Compositions Comprising Sequence-Specific Endoribonucleases and Methods of Use
ToxN endoribonucleases overcome inefficiencies in RNA analysis by providing precise cleavage at specific salt concentrations, enabling effective RNA fingerprinting and capping efficiency determination, thus improving RNA analysis and synthesis methods.
Patent Information
- Application Number
- JP2025545823
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-07
- Filing Date
- 2024-02-07
- Publication Date
- 2026-02-05
AI Technical Summary
Existing endoribonucleases face challenges such as nonspecific cleavage, high fragmentation, and inefficiency in analyzing long RNA molecules, particularly in determining 5' capping efficiency and polyA tail generation, due to limitations in resolution and stability, which are not adequately addressed by current analytical methods.
The use of sequence-specific ToxN endoribonucleases, which operate effectively at specific concentrations of monovalent salts and divalent metal cations, allowing precise cleavage of single-stranded RNA without the need for DNA probes, and are more stable than ribozymes and DNAzymes, enabling efficient RNA analysis and synthesis.
ToxN endoribonucleases provide precise and efficient cleavage of RNA molecules, facilitating methods for RNA fingerprinting, 5' capping efficiency determination, and polyA tail analysis, with improved stability and reduced enzyme requirements, enhancing the accuracy of RNA analysis and synthesis processes.
Smart Images

Figure 2026504519000015 
Figure 2026504519000016 
Figure 2026504519000017
Abstract
Description
[Technical Field]
[0001] The present disclosure provides compositions comprising sequence-specific endoribonucleases and methods for their use in RNA analysis and synthesis. In particular, the disclosure relates to compositions comprising ToxN endoribonucleases, which are a subfamily of ToxINs in the type III toxin-antitoxin system. ToxN endoribonucleases recognize and cleave single-stranded ribonucleic acid (RNA) molecules. [Background technology]
[0002] introduction Endoribonucleases are a group of enzymes that cleave internal phosphodiester bonds between adjacent nucleotides of RNA within single-stranded RNA or double-stranded RNA, depending on the enzyme. Endoribonucleases can be sequence-specific (e.g., restriction endoribonucleases) or sequence-independent.
[0003] Many endoribonuclease enzymes are known, including RNase H, a family of sequence-independent endoribonucleases that catalyze the cleavage of RNA in RNA / DNA hybrid substrates.
[0004] Endoribonuclease enzymes have several applications in molecular biology research, including the removal of RNA in DNA extraction processes and recombinant protein purification, cDNA synthesis, RNA fingerprinting, and the detection of RNA modifications such as 5' capping of mRNA.
[0005] Therapeutic RNA molecules, such as mRNA molecules encoding antigens for vaccine production, represent a new class of drugs. Successful protein expression from transfected mRNA depends not only on transfection efficiency but also on mRNA stability and translation efficiency. The 5' cap structure and 3' poly(A) tail are key features for achieving high translation efficiency. Therefore, an efficient method for determining the 5' capping efficiency of mRNA and other RNA modifications is highly desirable.
[0006] Analytical methods such as gel electrophoresis, ion-pair reversed-phase high-performance liquid chromatography (IP-RP HPLC), and mass spectrometry (MS) are commonly used to analyze RNA modifications. However, determining the integrity of the cap for long RNA molecules, i.e., RNA molecules longer than 5–10 ribonucleotides, is uncertain because capping only changes their molecular weight by approximately 600 Da, roughly equivalent to one ribonucleotide. Such a small change in molecular weight precludes direct downstream gel-based or mass spectrometry (MS) analysis of long mRNA molecules due to poor resolution.
[0007] Alternative capping molecules result in different products that exhibit only slight variations in molecular weight, e.g., Cap-1 or Cap-0, 5'-triphosphate, 5'-diphosphate, unmethylated G cap, reverse cap.
[0008] To overcome the low resolution of existing analytical tools, RNA samples, especially those containing long RNA molecules, need to be cut into short fragments before further analysis.
[0009] The current standard for RNA cleavage is endoribonuclease-based cleavage using frequent cleaving enzymes such as RNase I, RNase H-based methods, ribozyme-based methods, or DNAzyme-based approaches.
[0010] Frequent cleaving endoribonucleases such as RNase I cleave single-stranded RNA after each G. Such enzymes produce high levels of fragmentation and are therefore not optimal for certain RNA analysis methods.
[0011] RNase H, which cleaves RNA / DNA hybrids, relies on specific DNA hybridization (Patent Document 1), and RNase H-based methods have the problem of nonspecific and incomplete cleavage of target RNA even when the DNA probe is properly hybridized. Therefore, in RNase H-based methods, it is necessary to optimize the conditions for each hybridized RNA-DNA oligonucleotide pair to achieve complete and specific digestion of RNA.
[0012] The Csy4 endoribonuclease relies on a guide RNA to recognize and cleave an RNA target sequence. Recently, it has been reported that ribozymes can also be applied to sequence-specific cleavage of mRNA (Non-Patent Document 1 and Patent Document 2).
[0013] However, ribozymes rely on the synthesis of ribonucleic acid and must be used in a 1- to 10-fold excess over the concentration of the substrate to be analyzed. Because ribozymes are catalytic RNA molecules, they are expensive to produce and difficult to handle due to their lack of stability.
[0014] DNAzymes, like ribozymes, are DNA oligonucleotides with catalytic activity. The most abundant class of deoxyribozymes are ribonucleases, which catalyze the cleavage of the phosphodiester bond of ribonucleotides (Non-Patent Document 2).
[0015] Despite the existence of endoribonucleases, there remains a need to provide further endoribonucleases that overcome one or more of the drawbacks of endoribonucleases and prior art methods, and that enable efficient and simplified methods for RNA analysis or RNA synthesis. [Prior art documents] [Patent documents]
[0016] [Patent Document 1] Australian Patent Application Publication No. 2016297778 [Patent Document 2] International Publication No. 2015 / 101416 [Non-patent literature]
[0017] [Non-Patent Document 1] Vlatkovic et al., Ribozyme assays for quantifying the capping efficiency of in vitro transcribed mRNA,Pharmaceutics,2022,vol.14,no.2,p.328 [Non-patent document 2] Hengesbach,M.et al.Use of DNAzymes for site-specific analysis of ribonucleotide modification,RNA,2008,vol.14,no.l,p.180-187 Summary of the Invention [Problem to be solved by the invention]
[0018] The present inventors have unexpectedly shown for the first time that sequence-specific endoribonucleases of the ToxIN subfamily of type III toxin-antitoxin systems specifically cleave single-stranded RNA at their recognition sites in the presence of specific concentrations of monovalent salts, i.e., the nonspecific catalytic activity of the enzymes (also called "star activity") is reduced in the absence or at low to moderate concentrations of monovalent salts.
