-receptors of TCRs or BCRs, and / or any combination or hybrid thereof. In some embodiments, the engineered receptors may or may not be capable of signaling (including dominant negative antigen sinks). In some embodiments, the engineered receptors may include one or more of a DHD and / or binding site for a degradation factor, a binding site for an effector protein of a LOCKR switch, or a binding site for a direct or indirect signaling transducer of a safety switch. In some embodiments, the antigen receptor may include fully human sequences, humanized sequences, sequences isolated from or derived from mammalian or non-human sequences (including murine sequences), syngeneic sequences, chimeric sequences, recombinant sequences, or sequences derived from any species.

[0223] An example of an antigen receptor may include a chimeric antigen receptor (CAR). In some embodiments, a CAR may minimally comprise an extracellular domain containing a binding agent that specifically and selectively binds to a target antigen, a transmembrane domain, and an intracellular domain containing at least one signaling domain. In some embodiments, one or more sequences of a CAR may be naturally occurring or non-naturally occurring. In some embodiments, one or more sequences of a CAR may be endogenous or exogenous to the cell expressing it. In some embodiments, one or more sequences of a CAR may be fully human, humanized, isolated from or derived from mammalian or non-human sequences (including mouse sequences), and / or syngeneic sequences. In some embodiments, a CAR may be specific for one or more target antigens. For example, some CARs may have one or more binding agents, each specific for a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance in the immune synapse. The extracellular domain of a CAR may include a spacer positioned between the T cell surface and the binding agent. When more than one binding agent is present, a spacer may be positioned between the T cell surface and the first binding agent. In some embodiments, the binding agent may have any structure, including, but not limited to, (1) an antibody or any fragment thereof, (2) an antibody mimetic or any portion thereof, and / or (3) a de novo designed protein. Exemplary binding agents may include, but are not limited to, scFv, VH, VHH, monoclonal antibody, and any combination thereof. In some embodiments, the transmembrane domain may be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains may include sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, the CAR may be of any CAR "generation," including, but not limited to, Gen I, Gen II, Gen III, Gen IV, and Gen V.In some embodiments, the intracellular domain of the CAR may comprise one or more of an immunoreceptor tyrosine-based activation motif (ITAM) repeat (e.g., a single CD3ζ intracellular domain) (Gen I), an ITAM repeat and one costimulatory molecule (e.g., a CD27 or CD137 sequence) (Gen II), an ITAM repeat, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD134 or CD137) (Gen III), an ITAM repeat, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., WT IL-12) (Gen IV; also referred to as universal cytokine killing redirected T cells (TRUCK)), and / or an ITAM repeat, a costimulatory molecule, and the intracellular domain of a cytokine receptor (e.g., a WT IL-2R β chain fragment) (Gen V).

[0224] In some embodiments, the CAR may or may not be capable of signaling (dominant negative antigen sink). The CAR may comprise a DHD and / or binding site for a degradation factor, a binding site for an effector protein of a LOCKR switch, a binding site for a direct or indirect signaling transducer of a logic gate or switch, or a safety switch. In some embodiments, the CAR may be a split CAR whose ultimate activity depends on the binding and interaction of two domains or two receptors.

[0225] To avoid CAR T cell exhaustion, it would be beneficial to have a system comprising one or more exemplary constructs that can sense a cellular exhaustion state and shut down CAR stimulation. Disclosed herein are one or more exemplary engineered (non-naturally occurring) constructs and methods of use that can be used to shut down stimulating antigen receptors, including chimeric antigen receptors, in response to sensing a cellular state, including exhaustion.

[0226] Inducible constructs and expression of fusion proteins In some embodiments, the inducible construct may drive expression of a fusion protein comprising an engineered receptor (e.g., a CAR or TCR) and a degradation domain. For example, in some embodiments, a polypeptide may be fused to a degradation domain for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element of a protein sufficient for cell-mediated degradation. In some embodiments, the cell-mediated degradation is ubiquitin-dependent. In some embodiments, the cell-mediated degradation is ubiquitin-independent.

[0227] In some embodiments, one or more constructs can include a polynucleotide set comprising a polynucleotide encoding a degradation initiator fused to a binding element specific for a natural motif on an endogenous molecule of interest. The binding domain can recognize and bind, for example, to a particular region on the molecule of interest or a particular modification on the molecule of interest. Interaction of the binding element with the natural motif on the molecule recruits the degradation initiator to the molecule, initiating degradation.

[0228] In some embodiments, the degradation domain comprises a ligase or ligase binding domain. In some embodiments, one or more polypeptides of the construct may be used as binding elements, where the polypeptide is fused to a ligase domain (or a functional variant thereof). Binding of one or more polypeptides of the construct to a protein of interest brings the modified ligase into proximity with the target protein, thereby facilitating ubiquitination and subsequent degradation of the protein target.

[0229] In some embodiments, the ligase of one or more constructs can include an E3 ligase. E3 ligases control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin proteasome system, E3 ligase proteins recruit ubiquitin-loaded E2 ubiquitin-conjugating enzymes, recognize protein substrates, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof can be selected based on the intended protein to be targeted for degradation. For example, E3 ligases and / or sets of E3 ligases can be selected to modulate the stability and / or half-life of a target transmembrane protein. In another example, E3 ligases and / or sets of E3 ligases can be selected to modulate the stability and / or half-life of a cytoplasmic protein (e.g., a transcription factor). In some embodiments, one or more constructs may comprise one or more synthetic degradation factors that may be useful for modulating the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degradation factors may be used in cell therapy applications to program cell populations to perform and / or modulate a therapeutic function.

[0230] In some embodiments, one or more synthetic degradation factors can be used to regulate (degrade) T cell receptor (TCR) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degradation factor system of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, which can lead to the undesirable exhaustion phenotype observed in many existing immune cell therapies.

[0231] It can be understood that within a construct, the regulated promoter or EP pair can drive transcription of any reporter gene or gene. In a construct comprising an inducible receptor system, the regulated promoter or EP pair can drive transcription of a CAR or degradation factor. For example, in some embodiments, the regulated promoter or EP pair can drive expression of a polypeptide comprising a fusion protein having a CAR or degradation domain. In some embodiments, the polypeptide can be fused to a degradation domain for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element of a protein sufficient for cell-mediated degradation. In some embodiments, cell-mediated degradation may or may not depend on ubiquitin.

[0232] In some aspects, the inducible receptor system of the present disclosure may be useful for modulating the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. For example, in one embodiment, the inducible receptor system of the present disclosure may be used in cell therapy applications to program cell populations to perform and / or modulate therapeutic functions. In one aspect, the inducible receptor system of the present disclosure may be used to modulate T cell receptor (TCR) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the inducible receptor system of the present disclosure may be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, which can lead to the undesirable exhaustion phenotype observed in many existing T cell therapies.

[0233] vector The present disclosure provides vectors comprising one or more of the nucleic acid sequence constructs of the present disclosure. In some embodiments, the vector is an expression vector, e.g., a plasmid. In some embodiments, the expression vectors of the present disclosure can be expressed in a host cell. The host cell can be, for example, a prokaryotic cell, such as a bacterial cell, or a eukaryotic cell, such as a yeast cell, a plant cell, or a mammalian cell. Examples of mammalian cells suitable for use with the present disclosure include human primate cells and non-human primate cells. Other mammalian cells include mouse, rat, pig, rabbit, sheep, and goat cells. In some cases, the cell is a synthetic cell. The host cell can be, for example, selected from the group consisting of immune cells, cardiac cells, lung cells, muscle cells, epithelial cells, pancreatic cells, skin cells, CNS cells, neurons, myocytes, skeletal muscle cells, smooth muscle cells, liver cells, kidney cells, and glial cells.

[0234] In some embodiments, the host cells are immune cells. Immune cells may include stem cells, progenitor cells, and / or differentiated cells. Immune cells may be isolated and / or derived from cells of the innate immune system and / or adaptive immune system. Immune cells may be isolated and / or derived from cells of bone marrow or immune cell-containing organs (e.g., thymus, liver, tonsils, lymph nodes, spleen, and / or blood). In some embodiments, cells of the innate immune system include, but are not limited to, granulocytes (including basophils, eosinophils, and neutrophils), monocytes (which become macrophages), macrophages, mast cells, antigen presenting cells ("APCs") including dendritic cells, and natural killer ("NK") cells, which also play a role in adaptive immunity. In some embodiments, cells of the adaptive immune system include, but are not limited to, hematopoietic stem cells ("HSCs"), T lymphocytes (e.g., T cells), B lymphocytes (e.g., B cells), and NK cells.

