Methods for treating NETosis-mediated diseases
Inhibiting adenosine receptors, PAD4, and elastase through specific antagonists effectively treats NETosis-mediated tissue destruction in snakebites and other diseases, addressing the limitations of current antivenin treatments.
Patent Information
- Application Number
- JP2025540051
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-01-09
- Filing Date
- 2024-01-09
- Publication Date
- 2026-01-27
AI Technical Summary
Current treatments for snakebite envenoming, particularly from Formosan cobra bites, fail to address the severe tissue destruction at the bite site, despite antivenin administration, and the underlying mechanisms of this tissue destruction are not well understood.
Administering antagonists or inhibitors specific to adenosine receptors, protein arginine deiminase 4 (PAD4), and/or elastase to inhibit NETosis-mediated tissue destruction, using agents such as AR-specific antagonists, PAD4-specific antagonists, and elastase-specific antagonists.
Inhibiting NETosis reduces tissue destruction and inflammation, providing effective treatment for snakebite envenoming and other NETosis-mediated diseases like psoriasis and kidney damage.
Smart Images

Figure 2026503048000001 
Figure 2026503048000002 
Figure 2026503048000003
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 437,840, filed January 9, 2023, the contents of which are incorporated herein by reference in their entirety.
[0002] The present disclosure relates to methods for treating or ameliorating disease, and in particular to methods for preventing, treating, or ameliorating NETosis-mediated disease. [Background technology]
[0003] Approximately 5.4 million people experience snakebite envenoming annually, resulting in over 95,000 deaths and 300,000 amputations worldwide. Snakebite envenoming was added to the list of Category A neglected tropical diseases (NTDs) by the World Health Organization (WHO) in 2017 to draw public health attention to this unresolved issue. Snakebite envenoming causes multiple severe systemic and localized illnesses, including tissue destruction, thrombosis, neurotoxicity, nephrotoxicity, and cardiotoxicity. Antivenin is the mainstay of clinical care for treating snakebite envenoming and significantly improves post-envenom survival rates. However, the cause of the ongoing, unspecified, severe tissue destruction at the bite site remains unknown, and antivenin has not provided a cure.
[0004] The Formosan cobra (Naja atra) is one of the most common venomous snakes, frequently found in Taiwan, southern mainland China, and northern Vietnam. Formosan cobra (Naja atra) bites cause various symptoms of poisoning in victims, such as local tissue swelling and pain (94.5%) and severe skin necrosis (65.5%). These symptoms usually do not improve even after administering more than 10 vials of specific antivenom. A clinic survey found that 42.8% of poisoned patients still required debridement, 26.6% underwent fasciotomy / fasciectomy, and 4% underwent amputation of a finger or toe. Therefore, the development of new treatments for snakebites is an urgent issue. Summary of the Invention
[0005] The present disclosure surprisingly found that NETosis-mediated diseases can be improved by administering antagonists or inhibitors specific to adenosine receptors, PAD4, and / or elastase. Therefore, antagonists or inhibitors specific to adenosine receptors, PAD4, and / or elastase may have the potential to be innovative therapeutic agents for preventing NETosis-mediated diseases.
[0006] The present disclosure provides methods for preventing, treating, or ameliorating a NETosis-mediated disease in a subject. The methods include administering to the subject a therapeutically effective amount of an active agent or a pharmaceutical composition comprising the same, wherein the active agent is selected from the group consisting of an adenosine receptor (AR)-specific antagonist or inhibitor, a protein arginine deiminase 4 (PAD4)-specific antagonist or inhibitor, and an elastase-specific antagonist or inhibitor. In some embodiments, examples of NETosis-mediated diseases include, but are not limited to, NETosis-induced organ or tissue destruction, kidney damage, autoimmune conditions, and autoinflammatory conditions.
[0007] In some embodiments, the autoimmune condition is psoriasis, rheumatoid arthritis, or systemic lupus erythematosus.
[0008] In some embodiments, the renal disorder is early stage acute tubular necrosis, antineutrophil cytoplasmic antibody-mediated renal vasculitis, lupus nephritis, thrombotic microangiopathy, antiglomerular basement membrane disease, or diabetic nephropathy.
[0009] In one embodiment, the NETosis-mediated disease is snake venom-induced tissue or organ destruction, or tissue or organ destruction induced by obesity, diabetes, or pathogen-mediated acute / chronic inflammation. In a further embodiment, the snake venom is cobra venom, viper venom, elapid venom, or krait venom. In a further embodiment, the tissue or organ destruction is delayed wound healing induced by obesity and diabetes.
[0010] In one embodiment, organ or tissue destruction is induced by SV-CTX and the active agent is a PAD4-specific antagonist or inhibitor and / or an elastase-specific antagonist or inhibitor. Embodiments of the PAD4-specific antagonist or inhibitor or elastase-specific antagonist or inhibitor are as described herein.
[0011] In one embodiment, organ or tissue destruction is induced by SV-CTX and potentiated by SV-HMW, and the active agent is an AR-specific antagonist and / or a PAD4-specific antagonist or inhibitor. Embodiments of the PAD4 antagonist or inhibitor or the AR antagonist or inhibitor are as described herein.
[0012] In one embodiment, the AR-specific antagonist is a pan-AR antagonist or inhibitor, an adenosine receptor A1 (AR1) antagonist or inhibitor, or an adenosine receptor A3 (AR3) antagonist or inhibitor. In some embodiments, the pan-AR antagonist is caffeine or a salt thereof. The AR1 antagonist or inhibitor is a snake venom high molecular weight fraction (SV-HMW)-mediated AR1 antagonist or inhibitor. In a further embodiment, the AR1 antagonist or inhibitor is 1,3-dipropyl-8-cyclopentylxanthine (DPCPX) or a salt thereof. The AR3 antagonist or inhibitor is N-(2-methoxyphenyl)-N'-[2-(3-pyrindinyl)-4-quinazolinyl]-urea (VUF5574). In some further embodiments, the AR-specific antagonist is an AR1 antagonist or inhibitor or an AR3 antagonist or inhibitor.
[0013] In one embodiment, the PAD4-specific antagonist or inhibitor is a snake venom high molecular weight fraction (SV-HMW)-mediated PAD4 antagonist or inhibitor, or a snake venom cytotoxin (SV-CTX)-mediated PAD4 antagonist or inhibitor. In one embodiment, the PAD4-specific antagonist or inhibitor is ((3S,4R)-3-amino-4-hydroxypiperidin-1-yl)(2-(1-(cyclopropylmethyl)-1H-indol-2-yl)-7-methoxy-1-methyl-1H-benzo[d]imidazol-5-yl)methanone hydrochloride (GSK484), or a salt thereof.
[0014] In one embodiment, the elastase-specific antagonist or inhibitor is a snake venom cytotoxin (SV-CTX)-mediated elastase antagonist or inhibitor, hi one embodiment, the elastase-specific antagonist or inhibitor is sivelestat, or a salt thereof.
[0015] In one embodiment, the active agent inhibits SV-HMW-induced NETosis. In a further embodiment, the active agent is a PAD4 antagonist or inhibitor or an AR antagonist or inhibitor. Embodiments of the PAD4 antagonist or inhibitor or the AR antagonist or inhibitor are as described herein.
[0016] In one embodiment, the active agent inhibits crude snake venom (CV)-induced NETosis. In a further embodiment, the active agent is an elastase- or PAD4-specific antagonist or inhibitor. Embodiments of PAD4 or elastase-specific antagonists or inhibitors are as described herein.
[0017] In one embodiment, the active agent is administered to the subject via subcutaneous injection.
[0018] The present disclosure also provides a method for selecting a compound as a candidate compound for preventing, treating, or ameliorating a NETosis-mediated disease, the method comprising: (a) contacting a compound with AR, PAD4, or elastase; (b) determining whether the compound antagonizes or inhibits the activity of AR, PAD4, or elastase; If the compound is able to antagonize or inhibit AR, PAD4 or elastase activity, then said compound is identified as a candidate compound for preventing, treating or ameliorating NETosis-mediated tissue destruction.