[0019] The present inventors also unexpectedly and for the first time discovered that the catalytic activity of an endoribonuclease from the ToxIN subfamily of type III toxin-antitoxin systems is inhibited by specific concentrations of divalent metal cations, in contrast to other endoribonucleases, which tolerate specific low concentrations of divalent metal cations but whose enzymatic activity is inhibited at higher concentrations.
[0020] We also unexpectedly and for the first time found that the nonspecific catalytic activity, or star activity, of the ToxN subfamily of endoribonucleases is reduced or eliminated by low concentrations of divalent metal cations, thus demonstrating that the catalytic activity of the ToxN endoribonuclease family is independent of divalent metal cations.
[0021] We also demonstrated that divalent metal cations do not need to be removed from reaction mixtures containing ToxN endoribonuclease; rather, sequence-specific catalytic activity can be obtained in the presence of divalent metal cation chelators such as EDTA and EGTA. This is a major advantage, as RNA samples are often stored in buffers containing EDTA to prevent degradation by RNases.
[0022] Such sequence-specific catalytic activity at specific concentrations of monovalent salt and reduced nonspecific cleavage of RNA in the absence or at low concentrations of divalent metal cations are not observed with other known endoribonucleases.
[0023] Divalent metal cations are known to stabilize the three-dimensional structure of RNA and proteins. Without being bound by theory, it is believed that in the absence or low concentration of divalent metal cations, such reaction conditions destabilize the three-dimensional structure of the RNA, thereby allowing the ToxN endoribonuclease better access to its target site within the RNA molecule, thereby reducing the amount of enzyme required for complete digestion and therefore resulting in more complete cleavage of the RNA.
[0024] Furthermore, as mentioned above, this class of endoribonucleases has the advantage of being able to digest single-stranded RNA at specific sites without the need for a hybridized DNA probe or RNA guide oligo. Furthermore, the ToxN endoribonuclease family is more efficient and stable than catalytic nucleic acids such as ribozymes and DNAzymes, which require a 1- to 10-fold excess of the RNA substrate.
[0025] These advantages of ToxN endoribonucleases over other known endoribonucleases make this family of endoribonucleases particularly useful in in vitro methods for analyzing modifications of RNA molecules, such as the efficiency of 5' capping and polyA tail generation of synthetically transcribed RNA molecules. Also provided herein are the uses of ToxN in methods of RNA fingerprinting and in methods for generating precursor RNA molecules from rolling circle transcription (RCT). [Means for solving the problem]
[0026] In a first aspect, there is provided a composition comprising an isolated ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the concentration of a monovalent salt in said composition is ≦150 mM, such as about ≦100 mM, and said monovalent salt is preferably an alkali metal salt.
[0027] The ToxN endoribonuclease described herein contains the pFam domain PF13958. In one embodiment of the first aspect, the composition comprises an alkali metal salt at a concentration of about ≦75 mM, such as about ≦55 mM, for example from about 20 mM to about 75 mM, for example from about 20 mM to about 55 mM.
[0028] In one embodiment of the first aspect, the composition is a solution for application to a sample comprising at least one polyribonucleic acid (RNA) molecule. In one embodiment of the first aspect, the sample has a volume of about ≧0.1 μl.
[0029] In one embodiment of the first aspect, the sample has a volume of about 0.1 μl to about 500 μl, preferably about 0.1 μl to about 300 μl, preferably about 0.1 μl to about 250 μl, preferably about 0.1 μl to about 200 μl, more preferably about 0.1 μl to about 150 μl, more preferably about 0.1 μl to about 100 μl, more preferably about 0.1 μl to about 75 μl, more preferably about 0.1 μl to about 50 μl.
[0030] In one embodiment of the first aspect, the monovalent salt of the composition or sample is an inorganic salt comprising an alkali metal ion. Therefore, the monovalent salt is preferably an alkali metal salt.
[0031] In one embodiment of the first aspect, the alkali metal ion of the salt is selected from Na+, K+, Li+, Rb+, Cs+, and Fr+, or any combination thereof. In one embodiment of the first aspect, the alkali metal ion is selected from Na+, K+, Li+ and Rb+.
[0032] In one embodiment of the first aspect, the anion of the salt comprising the alkali metal ion is preferably selected from fluorine (F), chlorine (Cl), bromine (Br), iodine (I), sulfate, phosphate, or hydroxide, or any suitable combination thereof.
[0033] In one embodiment of the first aspect, the alkali metal salt is selected from NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, sodium phosphate, potassium phosphate, or any suitable combination.
[0034] In one embodiment of the first aspect, the composition is essentially free of divalent metal cations. The divalent metal cation is preferably Mg 2+ or Mn 2+ is. In one embodiment of the first aspect, the composition is essentially free of divalent metal cations, i.e., the concentration of divalent metal cations in the composition is about ≦3 mM, preferably about ≦2 mM, and more preferably about ≦1 mM.
[0035] In one embodiment of the first aspect, the composition is essentially free of divalent metal cations, i.e., comprises a ratio of the concentration of divalent metal cations to the concentration of divalent ion chelator in the composition, provided that the concentration of free divalent metal cations present in the composition is about ≦3 mM, preferably about ≦2 mM, and more preferably about ≦1 mM.
[0036] In one embodiment of the first aspect, the composition comprises a divalent ion chelator at a concentration of about ≦10 mM. The divalent ion chelator is preferably EDTA or EGTA.
[0037] In one embodiment of the first aspect, the isolated ToxN enzyme is a ToxN enzyme from E. coli. In one embodiment of the first aspect, the isolated ToxN endoribonuclease or enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID NO:1 or an amino acid sequence that is at least 30% identical to SEQ ID NO:1.
[0038] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID NO:1 or an amino acid sequence that is at least 70% identical to SEQ ID NO:1.
[0039] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or enzymatically active fragment thereof comprises the amino acid sequence of SEQ ID NO:1 or an amino acid sequence that is at least 75%, 80%, 85%, 90%, 92%, 94%, 95%, 98%, or 99% identical to SEQ ID NO:1.