[0235] In some embodiments, the host cell is a white blood cell. In some embodiments, the host cell is a lymphocyte. In some embodiments, the host cell is a T cell. In some embodiments, the host cell is a CD8+ T cell. In some embodiments, the host cell is a CD4+ T cell. In some embodiments, the host cell is a regulatory T cell. In some embodiments, the host cell is a gamma delta T cell. In some embodiments, the host cell is an alpha beta T cell. In some embodiments, the host cell is an ex vivo human cell. In some embodiments, the host cell is an in vivo human cell.

[0236] In some embodiments, the host cells are modified to express an exogenous receptor. In some embodiments, the host cells are modified to express a chimeric antigen receptor (CAR). In some embodiments, the host cells are modified to express an engineered T cell receptor (TCR). In some embodiments, the host cells are ex vivo human cells. In some embodiments, the host cells are in vivo human cells.

[0237] In some embodiments, the host cells are modified to express an exogenous receptor. In some embodiments, the host cells are modified to express a chimeric antigen receptor (CAR). In some embodiments, the host cells are modified to express an engineered T cell receptor (TCR).

[0238] In some embodiments, the vector is used to deliver the constructs of the present disclosure and includes a non-viral vector comprising one or more of the constructs described herein. Non-limiting examples of non-viral vectors of the present disclosure include organic particles, inorganic particles (e.g., gold particles), nanoparticles, lipid-based vectors, micelles, endosomes, exosomes, liposomes, polymer-based vectors, polymersomes, peptide-based vectors, and cell-penetrating peptides.

[0239] Pharmaceutical Composition Also provided herein are pharmaceutical compositions. In some embodiments, the pharmaceutical compositions of the present disclosure comprise any one or more of the sequences, nucleotides, constructs, vectors, and cells of the present disclosure in combination with a pharmaceutically acceptable excipient thereof.

[0240] How to use In some embodiments, provided herein are methods that involve using a construct of the present disclosure to drive expression in response to a cellular condition. For example, in some embodiments, using a construct to reduce exhaustion in an immune cell involves using the construct to drive expression of a desired downstream gene during stimulation of a TCR or CAR expressed by the immune cell. The constructs provided herein are responsive to cellular exhaustion, cellular quiescence, antigen receptor activation, cellular stimulation, and epigenetic modulation. In some embodiments, the constructs disclosed herein can be used to treat cancer, including solid cancers and hematological cancers, or to treat autoimmune diseases.

[0241] Also provided herein are uses of such constructs, vectors containing the constructs described herein, and cells containing the vectors described herein.

[0242] While embodiments of the present invention have been shown and described herein, those skilled in the art will understand that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used in practicing the invention. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0243] Enumerated Embodiments Embodiment I-1 A nucleic acid construct comprising a transcription initiation factor or a transcription initiation factor and a transcription regulatory factor, wherein each of the transcription regulatory factor and the transcription initiation factor comprises a concatemer of transcription factor binding motifs for binding to more than one unique transcription factor or for binding to the same transcription factor at more than one site, and wherein the construct does not occur in nature.

[0244] Embodiment I-2 The construct of embodiment I-1, comprising a transcriptional regulatory factor and a transcription initiation factor.

[0245] Embodiment I-3 The construct of embodiment I-1, wherein the transcriptional regulatory element is located 5' of the transcription initiation element.

[0246] Embodiment I-4 The construct of embodiment I-1, wherein the transcriptional regulatory element is located 3' to the transcription initiation element.

[0247] Embodiment I-5 The construct comprises: A transcriptional regulatory factor including an NFAT sequence, an IRF4 sequence, an AICE sequence, and an ISRE sequence, and The construct of embodiment I-1, which does not comprise a combination of transcription initiation factors comprising a human beta globin sequence.

[0248] Embodiment I-6. The construct of embodiment I-1, wherein the construct does not comprise the sequence GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

[0249] Embodiment I-7 The construct a transcriptional regulator comprising an NFAT sequence, and The construct of embodiment I-1, which does not comprise a combination of transcription initiation factors comprising a YB-TATA sequence.

[0250] Embodiment I-8. The construct of embodiment I-1, wherein the construct does not comprise the sequence of GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

[0251] Embodiment I-9 The construct according to any one of embodiments I-1 to I-8, wherein the concatemer of transcriptional regulators comprises two or more repeat sequences.

[0252] Embodiment I-10. The construct of embodiment I-9, wherein the concatemer of transcription factor binding motifs binds to more than one unique transcription factor.

[0253] Embodiment I-11 The construct of embodiment I-9, wherein the concatemers of transcription factor binding motifs bind to the same transcription factor at more than one site.

[0254] Embodiment I-12. The construct of embodiment I-9, wherein the two or more repeat sequences comprise the same sequence.

[0255] Embodiment I-13 The construct of embodiment I-9, wherein the two or more repeat sequences do not comprise the same sequence.

[0256] Embodiment I-14. The construct of any one of embodiments I-9 to I-13, wherein the concatemer comprises a linking sequence positioned between the repeat sequences.

[0257] Embodiment I-15. The construct of embodiment I-14, wherein the linking sequence comprises one or more of TACGCT, TGATCT, TGCTTT, and TGCCCGT.

[0258] Embodiment I-16: The transcriptional regulator is selected from the group consisting of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, The construct of any one of embodiments I-1 to I-15, comprising sequences isolated from or derived from one or more of the untranslated genomic sequences of RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0259] Embodiment I-17 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0260] Embodiment I-18 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally any one or more of the sequences of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0261] Embodiment I-19 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally any one or more of the sequences of SEQ ID NOs: 550 to 553, 1060 to 1063, and 5696 to 5699.

[0262] Embodiment I-20 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally any one or more of the sequences of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0263] Embodiment I-21 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0264] Embodiment I-22 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally any one or more of the sequences of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0265] Embodiment I-23 The construct of any one of embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally comprises any one or more of the sequences of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0266] Embodiment I-24 The construct of any one of embodiments I-1 to I-23, wherein (a) the transcriptional regulator is inducible, or (b) the construct is inducible.

[0267] Embodiment I-25 The construct of any one of embodiments I-1 to I-24, wherein the transcription initiation element comprises a classical promoter.

[0268] Embodiment I-26. The construct of embodiment I-25, wherein the promoter comprises a minimal promoter.

[0269] Embodiment I-27 The construct of embodiment I-26, wherein the minimal promoter comprises sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta globin.

[0270] Embodiment I-28 The minimal promoter comprises: MinP1 having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788), MinP2 having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789), and The construct of embodiment I-27, comprising one or more of MinP3 having the sequence: CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0271] Embodiment I-29 The construct of any one of embodiments I-1 to I-28, wherein the transcription initiation factor comprises a transcription factor binding motif.

[0272] Embodiment I-30. The construct of embodiment I-29, wherein the transcription initiation factor comprises motifs isolated from or derived from untranslated genomic sequences of transcription factors or comprises a mammalian promoter sequence.

[0273] Embodiment I-31 The construct of embodiment I-29, wherein the motif comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0274] Embodiment I-32 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0275] Embodiment I-33 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally any one or more of the sequences of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0276] Embodiment I-34 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally any one or more of the sequences of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0277] Embodiment I-35 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation element comprises a sequence derived from the untranslated genomic sequence of REL, and optionally any one or more of the sequences of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0278] Embodiment I-36 A construct according to any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences of SEQ ID NOs: 4484 to 4499, 4994 to 5009, and 9630 to 9645.

[0279] Embodiment I-37 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0280] Embodiment I-38 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally any one or more of the sequences of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0281] Embodiment I-39 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally any one or more of the sequences of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0282] Embodiment I-40. The construct of any one of embodiments I-1 to I-39, wherein the transcription initiation factor comprises any one or more of the sequences of SEQ ID NOs: 175 to 9781, or a concatemer thereof.

[0283] Embodiment I-41 The construct of any one of embodiments I-1 to I-40, wherein the construct further comprises an integration sequence capable of directing or increasing insertion of the construct into the target site.

[0284] Embodiment I-42. The construct of embodiment I-41, wherein the vector comprises a targeting site.

[0285] Embodiment I-43 The construct of embodiment I-41, wherein the chromosome comprises the target site.

[0286] Embodiment I-44 The construct of any one of embodiments I-41 to I-43, wherein the integration sequence comprises a first integration sequence or a 5' integration sequence and a second integration sequence or a 3' integration sequence.