[0019] Embodiments of NETosis-mediated diseases, AR, PAD4, and elastase are as described herein. [Brief explanation of the drawings]
[0020] [Figures 1A-1I] These results indicate that N. atra venom induces distinct NETosis in vivo and ex vivo, and that venom-stimulated NETosis in human neutrophils is primarily promoted by CTXs and SV-HMW. [Figure 1A] Quantification of CV-induced in vitro NETosis via citrullinated histone H3 ELISA. Results were calculated as the percentage increase relative to CTR (unstimulated cells). Data are presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, *p < 0.05, **p < 0.01, ***p < 0.001 vs. CTR). [Figure 1B] SDS-PAGE analysis of crude venom (CV) and purified snake venom-derived cytotoxins (CTXs), neurotoxins (NTXs), phospholipase A2 (PLA2), and high molecular weight fraction (SV-HMW). [Figures 1C-1F] Quantification of in vitro NETosis induced by CTXs, NTXs, PLA2, and SV-HMW via citrullinated histone H3 ELISA. Results were calculated as the percentage increase relative to CTR. Data are presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, *p < 0.05, **p < 0.01, ***p < 0.001 vs. CTR). [Figure 1G]Representative immunofluorescence (IF) analysis of NETosis. Human neutrophils were stimulated with Taiwan cobra (N. atra)-derived CV (5 μg ml-1), CTXs (2.7 μg ml-1), NTXs (1.2 μg ml-1), PLA2 (0.9 μg ml-1), and SV-HMW (0.4 μg ml-1) for 3 h at 37 °C. Arrows indicate NET structures. Scale bar is 50 μm. [Figure 1H-1I] The results of measuring the neutrophil population (Figure 1H) and CitH3 levels (Figure 1I) in the peripheral blood of a patient bitten by a Formosan cobra (N. atra). Blood samples were collected from the patient within one day after the snakebite, and neutrophil levels (%) and CitH3 (ng / mL) were measured by differential white blood cell count and ELISA, respectively. Error bars represent s.e.m. n = 5–7 (unpaired two-tailed t-test, *p<0.05, **p<0.01). [Figures 2A-2F] The adenosine induced by venom from the Taiwan cobra (N. atra) is primarily contributed by SV-HMW. [Figure 2A] Adenosine receptor expression levels were detected by qRT-PCR using freshly isolated human neutrophils. Results were obtained from three independent experiments. Data were normalized to β-actin expression levels and presented as mean ± SEM (n = 3 biologically independent experiments). [Figure 2B] Measurement of dose-dependent CV-mediated adenosine release during NETosis induction. Data are presented as mean ± SEM (n = 3 biologically independent experiments), (unpaired two-tailed t-test, ns, not significant; *p < 0.05, **p < 0.01, ***p < 0.001 vs. CTR). [Figures 2C-2F] Time-dependent analysis of adenosine release in CTXs, NTXs, PLA2, and SV-HMW. Data are presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, *p < 0.05, **p < 0.01, ***p < 0.001 vs. CTR). [Figure 2G-2I] We show that adenosine receptor 1 (AR1) is highly expressed in human neutrophils and snakebite lesions. [Figure 2G] Adenosine release from CTXs (5.3 μg / mL), NTXs (2.4 μg / mL), PLA2 (1.7 μg / mL), and HMW (0.7 μg / mL) fractions from Taiwanese cobra (N. atra) venom is shown. Error bars are sem. n=3 (unpaired two-tailed t-test, *p<0.05, **p<0.01, ***p<0.001 vs. CTR). [Figure 2H] IHC staining of AR1 in skin samples from snakebite patients. Scale bar is 200 μm. [Figure 2I] Immunofluorescence staining of AR1 expression in skin tissue from a snakebite patient. DNA (blue), CD11b (green), AR1 (red), and MPO (cyan). Scale bars are as indicated. [Figures 3A-3D] We show that adenosine receptor inhibitors modulated CV-induced NETosis by inhibiting SV-HMW-derived adenosine-dependent NETosis. [Figure 3A-3C] The effects of adenosine receptor antagonist supplementation on CV (Figure 3A), SV-HMW (Figure 3B), and CTXs (Figure 3C)-induced NETosis are shown. CTX was quantified by citrullinated histone H3 ELISA, and results were calculated as a percentage of vehicle (DMSO)-treated neutrophils. Data are presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, *p < 0.05, **p < 0.01, ***p < 0.001 vs. vehicle). [Figure 3D] Representative IF images of NETosis are shown. Human neutrophils stimulated with CV, SV-HMW, and CTXs were supplemented with vehicle (DMSO), caffeine (20 μM), or DPCPX (1 μM) for 3 h at 37°C. The scale bar is 50 μm. [Figures 4A-4D]These results suggest that SV-HMW-induced NETosis may be PAD4-dependent. The expression levels of PAD4 (Figure 4A), ELANE (Figure 4B), MPO (Figure 4C), and MMP9 (Figure 4D) were detected by qRT-PCR after freshly isolated human neutrophils were treated with CV, CTXs, and SV-HMW. Results were obtained from three independent experiments. Data were normalized to the expression levels of β-actin and mock control and presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, *p < 0.05, **p < 0.01, ***p < 0.001). [Figures 5A-5D] We show that PAD4 antagonists dramatically inhibited SV-HMW-induced NETosis and attenuated CV-induced NETosis. [Figures 5A-5C] The effects of PAD4 and elastase antagonist supplementation on CV (Figure 5A), SV-HMW (Figure 5B), and CTXs (Figure 5C)-induced NETosis are shown. Quantification was performed by citrullinated histone H3 ELISA. Results were calculated as a percentage of vehicle (DMSO)-treated neutrophils. Data are presented as mean ± SEM (n = 3 biologically independent experiments) (unpaired two-tailed t-test, ns, not significant; *p < 0.05, **p < 0.01, ***p < 0.001). [Figure 5D] Representative IF images of NETosis are shown. Human neutrophils stimulated with CV, SV-HMW, and CTXs were supplemented with vehicle (DMSO), GSK484 (10 μM), or sivelestat (10 μM) for 3 h at 37°C. The scale bar is 50 μm. [Figures 6A-6C] These results indicate that SV-HMW enhances the tissue destruction ability of CTXs. [Figure 6A] Representative photographs of mice intradermally injected with components derived from Taiwan cobra (N. atra) venom at different days after injection. Mice were injected with CTXs (2.8 mg / kg), SV-HMW (0.4 mg / kg), or their combination (CTXs + SV-HMW). The scale bar is 0.5 cm. [Figure 6B]This graph shows the area of persistent necrosis (cm2) at the injection site of mice injected with components derived from Taiwanese cobra (N. atra) venom. Data are shown as mean ± SEM (n = 3). **P < 0.01, ***P < 0.001 vs. vehicle control mice (PBS injections) (one-way ANOVA followed by Dunnett's post-hoc test). [Figure 6C] Representative IF images of the skin at the injection site 16 hours after injection of components derived from Taiwanese cobra (N. atra) venom are shown. The scale bar is 50 μm. [Figures 7A-7D] We show that AR1 and PAD4 antagonists significantly ameliorate venom-induced tissue destruction. [Figure 7A] Representative photographs (top) show mice subcutaneously administered vehicle (DMSO), DPCPX (4 mg / kg), or GSK484 (4 mg / kg) 2 hours after injection of CTXs+SV-HMW. The scale bar is 0.5 cm (n=3). The graph (bottom) shows the relative necrotic area at the injection site. Results were calculated as the percentage increase compared to the vehicle group on day 1. Data are presented as mean ± SEM (n=3). **P<0.01 vs. vehicle control mice (one-way ANOVA followed by Dunnett's post-hoc test). [Figure 7B] Representative images of H&E- and IF-stained mouse skin tissues 16 hours after administration of CTXs+SV-HMW with or without DPCPX and GSK484 are shown. Scale bar is 20 μm. [Figure 7C] Representative photographs (left) of mice intradermally injected with the original dose (1x SV-HMW) or a higher SV-HMW dose (5x SV-HMW) in combination with a fixed dose of CTXs. The graph (right) shows the relative necrotic area at the injection site over time. Results were calculated as the percentage increase compared to the data from day 1 in mice injected with the original dose. Data are presented as mean ± SEM (n = 3). ***P < 0.001 vs. mice treated with the original dose (one-way ANOVA followed by Dunnett's post-hoc test). [Figure 7D]Representative photographs (left) show mice subcutaneously administered vehicle (DMSO), DPCPX (4 mg / kg), GSK484 (4 mg / kg), or a combination of DPCPX and GSK484 (DPCPX+GSK484) 2 hours after injection of CTXs+5×SV-HMW. Scale bar is 0.5 cm (n=3). Graph (right) shows the relative necrotic area at the injection site. Results were calculated as the percentage increase compared to the vehicle group on day 1. Data are presented as mean ± SEM (n=3). *p<0.05, ***p<0.001 vs. vehicle group (one-way ANOVA followed by Dunnett's post-hoc test). [Figure 8] The effects of DPCPX (1 μM), GSK484 (10 μM), sivelestat (1 μM), and their combination on CTXs+HMW-induced NETosis in vitro (n=3 biologically independent experiments) (unpaired two-tailed t-test, ns, not significant, *p<0.05, ***p<0.001). [Figures 9A-9D] Cross-species snake characterization of NETosis-inducing activity and adenosine-modulating activity. [Figure 9A-9B] Figure 9A shows the in vitro assays of NETs-inducing activity (Figure 9A) and adenosine-releasing activity (Figure 9B) of various snake venoms. Error bars are sem. n=3 (unpaired two-tailed t-test, *p<0.05, **p<0.01, ***p<0.001 vs. CTR). [Figure 9C] Figure 1 shows the effects of GSK484 (10 μM), DPCPX (10 μM), and their combination on various snake venom-induced NETosis in vitro. Error bars are sem. n=3 (unpaired two-tailed t-test, *p<0.05, ***p<0.001 vs. vehicle control). [Figure 9D] 1 shows a linear regression analysis of adenosine-releasing activity with NETs inhibitory potential in various snake venoms. [Figures 10A-10C] 1 shows the effects of PAD4 and AR1 inhibitors on wound healing in HFD mice. [Figure 11A]IF staining of AR (AR1 / AR2a / AR2b / AR3) on human neutrophils is shown. [Figure 11B] The effect of supplementation with AR1, AR2a, and AR3 antagonists on NETosis induced by CV derived from Taiwanese cobra (N. atra) venom is shown. Error bars are sem. n = 3 (unpaired two-tailed t-test, ns, not significant, ***p<0.001). The AR1, AR2a, and AR3 antagonists are DPCPX, ZM241385, and VUF5574, respectively. NETosis levels were expressed as the expression of citrullinated histone H3 (CitH3). [Figure 12A] Figure 1 shows FACS analysis of neutrophil populations (CD11b+Ly6G+ cells) in peripheral blood of mice 1 hour after intradermal injection of Taiwanese cobra (N. atra) CV (0.4 mg / kg), CV (0.4 mg / kg) with HMW (0.4 mg / kg), 5NT (0.2 mg / kg), PDE (0.2 mg / kg), adenosine (12 nmol / kg), or the indicated combinations. Error bars represent s.e.m., n = 3 (unpaired two-tailed t-test, *p<0.05, **p<0.01, ***p<0.001 vs. CTR). [Figure 12B] IHC and IF staining for the detection of neutrophils (MPO), AR1, and NETs in skin tissue after injection of Taiwanese cobra (N. atra) CV (0.4 mg / kg), HMW (0.4 mg / kg), 5NT (0.2 mg / kg), PDE (0.2 mg / kg), adenosine (12 nmol / kg), or the indicated combinations. Scale bar = 50 μm. [Figures 13A-13B] Measurements of NETosis (Figure 13A) and adenosine levels (Figure 13B) after dose-dependent induction of NETosis with carpet viper (E. carinatus) venom are shown. Error bars are sem. n=3 (unpaired two-tailed t-test, ns, not significant; *p<0.05, **p<0.01, ***p<0.001 vs. CTR). [Figure 13C]Figure 1 shows the effect of GSK484 and DPCPX supplementation on carpet viper (E. carinatus) venom-induced NETosis. Citrullinated histone H3 was quantified by ELISA, and results were calculated as a percentage of vehicle (DMSO)-treated neutrophils. Error bars are s.e.m., n=3 (unpaired two-tailed t-test, **p<0.01, ***p<0.001 vs. vehicle). [Figure 13D] Mice received vehicle (DMSO), DPCPX (4 mg / kg), GSK484 (4 mg / kg), or a combination of each other (DPCPX + GSK484) subcutaneously 2 hours after injection of carpet viper (E. carinatus) venom. Scale bar is 0.5 cm. Graph (right) shows the relative necrotic area at the injection site over time. Results were calculated as the percentage increase compared to the vehicle group on day 1. Error bars are s.e.m. n=3, *p<0.05, ***p<0.001 vs. vehicle. (One-way ANOVA followed by Dunnett's post-hoc test). [Figure 13E] H&E- and IF-stained mouse skin tissues are shown 16 hours after administration of carpet viper (E. carinatus) venom with GSK484, DPCPX, or a combination of both. Scale bar: 50 μm. DETAILED DESCRIPTION OF THE INVENTION
[0021] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0022] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.
[0023] As used herein, the term "and / or" is to be construed as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" used in phrases such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0024] As used herein, "treating" or "treatment" of a condition, disorder, or condition includes (1) preventing or delaying the onset of clinical or subclinical symptoms of the condition, disorder, or condition in a mammal that is suffering from or may be susceptible to the condition, disorder, or condition, but that has not yet experienced or displayed clinical or subclinical symptoms of the condition, disorder, or condition; and / or (2) inhibiting the condition, disorder, or condition, i.e., arresting, alleviating, or delaying the progression of the disease or its recurrence (in the case of maintenance therapy) or at least one clinical or subclinical symptom thereof; and / or (3) palliating the disease, i.e., causing regression of the condition, disorder, or condition, or at least one of its clinical or subclinical symptoms; and / or (4) reducing the severity of one or more symptoms of the disease.