[0040] In one embodiment of the first aspect, the isolated ToxN endoribonuclease or enzymatically active fragment thereof comprises the amino acid sequence of an endoribonuclease having an amino acid sequence selected from the following: SEQ ID NO: 6 or an amino acid sequence at least 70% identical thereto, SEQ ID NO: 7 or an amino acid sequence at least 70% identical thereto, SEQ ID NO: 8 or an amino acid sequence at least 70% identical thereto, or SEQ ID NO: 13 or an amino acid sequence at least 70% identical thereto.
[0041] In one embodiment of the first aspect, the ToxN endoribonuclease has an amino acid sequence that is at least 75%, preferably at least 80%, 85%, 90% or 95%, for example at least 98% or 99% or 99.5% identical to SEQ ID NO: 6, 7, 8 or 13.
[0042] In other embodiments of the first aspect, the ToxN endoribonuclease consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 6, 7, 8, and 13. Enzymatically active fragments thereof are also provided.
[0043] The isolated ToxN endoribonuclease disclosed herein is not complexed with ToxI RNA. In another embodiment of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 30% identical, e.g., 70% identical, to SEQ ID NO: 1; The concentration of the monovalent salt in the composition or sample is preferably about ≦100 mM, about ≦75 mM, or about ≦55 mM, more preferably about 20 mM to about 75 mM, and even more preferably about 20 mM to about 55 mM.
[0044] In another embodiment of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as at least 70% identical, to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is preferably about ≦100 mM, about ≦75 mM, or about ≦55 mM, more preferably about 20 mM to about 75 mM, and even more preferably about 20 mM to about 55 mM; and, The composition or sample is essentially free of free divalent metal cations, the divalent metal cations being preferably Mg2+ or Mn2+, and the divalent metal cations being provided as inorganic salts such as MgCl2 or MnCl2.
[0045] In another embodiment of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as at least 70% identical, to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is preferably about ≦100 mM, about ≦75 mM, or about ≦55 mM, more preferably about 20 mM to about 75 mM, and even more preferably about 20 mM to about 55 mM; and, The concentration of free divalent metal cations is about ≦1 mM, and the divalent metal cations are preferably Mg 2+ or Mn 2+ wherein the divalent metal cation is provided as an inorganic salt such as MgCl or MnCl.
[0046] In another embodiment of the first aspect, the composition or sample comprises a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as at least 70% identical, to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is preferably about ≦100 mM, about ≦75 mM, or about ≦55 mM, more preferably about 20 mM to about 75 mM, and even more preferably about 20 mM to about 55 mM; and, the composition or sample comprises a ratio of the concentration of divalent metal cations to the concentration of divalent ion chelator in the composition or sample such that the concentration of free divalent metal cations present in the sample or composition is about ≦1 mM and the concentration of divalent ion chelator is about ≦10 mM; The divalent metal cation is preferably Mg 2+ or Mn 2+ and provided as an inorganic salt such as MgCl or MnCl, The divalent ion chelator is preferably EDTA or EGTA.
[0047] In a second aspect, there is provided a method for cleaving single-stranded RNA molecules in a sample, the method comprising: a. providing a sample containing at least one single-stranded RNA molecule containing a cleavage site for ToxN endoribonuclease; and b. contacting ToxN endoribonuclease or an enzymatically active fragment thereof with said at least one RNA molecule in said sample under conditions allowing cleavage of at least a portion of said RNA molecule present in said sample, wherein the concentration of a monovalent salt in said sample is about ≦150 mM, for example about ≦100 mM, and said monovalent salt is preferably an alkali metal salt.
[0048] In one embodiment of the second aspect, the single-stranded RNA molecule of step a) is a concatemer comprising multiple copies of any of a precursor of an mRNA, siRNA, circular RNA precursor, microRNA, or ribozyme, and the concatemeric RNA molecule comprises a cleavage site for ToxN endoribonuclease between each copy of the precursor of the mRNA, siRNA, circular RNA, microRNA, or ribozyme.
[0049] In one embodiment of the second aspect, the cleavage step is typically an incubation that allows cleavage of at least a portion of said RNA molecules present in said sample. In one embodiment of the second aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and its embodiments.
[0050] In one embodiment of the second aspect, the incubation is carried out at about 10°C to about 50°C, for example, about 10°C to 30°C, preferably about 15°C. In one embodiment of the second aspect, the incubation time that allows for cleavage of at least a portion of the RNA molecules present in the sample is from about 1 minute to about 2 hours, for example, from about 5 minutes to about 1.5 hours, for example, from about 15 minutes to about 1 hour.
[0051] In a third aspect, there is provided a method for preparing a single-stranded circular RNA molecule, the method comprising: a. providing a sample containing at least one single-stranded RNA molecule, said RNA molecule containing a cleavage site for ToxN endoribonuclease; b. contacting ToxN endoribonuclease with at least one single-stranded RNA molecule present in the sample under conditions that allow for at least partial digestion of the at least one RNA molecule, thereby producing at least one RNA molecule comprising a 3'-PO4 end and a 5'-OH end, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, e.g., about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. contacting at least one cleaved RNA molecule with RtcB ligase under conditions that allow ligation, thereby generating a circular RNA.
[0052] In one embodiment of the third aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and its embodiments. In a further embodiment, a method for synthesizing siRNA is provided, the method comprising: a. providing a sample containing at least one rolling-circle transcribed concatemeric RNA molecule containing cleavage sites for two different ToxN endoribonucleases, ToxN-A and ToxN-B, which have different recognition sites, wherein the recognition site for ToxN-B is located between the tandem repeats and the recognition sequence for ToxN-A is located within the tandem repeat; b. contacting the sample with ToxN-B endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample, thereby generating a single repeat sequence that forms a hairpin structure based on the sense-antisense sequence information; contacting the formed hairpin structure with a second ToxN-A enzyme that cleaves the RNA within the loop structure to form a double-stranded RNA molecule, wherein the concentration of the monovalent salt in the sample is about ≦150 mM, for example about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Removing the resulting overhang, which contains part of the ToxN recognition site, using a standard single-strand-specific ribonuclease, such as RNase T1, to generate double-stranded siRNA.
[0053] In an embodiment of the further aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and embodiments thereof. In a fourth aspect, there is provided a method for determining the 5'-capping efficiency of an RNA molecule, the method comprising: a. providing a sample comprising at least one single-stranded mRNA molecule, the at least one single-stranded mRNA molecule comprising a cleavage site for ToxN endoribonuclease in a 5' UTR of the mRNA; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecules to generate at least one 5'-end RNA fragment and at least one 3'-end RNA fragment, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, for example about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the RNA fragments from step b) and determining the presence of 5'-capping modifications at the 5' ends of said 5'-end RNA fragments.