[0287] Embodiment I-45. The construct of any one of embodiments I-41 to I-44, wherein the integration sequence comprises a homologous sequence corresponding to an insertion site for promoting homologous recombination.

[0288] Embodiment I-46. The construct of any one of embodiments I-41 to I-44, wherein the integration sequence comprises a transposable element to facilitate transposition.

[0289] Embodiment I-47. The construct of embodiment I-46, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

[0290] Embodiment I-48 The construct according to any one of embodiments I-41 to I-44, wherein the integration sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

[0291] Embodiment I-49. The construct of embodiment I-48, wherein the integration sequence comprises a first 5' terminal repeat sequence and a second 3' terminal repeat sequence.

[0292] Embodiment I-50. The construct of embodiment I-48 or I-49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR) sequence.

[0293] Embodiment I-51 The construct of embodiment I-48 or I-49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat (ITR) sequence.

[0294] Embodiment I-52. The construct of any one of embodiments I-1 to I-51, further comprising a reporter sequence.

[0295] Embodiment I-53. The construct of embodiment I-52, wherein the reporter sequence comprises a fluorescent protein.

[0296] Embodiment I-54. The construct of embodiment I-53, wherein the reporter sequence comprises green fluorescent protein (GFP).

[0297] Embodiment I-55 A vector comprising a construct according to any one of embodiments I-1 to I-54.

[0298] Embodiment I-56. The vector of embodiment I-55, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

[0299] Embodiment I-57. The vector of embodiment I-55 or I-56, wherein the vector is an expression vector capable of expressing the construct in human cells.

[0300] Embodiment I-58 The vector of embodiment I-57, wherein the vector is a delivery vector capable of delivering the construct to a mammalian cell.

[0301] Embodiment I-59. The vector of embodiment I-55 or I-58, wherein the vector is a delivery vector capable of delivering the construct to a human cell.

[0302] Embodiment I-60 A library comprising a construct according to any one of embodiments I-11 to I-54 or a vector according to any one of embodiments I-55 to I-59.

[0303] Embodiment I-61. A library according to embodiment I-60, comprising a plurality of constructs according to any one of embodiments I-1 to I-54 or a plurality of vectors according to any one of embodiments I-55 to I-59.

[0304] Embodiment I-62. A library according to embodiment I-60 or I-61, comprising a plurality of constructs, each sequence being as described in any one of embodiments I-1 to I-54.

[0305] Embodiment I-63. The library according to embodiment I-60 or I-61, comprising a plurality of vectors, each vector being described in any one of embodiments I-55 to I-59.

[0306] Embodiment I-64 A construct according to any one of embodiments I-1 to I-54, A vector according to any one of embodiments I-55 to I-59, or A cell comprising a library according to any one of embodiments I-60 to I-63.

[0307] Embodiment I-65 The cell of embodiment I-64, wherein the cell is an immune cell.

[0308] Embodiment I-66 The cell of embodiment I-64 or I-65, wherein the cell is a stem cell, a progenitor cell, a precursor cell, or a naive cell.

[0309] Embodiment I-67. The cell of embodiment I-64 or I-65, wherein the cell is a differentiated cell.

[0310] Embodiment I-68 The cell of any one of embodiments I-64 to I-67, wherein the cell is a T cell, a B cell, a macrophage or an NK cell.

[0311] Embodiment I-69 The cell of any one of embodiments I-64 to I-67, wherein the cell is a T cell.

[0312] Embodiment I-70 The cell of any one of embodiments I-64 to I-67, wherein the cell is a NK cell.

[0313] Embodiment I-71 The cell of any one of embodiments I-64 to I-67, wherein the cell is in vitro or ex vivo.

[0314] Embodiment I-72 The cell of any one of embodiments I-64 to I-67, wherein the cell is a primary cell.

[0315] Embodiment I-73 The cell of any one of embodiments I-64 to I-67, wherein the cell is a cultured cell.

[0316] Embodiment I-74 Use of a construct according to any one of embodiments I-1 to I-54, a vector according to any one of embodiments I-55 to I-59, a library according to any one of embodiments I-60 to I-63, or a cell according to any one of embodiments I-64 to I-73 for selecting sequences that respond to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

[0317] Embodiment I-75 The use of embodiment I-74, wherein the cell stimulation is early stimulation.

[0318] Embodiment I-76 The use of embodiment I-74, wherein the cell stimulation is a late stimulation.

[0319] Embodiment I-77 The use of embodiment I-74, wherein the antigen receptor is a chimeric antigen receptor.

[0320] Embodiment I-78 The use of embodiment I-74, wherein the cell is a T cell and the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0321] Embodiment I-79 Use of a construct according to any one of embodiments I-1 to I-54, a vector according to any one of embodiments I-55 to I-59, a library according to any one of embodiments I-60 to I-63, or a cell according to any one of embodiments I-64 to I-73 for regulating transcription of an exogenous protein in response to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

[0322] Embodiment I-80. The use of embodiment I-79, wherein the exogenous protein is one or more of an engineered receptor, a cytokine, or a degradation factor.

[0323] Embodiment II-1 An inducible nucleic acid construct comprising a transcriptional regulatory enhancer sequence and a transcriptional initiation promoter sequence (EP pair), wherein the construct does not exist naturally.

[0324] Embodiment II-2 The construct according to embodiment II-1, wherein the EP pairing comprises an EP pairing sequence of any one or more of SEQ ID NOs: 1 to 174, or a sequence comprising 90% sequence identity thereto.

[0325] Embodiment II-3 The construct of embodiment II-1, wherein the EP pairing comprises an enhancer sequence comprising at least 70% sequence identity to any one or more of the enhancer sequences of SEQ ID NOs: 1-174.

[0326] Embodiment II-4 The construct of embodiment II-1, wherein the EP pairing comprises a promoter sequence comprising at least 70% sequence identity to any one or more of the promoter sequences of SEQ ID NOs: 1-174.

[0327] Embodiment II-5. The construct of embodiment II-1, wherein the enhancer sequence is located 5' to the promoter sequence.

[0328] Embodiment II-6. The construct of embodiment II-1, wherein the enhancer sequence is located 3' to the promoter sequence.

[0329] Embodiment II-7 The construct of embodiment II-1, wherein the EP pairing comprises from about 100 base pairs to about 1500 base pairs.

[0330] Embodiment II-8. The construct of embodiment II-1, wherein the EP pairing comprises from about 500 base pairs to about 1250 base pairs.

[0331] Embodiment II-9. The construct of embodiment II-1, wherein the EP pairing comprises from about 900 base pairs to about 1100 base pairs.

[0332] Embodiment II-10. The construct of any one of embodiments II-1 to II-9, wherein the construct further comprises a barcode sequence.

[0333] Embodiment II-11 The construct of embodiment II-10, wherein the barcode sequence is located 5' to the EP pairing.

[0334] Embodiment II-12. The construct of embodiment II-10, wherein the barcode sequence is located 3' to the EP pairing.

[0335] Embodiment II-13 The construct according to any one of embodiments II-1 to II-12, wherein the construct further comprises a 5' untranslated region (UTR) located 3' to the EP pairing.

[0336] Embodiment II-14 The construct of any one of embodiments II-1 to II-12, wherein the construct further comprises a 5' untranslated region (UTR) located 3' to the barcode sequence.

[0337] Embodiment II-15. The construct according to any one of embodiments II-1 to II-14, wherein the construct further comprises an integration sequence capable of directing or increasing insertion of the construct into the target site.

[0338] Embodiment II-16. The construct of embodiment II-15, wherein the target site is a target site in a vector.

[0339] Embodiment II-17. The construct of embodiment II-15, wherein the target site is a target site in a chromosome.

[0340] Embodiment II-18. The construct according to any one of embodiments II-15 to II-17, wherein the integration sequence comprises a first integration sequence or a 5' integration sequence and a second integration sequence or a 3' integration sequence.

[0341] Embodiment II-19. The construct according to any one of embodiments II-15 to II-18, wherein the integration sequence comprises a homologous sequence corresponding to an insertion site for promoting homologous recombination.

[0342] Embodiment II-20. The construct of any one of embodiments II-15 to II-18, wherein the integration sequence comprises a transposable element to facilitate transposition.

[0343] Embodiment II-21. The construct of embodiment II-20, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

[0344] Embodiment II-22 The construct according to any one of embodiments II-15 to II-18, wherein the integration sequence comprises a first 5'-terminal repeat sequence or a second 3'-terminal repeat sequence.

[0345] Embodiment II-23 The construct of embodiment II-21 or II-22, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR) sequence.

[0346] Embodiment II-24. The construct of embodiment II-21 or II-22, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat (ITR) sequence.