[0025] As used herein, the term "ameliorate" means to reduce, prevent, alleviate and / or relieve the effects of a disease, symptom or condition, improve the disease or condition, or cause at least partial relief (up to and including complete relief) of the symptoms associated with the disease or condition, so that said effects are zero or effectively zero.
[0026] The terms "preventing" or "prevention," when used in reference to a medical condition, are art-recognized and include administering an agent prior to the onset of the condition to reduce the frequency or severity of symptoms of, or delay the onset of, the condition in a subject compared to a subject who does not receive the agent.
[0027] As used herein, the terms "patient," "subject," "individual," and the like are used interchangeably and refer to any animal, including any vertebrate or mammal, particularly a human, and may also refer to, for example, an individual or patient.
[0028] As used herein, the term "in need of treatment" refers to the judgment of a caregiver (e.g., a physician, nurse, nurse practitioner, or individual in the case of a human, or a veterinarian in the case of an animal, including a non-human mammal) to determine whether a subject requires or will benefit from treatment. This judgment is within the expertise of the caregiver, but is made based on a variety of factors, including knowledge that the subject is ill or will become ill as a result of a condition treatable by the compounds of the present disclosure.
[0029] The term "administration" includes routes of administration that allow an agent of the present disclosure to perform its intended function.
[0030] The term "tissue disruption" refers to the act of damaging or destroying an organ or tissue, or the stage at which it is destroyed, and may be used interchangeably with or encompass terms such as tissue lesion, tissue injury, and / or tissue injury.
[0031] The term "NETosis" can refer to the program for the formation of neutrophil extracellular traps (NETs), which are composed of modified chromatin decorated with granule- and cytoplasm-derived antimicrobial proteins. NETosis can also refer to a cell death pathway with NET formation as a primary outcome.
[0032] The term "candidate compound" refers to any agent or compound suspected of having the ability to prevent, treat, or ameliorate NETosis-mediated tissue destruction.
[0033] The term "therapeutically effective amount" of a pharmaceutical agent provided herein refers to an amount of a component sufficient to provide the desired modulation of a desired function. As noted below, the exact amount required will vary from subject to subject, depending on the disease state, physical condition, age, sex, species, and weight of the subject, as well as the specific identity and formulation of the composition. Dosage regimens can be adjusted to elicit the optimal therapeutic response. For example, several divided doses can be administered daily, or the dosage can be proportionally reduced depending on the exigencies of the therapeutic situation. Therefore, it is not possible to specify an exact "effective amount." However, an appropriate effective amount can be determined by one of ordinary skill in the art using only routine experimentation.
[0034] As used in this disclosure, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent that is administered to an animal, e.g., a human, to treat or eliminate a particular disease or pathological condition from which the animal suffers. In some embodiments of the present disclosure, the pharmaceutical composition optionally includes a pharmaceutically acceptable excipient.
[0035] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of a subject (human or non-human animal) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit-to-risk ratio. Each carrier, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, excipients, etc. are described in standard pharmaceutical literature.
[0036] The composition of snake venom varies depending on the snake species, geographic location, habitat, and climate. Based on their clinical effects, they can be classified into three types: hemotoxic, cytotoxic, and neurotoxic (Goswami, P.K., Samant, M., & Srivastava, R.S. Snake venom, anti-snake venom & potential of snake venom. International Journal of Pharmacy and Pharmaceutical Sciences 6, 4-7 (2014)). Venoms can also be classified by molecular mass, such as low molecular weight (SV-LMW) and high molecular weight (SV-HMW). SV-LMW is mostly composed of venom-derived cytotoxins (SV-CTXs), neurotoxins (SV-NTXs), and phospholipase A2 (SV-PLA2), and is thought to be neutralized by anti-snake venoms. In comparison, the role of SV-HMWs in the pathogenesis of post-intoxication, such as snake venom metalloproteases (SVMPs), L-amino acid oxidase (SV-LAAO), phosphodiesterase (SV-PDE), and 5'-nucleotidase (SV-5'NT), is largely unknown (Ferraz, CR et al. Multifunctional Toxins in Snake Venoms and Therapeutic Implications: From Pain to Hemorrhage and Necrosis. Frontiers in Ecology and Evolution 7 (2019)). Previous studies on Naja have revealed that SV-HMWs account for only 3.13–17.52% (v / v) of crude venom, yet suggest their possible involvement in the pathogenesis of intoxication.
[0037] In snakebite envenomation, neutrophils rapidly accumulate at the bite site and become the first-line immune cells responsible for removing invading pathogens and harmful substances. Paradoxically, previous reports have demonstrated that rapid neutrophil accumulation and extracellular trap formation (NETs) accelerate the progression of venom-induced tissue damage (Katkar, GD et al. NETosis and lack of DNase activity are key factors in Echis carinatus venom-induced tissue destruction. Nat Commun 7, 11361 (2016). https: / / doi.org:10.1038 / ncomms11361). However, the cellular and molecular mechanisms underlying snake venom venom formation to form NETs remain controversial. Furthermore, purinergic signaling has been shown to regulate leukocyte trafficking and inflammation in the immune system, including chemotaxis, ROS generation, and neutrophil NET formation. To date, at least two purinergic molecules, SV-5'NT and SV-PDE, have been reported in SV-HMW (Munawar, A., Ali, SA, Akrem, A. & Betzel, C. Snake Venom Peptides: Tools of Biodiscovery. Toxins (Basel) 10 (2018). https: / / doi.org:10.3390 / toxins10110474). However, only a few studies have been conducted on the effect of nuclease activity on the venom, much less its role in neutrophil functional transformation.
[0038] Neutrophils are first-line defense cells and effectively capture pathogens through NETosis. NETosis is a process that leads to the formation of neutrophil extracellular traps (NETs), which are composed of modified chromatin decorated with granule- and cytoplasm-derived bactericidal proteins. Various pathogens, antibodies and immune complexes, cytokines, microcrystals, and other physiological stimuli can trigger NETosis. NETs can capture and promote the elimination of various pathogens, suggesting their possible role in host defense. While NET formation can fulfill a protective function for the host, dysregulation of this pathway can lead to tissue damage and inflammation. This study demonstrated that the induction of NETosis is dose-dependently correlated with increased levels of adenosine, which is released exclusively by HMW. Adenosine receptor antagonists can inhibit adenosine-dependent NETosis but are insensitive to CTX-induced adenosine-independent NETosis. HMW-induced NETosis was also rescued by PAD4-specific inhibitors (such as GSK484), certainly providing the first evidence of a role for HMWs in PAD4-dependent NETs. This surprisingly demonstrates the feasibility of targeting NETosis in the clinic, highlighting the potential for treatment with adenosine receptor blockade or PAD4 inhibitors, particularly in tissue destruction with high HMW content.
[0039] The present disclosure provides a method for preventing, treating, or ameliorating a NETosis-mediated disease in a subject, the method comprising administering to the subject a therapeutically effective amount of an active agent or a pharmaceutical composition comprising the same, wherein the active agent is selected from the group consisting of an adenosine receptor (AR)-specific antagonist or inhibitor, a protein arginine deiminase 4 (PAD4)-specific antagonist or inhibitor, and an elastase-specific antagonist or inhibitor.
[0040] In some embodiments, examples of NETosis-mediated diseases include, but are not limited to, NETosis-induced organ or tissue damage, kidney damage, autoimmune conditions, and autoinflammatory conditions. In some embodiments, the autoimmune condition is psoriasis, rheumatoid arthritis, or systemic lupus erythematosus. In some embodiments, the kidney damage is the early stage of acute tubular necrosis, antineutrophil cytoplasmic antibody-mediated renal vasculitis, lupus nephritis, thrombotic microangiopathy, antiglomerular basement membrane disease, or diabetic nephropathy.
[0041] Upon sensing pathogens or harmful substances, such as in snakebite envenomation, neutrophils rapidly accumulate at the bite site and become the first-line immune cells to remove invading pathogens and harmful substances. Paradoxically, the rapid accumulation of neutrophils and the formation of NETs accelerate the progression of venom-induced tissue damage. NETs can trap cytotoxic molecules around the snakebite site, causing persistent tissue damage and severe inflammation.
[0042] Without being limited by theory, adenosine receptor A1 (AR1), PAD4, and elastase are thought to be involved in NETosis. NETosis inhibitors may be innovative therapeutic agents for preventing NETosis-mediated tissue destruction in clinical applications. Accordingly, antagonists specific to AR1, PAD4, or elastase show potential for the treatment of NETosis-mediated tissue destruction.
[0043] In some embodiments of the present disclosure, the AR-specific antagonist is a pan-AR antagonist or inhibitor such as caffeine, theophylline, theobromine, or a salt thereof; 1,3-dipropyl-8-cyclopentylxanthine (DPCPX), 3-[4-(2,6-dioxo-1,3-dipropyl-7H-purin-8-yl)-1-bicyclo[2.2.2]octanyl]propanoic acid (tonapophilin), 8-(hexahydro-2,5-methanopentalen-3a(1H)-yl)-3,7-dihydro-1,3-dipropyl-1H-purine-2,6-dione (rolofylin), 8-cyclopentyl-1,3-dimethylxanthine, trans-4-[(2-phenyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]-cyclohexanol (delenophilin), 2-chloro-N6-cyclohexyl The compound may be an adenosine receptor A1 (AR1) antagonist or inhibitor, such as pentyl adenosine, 7-methylxanthine, or a salt thereof; or an adenosine receptor A3 (AR3) antagonist or inhibitor, such as N-(2-methoxyphenyl)-N'-[2-(3-pyrindinyl)-4-quinazolinyl]-urea (VUF5574), methyl 1-[N6-(3-iodobenzyl)-adenin-9-yl]-bD-ribofuronamide (CF101), 1H-purine-2,6-diamine, N6-(1R,2S,4S)-bicyclo[2.2.1]hept-2-yl-N2-phenyl (CAY10498), 6-ethyl-5-[(ethylthio)carbonyl]-2-phenyl-4-propyl-3-pyridinecarboxylic acid propyl ester (MRS1523), or a salt thereof.