[0054] In one embodiment of the fourth aspect, the 5'-terminal RNA fragment has a length of about 2 ribonucleotides to about 100 ribonucleotides, preferably 5 to 50, and more preferably 5 to 10.
[0055] In one embodiment of the fourth aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and its embodiments. In a fifth aspect, there is provided a method for determining the polyA tail length distribution of RNA molecules, the method comprising: a. providing a sample containing at least one single-stranded mRNA molecule, said sample containing a cleavage site for ToxN endoribonuclease upstream of the polyA tail of said mRNA; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecules to generate at least one 5'-end RNA fragment and at least one 3'-end RNA fragment, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, for example about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the RNA fragments from step b) and determining the length of the poly-A tail at the 3' end of said 3' end RNA fragments.
[0056] In one embodiment of the fifth aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and embodiments thereof. In a sixth aspect, there is provided a method of RNA fingerprinting, the method comprising: a. providing a sample containing at least one single-stranded RNA molecule having an unknown sequence; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the RNA molecules, thereby obtaining a plurality of RNA fragments, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, e.g., about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the fragmented RNA molecules from step b) to obtain a fingerprint of said RNA molecule having an unknown sequence, and comparing the obtained fingerprint with fingerprints of RNA molecules having known sequences.
[0057] In one embodiment of the sixth aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and its embodiments. In a seventh aspect, a method of analyzing a multivalent RNA composition is provided, the method comprising: a. providing a sample comprising a polyvalent RNA composition comprising a first RNA species and a second RNA species, wherein at least one position in each of the first RNA species and the second RNA species comprises a cleavage site for ToxN endoribonuclease; b. releasing a plurality of first and second RNA fragments from the first and second RNA species by contacting the sample from step a) with ToxN endoribonuclease under conditions that allow for cleavage of at least a portion of the first and second RNA species, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, e.g., about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the presence and / or amount of the released first and second RNA fragments.
[0058] In one embodiment of the sixth and seventh aspects, the RNA molecule is selected from an mRNA, an RNA virus, an immunogenic RNA molecule, a viroid, a long non-coding RNA, and a ribozyme.
[0059] In one embodiment of the above method, the separation and detection steps are based on the different molecular weight, charge, or length of the RNA fragments. In one embodiment of the above method, the separation and detection steps are selected from gel electrophoresis, capillary gel electrophoresis (CGE), PAGE, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, IP RP HPLC, and LC-UV.
[0060] In one embodiment of the seventh aspect, said compositions and samples comprising ToxN are compositions and samples as described in the first aspect and its embodiments. In an eighth aspect, there is provided a kit comprising: a. a composition according to the first aspect and embodiments thereof, and b. A second composition comprising a second enzyme selected from the group consisting of an RNA polymerase, an RNA ligase that ligates single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or other enzyme that modifies nucleic acids or ribonucleic acids, and at least one additional ToxN endoribonuclease that has a recognition site different from that of the ToxN endoribonuclease of a). A kit is provided comprising: [Brief explanation of the drawings]
[0061] [Figure 1] DNA sequence of ToxIN from Escherichia coli (gray shaded sequence) encoding the amino acid sequence of SEQ ID NO: 1, also referred to herein as ET-N1 (SEQ ID NO: 3); antitoxin repeat (sequence in black box) transcribed into ToxI (SEQ ID NO: 4); terminator (sequence in dotted line). [Figure 2] Profiling of ToxN (ET-N1) endoribonuclease activity: A: MW DNA ladder, B: 120 nM ToxN, C: 60 nM ToxN, D: 30 nM ToxN, E: 15 nM ToxN, F: 8 nM ToxN, G: 4 nM ToxN, H: 2 nM ToxN, I: 0 nM ToxN. [Figure 3] Profiling of ToxN (ET-N1) endoribonuclease activity: (1) 50 mM Tris-HCl pH 7.0, (2) 50 mM Tris-HCl pH 7.5, (3) 50 mM Tris-HCl pH 8.0, (4) 50 mM Tris-HCl pH 9.0, (A) MW DNA ladder, (B) control without ToxN, (C) 0 mM NaCl, (D) 25 mM NaCl, (E) 50 mM NaCl, (F) 75 mM NaCl, (G) 100 mM NaCl, (H) 125 mM NaCl, (I) 150 mM NaCl, (J) 175 mM NaCl. [Figure 4a] Profiling of ToxN (ET-N1) endoribonuclease activity: (A): MW DNA ladder, (B): no ToxN, (C): 0 mM MgCl2, (D): 1 mM MgCl2, (E): 2 mM MgCl2, (F): 3 mM MgCl2, (G): 4 mM MgCl2, (H): 5 mM MgCl2, (I): 6 mM MgCl2, (J): 7 mM MgCl2. [Figure 4b] Profiling of ToxN (ET-N1) endoribonuclease activity: Lanes 1–6: 10 mM MgCl2, 5 mM MgCl2, 3 mM MgCl2, 1 mM MgCl2, 0 mM MgCl2, no enzyme added; Lanes 7–12: 10 mM MnCl2, 5 mM MnCl2, 3 mM MnCl2, 1 mM MnCl2, 0 mM MnCl2, no enzyme added. [Figure 5]Profiling of ToxN (ET-N1) endoribonuclease activity: (A): MW DNA ladder, (B): No ToxN, (C): ToxN, (D): 5 mM MgCl2, (E): 5 mM EDTA, (F): 5 mM DTT 5 mM, (G): 5 mM MgCl2, 5 mM EDTA, (H): 5 mM MgCl2, 10 mM EDTA, (I): 5 mM MgCl2, 5 mM EDTA, 5 mM DTT, (J): 5 mM MgCl2, 10 mM EDTA, 5 mM DTT. [Figure 6] Profiling of ToxN (ET-N1) endoribonuclease activity: (A): MW DNA ladder, (B): no ToxN, (C): 5 min, (D): 10 min, (E): 15 min, (F): 20 min, (G): 30 min, (H): 40 min, (I): 50 min, (J): 60 