[0347] Embodiment II-25. The construct of any one of embodiments II-1 to II-24, further comprising a reporter sequence.

[0348] Embodiment II-26. The construct of embodiment II-25, wherein the reporter sequence comprises a fluorescent protein.

[0349] Embodiment II-27. The construct of embodiment II-26, wherein the reporter sequence comprises green fluorescent protein (GFP).

[0350] Embodiment II-28 The construct of any one of embodiments II-1 to II-27, wherein the enhancer sequence is isolated from or derived from one or more sequences of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

[0351] Embodiment II-29 The construct according to any one of Embodiments II-1 to II-28, wherein the enhancer sequence is a minimal sequence exhibiting enhancer function or activity.

[0352] Embodiment II-30 The construct of embodiment II-28 or II-29, wherein the enhancer sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs therebetween.

[0353] Embodiment II-31 The construct of any one of embodiments II-1 to II-30, wherein the promoter sequence is isolated from or derived from one or more sequences of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

[0354] Embodiment II-32 The construct according to any one of Embodiments II-1 to II-31, wherein the promoter sequence is a minimal sequence exhibiting promoter function or activity.

[0355] Embodiment II-33 The construct of embodiment II-31 or II-32, wherein the promoter sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs therebetween.

[0356] Embodiment II-34 A vector comprising the construct according to any one of embodiments II-1 to II-33.

[0357] Embodiment II-35. The vector of embodiment II-34, wherein the transcriptional regulatory enhancer sequence and / or transcriptional initiation promoter sequence is operably linked to a nucleic acid sequence encoding any one or more of a chimeric antigen receptor (CAR), an exogenous T cell receptor (TCR), a cytokine, or a resolution factor.

[0358] Embodiment II-36. The vector of embodiment II-34 or II-35, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

[0359] Embodiment II-37. The vector according to any one of embodiments II-34 to II-36, wherein the vector is an expression vector capable of expressing the construct in human cells.

[0360] Embodiment II-38. The vector of embodiment II-34 or II-35, wherein the vector is a delivery vector capable of delivering the construct into mammalian cells.

[0361] Embodiment II-39. The vector of embodiment II-34 or II-35, wherein the vector is a delivery vector capable of delivering the construct into human cells.

[0362] Embodiment II-40 A library comprising a construct according to any one of embodiments II-1 to II-33 or a vector according to any one of embodiments II-34 to II-39.

[0363] Embodiment II-41 A library according to embodiment II-40, comprising a plurality of constructs according to any one of embodiments II-1 to II-33 or a plurality of vectors according to any one of embodiments II-34 to II-39.

[0364] Embodiment II-42. A library according to embodiment II-40 or II-41, comprising a plurality of constructs, each sequence being as described in any one of embodiments II-1 to II-33.

[0365] Embodiment II-43. The library of embodiment II-42, wherein each construct comprises a unique barcode sequence.

[0366] Embodiment II-44. A library according to embodiment II-40 or II-41, comprising a plurality of vectors, each vector being described in any one of embodiments II-34 to II-39.

[0367] Embodiment II-45 A construct according to any one of embodiments II-1 to II-33, A vector according to any one of embodiments II-34 to II-39, or A cell comprising a library according to any one of embodiments II-40 to II-44.

[0368] Embodiment II-46. The cell of embodiment II-45, wherein the cell is an immune cell.

[0369] Embodiment II-47. The cell of embodiment II-45, wherein the cell is a stem cell, a progenitor cell, a precursor cell, or a naive cell.

[0370] Embodiment II-48 The cell of embodiment II-45, wherein the cell is a differentiated cell.

[0371] Embodiment II-49 The cell of any one of embodiments II-45 to II-48, wherein the cell is a T cell, a B cell, a macrophage or an NK cell.

[0372] Embodiment II-50 The cell of any one of embodiments II-45 to II-48, wherein the cell is a T cell.

[0373] Embodiment II-51 The cell of any one of embodiments II-45 to II-48, wherein the cell is a NK cell.

[0374] Embodiment II-52 The cell of any one of embodiments II-45 to II-48, wherein the cell is in vitro or ex vivo.

[0375] Embodiment II-53 The cell of any one of embodiments II-45 to II-48, wherein the cell is a primary cell.

[0376] Embodiment II-54 The cell according to any one of embodiments II-45 to II-48, wherein the cell is a cultured cell.

[0377] Embodiment II-55: Use of a construct according to any one of embodiments II-1 to II-33, a vector according to any one of embodiments II-34 to II-39, or a library according to any one of embodiments II-40 to II-44 or a cell according to any one of embodiments II-45 to II-54 for selecting EP pairings in response to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

[0378] Embodiment II-56 The use according to embodiment II-55, wherein the cell stimulation is early stimulation.

[0379] Embodiment II-57 The use according to embodiment II-55, wherein the cell stimulation is a late stimulation.

[0380] Embodiment II-58 The use of embodiment II-55, wherein the antigen receptor is a chimeric antigen receptor (CAR).

[0381] Embodiment II-59 The use according to embodiment II-55, wherein the cell is a T cell and the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0382] Embodiment III-1 An inducible construct comprising a nucleic acid / nucleotide / polynucleotide sequence encoding a circuit component, the circuit component comprising: A response component, the response component comprising: Signals from receptors, epigenetic changes, Induction or repression of transcription, or a response element capable of modifying the activity of the effector element in response to a change in cellular condition; an effector component, wherein the activity of the response component can induce a change in the activity of the effector component; An inducible construct, wherein the construct does not occur in nature.

[0383] Embodiment III-2. The construct of embodiment III-1, wherein the response element comprises one or more of a sequence of an untranslated region of a transcription factor (TF), a sequence comprising a binding site for a TF, a promoter, an enhancer, and a suppressor.

[0384] Embodiment III-3. The construct of embodiment III-1, wherein the response element comprises an epigenetic modifier.

[0385] Embodiment III-4 The construct of embodiment III-1, wherein the response element comprises a transcription initiation factor (eg, a promoter) or a transcription initiation factor (eg, a promoter) and a transcriptional regulatory factor (eg, an enhancer).

[0386] Embodiment III-5. The construct of embodiment III-4, wherein the promoter comprises a minimal promoter.

[0387] Embodiment III-6: The minimal promoter comprises: MinP1 having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788), MinP2 having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789), The construct of embodiment III-5, comprising one or more of the following: MinP3 having the sequence: CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0388] Embodiment III-7. The construct of embodiment III-4 or III-5, wherein the promoter comprises an inducible promoter.

[0389] Embodiment III-8. The construct of embodiment III-4, wherein the transcription initiation factor comprises a concatemerization sequence.

[0390] Embodiment III-9. The construct of embodiment III-8, wherein the concatenated sequence comprises any one or more of the sequences of SEQ ID NOs: 176 to 9781, or a sequence having at least about 70% sequence identity thereto.

[0391] Embodiment III-10 The construct of embodiment III-8, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0392] Embodiment III-11. The construct of embodiment III-4, wherein the response element comprises an enhancer and promoter pair (EP pair).

[0393] Embodiment III-12. The construct of embodiment III-11, wherein the EP pair comprises a sequence of any one or more of SEQ ID NOs: 1-175, or a sequence having at least about 90% sequence identity thereto.

[0394] Embodiment III-13 The construct of embodiment III-11, wherein the EP pair comprises an enhancer sequence of any one or more of the enhancer sequences of SEQ ID NOs: 1-174, or a sequence having at least about 70% sequence identity thereto, and / or the EP pair comprises a promoter sequence of any one or more of the promoter sequences of SEQ ID NOs: 1-174, or a sequence having at least about 70% sequence identity thereto.

[0395] Embodiment III-14. The construct of any one of embodiments III-1 to III-13, wherein the effector component comprises a degrader.

[0396] Embodiment III-15. The construct of any one of embodiments III-1 to III-13, wherein the signal from the receptor comprises a signal from a chimeric antigen receptor (CAR).

[0397] Embodiment III-16. The method according to claim 1, wherein the cell state is: non-irritating, Stimulation on, Stimulation off, exhaustion, and The construct of any one of embodiments III-1 to III-15, comprising one or more of the following pauses:

[0398] Embodiment III-17 A cell comprising a construct according to any one of embodiments III-1 to III-16.

[0399] Embodiment III-18. The cell of embodiment III-17, wherein the cell is an immune cell.

[0400] Embodiment III-19. The cell of embodiment III-17 or III-18, wherein the cell is a stem cell, a progenitor cell, a precursor cell or a naive cell.