[0044] In one embodiment, the PAD4-specific antagonist or inhibitor is a snake venom high molecular weight fraction (SV-HMW)-mediated PAD4 antagonist or inhibitor. In some embodiments of the present disclosure, the PAD4-specific antagonist or inhibitor is ((3S,4R)-3-amino-4-hydroxypiperidin-1-yl)(2-(1-(cyclopropylmethyl)-1H-indol-2-yl)-7-methoxy-1-methyl-1H-benzo[d]imidazol-5-yl)methanone hydrochloride (GSK484), N-[(1S)-1-(aminocarbonyl)-4-[(2-chloro-1-iminoethyl)amino]butyl]-benzamide (Cl-amidine), (3-amino-1-piperidinyl)[1-methyl-2-(1-methyl-1H-indol-2-yl)-1H-benzimidazol-5-yl]-methanone, 2,2,2-trifluoroacetate (GSK121), N-acetyl-L-threonyl-L-α-aspartyl-N5- (2-Fluoro-1-iminoethyl)-L-ornithineamide (TDFA), [(2S,5R)-5-amino-2-methyl-1-piperidinyl][2-[1-(cyclopropylmethyl)-1H-pyrrolo[2,3-b]pyridin-2-yl]-7-methoxy-1-methyl-1H-methanone (BMS-P5), N-[(1S)-1-(aminocarbonyl)-4-[(2-fluoro-1- iminoethyl)amino]butyl]-benzamide, 2,2,2-trifluoroacetate (F-amidine), ((3S,4R)-3-amino-4-hydroxypiperidin-1-yl)(2-(1-benzyl-1H-indol-2-yl)-7-methoxy-1-methyl-1H-benzo[d]imidazol-5-yl)methanone (CAY10740), or a salt thereof.
[0045] In one embodiment, the elastase-specific antagonist or inhibitor is a snake venom cytotoxin (SV-CTX)-mediated elastase antagonist or inhibitor. In some embodiments of the present disclosure, the elastase-specific antagonist or inhibitor may be sivelestat, or a salt thereof.
[0046] The term "salt" includes all anionic and cationic complexes, such as complexes formed between the cationic lipids disclosed herein and one or more anions.Non-limiting examples of anions include inorganic and organic anions, such as hydride, fluoride, chloride, bromide, iodide, oxalate (e.g., hemioxalate), phosphate, phosphonate, hydrogen phosphate, dihydrogen phosphate, oxide, carbonate, bicarbonate, nitrate, nitrite, nitride, bisulfate, sulfide, sulfite, bisulfate, sulfate, thiosulfate, hydrogen sulfate, borate, formate, acetate, benzoate, citrate, tartrate, lactate, acrylate, polyacrylate, fumarate, Includes maleate, itaconate, glycolate, gluconate, malate, mandelate, tiglate, ascorbate, salicylate, polymethacrylate, perchlorate, chlorite, hypochlorite, bromate, hypobromite, iodate, alkylsulfonate, arylsulfonate, arsenate, arsenite, chromate, dichromate, cyanide, cyanate, thiocyanate, hydroxide, peroxide, permanganate, and mixtures thereof.
[0047] As described above, NETosis-mediated tissue destruction can be induced by snake venom. For example, the snake venom can be cobra venom, viper venom, or krait venom. In some embodiments of the present disclosure, the snake venom can be from the Elapidae and Viperidae families, such as the Taiwan cobra (Naja atra), black-necked cobra (N. nigricollis), Cape cobra (N. nivea), king cobra (O. hannah), Western diamondback rattlesnake (C. atrox), Asian viper (D. siamensis), B. jararaca, or carpet viper (E. carinatus). In some embodiments, NETosis-mediated tissue destruction can be induced by other pathogens, syndromes, and / or diseases.
[0048] Snake venoms can be classified by molecular mass into low molecular weight fractions (SV-LMW) and high molecular weight fractions (SV-HMW). SV-LMW is mostly composed of venom-derived cytotoxins (SV-CTXs), neurotoxins (SV-NTXs), and phospholipase A2 (SV-PLA2), which are thought to be neutralized by antivenins.
[0049] Snake venom cytotoxins (SV-CTXs), also known as cardiotoxins or cytotoxins, are small three-finger toxins. SV-CTXs may include different homologues of A1, A2, A3, A4, A5, and A6.
[0050] The high-molecular-weight fraction of snake venom (SV-HMW), also known as "high-molecular-weight molecules," refers to snake venom molecules with a molecular weight of 40 kDa or greater. SV-HMW may contain snake venom metalloproteases (SVMPs), snake venom CRISPs (svCRISPs), L-amino acid oxidase (SV-LAAO), phosphodiesterase (SV-PDE), and 5'-nucleotidase (SV-5'NT). Relatively little is known about the role of SV-HMW in the pathogenesis of post-intoxication. Although SV-HMW accounts for only 3.13-17.52% (v / v) of crude Naja venom, its involvement in the pathogenesis of intoxication has been suggested.
[0051] Without being limited by theory, Taiwan cobra (N. atra) venom is thought to stimulate NETosis in human neutrophils, which is mediated primarily by SV-CTXs and SV-HMW fractions, but not by SV-NTXs or SV-PLA2. SV-CTX administered alone can directly damage local skin tissue in snake-envenomed experimental mice, whereas SV-HMW alone does not.
[0052] Without being limited by theory, it is believed that both adenosine and PAD4 signatures support SV-CTX- and SV-HMW-venom-induced NETs. Separate local administration of adenosine receptor and PAD4-specific antagonists at the venom puncture site may reverse venom-induced NETosis and tissue damage. Adenosine receptor antagonists may inhibit adenosine-dependent NETosis induced by SV-HMW but are insensitive to adenosine-independent NETosis induced by CTX. In addition to PAD4, elastase is another important mediator of NETosis. CV and SV-CTX treatment may enhance elastase expression in human neutrophils, and the elastase antagonist sivelestat reduced CV- and SV-CTX-induced NETosis. Interestingly, elastase blockade had no effect on SV-HMW-induced NETosis.
[0053] Without being limited by theory, SV-HMW-mediated NETosis is thought to be an adenosine- and PAD4-dependent response that can be ablated by targeting adenosine receptors and PAD4 signaling, respectively. Activation of AR1 can promote neutrophil effector functions, including the induction of NETosis. SV-HMW-induced NETosis was also rescued by PAD4-specific antagonists (e.g., GSK484), demonstrating a role for SV-HMW in preventing PAD4-dependent NETs.
[0054] Without being limited by theory, SV-HMW is thought to play a supporting role in enhancing SV-CTX-induced tissue destruction, even though administration of SV-HMW alone did not induce tissue destruction. Subcutaneous administration of AR1-specific antagonists (e.g., DPCPX) and PAD4-specific antagonists (e.g., GSK484) at the venom injection site significantly reduced neutrophil recruitment and NETosis, ameliorating venom-induced tissue destruction. Interestingly, SV-HMW increased with a fixed dose of SV-CTXs can dramatically enhance the severity of local tissue necrosis, with better efficacy after DPCPX or GSK484 treatment, strongly suggesting the potential of SV-HMW-targeted therapeutics.
[0055] In accordance with the above, in some embodiments of the present disclosure, NETosis-mediated tissue destruction is induced by SV-CTX and the active agent is a PAD4-specific antagonist and / or an elastase-specific antagonist.
[0056] In some embodiments of the present disclosure, NETosis-mediated tissue destruction is induced by SV-CTX and enhanced by SV-HMW, and the active agent is an AR-specific antagonist and / or a PAD4-specific antagonist.
[0057] This study revealed that venom-induced NETosis correlated with a dose-dependent increase in adenosine levels, released exclusively by SV-HMW. Adenosine receptor antagonists could inhibit SV-HMW-induced adenosine-dependent NETosis, but not CTX-induced adenosine-independent NETosis. Furthermore, SV-HMW-induced NETosis was also rescued by the PAD4-specific inhibitor GSK484, providing the first evidence of a role for SV-HMW in PAD4-dependent NET formation. To verify the role of SV-HMW in venom-induced tissue destruction in vivo, a mouse model was intradermally injected with a combination of SV-CTXs and SV-HMW. Although SV-HMW administration alone did not induce tissue destruction, we found that SV-HMW played a supporting role in enhancing SV-CTXs-induced tissue destruction. As expected, subcutaneous administration of DPCPX and GSK484 at the envenomation site significantly reduced neutrophil recruitment and NETosis, ameliorating venom-induced tissue destruction. Interestingly, the increased SV-HMW with a fixed dose of SV-CTXs dramatically enhanced the severity of local tissue necrosis, with better efficacy after DPCPX or GSK484 treatment, strongly suggesting the potential for therapeutic targeting of SV-HMW. These results offer the possibility of targeting NETosis in clinical settings, particularly in snakebite-induced tissue destruction caused by venoms with a high SV-HMW content, using adenosine receptor blockade or PAD4 inhibitors.
[0058] In another aspect, NETosis-mediated tissue destruction can be adversely affected by obesity and / or diabetes, for example, obesity and / or diabetes can increase the size and severity of wounds, and obesity and / or diabetes can delay wound healing, even though the wounds are not directly induced by obesity and / or diabetes.
[0059] Without being limited by theory, it is believed that obesity and / or diabetes may induce intradermal NETosis in the wound bed, resulting in increased wound size and / or delayed wound healing. Administration of an AR-specific antagonist, a PAD4-specific antagonist, and / or an elastase-specific antagonist may inhibit intradermal NETosis, thereby accelerating the wound healing process.
[0060] The following examples are provided to aid those of ordinary skill in the art in practicing the present disclosure. [Example]
[0061] Materials and Methods:
[0062] Isolation of human neutrophils
[0063] Human neutrophils were isolated from the peripheral blood of healthy volunteers. Blood was collected into EDTA-coated tubes and then centrifuged at 500 × g to separate the granulocyte and red blood cell layers (bottom cell layer) using Ficoll-Paque PLUS density gradient medium. To remove red blood cells (RBCs), the isolated cells were mixed with 20 ml of 1.6% (w / w) NaCl solution, followed by the addition of 20 ml of 0.2% (w / w) NaCl solution and subsequent centrifugation. Purified granulocytes were resuspended in cell maintenance medium containing 2% (v / v) human AB serum. The isolated cells were mixed 1:1 with 0.4% trypan blue solution and counted using a cell counting slide. Cell purity was determined to be greater than 95% by FACS analysis using the expression of CD11b, CD15, CD16, CD66b, and myeloperoxidase (MPO). This protocol was approved by the Research Ethics Committee, National Health Research Institute (Taiwan, No. EC1110503-E).
[0064] animal
[0065] C57BL / 6JNarl mice (6-8 week-old males) were obtained from the National Laboratory Animal Center, National Applied Research Laboratories, Taipei, Taiwan. Animal experiments were approved by the Institutional Animal Care and Use Committee, National Health Research Institute, Miaoli, Taiwan (approval number: NHRI-IACUC-111039-A). Animal care and handling during all experiments complied with the Animal Care and Use Policies and Guidelines.