min. [Figure 7] Profiling of ToxN (ET-N1) endoribonuclease activity: (A): MW DNA ladder, (B): no ToxN, (C): 6°C, (D): 7°C, (E): 10°C, (F): 13°C, (G): 17°C, (H): 22°C, (I): 27°C. [Figure 8] Profiling of ToxN (ET-N1) endoribonuclease activity: (A): MW DNA ladder, (B): No ToxN, (C): 25°C, (D): 25.2°C, (E): 26°C, (F): 27°C, (G): 29°C, (H): 31°C, (I): 33°C, (J): 33.6°C, (K): 34°C, (L): 35°C, (M): 35.7°C, (N): 36°C. [Figure 9a] This demonstrates the concept of using ToxN endoribonuclease to determine the 5' capping efficiency of mRNA transcripts. [Figure 9b]Capping analysis of a 40-nucleotide In Vitro Translated (IVT) construct prepared using the commercially available "CleanCap" kit is shown. The dark gray triangles indicate 13-nucleotide (uncapped) and 14-nucleotide (capped) fragments following cleavage with E. coli ToxN1. The additional bands marked with white triangles are due to shifts in RNA initiation. Lane 1: DNA ladder: bands 50, 20, 15, 8, and 6 bases; Lane 2: capped IVT cleaved with E. coli ToxN1; Lane 3: uncapped IVT cleaved with E. coli ToxN1; Lane 4: uncleaved capped IVT; Lane 5: uncleaved uncapped IVT. The plasmid was linearized with HindIII. The 40-nucleotide mRNA contains a ToxN1 (ET-N1) cleavage site 10 bases from the 5' end, generating two fragments of 13 and 27 bases, respectively. Successful capping was confirmed by a shift of the bands toward higher molecular weights. [Figure 9c] Capping analysis of IVT (In Vitro Translated) constructs is shown. Gel photograph (left): Lane 1: ET-N1 enzyme and uncapped RNA oligo (GEM3Zf); Lane 2: ET-N1 enzyme and capped RNA oligo (GEM3Zf); Lane 3: uncapped RNA oligo (GEM3Zf) without enzyme; Lane 4: capped RNA oligo (GEM3Zf) without enzyme. The gel photograph in the middle is an excerpt from the gel photograph on the left. The diagram on the right shows quantification of capped (<<, p1) and uncapped (p2) mRNA fragments. [Figure 9d] Capping analysis of IVT (In Vitro Translated) constructs is shown. Lane 1: ET-N1 enzyme and uncapped RNA oligo (GEM3Zf); Lane 2: ET-N1 enzyme and capped RNA oligo (GEM3Zf); Lane 3: uncapped RNA oligo (GEM3Zf) without enzyme; Lane 4: capped RNA oligo (GEM3Zf) without enzyme. [Figure 10a]The concept of mRNA fingerprinting of unknown virus strains in samples is illustrated. S1, S2, and S3: RNA samples isolated from three types of RNA viruses with uniquely different distributions of ToxN recognition sites. V: RNA sample isolated from an unknown RNA virus. Analysis of the fragment distribution by electrophoresis showed that the unknown virus (V) was a type (S2) virus. [Figure 10b] RNA fingerprinting by simultaneous digestion of two 20-nucleotide RNA substrates (MOD-UTR: GGGAA↓AUAAGAGAGAAAAGA-FAM and Dist1: GCCGAA↓AUAGUGACCCUGCA-FAM) is shown. The FAM-labeled products differ by a single nucleotide, resulting in 15-nucleotide and 14-nucleotide product bands, respectively. Lane 1: uncleaved MOD-UTR; lane 2: cleaved MOD-UTR; lanes 3-6: mixtures of MOD-UTR and Dist1 at ratios of 8:2, 6:4, 4:6, and 2:8; lane 7: cleaved Dist1; lane 8: uncleaved Dist1. Only the FAM-labeled product is visible. [Figure 10c] Based on the analysis of the band intensities of the FAM-labeled oligonucleotides in Figure 10b, the ratio of substrates in the mixture is shown. [Figure 11] This paper presents the concept of RNA production by rolling circle transcription (RCT): (1) a DNA plasmid for mRNA production, (2) a single-stranded plasmid, (3) initiation of RNA polymerase at the ToxN recognition site, (4) amplification of the RNA, and once the circular structure is completed, (5) this RNA continues to amplify the RNA, (6) a long-stranded RNA containing multiple copies of the target mRNA, and (7) the RNA is cleaved by the ToxN endoribonuclease to produce multiple copies of the mRNA. This process occurs simultaneously with the RNA polymerase, resulting in the constant production of new mRNA. [Figure 12]Figure 1 shows concatemeric RNA sequences transcribed by rolling circle transcription to generate siRNA. The transcribed sequences contain ToxN recognition sequences for two different ToxN enzymes, ToxN-A and ToxN-B. ToxN-B endoribonuclease digests the RNA between the two concatemeric RNA sequences. The concatemeric RNAs hybridize to form a hairpin structure. ToxN-A enzyme cleaves the RNA at its recognition site in the hairpin loop, and the 5' and 3' ends of the concatemeric RNA are digested with single-strand-specific RNases to remove the remaining ToxN recognition sequences, resulting in the generation of siRNA. [Figure 13] IVT-generated concatemers of the Mango aptamer digested with EcoToxN1 (ET-N1) at decreasing enzyme concentrations are shown: Lane 1: no enzyme, Lane 2: 95 nM EcoToxN1, Lane 3: 47 nM, Lane 4: 23 nM, Lane 5: 12 nM, Lane 6: 6 nM, Lane 7: 2 nM, Lane 8: 1 nM. [Figure 14] Profiling of EcoToxN1 (ET-N1), EcoToxN5 (ET-N5), and BtuToxN (BT-N1) endoribonuclease activity. Lane 1: RNA oligo ladder; Lane 2: ET-N1 and Q1 RNA oligo containing the ET-N1 recognition site; Lane 3: Q1 RNA oligo without enzyme; Lane 4: RS2 RNA oligo containing ET-N5 and ET-N5 recognition sites; Lane 5: RS2 RNA oligo without enzyme; Lane 6: RS3 RNA oligo containing ET-N5 and ET-N5 recognition sites; Lane 7: RS3 RNA oligo without enzyme; Lane 8: UTR sequence without the ET-N5 recognition site; Lane 9: UTR sequence without enzyme; Lane 10: RS3 RNA oligo with the BT-N1 recognition site; Lane 11: RS3 oligo without enzyme. DETAILED DESCRIPTION OF THE INVENTION
[0062] Detailed Description Unless otherwise defined herein, all technical and scientific terms used have the same meaning as commonly understood by one skilled in the art of genetics, biochemistry, and molecular biology.
[0063] Where a numerical limit or range is recited herein, the endpoints are included, and all values and sub-ranges within a numerical limit or range are specifically included as if expressly written.