[0401] Embodiment III-20. The cell of embodiment III-17 or III-18, wherein the cell is a differentiated cell.

[0402] Embodiment III-21 The cell according to any one of embodiments III-17 to III-20, wherein the cell is a T cell, a B cell, a macrophage or an NK cell.

[0403] Embodiment III-22 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a T cell.

[0404] Embodiment III-23 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a NK cell.

[0405] Embodiment III-24 The cell of any one of embodiments III-17 to III-21, wherein the cell is in vitro or ex vivo.

[0406] Embodiment III-25 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a primary cell.

[0407] Embodiment III-26 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a cultured cell.

[0408] Embodiment III-27 Use of any one of the constructs, circuits, vectors or cells according to embodiments III-1 to III-26 for inducibly regulating expression of an effector component in response to a cellular condition. [Example]

[0409] Example 1: General Methods Arrayed screening method, in vitro enhancer-promoter (EP) vs. CAR circuit functional testing: T cells were cultured in T cell medium (TCM) (OpTmizer basal medium (Thermo) + OpTmizer cell supplement (Thermo) + Immune Cell Serum Replacement (Thermo) + 2 mM L-glutamine (Gibco) + 2 mM GlutMAX (Thermo)) containing 200 IU / mL recombinant IL-2 (R&D Systems), 1200 IU / mL recombinant IL-7 (R&D Systems), and 200 IU / mL recombinant IL-15 (R&D Systems). T cells were thawed into pre-warmed TCM at 37°C on day 0 of T cell production and immediately activated with a 1:100 dilution of TransAct™ (Miltenyi) for 24 hours. Twenty-four hours after activation, T cells were resuspended at 3e6 cells / mL in TCM + 1x TransAct™ and then transduced with a single lentiviral vector expressing a unique promoter-driven "tool" (i.e., ROR1) CAR and a truncated CD19 (tCD19) transduction marker at a multiplicity of infection (MOI) of 4. Lentiviral copy number (VCN) was previously determined by titration on Jurkat cells and measuring VCN by droplet digital polymerase chain reaction (ddPCR). Twenty-four hours after transduction, T cells were expanded in 2 mL of TCM containing cytokines in 24-well plates to stop activation. Four days after thawing, T cells were split 1:2 by volume into fresh TCM containing cytokines.

[0410] On day 7 after thawing, T cells were harvested and assessed for transduction efficiency by flow cytometry and for viability and counting by Acridine Orange / Propidium Iodide (AOPI) staining (Nexcelom Biosciences) on a Cellometer (Nexcelom Biosciences). Given their previously characterized activity, MND CAR and 10×NFkB CAR samples were used to assess transduction efficiency on day 6 after transduction. T cells were then used in downstream passage stimulation assays.

[0411] A serial stimulation assay was set up in 1640-RPMI + 10% FBS. Exemplary target cells (i.e., H1975-mKate cells of epithelial origin isolated from the lungs of a non-smoking woman with non-small cell lung cancer) maintained for less than 20 passages were seeded at 20,000 cells / well in a 96-well moat plate (Eppendorf) and allowed to attach to the plate for 2 hours at 37°C. 3 mL of 1x PBS was added to each moat well of the plate to prevent evaporation from the well. T cells were seeded at a 1:2 effector:target (E:T) ratio based on the number of viable cells from AOPI counts. The final volume of each well was 200 μL. Co-culture plates were imaged every 6 hours for 3–4 days in the red channel on an IncuCyte® Sx5 (Sartorius). 24 hours after initial co-culture setup, 30 μL of supernatant was collected from each well and stored at -80°C. After at least 24 hours, the supernatant was diluted 1:5 onto MSD plates, and the concentrations of IFN-gamma and IL-2 were determined according to the manufacturer's protocol. Three to four days after the initial coculture setup, new plates of target cells at 20,000 cells / well were prepared as previously described. The original coculture was gently resuspended, and 50% of the volume was transferred onto the newly plated target cells. These plates were then imaged every 6 hours for 3 to 4 days on an IncuCyte® Sx5. This marked the end of round 1 and the beginning of round 2. Excess cells from the round 1 plates were harvested, stained for transduction markers and CAR expression, and analyzed by flow cytometry for surface marker expression and T cell expansion. The passaging stimulation assay continued for 4 to 5 rounds.

[0412] Tumor spheroid generation: Tumor spheroids were generated by adding 1e4 target cells in 100 μL of R10 medium to wells of a 96-well round-bottom ultra-low attachment plate (Sbio). PBS was added to the edge wells. The plate was centrifuged at 1,000 × g for 10 min and then transferred to a 37°C incubator for 72 h.

[0413] Spheroid killing assay: Transduced T cells (described above) were resuspended at 1e4 / mL in R10 medium. Each sample was serially diluted twice to obtain cell suspensions of 5e3 / mL and 2.5e3 / mL. 100 μL of each sample dilution was added to triplicate wells of spheroids to measure E:T ratios of 1:10, 1:20, and 1:40. Plates were imaged every 6 hours for 1 week in an IncuCyte® Sx5. The mean total red fluorescence integrated intensity (RCU x um²) was calculated for three technical replicates per sample and normalized to baseline for visualization. At the end of the assay, plates were centrifuged, and each well was resuspended in cell staining buffer (BioLegend). Triplicates from the 1:10 E:T wells were combined and stained for surface markers at 4°C for 20 minutes. Cells were then fixed with Fluorofix™ fixation buffer (BioLegend) for 20 min at 37°C, washed, and resuspended in CSB for analysis by flow cytometry. Data were acquired on a Ze5 (Biorad) and analyzed with FlowJo software.

[0414] Cell line generation for IncuCyte © Imaging (RK): Lentivirus was prepared using suspension-adapted 293Ts. CAR virus was concentrated 10-fold using LentiX, and EP-mKate2 virus was prepared unconcentrated in an arrayed 96-well plate format. Primary T cells were co-transduced with an MOI of 4 MND-CAR and 50uL EP-mKate2 library in a 96-well plate format. 24 hours after transduction, cells were expanded to a 24-well plate format. Five days after transduction, cells were enriched for CAR-positive cells using the stem cell "EasySep™ Human CD19 Positive Selection Kit II" (Cat. No. 17854). Cells were expanded for 11-14 days in TCM + cytokines.

[0415] Incucyte Imaging Experiment (RK): T cells were harvested 11–14 days after thawing. Cells were plated at 100k cells per well in a 96-well Nunc Edge plate, either coated with 1µg / mL ROR1 antigen or uncoated. Cells were imaged every 4 hours using the red and phase channels in an IncuCyte © continuous imaging incubator. On days 2, 4, 7, 9, and 11 of the assay, stimulated cells were split onto fresh antigen plates. Unstimulated cells were fed with fresh media and cytokines. The time course was completed after 14 days. Normalized fluorescence (Figure 6A–B) was calculated by taking the ratio of integrated red intensity to phase confluence.

[0416] Example 2: Generation of an enhancer-promoter library As shown in Figure 3, over one million constructs were generated for use in a massively parallel reporter assay (MPRA). Transcription was measured using RNA-seq and normalized for enhancer-promoter (EP) pair copy number using DNA-seq. Approximately one million combinations of 50,000 different enhancer sequences were used to form unique combinations with 9,000 promoter sequences in the format of the constructs shown in this figure. The library of over one million constructs was functionally tested to identify constructs with inducible patterns of activity under conditions or induced cellular states, such as stimulation, no stimulation, pulsed stimulation, continuous stimulation, resting, and exhaustion. Briefly, the MPRA involved thawing T cells on day 0, transduction of thawed cells with the "tool" CAR on day 1, and CD19+ enrichment on day 4 (see Example 1 for detailed protocol). Stimulation or no stimulation conditions were initiated on day 7 for day 0 thawing. Resting conditions began on day 14 for day 0 thawing.

[0417] Example 3: Initial screening of EP pairings As shown in Figure 6, each EP pair was functionally characterized for beneficial activities associated with endogenous regulation of an exogenous construct (e.g., a chimeric receptor, cytokine, or exogenous regulatory factor) (e.g., induced regulation from the activity of an endogenous circuit, a modified endogenous circuit, and / or an exogenous circuit, and initiation or change in cell morphology). See Example 1 for the experimental protocol. Briefly, this initial screening was designed to (1) determine which EP pairs could drive protein expression and (2) roughly classify the EP pairs into stimulus-on, stimulus-off, and oscillatory categories based on qualitative behavioral patterns.