[0066] reagent
[0067] Cobra venom (N. atra) was provided by National Tsing Hua University and the Taiwan Centers for Disease Control (CDC). Human AB serum, bovine serum albumin, DNase I, DMSO, PMA, sodium chloride (NaCl), adenosine monophosphate (AMP), paraformaldehyde (PFA), Triton X-100, methanol, ethanol, acetic acid, xylene, 4',6-diamidino-2-phenylindole (DAPI), Brilliant Blue R staining solution (catalog no. B6529), and SDS sample buffer (4X, catalog no. 70607) were purchased from Sigma-Aldrich Corporation. RPMI-1640 medium and Ficoll-Paque PLUS density gradient medium were purchased from Cytiva. Trypan blue solution (0.4%), cell counting slides, and Trizol reagent were purchased from ThermoFisher Scientific. The bicinchoninic acid (BCA) assay kit (catalog number 786-571) was purchased from G-bioscience. 12-well 8–16% Bis-Tris gels (catalog number M00659) and Tris-MOPS-SDS buffer (catalog number M00138) were purchased from Genscript Biotech Corp. The reverse transcription cDNA synthesis kit (catalog number 06-20-00500) and EvaGreen qPCR master mix (ROX) (catalog number 08-24-00001) were purchased from Solis BioDyne. Adenosine assay kit (catalog no. ab211094), mouse monoclonal anti-MPO antibody (2C7, catalog no. ab25989), rabbit polyclonal anti-PAD4 antibody (catalog no. ab96758), AlexaFluor 488-conjugated goat anti-mouse IgG H&L antibody (catalog no. ab150113), AlexaFluor 594-conjugated goat anti-rabbit IgG H&L antibody (catalog no. ab150080), and AlexaFluor 647-conjugated donkey anti-sheep IgG H&L antibody (catalog no. ab150179) were purchased from Abcam.Citrullinated histone H3 (CitH3) ELISA kit (catalog no. 501620) and mouse monoclonal anti-histone H3 (citrullinated R2+R8+R17) antibody (11D3, catalog no. 17939) were purchased from Cayman Chemical. Sheep polyclonal anti-elastase antibody (catalog no. AP23184PU-N) was purchased from Origene Technologies. Rabbit polyclonal anti-MPO antibody (catalog no. 22225-1-AP) and rabbit polyclonal anti-adenosine receptor 1 antibody (catalog no. 20332-1-AP) were purchased from Proteintech group. GSK484 hydrochloride (catalog no. HY-100514) and DPCPX (catalog no. HY-100937) were purchased from MedChemExpress.
[0068] Purification of venom proteins
[0069] Purified venom proteins were isolated from crude venom (CV) as previously described
[17] , and protein concentrations were determined using a bicinchoninic acid (BCA) assay. Purity of the purified proteins was determined using a denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Brilliant Blue R staining procedure. The purity of snake venom cytotoxins (SV-CTXs), neurotoxins (SV-NTXs), phospholipase A2 (SV-PLA2), and high molecular weight molecules (SV-HMW) exceeded 90%.
[0070] Protein quantification and SDS-PAGE analysis
[0071] The concentration of purified venom protein was measured by BCA assay. Five microgram samples were denatured in 1X SDS sample buffer at 95°C for 10 minutes. Reduced proteins were analyzed on 12-well 8-16% Bis-Tris gels with MOPS running buffer. The gels were stained with Brilliant Blue R staining solution and then destained with destaining buffer (50% v / v methanol, 10% acetic acid in distilled water). The gels were further scanned using an Amersham Imager 600 system (GE Healthcare Life Sciences, USA) and analyzed using ImageJ software.
[0072] Quantification of NETosis by citrullinated histone H3 (CitH3) ELISA
[0073] Purified neutrophils (1 × 10 cells / ml) were seeded in 200 μl of RPMI containing 2% human AB serum at 37°C and 5% CO2 in 96-well culture plates. Cells were then independently stimulated with Taiwan cobra (N. atra) CV (0.2–50 μg ml), SV-SV-NTXs (0.1–11.8 μg ml), SV-PLA2 (0.1–8.5 μg ml), or SV-HMW (0.05–3.5 μg ml) for 180 min, and the dose-dependent response was analyzed. PMA (50 nM) was used as a positive control for NET induction. To quantify NETs, the amount of citrullinated histone H3 (CitH3) was measured by sandwich ELISA (Citrullinated Histone H3 (Clone 11D3) ELISA Kit) according to the manufacturer's instructions. Briefly, after NET induction, the reaction mixture was first treated with DNase I (1 U ml-1) at room temperature for 30 minutes to release CitH3 protein into the medium. The DNase I-treated reaction mixture was centrifuged at 50 × g for 5 minutes at room temperature, and the supernatant was collected and subjected to CitH3 ELISA. To calculate the fold-induction of NETs, all results were normalized to the CitH3 levels in the supernatant from unstimulated human neutrophils.
[0074] Adenosine quantification
[0075] To measure adenosine levels during NET induction by Taiwan cobra (N. atra) CV, human neutrophils were independently stimulated with Taiwan cobra (N. atra) crude venom (0.2–50 μg ml-1) for 180 min at 37°C and 5% CO2, and the incubations were collected. To measure the time-dependent activity of venom proteins in adenosine release, SV-CTXs, SV-NTXs, SV-PLA2, and SV-HMW were each supplemented with 10 mM adenosine monophosphate (AMP), and supernatants were collected at 5, 10, 30, 60, and 120 min after incubation. Adenosine levels were measured in all collected supernatants using a Fluorometric Adenosine Assay Kit according to the manufacturer's protocol. Immunocytochemistry.
[0076] Human neutrophils (1 × 10 cells / ml) were seeded onto 13-mm round coverslips in 500 μl of RPMI containing 2% human AB serum in a 24-well culture plate and allowed to adhere to the coverslips for 30 min at 37°C and 5% CO. For immunofluorescence (IF) staining of NET structures, cells were independently stimulated with Taiwan cobra (N. atra) CV (10 μg ml), SV-CTXs (5.5 μg ml), SV-NTXs (2.4 μg ml), SV-PLA2 (1.7 μg ml), and SV-HMW (0.7 μg ml) for 1.5 h, fixed with 4% paraformaldehyde (Sigma, USA), permeabilized with 1% Triton X-100, and blocked with 2% bovine serum albumin (BSA). The cells were then incubated with a mixture of primary antibodies against CitH3 (1:500, clone 11D3, Cayman, USA), PAD4 (1:500, Abcam, USA), and elastase (1:1000, Origene, USA) at room temperature for 2 h, followed by a mixture of secondary antibodies (AlexaFluor 488-conjugated goat anti-mouse IgG, AlexaFluor 594-conjugated goat anti-rabbit IgG, and AlexaFluor 647-conjugated goat anti-sheep IgG (all 1:500, Abcam, USA)). Cells were stained with DAPI (1 μg ml-1) before mounting. Images were acquired with a Leica TCS SP5 II confocal spectrum microscope (Leica Microsystems, USA) using LEICA Application Suite X software (version 4.3.0, 64-bit). Images were analyzed using ImageJ software.
[0077] RNA preparation and real-time quantitative RT-PCR
[0078] Total RNA was extracted using Trizol reagent and converted to cDNA using a cDNA synthesis kit according to the manufacturer's instructions. Real-time PCR analysis was performed using EvaGreen qPCR mix plus and the ABI ViiA7 system (Applied Biosystems, USA). Samples were subjected to the following PCR program: 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Analysis was performed in triplicate, and results were normalized to the level of the β-actin gene on the same plate. The mRNA expression levels of different cell populations were calculated using the 2-ΔΔCT method. Primers specific to each gene used for quantitative RT-PCR were designed as follows: human β-actin, CACCATTGGCAATGAGCGGTTC (forward primer, F), AGGTCTTTGCGGATGTCCACGT (reverse primer, R); human adenosine A1 receptor, ATTGCTGTGGACCGCTACCTCC (F), CGCACTCAGATTGTTCCAGCCA (R); human adenosine A2a receptor, ACCGCTACATTGCCATCCGCAT (F), TCCTTTGGCTGACCGCAGTTGT (R); human adenosine A2b receptor, GCTCCATCTTCAGCCTTCTGGC (F), AAGGACCCAGAGGACAGCAATG (R); human adenosine A3 receptor, ATACAAGAGGGTCACCACTCA (F), CAGGTGAGGAAGCTGAAGTATAC (R). PADI4, GCACAACATGGACTTCTACGTGG(F), CACGCTGTCTTGGAACACCACA(R). ELANE, TGCGCCCAACTTCGTCATGTCG(F), CGTAGCCGTTTTCGAAGATGCG(R).
[0079] Venom-induced mouse skin tissue destruction
[0080] Six- to eight-week-old male B6 mice were first depilated on the back and then intradermally administered SV-CTXs (2.1 mg / kg body weight) and SV-HMW (0.3 mg / kg body weight) (dissolved in 30 μl of PBS) in combination or alone into the hind flank (n = 3-5 / pair). To evaluate the effects of DPCPX and GSK484 on tissue destruction, 4 mg / kg body weight of the drug (dissolved in 30 μl of saline with 5% DMSO) or vehicle alone was injected subcutaneously into the same site 2 hours after administration of SV-CTXs and SV-HMW. Wound progression at the injection site was recorded daily by photographing with a fixed scale bar, and the size of the necrotic area (cm2) was quantified using ImageJ software.
[0081] Histopathological study
[0082] H&E staining was used to examine venom-induced tissue destruction and the presence of NETs in the lesions. Briefly, 16–18 h after administration of venom proteins and drugs, tissues were excised from the venom injection site, fixed overnight in 10% (v / v) formalin, and dehydrated using a mixture of various grades of alcohol and chloroform. The processed tissues were embedded in molten paraffin wax and 7 μm-thick sections were prepared using a microtome. The sections were then stained with H&E and photographed using an Axio Imager.A2 microscope (Zeiss).
[0083] immunohistochemistry
[0084] The distribution of CitH3, MPO, PAD4, and DNA in venom-induced lesions was examined by immunofluorescence staining. Tissue sections were first deparaffinized by incubation in xylene for 5 minutes, followed by rehydration using various grades of alcohol and distilled water. Antigen retrieval was performed by immersing slides in Tris-EDTA buffer (pH 9.0) at 95°C for 30 minutes. Samples were permeabilized using 1% Triton X-100 (v / v) and blocked with 2% BSA (w / w). Tissues were further incubated with a mixture of primary antibodies against CitH3 (1:500) and PAD4 (1:500) at room temperature for 2 hours, followed by a mixture of secondary antibodies (AlexaFluor 488-conjugated goat anti-rabbit IgG antibody (1:500) and AlexaFluor 594-conjugated goat anti-mouse IgG antibody (1:500)) for 2 hours at room temperature. Sections were then incubated with AlexaFluor 647-conjugated anti-mouse MPO antibody (1:1000) for 2 hours and stained with DAPI (1 μg ml-1) before mounting. Images were acquired with a Leica TCS SP5 II confocal spectrum microscope (Leica Microsystems, USA) using LEICA Application Suite X software (version 4.3.0, 64-bit). Images were analyzed using ImageJ software.
[0085] statistics
[0086] All data are presented as the mean ± SEM of three independent experiments and analyzed according to two-tailed Student's t-test (unpaired) and one-way analysis of variance. All analyses were performed using GraphPad Prism software (version 6.0). Results were considered significant when P < 0.05.