[0064] All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and suitable methods and materials are described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0065] In the following description, various examples and embodiments of the present invention are presented to enable those skilled in the art to more fully understand the present invention. Specific details described in the context of various embodiments and with reference to the accompanying drawings are not intended to be construed as limiting.
[0066] Definition: " Polyribonucleotides " refers to the polymeric form of ribonucleotides. In some embodiments, a polyribonucleotide is composed exclusively of ribonucleotides. In other embodiments, a polyribonucleotide comprises ribonucleotides and one or more modified ribonucleotides, but no deoxyribonucleotides. In other cases, a polyribonucleotide may comprise ribonucleotides, one or more modified ribonucleotides, and one or more deoxyribonucleotides (including modified deoxyribonucleotides).
[0067] " Ribonucleic Acid ”, RNA, and the terms “polyribonucleotide” are used interchangeably to refer to polymeric forms of ribonucleotides of any length. " isolated" refers to a protein or nucleic acid that, if naturally occurring, is in an environment that is different from that in which it may naturally occur. "Isolated" refers to a protein or nucleic acid in which the protein or nucleic acid of interest has been substantially enriched and / or is in a sample from which the protein or nucleic acid of interest has been partially or substantially purified. If the protein or nucleic acid is not naturally occurring, "isolated" indicates that the protein or nucleic acid has been separated from the environment in which it was produced by synthetic or recombinant means.
[0068] endoribonuclease The endoribonucleases described in this patent application cleave single-stranded RNA. "RNA digestion" or "RNA cleavage" The terms are used interchangeably and refer to the hydrolysis of phosphodiester bonds within the polyribonucleotide backbone in a sample.
[0069] The method of RNA digestion involves contacting a sample containing single-stranded RNA with ToxN endoribonuclease under conditions that allow for at least partial digestion of the single-stranded RNA present in the sample. ToxN endoribonuclease is sequence-specific and completely digests polyribonucleotides at the target site for a time and under reaction conditions sufficient for the enzyme to function. Digestion of at least a portion of the single-stranded RNA present in the sample can be numerically expressed as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. Alternatively, 100% of the single-stranded RNA present in the sample is digested. That is, all RNA molecules present in the sample are completely digested at the target site.
[0070] Endoribonucleases may cleave sequences similar to their target recognition sequences. This nonspecific activity is called " Star ActivityStar activity is called "star activity" and should be avoided if possible. It results from the recognition and cleavage of a secondary cleavage site in addition to the primary cleavage site. The secondary cleavage site differs from the primary recognition site by one or more ribonucleotides. Star activity is characterized by the appearance of additional bands on gel electrophoresis in addition to the band pattern of complete digestion resulting from specific cleavage.
[0071] " contact The terms "," "contacting," "applying to," "applying," "adding to," and "adding" have their ordinary meanings and are used interchangeably herein. The present invention also encompasses terms, features, values, ranges, etc. used in combination with terms such as about, in the vicinity of, approximately, substantially, essentially, at least, etc., to the exact term, feature, value, range, etc. (i.e., "about 3" also encompasses the exact 3, and "essentially not having" also encompasses "not having / none").
[0072] " At least one The term "one or more" should be understood to mean "one or more," and therefore includes both embodiments containing one or more components. ToxN is a family of endoribonucleases from the ToxIN subfamily of the Type III toxin-antitoxin (TA) system. The toxin (ToxN) is a protein / enzyme, and the antitoxin (ToxI) consists of multiple repeats of RNA. The ToxN endoribonuclease described herein contains the pFam domain PF13958. The toxic effects of this protein are neutralized by a specific antitoxin RNA sequence (ToxI). The toxin combines with individual antitoxin repeats to form a circular complex in which the antitoxin forms a pseudoknot structure. This RNA antitoxin tightly binds to the toxin, forming a unique, self-closed, circular, heterotetrameric or heterohexameric RNA-protein complex. In this complex, the toxin and antitoxin alternate in a 1:1 ratio, forming the ToxIN complex. The structural identification and functional characteristics of the ToxN-antitoxin (RNA) complex from E. coli are described in Manikandan, P. et al., Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E. coli, Nucleic acid research, 2022, vol. 50, no. 3, pp. 1687-1700.
[0073] "ToxN" (endoribonuclease), "ToxI" (antitoxin RNA molecule / inhibitor of ToxN) and "ToxIN" (heteromeric protein / RNA complex of ToxN and ToxI).
[0074] The DNA sequence (NCBI accession number: PDB:7D8O_A) encoding the ToxN endoribonuclease from Escherichia coli, which is neutralized by the RNA antitoxin ToxI and forms an inactive ToxIN complex with it, is shown in Figure 1 and SEQ ID NO:3.
[0075] The number of ribonucleotides in the recognition sequence of the ToxN endoribonuclease can vary. The recognition sequence can be 2 to 20 ribonucleotides. Preferably, the recognition sequence is 3 to 15 ribonucleotides, more preferably 4 to 10 ribonucleotides, 4 to 9 ribonucleotides, or 4 to 6 ribonucleotides.
[0076] Non-limiting examples of ToxN endoribonucleases containing pFam domain PF13958 and their recognition sequences are shown in Table 1 below.
[0077] [Table 1]
[0078] The Type III toxin-antitoxin system includes at least three enzyme subfamilies: the CptIN subfamily and the TenpIN subfamily. See Blower, TR et al., "Identification and classification of bacterial Type III toxin-antitoxin systems encoding in chromosomal and plasmid genomes," Nucleic acid research, 2012, Vol. 40, No. 13, pp. 6158-6173.
[0079] The endoribonuclease disclosed by the sequence CBK89509.1 does not belong to the ToxN subfamily according to the pFam classification. CBK89509.1 is classified in the CptIN subfamily, an alternative subfamily of type III TA systems.
[0080] [Table 2]
[0081] As described above, the present inventors have unexpectedly demonstrated for the first time that the sequence-specific endoribonuclease ToxN derived from a type III toxin-antitoxin system specifically cleaves single-stranded RNA at its recognition site in the presence of specific concentrations of monovalent salt, i.e., the nonspecific catalytic activity of the enzyme (also called "star activity") is reduced or eliminated at specific concentrations of monovalent salt.