[0418] Figure 7 provides a series of graphs showing the activity of either a control construct or a construct containing an EP pair of the present disclosure under both stimulated and unstimulated conditions. For each plot, normalized fluorescence (shown in arbitrary units of fluorescence) and confluence (shown as percent) are shown as a function of time (measured in days). For the control construct, MND activity is known to be constitutive, whereas the activity of concatemerized NFkB (10xNFkB) has been shown in the present disclosure to be inducible in the presence of antigen and thus follows a stimulus-on pattern. For the EP pair constructs, the low confluence in this experiment made it difficult to identify constructs that were active under unstimulated conditions. However, some EP pair constructs were observed to have inducible activity under stimulated conditions.

[0419] Figures 8A-C provide a series of plots showing the dynamic range of EP pairings characterized according to the protocol described in Figures 6A-B. Figure 8A shows the maximum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8B shows the minimum expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. Figure 8C shows the range of expression of each construct in this study, along with annotations for the MND and 10xNFkB control constructs. In some embodiments, constructs with a larger dynamic range, including minimum expression under unstimulated conditions, are desirable constructs for stimulated ON circuits.

[0420] Figure 9 is a series of diagrams showing both RNA and protein produced from exemplary constructs containing EP pairings of the present disclosure. As shown in the right panel, not all RNA and protein data are qualitatively aligned. However, each construct of the present disclosure can be functionally characterized with respect to transcriptional activity as a function of cellular activity (e.g., contact with antigen) or cellular state (e.g., stimulation and / or exhaustion). In some embodiments, the presence or absence of a 5' UTR sequence, or the composition of the 5' UTR sequence, affects the translational behavior of transcripts produced under the control of a construct of the present disclosure.

[0421] Figure 10 is a repeat of the study conducted in Figure 9. Notably, at a higher confluency compared to the Figure 9 study, this study provides data for the no stimulus condition.

[0422] Example 3: Functional activity of EP pairs As shown in Figure 11, a pooled screen was performed using constructs comprising a pair of EPs of the present disclosure (see SEQ ID NOS: 1-174), each driving expression of a "tool" CAR in T cells (top), and the experimental design for the screen (bottom). The control construct comprises a constitutive MND promoter and an inducible lOxNFkB promoter.

[0423] FIG. 12 is a pair of graphs showing the selection of candidate constructs for enrichment based in part on the negative selection of exhausted T cells (identified in this embodiment as CD39+TIGIT+).

[0424] Example 4: Target cell killing and cytokine production assays As shown in Figure 13, a confirmatory three-donor assay was performed using the best-performing EP pairs identified in the preliminary screen using only a single donor. In the preliminary screen, test constructs included 26 constructs containing EP pairs driving the tool CAR construct and four control constructs (MND and 10xNFkB promoters driving the expression of the tool CAR, each control promoter with and without a barcode). The preliminary screen was designed to identify constructs that demonstrated the most effective killing of target cancer cells in vitro, compared to the activity of each of the control constructs. This confirmation screen used nine constructs containing the selected EP pairs driving the tool CAR construct (see Figures 14 and 15) and two control constructs (same as the preliminary screen).

[0425] Figure 14 is a series of graphs showing target cell killing data from each round of the validation study described in Figure 13. In each round, the ability of each construct to drive expression of the tool CAR and kill target cancer cells (H1975 mKate cells) is represented as the number of target cells normalized to time = zero as a function of time (expressed in hours). The data demonstrate that the "OTP-CSF2" EP pairing exhibits comparable killing to a construct containing a control 10xNFkB promoter construct driving expression of the same CAR. The data further demonstrate that the "RPS6KA1-RSRP1" EP pairing can be used as a regulated alternative to the constitutive control promoter MND.

[0426] Figure 15 is a series of graphs showing cytokine secretion (IL-2 and interferon-gamma) from T cells expressing each of the test constructs described in Figure 13 in each of three donors. The data demonstrate that the "OTP-CSF2" and "RPS6KA1-RSRP1" EP pairings exhibit functional activity at least equivalent to that of control constructs with MND and 10xNFkB promoters, respectively. Furthermore, when the "OTP-CSF2" EP pairing drives expression of a CAR, T cells exhibit higher IL-2 expression than when the MND control drives expression of the same CAR. The "RPS6KA1-RSRP1" EP pairing exhibits higher overall cytokine expression than the other seven constructs tested, which is consistent with the target cell killing data shown in Figure 14.

[0427] Example 5: Modulated CAR circuit As shown in Figures 16A-16B and 18, the EP pairs of the present disclosure inducibly regulate exogenous elements in T cells, including, for example, a CAR. The ability to regulate expression of various exogenous elements in response to changes in endogenous conditions leads to better functional outcomes.

[0428] CAR expression after one round of antigen stimulation for each of the control constructs (containing MND and 10xNFkB, respectively) and two test constructs (containing the EP pairings "OTP-CSF2" and "RPS6KA1-RSRP1," respectively). Figure 16A shows a series of cell sorting plots for both unstimulated (top) and stimulated (+H1975-mKate target cells, bottom), where the level of CD19 marker is represented on the Y-axis and the level of CAR expression is represented on the X-axis. For a schematic of the constructs / markers used, see Figure 11. Shown in this figure are representative data from donor 2. Figure 16B is a graph showing aggregate and quantitative data from all three donors in this study. For each condition and each construct, the data represent the mean ± SEM %tCD19+CAR+ across the three donors. Taken together, the data demonstrate that (1) the "OTP-CSF2" construct exhibits stimulation-on activity after one round of passage stimulation, and (2) the "RPS6KA1-RSRP1" construct has different expression kinetics than the MND control construct but a similar functional readout to the MND control construct.

[0429] 18 is a pair of schematic diagrams and corresponding graphs showing an exemplary use of constructs of the present disclosure within a cellular circuit. The data demonstrate that under chronic stimulation conditions in vitro, NFkB-regulated MSLN CARs exhibit improved killing and cytokine production when compared to the same MSLN CARs under the control of MND constitutive expression.

Claims

1. A nucleic acid construct comprising a transcription initiation factor or the transcription initiation factor and a transcription regulatory factor, wherein the transcription regulatory factor and the transcription initiation factor each comprise a concatemer of transcription factor binding motifs for binding to more than one specific transcription factor or for binding to the same transcription factor at more than one site, and wherein the construct does not occur in nature.

2. The construct of claim 1 , comprising the transcriptional regulatory factor and the transcription initiation factor.

3. The construct of claim 1 , wherein the transcriptional regulatory element is located 5′ of the transcription initiation element.

4. The construct of claim 1 , wherein the transcriptional regulatory element is located 3′ of the transcription initiation element.

5. The construct comprises: (a) a transcriptional regulatory factor comprising an NFAT sequence, an IRF4 sequence, an AICE sequence, and an ISRE sequence; and (b) The construct of claim 1, which does not contain a combination of transcription initiation factors including a human beta globin sequence.

6. 2. The construct of claim 1, wherein the construct does not contain the sequence of GGAGGAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAACTGTTTCATACAGAAGGCGTGGAGGAAAACTGTTTCATACAGAAGGCGTGGAGGAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

7. The construct comprises: (a) a transcriptional regulator comprising an NFAT sequence; and (b) the construct according to claim 1, which does not contain a combination of transcription initiation factors containing the YB-TATA sequence.

8. 2. The construct of claim 1, wherein the construct does not contain the sequence GGAGGAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

9. The construct according to any one of claims 1 to 8, wherein the concatemer of the transcriptional regulatory factor comprises two or more repeat sequences.

10. The construct of claim 9 , wherein the concatemer of transcription factor binding motifs binds to more than one unique transcription factor.

11. 10. The construct of claim 9, wherein the concatemer of transcription factor binding motifs binds to the same transcription factor at more than one site.

12. The construct of claim 9 , wherein the two or more repeat sequences comprise the same sequence.

13. The construct of claim 9 , wherein the two or more repeat sequences do not contain the same sequence.

14. The construct of any one of claims 9 to 13, wherein the concatemer comprises a linking sequence positioned between the repeat sequences.

15. 15. The construct of claim 14, wherein the linking sequence comprises one or more of TACGCT, TGATCT, TGCTTT, and TGCCCGT.

16. The transcriptional regulatory factors include BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RE 16. The construct of any one of claims 1 to 15, comprising sequences isolated from or derived from one or more of the untranslated genomic sequences of LA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

17. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

18. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally comprises any one or more of the sequences of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

19. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally comprises any one or more of the sequences of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

20. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

21. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally comprises any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

22. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally comprises any one or more of the sequences of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

23. 17. The construct of any one of claims 1 to 16, wherein the transcriptional regulator comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally comprises any one or more of the sequences of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

24. 24. The construct of any one of claims 1 to 23, wherein (a) the transcriptional regulator is inducible, or (b) the construct is inducible.