[0087] Example 1: Obvious and persistent NETosis in a patient bitten by a Formosan cobra (N. atra)
[0088] The coordinated recruitment of neutrophils and the subsequent formation of neutrophil extracellular traps (NETs) at the bite site have been shown to cause severe tissue damage in animal models of snakebite envenomation. To determine whether these findings are relevant to real-world clinical samples, we examined skin samples from patients who experienced significant local tissue destruction after a bite from a Formosan cobra (N. atra) despite multiple antivenom treatments. All examined patient skin samples obtained from debridement procedures within 14 days after the snakebite demonstrated extensive tissue necrosis and neutrophil infiltration, with significant NETosis extending from the dermis to the subcutaneous tissue. Snakebite-induced ongoing tissue destruction in patients with Formosan cobra (N. atra) bites. Both patients sustained leg puncture wounds and prolonged tissue destruction. Wound debridement was performed 8–9 days after the snakebite. In IF-stained skin tissues from patients A and B, the distribution of DNA, Cit-H3, PAD4, and MPO revealed extensive NET formation in the dermis and hypodermis of both patients. Time-course analysis of skin samples from the bite site from patient B revealed the early presence of NETs and clear neutrophil recruitment from day 1 after snakebite, as well as persistent NET formation and tissue damage over a 2-week period. Furthermore, increased neutrophil counts in the peripheral blood of patients with N. atra bites (Figure 1H) correlated with the extent of NETosis (Figure 1I). To our knowledge, these data constitute the first clinical evidence of NETosis in snakebite victims and support its central role in venom-induced tissue destruction.
[0089] Example 2: SV-CTXs and SV-HMW derived from Taiwan cobra (N. atra) venom stimulate NETosis.
[0090] We aimed to define NETosis-inducing compounds in snake venom. First, we tested whether Taiwan cobra (N. atra) crude venom (CV) could stimulate NETosis in human neutrophils in vitro. NETs were measured via citrullinated histone H3 ELISA and further confirmed by immunofluorescence staining (Figure 1A, 1G). Venom-treated neutrophils showed a dose-dependent increase in the expression of citrullinated histone H3 (CitH3), which coincided with the formation of colocalized peptidylarginine deiminase 4 (PAD4), CitH3, and DNA in immunofluorescence image analysis (Figure 1A, 1G). These results confirmed the ability of Taiwan cobra (N. atra) venom to stimulate NETosis.
[0091] To further identify NETosis-stimulating factors in Naja atra venom, we investigated the contribution of major snake venom components, including cytotoxins (SV-CTXs), neurotoxins (SV-NTXs), phospholipase A2 (SV-PLA2), and high-molecular-weight fractions (SV-HMW), to promoting NETosis. Based on our previous proteomic analysis of Naja atra venom (Huang, HW et al. Cobra venom proteome and glycome determined from individual snakes of Naja atra reveal medically important dynamic range and systematic geographic variation. J Proteomics 128, 92–104 (2015)), we profiled and isolated SV-CTXs, SV-NTXs, SV-PLA2, and SV-HMW from the snake venom using HPLC chromatography, and verified their purity via SDS-PAGE (Figure 1B). Human neutrophils were treated with various fractions of venom based on their original composition. Here, the percentages of SV-CTXs, SV-NTXs, SV-PLA2, and SV-HMW in Taiwanese cobra (N. atra) venom were approximately 59.4%, 20.5%, 14%, and 6.1%, respectively. The 6% SV-HMW contained approximately 1.8% SVMPs, approximately 2.1% CRISP, approximately 0.2% PDE, approximately 0.5% 5NT, and approximately 1.6% others. Our data revealed that SV-CTXs and SV-HMW had substantial and dose-dependent activity in inducing NET formation, whereas SV-NTXs and SV-PLA2 had relatively low efficacy (Figures 1C-1G). These data suggest that SV-CTXs and SV-HMW derived from N. atra venom, but not SV-NTXs and SV-PLA2, play a major role in stimulating NETosis and may be potential targets for inhibiting snake venom-induced NETs.
[0092] Example 2: SV-HMW derived from Taiwan cobra (N. atra) venom has high adenosine releasing activity.
[0093] Cobra SV-CTXs are a mixture of polypeptides that cause cell injury, cell death, and inflammation through either direct cytolytic activity or indirect regulation. However, antivenins, which are thought to neutralize the major components of snake venom, including SV-CTXs, have failed to inhibit tissue destruction induced by Taiwan cobra (N. atra) bites. Interestingly, SV-HMWs have been found to have a remarkable ability to stimulate NETosis. Furthermore, SV-HMWs are considered to be relatively non-toxic components compared with SV-CTXs, a property that has not previously attracted much attention from researchers. Given the limited understanding of the role of SV-HMWs, we attempted to elucidate their mechanism of stimulating NETosis, which will help clarify the pathogenesis of snake venom-induced tissue destruction.
[0094] Our previous research has revealed that at least two types of purinergic molecules, including a snake venom-derived phosphodiesterase (SV-PDE) and a snake venom-derived 5'-nucleotidase (SV-5'NT), are found in SV-HMW compartments from the venom of the Taiwanese cobra (N. atra) (Huang, HW et al. Cobra venom proteome and glycome determined from individual snakes of Naja atra reveal medically important dynamic range and systematic geographic variation. J Proteomics 128, 92-104 (2015)). Purinergic molecules have also been found in the SV-HMW compartments from the venoms of cobras, vipers, and kraits. Purinergic signaling, particularly adenosine, may regulate the immune system in both rodents and humans, and activation of adenosine signaling may promote or inhibit its effector functions depending on the type of adenosine receptor involved. Therefore, we next investigated whether venom-derived purinergic molecules contribute to venom-induced NETosis by regulating environmental adenosine. We investigated whether human neutrophils express adenosine receptors using real-time quantitative RT-PCR analysis (qRT-PCR). Results showed that adenosine receptor A1 (AR1) is highly expressed in human neutrophils, approximately 4.3, 195, and 15.9 times higher than the levels of adenosine receptors A2a, A2b, and A3, respectively (Figure 2A). AR1 activation can promote neutrophil effector functions, including the induction of NETosis. Furthermore, we measured adenosine levels after in vitro induction of NETosis with CV, which showed a positive dose-dependence between CV dose and adenosine (Figure 2B). To further confirm whether SV-HMW contributes adenosine through its enzymatic activity, we directly supplied adenosine monophosphate (AMP) to SV-CTXs, SV-NTXs, SV-PLA2, and SV-HMW in vitro. A time-dependent increase in adenosine was observed only in SV-HMW, but not in the others (Figures 2C-2F).In summary, these data suggest that SV-HMW-derived adenosine may play a role in SV-HMW- and, by extension, CV-induced NETosis.
[0095] Example 3: HMW fraction of Taiwan cobra (N. atra) venom induces NETosis via the adenosine signaling axis
[0096] The widespread presence of the adenosine-regulating enzymes 5NT and PDE in snake venoms led us to hypothesize that snake venoms may induce NETosis via an adenosine signaling axis that is important for leukocyte trafficking and NETosis. Interestingly, we observed a dose-dependent increase in adenosine levels in human neutrophil cultures treated with Formosan cobra (N. atra) crude venom (Figure 2G). This increase appeared to be primarily mediated by the HMW venom fraction (Figure 2G). Because adenosine in crude venom should be removed during fractionation, and the adenosine levels detected in neutrophil cultures greatly exceeded those reported in snake venom, carryover of adenosine from the crude venom was unlikely. Rather, the increase in adenosine levels may have been mediated by enzymes in the HMW fraction, particularly 5NT and PDE, which may generate adenosine through hydrolysis of ATP / AMP released by neutrophils, which may be associated with NETosis.
[0097] Further supporting the role of adenosine signaling in Taiwan cobra (N. atra) venom-induced NETosis, we showed that specific antagonists targeting AR1 and AR3 (but not AR2a) significantly reduced venom-induced NETosis in human neutrophils (Figure 11B). Furthermore, our findings suggest the expression of AR1, AR2a, AR2b, and AR3 in human neutrophils. This receptor subtype selectivity is consistent with previous studies showing that activation of AR1 and AR3, but not AR2, promotes neutrophil effector function and NETosis.
[0098] Example 4: The neutrophil adenosine axis enhances toxin-induced NETosis and tissue damage.
[0099] To determine the in vivo relevance of adenosine-mediated NETosis, we analyzed AR1-expressing neutrophils (AR1) in skin samples from snakebite patients. + MPO + The presence of AR1 cells was examined. + The degree of neutrophil infiltration was significantly correlated with the progression of tissue damage (Figures 2H and 2I). + Neutrophils accumulated in the subcutaneous tissue during the early stages of intoxication (patient B, day 1) and then infiltrated throughout the cutaneous tissue as intoxication and necrosis progressed (patient A, day 8 and patient B, days 6–14). These findings highlight the clinical significance of the AR1-mediated neutrophil-adenosine axis in venom-induced tissue destruction.
[0100] Example 5: Adenosine signaling enhances toxin-induced NETosis and tissue damage.
[0101] To investigate the relationship between adenosine and toxicity as a result of snake venom-induced tissue damage, mice were intradermally injected with N. atra venom. Mice injected with doses above 0.4 mg / kg of N. atra venom exhibited mortality throughout the experiment, and survival time was inversely correlated with the administered dose of N. atra crude venom (CV). In contrast, NETosis-inducing CTX and HMW fraction administered individually were nonlethal at 5 mg / kg and 1 mg / kg, respectively. Interestingly, intradermal injection of crude venom in combination with either HMW fraction, purified N. atra 5NT, purified N. atra PDE, or exogenous adenosine extended mouse survival time, revealing a potential protective role for additional adenosine-regulating components in the immune response that confers resistance to venom toxicity in CV-infected mice.
[0102] To investigate the involvement of neutrophil adenosine signaling in the early immune response to snake venom in vivo, we analyzed blood samples from mice within the first hour after intradermal venom injection, before the onset of death. As expected, N. atra venom alone increased peripheral blood neutrophils, with CD11b+ cells accounting for 35.5% of all Ly6G+ granulocytes compared to 14.3% in controls (Figure 12A). This is consistent with previous clinical evidence that exposure to snake venom elevates circulatory neutrophil levels. Co-injection of adenosine and N. atra venom further increased peripheral blood neutrophil counts to 56%, highlighting the important role of adenosine signaling in venom-induced neutrophil recruitment. Consistent with our in vitro findings showing that specific venom components increased adenosine levels, co-injection of Taiwanese cobra (N. atra) venom with the HMW fraction, purified 5NT, or PDE also enhanced neutrophil recruitment (Fig. 12A). Notably, individually injected adenosine, the HMW fraction, 5NT, and PDE had no effect on neutrophil levels during the first hour, suggesting that adenosine signaling likely enhanced the early venom-induced immune response (Fig. 12A).