[0082] The inventors have also unexpectedly found that the presence of Mg in the composition or sample 2+ or Mn 2+ We have found for the first time that the nonspecific catalytic activity, i.e., star activity, of ToxN is reduced or eliminated when divalent metal cations, such as Mg2+ or Mn2+, are present in a composition or sample at low or no concentrations. Free divalent cations are understood to be cations that are not bound to divalent ion chelators, such as EDTA or EGTA. ToxN catalytic activity is also inhibited by divalent cations exceeding a certain concentration. Without being bound by theory, it is believed that divalent metal cations, such as Mg2+ or Mn2+, present in a composition or sample bind to RNA, thereby inhibiting ToxN from accessing its target site.
[0083] The inventors have also unexpectedly shown that it is not necessary to remove divalent metal cations from compositions or samples containing ToxN endoribonucleases; rather, sequence-specific catalytic activity can be maintained by divalent cation chelators such as EDTA or EGTA.
[0084] " in the context of divalent ion chelators Substantially free of divalent metal cations " means that the ratio of the concentration of divalent cations, preferably Mg2+ or Mn2+, in the sample to the concentration of a divalent ion chelator, such as EDTA or EGTA, is 3:1 to 1:10 (e.g., Mg 2+ or Mn 2+ : EDTA or EGTA), which means that the ToxN enzyme can tolerate low concentrations of divalent metal cations that are not bound to a divalent ion chelator present in a sample without losing catalytic activity.
[0085] This includes those used in upstream applications and containing Mg for optimal enzyme activity. 2+ or Mn 2+ Advantageously, enzymes that require divalent metal cations, such as ATP, can be inactivated by the addition of a divalent ion chelator such as EDTA or EGTA, after which a purification step may not be required before adding ToxN (as ToxN catalytic activity and specificity is maintained in the essential absence of free divalent cations in the composition or sample, i.e., divalent cations not bound to a divalent ion chelator).
[0086] A further advantage is that the catalytic activity and specificity of the ToxN enzyme is not significantly affected by the presence of divalent ion chelators, such as EDTA or EGTA, and therefore it may not be necessary to remove EDTA or EGTA present in the sample.
[0087] The composition containing isolated ToxN does not contain the ToxIN complex. A composition or sample comprising an isolated ToxN endoribonuclease or an enzymatically active fragment of ToxN may be free of monovalent salts.
[0088] A composition or sample comprising an isolated ToxN endoribonuclease or an enzymatically active fragment of ToxN may be free of free divalent metal cations. The ToxN endoribonuclease can be a ToxN endoribonuclease from E. coli or an enzymatically active fragment thereof.
[0089] The expression "enzymatically active fragments thereof" of ToxN endoribonuclease is understood to mean truncated forms of ToxN endoribonuclease in which the catalytic activity of the endoribonuclease is maintained. Example 3 provides a suitable assay for measuring endoribonuclease activity.
[0090] The ToxN endoribonuclease is preferably ToxN having the amino acid sequence of SEQ ID NO: 1 (NCBI Acc. No.: PDB:7D8O_A) or an amino acid sequence that is at least about 70% identical to SEQ ID NO: 1. An example of a sequence that has at least 70% sequence identity to SEQ ID NO: 1 is the sequence of SEQ ID NO: 6. SEQ ID NO: 6 has 81.4% sequence identity to SEQ ID NO: 1.
[0091] The ToxN endoribonuclease can be a ToxN having the amino acid sequence of SEQ ID NO: 1 (NCBI Acc. No.: PDB:7D8O_A) or an amino acid sequence that is at least about 30% identical to SEQ ID NO: 1. Examples of sequences that have at least 30% sequence identity to SEQ ID NO: 1 are the sequences of SEQ ID NO: 7 (30.95% identity), SEQ ID NO: 8 (32.5% identity), and SEQ ID NO: 13 (40.88% identity).
[0092] The ToxN endoribonuclease may be a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein ToxN comprises an amino acid sequence that is at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 98%, or 99% identical to SEQ ID NO:1.
[0093] By "at least about 30%" it is meant that the sequence identity can be at least 29%, 29.5%, or 29.9% to SEQ ID NO:1. By "at least about 70%" it is meant that the sequence identity can be at least 69%, 69.5%, or 69.9% to SEQ ID NO:1.
[0094] The ToxN endoribonuclease may consist of the amino acid sequence of SEQ ID NO: 1. Enzymatically active fragments thereof are also provided. An endoribonuclease having an amino acid sequence that is at least 30% identical to SEQ ID NO: 1 can be obtained from a prokaryote.
[0095] An endoribonuclease having an amino acid sequence that is at least 70% identical to SEQ ID NO: 1 can be obtained from a prokaryote. Thus, in another aspect, there is provided a composition comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, said ToxN endoribonuclease comprising: (a) SEQ ID NO: 6 or an amino acid sequence at least 70% identical thereto; (b) SEQ ID NO: 7 or an amino acid sequence at least 70% identical thereto; (c) SEQ ID NO: 8 or an amino acid sequence at least 70% identical thereto; or (d) SEQ ID NO: 13 or an amino acid sequence at least 70% identical thereto. The amino acid sequence is selected from
[0096] In one embodiment, the ToxN endoribonuclease has an amino acid sequence that is at least 75%, preferably at least 80%, 85%, 90%, or 95%, such as at least 98%, 99%, or 99.5%, identical to SEQ ID NO: 1, 6, 7, 8, or 13. In other embodiments, the ToxN endoribonuclease consists of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, 6, 7, 8, and 13. Enzymatically active fragments thereof are also provided.
[0097] Variants of SEQ ID NOs: 1, 6, 7, 8, and 13 include amino acid sequences in which one or more amino acids of said amino acid sequences have been conservatively substituted. Preferably, such substitutions are silent, in that the modified form of the ToxN endoribonuclease of the invention has the same enzymatic activity as the unmodified form.
[0098] In this application, when referring to "sequence identity" of a protein, an amino acid sequence having at least x% identity with a second amino acid sequence means that x% represents the number of amino acid residues in the first sequence that are identical to the corresponding amino acid residues in the second sequence, over the entire length of the second amino acid sequence, when both sequences are optimally aligned by global alignment. Both sequences are optimally aligned when x is maximum, using the EMBL-EBI multiple protein sequence alignment tool Clustal Omega with default settings.
[0099] Preferably, the composition is a solution, preferably an aqueous solution. solution " refers to a liquid mixture in which one or more minor components (solutes) are uniformly distributed within a major component (solvent).
[0100] Usually, the minor component of a solution (the solute) is soluble in the major component (the solvent). Preferably, the major component, i.e., the solvent, i.e., the liquid phase, is water. Preferably, the solution comprises water. The solution of the present invention comprises at least ToxN endoribonuclease or an enzymatically active fragment thereof as a minor component.