25. The construct of any one of claims 1 to 24, wherein the transcription initiation element comprises a classical promoter.

26. 26. The construct of claim 25, wherein the promoter comprises a minimal promoter.

27. 27. The construct of claim 26, wherein the minimal promoter comprises sequences isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human beta globin.

28. The minimal promoter is (a) MinP1 having the sequence AGAGGGTATATAAAGCTCGACTTCCAG (SEQ ID NO: 9788); (b) MinP2 having the sequence of TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); and 28. The construct of claim 27, comprising one or more of: (c) MinP3 having the sequence: CTAGAGGGTATATAATGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

29. 29. The construct of any one of claims 1 to 28, wherein the transcription initiation factor comprises a transcription factor binding motif.

30. 30. The construct of claim 29, wherein the transcription initiation factor comprises a motif isolated from or derived from an untranslated genomic sequence of a transcription factor or comprises a mammalian promoter sequence.

31. The motif is selected from the group consisting of BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, RE 30. The construct of claim 29, comprising sequences isolated from or derived from one or more of the untranslated genomic sequences of L, RELA, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

32. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

33. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFAT, and optionally comprises any one or more of the sequences of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

34. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of NFkB, and optionally comprises any one or more of the sequences of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

35. 32. The construct of any one of claims 1-31, wherein the transcription initiation element comprises a sequence derived from the untranslated genomic sequence of REL, and optionally any one or more of the sequences in SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

36. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of RELA, and optionally comprises any one or more of the sequences of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

37. 32. The construct of any one of claims 1-31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally comprises any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

38. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of GATA3, and optionally comprises any one or more of the sequences of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

39. 32. The construct of any one of claims 1 to 31, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of ATF3, and optionally comprises any one or more of the sequences of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

40. 40. The construct of any one of claims 1 to 39, wherein the transcription initiation factor comprises any one or more of the sequences of SEQ ID NOs: 175 to 9781, or a concatemer thereof.

41. 41. The construct of any one of claims 1 to 40, wherein the construct further comprises an integration sequence capable of directing or increasing insertion of the construct into a target site.

42. 42. The construct of claim 41, wherein the vector comprises the target site.

43. 42. The construct of claim 41, wherein a chromosome comprises the target site.

44. 44. The construct of any one of claims 41 to 43, wherein the integration sequence comprises a first integration sequence or a 5' integration sequence and a second integration sequence or a 3' integration sequence.

45. 45. The construct of any one of claims 41 to 44, wherein the integration sequence comprises a homologous sequence corresponding to an insertion site to promote homologous recombination.

46. 45. The construct of any one of claims 41 to 44, wherein the integration sequence comprises a transposable element to facilitate transposition.

47. 47. The construct of claim 46, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

48. 45. The construct of any one of claims 41 to 44, wherein the integration sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

49. 49. The construct of claim 48, wherein the integration sequence comprises a first 5' terminal repeat sequence and a second 3' terminal repeat sequence.

50. 50. The construct of claim 48 or 49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR) sequence.

51. 50. The construct of claim 48 or 49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat (ITR) sequence.

52. 52. The construct of any one of claims 1 to 51, further comprising a reporter sequence.

53. 53. The construct of claim 52, wherein the reporter sequence comprises a fluorescent protein.

54. 54. The construct of claim 53, wherein the reporter sequence comprises green fluorescent protein (GFP).

55. A vector comprising a construct according to any one of claims 1 to 54.

56. 56. The vector of claim 55, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

57. 57. The vector of claim 55 or 56, wherein the vector is an expression vector capable of expressing the construct in human cells.

58. 58. The vector of claim 57, wherein the vector is a delivery vector capable of delivering the construct to a mammalian cell.

59. 59. The vector of claim 55 or 58, wherein the vector is a delivery vector capable of delivering the construct to a human cell.

60. A library comprising a construct according to any one of claims 11 to 54 or a vector according to any one of claims 55 to 59.

61. 61. The library of claim 60, comprising a plurality of constructs according to any one of claims 1 to 54, or a plurality of vectors according to any one of claims 55 to 59.

62. 62. A library according to claim 60 or 61, comprising a plurality of constructs, each sequence being as set out in any one of claims 1 to 54.

63. 62. The library according to claim 60 or 61, comprising a plurality of vectors, each vector being as defined in any one of claims 55 to 59.

64. A cell, (a) a construct according to any one of claims 1 to 54; (b) a vector according to any one of claims 55 to 59, or (c) A cell comprising the library according to any one of claims 60 to 63.

65. 65. The cell of claim 64, wherein the cell is an immune cell.

66. 66. The cell of claim 64 or 65, wherein the cell is a stem cell, a progenitor cell, a precursor cell, or a naive cell.

67. 66. The cell of claim 64 or 65, wherein the cell is a differentiated cell.

68. The cell of any one of claims 64 to 67, wherein the cell is a T cell, a B cell, a macrophage, or an NK cell.

69. The cell of any one of claims 64 to 67, wherein the cell is a T cell.

70. The cell of any one of claims 64 to 67, wherein the cell is a NK cell.

71. 68. The cell of any one of claims 64 to 67, wherein the cell is in vitro or ex vivo.

72. The cell of any one of claims 64 to 67, wherein the cell is a primary cell.

73. The cell according to any one of claims 64 to 67, wherein the cell is a cultured cell.

74. 74. Use of a construct according to any one of claims 1 to 54, a vector according to any one of claims 55 to 59, a library according to any one of claims 60 to 63, or a cell according to any one of claims 64 to 73 for selecting sequences that respond to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

75. 75. The use according to claim 74, wherein the cell stimulation is early stimulation.

76. 75. The use according to claim 74, wherein the cell stimulation is a late stimulation.

77. 75. The use of claim 74, wherein the antigen receptor is a chimeric antigen receptor.

78. 75. The use of claim 74, wherein the cell is a T cell and the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

79. 74. Use of a construct according to any one of claims 1 to 54, a vector according to any one of claims 55 to 59, a library according to any one of claims 60 to 63, or a cell according to any one of claims 64 to 73 for regulating transcription of an exogenous protein in response to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

80. 80. The use of claim 79, wherein the exogenous protein is one or more of an engineered receptor, a cytokine, or a degradation factor.

81. An inducible nucleic acid construct comprising a transcriptional regulatory enhancer sequence and a transcriptional initiation promoter sequence (EP pair), said construct not occurring in nature.

82. 82. The construct of claim 81, wherein the EP pairing comprises an EP pairing sequence of any one or more of SEQ ID NOs: 1-174, or a sequence comprising 90% sequence identity thereto.

83. 82. The construct of claim 81, wherein the EP pairing comprises an enhancer sequence comprising at least 70% sequence identity to any one or more of the enhancer sequences of SEQ ID NOs: 1-174.

84. 82. The construct of claim 81, wherein the EP pairing comprises a promoter sequence comprising at least 70% sequence identity to any one or more of the promoter sequences of SEQ ID NOs: 1-174.

85. 82. The construct of claim 81 , wherein the enhancer sequence is located 5′ to the promoter sequence.

86. 82. The construct of claim 81 , wherein the enhancer sequence is located 3′ to the promoter sequence.

87. 82. The construct of claim 81, wherein the EP pairing comprises from about 100 base pairs to about 1500 base pairs.

88. 82. The construct of claim 81, wherein the EP pairing comprises from about 500 base pairs to about 1250 base pairs.

89. 82. The construct of claim 81, wherein the EP pairing comprises from about 900 base pairs to about 1100 base pairs.

90. 90. The construct of any one of claims 81 to 89, wherein the construct further comprises a barcode sequence.

91. 91. The construct of claim 90, wherein the barcode sequence is located 5' to the EP pairing.

92. 91. The construct of claim 90, wherein the barcode sequence is located 3' to the EP pairing.

93. 93. The construct of any one of claims 81 to 92, wherein the construct further comprises a 5' untranslated region (UTR) located 3' to the EP pairing.

94. 93. The construct of any one of claims 81 to 92, wherein the construct further comprises a 5' untranslated region (UTR) located 3' to the barcode sequence.

95. 95. The construct of any one of claims 81 to 94, wherein the construct further comprises an integration sequence capable of directing or increasing insertion of the construct into a target site.

96. 96. The construct of claim 95, wherein the target site is a target site in a vector.