[0103] Enhancement of the venom-induced immune response by adenosine and adenosine-modulating venom components was also evident locally at the injection site. Intradermal administration of these adenosine-driven molecules alone resulted in increased MPO expression at the injection site. + and AR1 + This resulted in significant cell infiltration and was accompanied by significant NET formation in mouse skin. Co-injection of Taiwan cobra (N. atra) venom with the HMW fraction, 5NT, PDE, or adenosine resulted in increased skin damage, neutrophil infiltration, NET formation, and lesion prominence at the injection site (Figure 12B). Overall, these results demonstrated the role of venom-induced adenosine signaling in neutrophil recruitment, infiltration, and local NET formation in vivo. This immune response, supported by adenosine release, triggered potent NETosis and significantly exacerbated the tissue damage caused by snake envenomation.
[0104] Example 6 Adenosine receptor antagonists inhibit CV-induced and SV-HMW-induced NETosis.
[0105] Next, we investigated whether adenosine derived from SV-HMW mediates CV-induced NETosis by signaling to adenosine receptors. To address this issue, we applied the pan-adenosine receptor antagonist caffeine and the AR1-specific antagonist DPCPX in in vitro studies. Notably, adenosine receptor blockade significantly reduced CV-induced NETosis by approximately 51% and 43% under treatment with 20 μM caffeine and 10 μM DPCPX, respectively (Figure 3A). Interestingly, adenosine receptor blockade revealed significant differences between SV-CTXs-induced and SV-HMW-induced NETosis. Both caffeine and DPCPX dose-dependently reduced SV-HMW-induced NETosis (Figure 3B), but had no effect on SV-CTX-induced NETosis (Figure (3C)). This result indicates that SV-HMW-induced NETosis is adenosine-dependent and can be distinguished from SV-CTX-induced NETosis, which is likely adenosine-independent. IF staining analysis further confirmed the data (Figure (3D)). In summary, adenosine receptor blockade at least partially inhibits CV-induced NETosis, which may be a potential therapeutic target for CV-induced tissue destruction.
[0106] Further experiments showed that AR1, AR2a, AR2b, and AR3 are expressed in human neutrophils (Figure 11A), but only AR1 and AR3 antagonists were able to reduce CV-induced NETosis (Figure 11B).
[0107] Example 4: PAD4 antagonists inhibit PAD4-dependent SV-HMW-induced NETosis
[0108] Protein arginine deiminase 4 (PAD4) plays a crucial role in catalyzing the citrullination of histone H3, which is recognized as a key regulatory protein in NETosis. Relatively higher PAD4 levels were observed in SV-HMW-induced NETosis compared with SV-CTXs (Figure 3D), suggesting that the former may be related to PAD4 activity. Based on this result, we next investigated the role of PAD4 in SV-HMW- and CV-induced NETosis. Using qRT-PCR analysis, we showed that both CV and SV-HMW induced PAD4 expression in human neutrophils, whereas SV-CTXs did not (Figure 4A). We also examined the expression of other NETosis-related genes, including ELANE, MPO, and MMP9. The data revealed that SV-CTX-induced NETosis involves multiple complex mechanisms, including the induction of ELANE, MPO, and MMP9, whereas SV-HMW-induced NETosis may be highly dependent on PAD4 induction (Figures 4A–4D). These results suggest the possibility of targeting PAD4 in inhibiting SV-HMW- and CV-induced NETosis.
[0109] To address this issue, we tested the specific PAD4 antagonist GSK484 on NET formation in human neutrophils treated with CV, SV-CTXs, and SV-HMW. In PAD4 blockade studies, 10 μM GSK484 inhibited SV-HMW-induced NETosis and SV-CTX-induced NETosis by 92% and 20%, respectively (Figures 5B and 5C). This data further demonstrated that SV-HMW-induced NETosis is primarily PAD4-dependent, whereas SV-CTX-induced NETosis is only partially affected by PAD4 activity. Most importantly, PAD4 blockade reduced NET formation in CV-induced NETosis by 43%, demonstrating the feasibility of applying GSK484 (Figure 5A). In addition to PAD4, elastase is another important mediator of NETosis. Because CV and SV-CTX treatment also enhanced elastase expression in human neutrophils (Figure 4A), we speculated on the possibility of using an elastase inhibitor to inhibit CV-induced NETosis. We tested the elastase antagonist sivelestat on CV-, SV-HMW-, and SV-CTX-induced NETosis. The results revealed that sivelestat reduced CV- and SV-CTX-induced NETosis by 23% and 53%, respectively (Figures 5A and 5C). Interestingly, elastase blockade had no effect on SV-HMW-induced NETosis, further highlighting the PAD4-dependent manner of HMW activation (Figure 5B). These data were further confirmed by IF image analysis (Figure 5D). In summary, our results provide evidence for the underlying mechanism of SV-HMW-induced NETosis, which depends on PAD4 activation and can be significantly inhibited by a PAD4-specific antagonist.
[0110] Both GSK484 and sivelestat inhibited SV-CTX-induced NETosis, but were found to be relatively less effective than GSK484 in SV-HMW. This data suggests that SV-CTX-induced NETs may involve a PAD4-independent, elastase-dependent activity that is much more complex than that of SV-HMW to drive NETosis.
[0111] Example 5: DPCPX and GSK484 prevent toxin-induced NETosis and tissue destruction.
[0112] Next, we aimed to extend our findings to snake venom-induced tissue destruction in vivo. In a pilot study, we measured the lethal doses of Taiwan cobra (N. atra) crude venom, SV-CTXs, and SV-HMWs in 6- to 8-week-old male C57BL / 6J Nar mice (LD50 of crude venom: 0.5 mg / kg; non-lethal doses of CTX and HMW: 3 mg / kg and 0.3 mg / kg body weight, respectively). Because SV-CTXs and SV-HMWs have been shown to be major factors contributing to CV-induced NETosis, we first examined the formation of tissue destruction after intradermal injection of SV-CTXs and SV-HMWs. SV-CTXs alone induced clear tissue necrosis at the injection site, whereas SV-HMWs alone did not (Figures 6A and 6B). While SV-HMW alone did not induce significant tissue damage, its combination with SV-CTXs (CTXs + HMW) demonstrated a complementary effect, significantly enhancing the severity of tissue destruction compared with SV-CTXs alone (Figures 6A and 6B). In addition to tissue damage, we verified the formation of NETs through IF staining of skin sections after administration of SV-CTXs and SV-HMW (Figure 6C). Interestingly, mice treated with SV-CTXs and SV-HMW alone showed NET formation at the injection site 16 hours after injection (Figure 6C). These results support the possibility that SV-HMW promotes the tissue-destructive ability of SV-CTXs by stimulating NETosis. Due to the strong neurotoxicity of CV, mice died immediately after injection, making it difficult to monitor tissue damage during follow-up. Therefore, we decided to use a combination of SV-CTXs and SV-HMW (CTXs + HMW) instead of crude venom to induce tissue destruction in further animal studies.
[0113] The effects of adenosine receptor A1 (DPCPX), PAD4 (GSK484), and elastase (sivelestat) inhibitors on CTXs + HMW-induced NETosis were tested in vitro, suggesting that DPCPX and GSK484 may be more suitable than sivelestat for inhibiting it (Figure 8). Therefore, we further investigated the therapeutic effects of adenosine receptor A1 and PAD4 antagonists on snake venom-induced tissue destruction in vivo. Mice were first intradermally injected with a combination of SV-CTXs and SV-HMW, followed by DPCPX or GSK484 at the same site 2 hours later (Figure 7A). We found that administration of DPCPX and GSK484 reduced neutrophil recruitment and NETosis at the injection site 16 hours after toxin injection, leading to a significant improvement of lesion size by 30–40% the following day (Figure 7A, 7B). These results indicate that blocking venom-induced NETosis can significantly reduce the severity of tissue necrosis. We also observed a faster lesion recovery rate in the DPCPX and GSK484-treated groups compared with the vehicle group (Figure 7A). Our data suggest that inhibiting venom-induced NETosis not only directly reduces tissue necrosis but also accelerates the healing rate of venom-induced lesions. Compared with individual drug treatments, coadministration of GSK484 and DPCPX significantly reduced neutrophil recruitment and local NETosis 16 hours after CTXs / HMW injection (Figure 7B).
[0114] To investigate NETosis inhibition as a broad therapeutic strategy for snake venom-induced tissue destruction, we evaluated the effects of GSK484 and DPDPX in mice injected with carpet viper (E. carinatus) venom. Patients bitten by carpet vipers (E. carinatus) often suffer from severe skin ulcers, for which there is no effective treatment. E. carinatus venom was chosen because, unlike N. atra venom, it lacks adenosine-regulating ability and induces adenosine-independent NETosis in human neutrophils (Figures 13A and 13B). Consistent with the induction of adenosine-independent NETosis by E. carinatus venom, GSK484, but not DPDPX, inhibited E. carinatus venom-induced NETosis in human neutrophils (Figure 13C). Consistent with the in vitro results, mice receiving GSK484 after E. carinatus venom injection showed significantly reduced local neutrophil infiltration, NET formation, and lesion size compared with vehicle (Figures S13D and S13E). Furthermore, consistent with adenosine-independent induction of NETosis by E. carinatus venom, DPCPX treatment did not affect neutrophil infiltration, NET formation, or skin lesion size (Figures S13D and S13E).
[0115] Overall, these results demonstrated that targeted molecular intervention of venom-induced NETosis successfully alleviated tissue damage caused by different snake venoms.
[0116] Example 6: Increasing HMW leads to more severe tissue destruction.
[0117] To further highlight the role of SV-HMW in venom-induced tissue destruction, we combined SV-CTXs with a higher dose of SV-HMW (CTXs + 5xHMW) and compared this with the original dose group (CTXs + 1xHMW) in vivo. Combining SV-CTXs with a higher dose of SV-HMW dramatically enhanced the severity of tissue destruction (Figure 7C). This data further highlighted the auxiliary role of SV-HMW in promoting venom-induced tissue destruction. Because the rationale for using AR1 and PAD4 antagonists is to inhibit SV-HMW-induced NETosis, treatment with DPCPX and GSK484 is expected to show more promising efficacy under CTXs + 5xHMW conditions. Indeed, administration of DPCPX and GSK484 reduced lesion size by more than 50% under CTXs + 5xHMW treatment, which was greater than the efficacy under CTXs + 1xHMW treatment (Figure 7D). Because the combination of DPCPX and GSK484 showed significantly greater inhibitory activity than either of them alone in inhibiting CTXs+HMW-induced NETosis in vitro, we also investigated whether DPCPX and GSK484 could act synergistically in inhibiting tissue destruction (Figure 8). We found that the combination therapy significantly improved therapeutic activity, reducing necrotic tissue by more than 70% compared with the use of either DPCPX or GSK484 alone (Figure 7D). In summary, these data demonstrated that NETosis inhibition by DPCPX and GSK484 was durable in reducing toxin-induced tissue destruction, especially for toxins with high SV-HMW content or potent adenosine release.