97. 96. The construct of claim 95, wherein the target site is a target site in a chromosome.

98. 98. The construct of any one of claims 95 to 97, wherein the integration sequence comprises a first integration sequence or a 5' integration sequence and a second integration sequence or a 3' integration sequence.

99. 99. The construct of any one of claims 95 to 98, wherein the integration sequence comprises a homologous sequence corresponding to an insertion site to promote homologous recombination.

100. 99. The construct of any one of claims 95 to 98, wherein the integration sequence comprises a transposable element to facilitate transposition.

101. 101. The construct of claim 100, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

102. 99. The construct of any one of claims 95 to 98, wherein the integration sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

103. 103. The construct of claim 101 or 102, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR) sequence.

104. 103. The construct of claim 101 or 102, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat (ITR) sequence.

105. 105. The construct of any one of claims 81 to 104, further comprising a reporter sequence.

106. 106. The construct of claim 105, wherein the reporter sequence comprises a fluorescent protein.

107. 107. The construct of claim 106, wherein the reporter sequence comprises green fluorescent protein (GFP).

108. 108. The construct of any one of claims 81 to 107, wherein the enhancer sequence is isolated from or derived from one or more sequences of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

109. The construct of any one of claims 81 to 108, wherein the enhancer sequence is a minimal sequence that exhibits enhancer function or activity.

110. 110. The construct of claim 108 or 109, wherein the enhancer sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs in between.

111. 111. The construct of any one of claims 81 to 110, wherein the promoter sequence is isolated from or derived from one or more sequences of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

112. The construct of any one of claims 81 to 111, wherein the promoter sequence is a minimal sequence that exhibits promoter function or activity.

113. 113. The construct of claim 111 or 112, wherein the promoter sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs in between.

114. A vector comprising the construct of any one of claims 81 to 113.

115. 115. The vector of claim 114, wherein the transcriptional regulatory enhancer sequence and / or the transcriptional initiation promoter sequence is operably linked to a nucleic acid sequence encoding any one or more of a chimeric antigen receptor (CAR), an exogenous T cell receptor (TCR), a cytokine, or a degradation factor.

116. 116. The vector of claim 114 or 115, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

117. The vector of any one of claims 114 to 116, wherein the vector is an expression vector capable of expressing the construct in human cells.

118. 116. The vector of claim 114 or 115, wherein the vector is a delivery vector capable of delivering the construct to a mammalian cell.

119. 116. The vector of claim 114 or 115, wherein the vector is a delivery vector capable of delivering the construct to a human cell.

120. A library comprising a construct according to any one of claims 81 to 113 or a vector according to any one of claims 34 to 39.

121. 121. A library according to claim 120, comprising a plurality of constructs according to any one of claims 81 to 113, or a plurality of vectors according to any one of claims 114 to 119.

122. 122. A library according to claim 120 or 121, comprising a plurality of constructs, each sequence being as set out in any one of claims 81 to 113.

123. 123. The library of claim 122, wherein each construct comprises a unique barcode sequence.

124. 122. A library according to claim 120 or 121, comprising a plurality of vectors, each vector being as defined in any one of claims 114 to 119.

125. A cell, A construct according to any one of claims 81 to 113, A vector according to any one of claims 114 to 119, or A cell comprising the library of any one of claims 120 to 124.

126. The cell of claim 125, wherein the cell is an immune cell.

127. The cell of claim 125, wherein the cell is a stem cell, a progenitor cell, a precursor cell, or a naive cell.

128. The cell of claim 125, wherein the cell is a differentiated cell.

129. The cell of any one of claims 125 to 128, wherein the cell is a T cell, a B cell, a macrophage, or an NK cell.

130. The cell of any one of claims 125 to 128, wherein the cell is a T cell.

131. The cell of any one of claims 125 to 128, wherein the cell is a NK cell.

132. The cell of any one of claims 125 to 128, wherein the cell is in vitro or ex vivo.

133. The cell of any one of claims 125 to 128, wherein the cell is a primary cell.

134. The cell according to any one of claims 125 to 128, wherein the cell is a cultured cell.

135. Use of a construct according to any one of claims 81 to 113, a vector according to any one of claims 114 to 119, a library according to any one of claims 120 to 124, or a cell according to any one of claims 125 to 134 for selecting EP pairings in response to one or more of antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, epigenetic modulation.

136. 136. The use of claim 135, wherein the cell stimulation is early stimulation.

137. The use of claim 135, wherein the cell stimulation is a late stimulation.

138. 136. The use of claim 135, wherein the antigen receptor is a chimeric antigen receptor (CAR).

139. 136. The use of claim 135, wherein the cell is a T cell and the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

140. 1. An inducible construct comprising a nucleic acid / nucleotide / polynucleotide sequence encoding a circuit component, said circuit component comprising: (a) a response component, the response component comprising: (i) a signal from a receptor; (ii) epigenetic changes; (iii) induction or repression of transcription, or (iv) a response element capable of modifying the activity of the effector element in response to a change in cellular condition; (b) an effector component, wherein the activity of the response component is capable of inducing a change in the activity of the effector component; An inducible construct, wherein the construct does not occur in nature.

141. The construct of claim 140, wherein the response element comprises one or more of a sequence from an untranslated region of a transcription factor (TF), a sequence containing a binding site for a TF, a promoter, an enhancer, and a suppressor.

142. 141. The construct of claim 140, wherein the response element comprises an epigenetic modifier.

143. 141. The construct of claim 140, wherein the response element comprises a transcription initiation factor (e.g., a promoter) or a transcription initiation factor (e.g., a promoter) and a transcription regulatory factor (e.g., an enhancer).

144. The construct of claim 143, wherein the promoter comprises a minimal promoter.

145. The minimal promoter is (a) MinP1 having the sequence AGAGGGTATATAAAGCTCGACTTCCAG (SEQ ID NO: 9788); (b) MinP2 having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); (c) the construct of claim 144, comprising one or more of the following: CTAGAGGGTATATAATGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790);

146. 145. The construct of claim 143 or 144, wherein the promoter comprises an inducible promoter.

147. 144. The construct of claim 143, wherein the transcription initiation factor comprises a concatemerization sequence.

148. 148. The construct of claim 147, wherein the concatemerization sequence comprises the sequence of any one or more of SEQ ID NOs: 176-9781, or a sequence having at least about 70% sequence identity thereto.

149. 148. The construct of claim 147, wherein the transcription initiation factor comprises a sequence derived from the untranslated genomic sequence of IRF2, and optionally comprises any one or more of the sequences of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

150. 144. The construct of claim 143, wherein the response element comprises an enhancer and promoter pair (EP pair).

151. 151. The construct of claim 150, wherein the EP pair comprises a sequence of any one or more of SEQ ID NOs: 1-175, or a sequence having at least about 90% sequence identity thereto.

152. The construct of claim 150, wherein the EP pair comprises an enhancer sequence of any one or more of the enhancer sequences of SEQ ID NOs: 1-174, or a sequence having at least about 70% sequence identity thereto, and / or the EP pair comprises a promoter sequence of any one or more of the promoter sequences of SEQ ID NOs: 1-174, or a sequence having at least about 70% sequence identity thereto.

153. The construct of any one of claims 140 to 152, wherein the effector component comprises a degradation factor.

154. The construct of any one of claims 140 to 152, wherein the signal from the receptor comprises a signal from a chimeric antigen receptor (CAR).

155. The cell state is one of: (a) non-stimulating; (b) Stimulation on; (c) stimulation off; (d) exhaustion, and (e) a pause.

156. A cell comprising a construct according to any one of claims 140 to 155.

157. The cell of claim 156, wherein the cell is an immune cell.

158. The cell of claim 156 or 157, wherein the cell is a stem cell, a progenitor cell, a precursor cell, or a naive cell.

159. 158. The cell of claim 156 or 157, wherein the cell is a differentiated cell.

160. The cell of any one of claims 156 to 159, wherein the cell is a T cell, a B cell, a macrophage, or an NK cell.

161. The cell of any one of claims 156 to 160, wherein the cell is a T cell.

162. The cell of any one of claims 156 to 160, wherein the cell is a NK cell.

163. The cell of any one of claims 156 to 160, wherein the cell is in vitro or ex vivo.

164. The cell of any one of claims 156 to 160, wherein the cell is a primary cell.

165. The cell of any one of claims 156 to 160, wherein the cell is a cultured cell.

166. 166. Use of any one of the constructs, circuits, vectors or cells of any one of claims 140 to 165 for inducibly regulating expression of an effector component in response to a cellular condition.

Images