[0118] Example 7: NETosis induction by various snake envenomations
[0119] To assess the generalizability of our proposed therapeutic strategy beyond the Formosan cobra (N. atra) and carpet viper (E. carinatus), we examined the ability of nine snake venoms from the Elapidae and Viperidae families, the two families most commonly responsible for snakebite envenomation, to induce NET formation and adenosine production in human neutrophils. Despite known clear differences in the composition of snake venoms, venoms from all different snake species tested induced NETosis, and most of them increased adenosine levels in human neutrophils in vitro (Figures 9A and 9B). These results reveal a common mechanism for NETosis induction and adenosine release during snake envenomation.
[0120] Next, we examined the effects of PAD4 and AR1 inhibitors on NETosis induced by different snake venoms. GSK484 significantly reduced NETosis induced by the venoms of the Taiwanese cobra (N. atra), black-necked cobra (N. nigricollis), Cape cobra (N. nivea), king cobra (O. hannah), Western diamondback rattlesnake (C. atrox), Asian viper (D. siamensis), and carpet viper (E. carinatus) with the exception of the venoms of the carpet viper (E. carinatus), Cape cobra (N. nivea), and multicinctus (B. multicinctus) (Figure 9C). Similarly, the AR1 inhibitor DPCPX effectively reduced NETosis induced by most snake venoms with the exception of the venoms of the carpet viper (E. carinatus), Cape cobra (N. nivea), and multicinctus (B. multicinctus) (Figure 9C). Notably, the latter three "DPCPX-unresponsive" venoms induced relatively small amounts of adenosine release by human neutrophils compared with the other six venoms (Figure 9B). This suggests that these venoms induced NETosis via an adenosine-independent mechanism. The fact that patients bitten by Cape cobra (N. nivea) and banded krait (B. multicinctus) primarily presented neurological symptoms further supports the distinct mechanisms by which "DPCPX-unresponsive" venoms induce NETosis. Finally, combined treatment of Taiwan cobra (N. atra), king cobra (O. hannah), and Asian viper (D. siamensis) with GSK484 and DPCPX further suppressed NETosis compared with individual inhibitor treatments (Figure 9C). Employing these small molecule inhibitors to assess NET activity across snake species provided unprecedented insight into the critical role of adenosine in snake venom-induced tissue damage. Inhibition of AR1 clearly demonstrates its important role in therapeutic interventions targeting the severe tissue necrosis induced by snake venom. The inhibitory effect of AR1 antagonists on NETs induced by different snake venoms was positively correlated with the amount of adenosine produced after venom action on neutrophils (Figure 9D).
[0121] Current medical treatment for snakebite envenomation follows guidelines that primarily rely on antisera. However, the controlled restriction of such antivenoms requires reliable identification of the venom species and local supply. Furthermore, many patients develop several adverse complications, such as serum sickness and hypersensitivity, primarily due to the heterotypic nature of antisera, and require careful observation after administration in medical facilities. Furthermore, exposure to species-specific venoms to elicit an immune response is essential for antivenom production, and the manufacturing process, from material collection to antisera delivery and maintenance, is time-consuming and costly worldwide. There is an urgent need to develop advanced therapies for treating snakebite envenomation that are broadly applicable, easy to manufacture, and have few side effects. Evolutionary studies of snake venom genes have demonstrated high homology of accessory venom proteins (AVPs), such as SVSPs, SVMPs, and SV-5'NTs, among different snake species. This suggests that AVP-targeting strategies may offer a universal treatment for snakebite envenomation. Furthermore, this study demonstrates that small molecule antagonists to induce the effects of AVP, such as DPCPX and GSK484, would be beneficial for manufacturing, formulating, and administering to snakebite victims, especially since these are commonly used worldwide.
[0122] Example 8: Treatment of delayed wound healing induced by obesity and diabetes
[0123] To investigate the relationship between obesity / diabetes and NETosis-mediated tissue destruction, we further conducted the following experiment. Male C57BL / 6 mice were fed either a normal diet (NCD) or a high-fat diet (HFD) for 30 weeks at 4 weeks of age. The development of diabetic status on the HFD was confirmed by a glucose tolerance test (GTT) (Figure 10A). Then, a 6-mm skin puncture wound was created on their backs (Figure 10B). Vehicle (10% DMSO), GSK484 (1 mg / kg), DPCPX (1 mg / kg), or a combination of GSK484 and DPCPX (1 mg / kg each) was directly administered to the wound every two days. Lesions were monitored daily (Figure 10B), and the size of the lesions was calculated as the % change compared to the wound size at D0 for each mouse (Figure 10C). Delayed wound healing was observed in HFD mice, whereas wound healing was accelerated after GSK484 administration. Combining GSK484 with DPCPX increased its efficacy by an additional 4%, clearly demonstrating that the combination of these two chemicals produces better results. Finally, administration of GSK484 and DPCPX did not affect wound healing in NCD mice.
[0124] Skin tissue from the wound site was harvested 7 days after wounding and subjected to histological analysis to verify the induction of intradermal NETosis (Figure 10D, shown as induction of CitH3 and PAD4 expression in the dermis). HFD mice had a clear induction of NETosis in the wound bed, but not in NCD mice. Administration of GSK484 or a combination of GSK484 and DPCPX significantly reduced intradermal NETosis, which may be related to the accelerated wound healing process in HFD mice.
[0125] In summary, these data demonstrated that GSK484 and DPCPX can treat obesity- and diabetes-induced delayed wound healing through blocking NETosis.
[0126] While the present disclosure has been described in conjunction with the specific embodiments outlined above, many alternatives, modifications, and variations thereto will be apparent to those skilled in the art, and all such alternatives, modifications, and variations are deemed to be within the scope of the present disclosure.
Claims
1. A method for preventing, treating, or ameliorating a NETosis-mediated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an active agent or a pharmaceutical composition comprising the same, wherein the active agent is selected from the group consisting of an adenosine receptor (AR)-specific antagonist or inhibitor, a protein arginine deiminase 4 (PAD4)-specific antagonist or inhibitor, and an elastase-specific antagonist or inhibitor.
2. 2. The method of claim 1, wherein the NETosis-mediated disease is selected from the group consisting of NETosis-induced organ or tissue destruction, kidney damage, autoimmune conditions, and autoinflammatory conditions.
3. 10. The method of any of the preceding claims, wherein the autoimmune condition is psoriasis, rheumatoid arthritis, or systemic lupus erythematosus.
4. 10. The method of any of the preceding claims, wherein the renal damage is acute tubular necrosis, antineutrophil cytoplasmic antibody-mediated renal vasculitis, lupus nephritis, thrombotic microangiopathy, antiglomerular basement membrane disease, or an early stage of diabetic nephropathy.
5. 10. The method according to any of the preceding claims, wherein the NETosis-mediated disease is tissue or organ destruction induced by snake venom, or tissue or organ destruction induced by obesity, diabetes or pathogen-mediated acute / chronic inflammation.
6. 6. The method of claim 5, wherein the snake venom is cobra venom, viper venom, or krait venom.
7. 10. The method of claim 1, 2 or 5, wherein the tissue or organ destruction is delayed wound healing induced by obesity and diabetes.
8. 10. The method of any of the preceding claims, wherein the AR-specific antagonist is a pan-AR antagonist or inhibitor, an adenosine receptor A1 (AR1) antagonist or inhibitor, or an adenosine receptor A3 (AR3) antagonist or inhibitor.
9. 9. The method of claim 8, wherein the pan-AR antagonist is caffeine, theophylline, theobromine, or a salt thereof, and / or the AR1 antagonist or inhibitor is a snake venom (SV-HMW) high molecular weight fraction-mediated AR1 antagonist or inhibitor.
10. The AR1 antagonist or inhibitor is 1,3-dipropyl-8-cyclopentylxanthine (DPCPX), 3-[4-(2,6-dioxo-1,3-dipropyl-7H-purin-8-yl)-1-bicyclo[2.2.2]octanyl]propanoic acid (tonapofylline), 8-(hexahydro-2,5-methanopentalen-3a(1H)-yl)-3,7-dihydro-1,3-dipropyl-1H-purine-2,6-dione (rolofylline), 8-cyclopentyl and / or the AR3 antagonist or inhibitor is N-(2-methoxyphenyl)-N'-[2-(3-pyrindinyl)-4-quinazolinyl]-urea (VUF5574) methyl.
10. The method of claim 9, wherein the compound is 1-[N6-(3-iodobenzyl)-adenin-9-yl]-b-D-ribofuronamide (CF101), 1H-purine-2,6-diamine, N6-(1R,2S,4S)-bicyclo[2.2.1]hept-2-yl-N2-phenyl (CAY10498), 6-ethyl-5-[(ethylthio)carbonyl]-2-phenyl-4-propyl-3-pyridinecarboxylic acid propyl ester (MRS1523), or a salt thereof.
11. 10. The method of any of the preceding claims, wherein the AR-specific antagonist is an AR1 antagonist or inhibitor or an AR3 antagonist or inhibitor.
12. A method according to any of the preceding claims, characterized in that the PAD4-specific antagonist or inhibitor is a snake venom high molecular weight fraction (SV-HMW)-mediated PAD4 antagonist or inhibitor, or a snake venom cytotoxin (SV-CTX)-mediated PAD4 antagonist or inhibitor.
13. 10. The method of any of the preceding claims, wherein the PAD4-specific antagonist or inhibitor is ((3S,4R)-3-amino-4-hydroxypiperidin-1-yl)(2-(1-(cyclopropylmethyl)-1H-indol-2-yl)-7-methoxy-1-methyl-1H-benzo[d]imidazol-5-yl)methanone hydrochloride (GSK484), or a salt thereof.
14. 10. The method of any of the preceding claims, wherein said elastase-specific antagonist or inhibitor is a snake venom cytotoxin (SV-CTX)-mediated elastase antagonist or inhibitor.
15. 10. The method of any of the preceding claims, wherein the elastase-specific antagonist or inhibitor is sivelestat, or a salt thereof.
16. 10. The method of any of the preceding claims, wherein the active agent inhibits SV-HMW-induced NETosis.
17. 17. The method of claim 16, wherein the active agent is a PAD4 antagonist or inhibitor or an AR antagonist or inhibitor.
18. 10. The method of any of the preceding claims, wherein the active agent inhibits crude snake venom (CV)-induced NETosis.
19. 10. The method of any of the preceding claims, wherein the active agent is an elastase-specific antagonist or inhibitor or a PAD4-specific antagonist or inhibitor.
20. 10. The method of any of the preceding claims, wherein the active agent is administered to the subject via subcutaneous injection.
21. 1. A method for selecting a compound as a candidate compound for preventing, treating, or ameliorating a NETosis-mediated disease, comprising: (a) contacting a compound with AR, PAD4, or elastase; (b) determining whether the compound antagonizes or inhibits the activity of AR, PAD4, or elastase; If the compound is capable of antagonizing or inhibiting the activity of AR, PAD4 or elastase, then the compound is identified as a candidate compound for preventing, treating or ameliorating NETosis-mediated tissue destruction.
22. 22. The method of claim 21, wherein the NETosis-mediated disease, AR, PAD4 and elastase are defined in any one of the preceding claims.