[0101] In a preferred embodiment, the solution is a reagent for application to a sample containing one or more RNA molecules. Such a reagent is applied to the sample to digest the one or more ribonucleotides present in the sample with the ToxN endoribonuclease in the reagent. Preferably, the sample contains a plurality of ribonucleotides. In this embodiment, the solution comprises ToxN endoribonuclease or an enzymatically active fragment thereof.
[0102] The term "sample" refers to a composition containing single-stranded RNA molecules. The composition also includes a buffer. Suitable buffers are well known in the art, and any such buffer can be used. Identifying a suitable buffer is within the capabilities of one skilled in the art.
[0103] The buffer has a buffering range of about pH 5.5 to about pH 9, preferably about pH 6.5 to about pH 9, preferably about pH 7 to about pH 9, more preferably about pH 7 to about pH 8.5. The buffer may be Tris, HEPES, or a phosphate buffer. Preferably, the buffer is present in the composition or sample at a concentration of 1 mM to 200 mM, preferably 10 mM to 200 mM, preferably 20 mM to 150 mM, more preferably 25 mM to 100 mM.
[0104] When present, Tris-HCl is preferably present at a concentration of 25 mM to 150 mM, more preferably 40 mM to 100 mM, and even more preferably about 50 mM. The sample may have a volume of >0.1 μl. Preferably, the sample of the present invention has a volume of about 0.1 μl to about 500 μl, for example, about 0.1 μl to about 300 μl, for example, about 0.1 μl to about 250 μl, for example, about 0.1 μl to about 200 μl, for example, about 0.1 μl to about 150 μl, for example, about 0.1 μl to about 100 μl, for example, about 0.1 μl to about 75 μl, for example, about 0.1 μl to about 50 μl.
[0105] Those skilled in the art can determine the appropriate concentration of enzyme to include in the sample and reaction mixture, preferably to digest all RNA molecules in the sample while avoiding non-specific digestion and star activity.
[0106] The reaction mixture may contain additional components that may be present due to addition earlier in the workflow and that are tolerated in the reaction assay, such as DTT, nucleotides, S-adenosylmethionine (SAM), or other enzymes. DTT is a reducing agent that stabilizes disulfide bonds within enzymes, thereby stabilizing the enzyme structure.
[0107] As mentioned above, compositions or samples containing ToxN endoribonuclease or enzymatically active fragments thereof preferably contain a particular concentration of a monovalent salt. The monovalent salt present in the composition or sample can be selected from inorganic salts containing alkali metal ions, where the alkali metal ions are selected from Na+, K+, Li+, Rb+, Cs+, and Fr+, or any combination thereof.
[0108] Thus, preferably the monovalent salt is an alkali metal salt. Preferably, the alkali metal ion of the salt is selected from Na+, K+, Li+, and Rb+.
[0109] The anion of the salt containing an alkali metal ion is preferably selected from fluorine (F), chlorine (Cl), bromine (Br), iodine (I), sulfate, phosphate, or hydroxide, or any suitable combination thereof.
[0110] Preferably, the alkali metal salt is NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, sodium phosphate, potassium phosphate, or any suitable combination.
[0111] Thus, preferably, a composition or sample comprising a particular concentration of monovalent salt refers herein to a composition or sample comprising a concentration of monovalent salt of ≦150 mM. The term "about ≦X mM" is equivalent to "0 to about X mM."
[0112] The composition or sample may be free of monovalent salts. Thus, in one aspect, a composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof comprises an alkali metal salt at a concentration of <150 mM, about ≦100 mM, about ≦75 mM, about ≦55 mM, about 20 mM to about 75 mM, or about 20 mM to about 55 mM in the composition or sample.
[0113] As noted above, a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof may be essentially free of free divalent metal cations, i.e., the composition or sample may contain low concentrations of divalent metal cations, which, as used herein, refers to divalent metal cations that are not bound to a divalent cation chelator, such as EDTA or EGTA.
[0114] Thus, the composition or sample may contain free divalent metal cations at a concentration of about ≦3 mM. The composition or sample may be free of free divalent metal cations.
[0115] The free divalent cation is preferably Mg 2+ and Mn 2+ is selected from. The composition or sample contains free Mg 2+ It may not include. The composition or sample contains free Mn 2+ It may not include.
[0116] Preferably, the free Mg in the composition and sample 2+ and / or free Mn 2+ is at a concentration of about ≦2 mM, more preferably about ≦1 mM. The composition or sample containing ToxN endoribonuclease or an enzymatically active fragment thereof may contain free Mg at a concentration ranging from 0 to about 1 mM, from about 1 μM to about 1 mM, from about 1 μM to about 0.9 mM, from about 1 μM to about 0.8 mM, from about 1 μM to about 0.7 mM, from about 1 μM to about 0.6 mM, or from about 1 μM to about 0.5 mM. 2+ and / or Mn 2+ may include:
[0117] A composition or sample comprising ToxN endoribonuclease or an enzymatically active fragment thereof may comprise a ratio of the concentration of divalent metal cations to the concentration of divalent ion chelator in the composition or sample such that the maximum concentration of free divalent cations, i.e., divalent cations not bound to the divalent ion chelator, in the composition or sample is 3 mM or less, preferably 2 mM or less, and more preferably 1 mM or less.
[0118] A composition or sample containing ToxN endoribonuclease or an enzymatically active fragment thereof may contain free Mg at a concentration ranging from 0 to about 3 mM in the composition or sample. 2+ may include: A composition or sample containing ToxN endoribonuclease or an enzymatically active fragment thereof may contain free Mn at a concentration ranging from 0 to about 1 mM in the composition or sample. 2+ may include:
[0119] A composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof may contain a divalent ion chelator at a concentration of about ≦10 mM. The divalent ion chelator is preferably EDTA or EGTA.
[0120] For solubility reasons, compositions and samples containing divalent metal cations are preferably added as divalent salts, i.e., salts in which at least one of the counterions is divalent, such as MgCl or MnCl. The salts are preferably inorganic.
[0121] Inorganic salts are salts in which neither counterion contains carbon. The monovalent or divalent salts are preferably inorganic salts. Preferably, the compositions and samples include a monovalent salt, and preferably also include a monovalent anion as a counterion. The preferred concentrations of the monovalent salt disclosed herein are essentially the preferred concentrations of the monovalent counterion, and vice versa.
[0122] Thus, there is provided herein a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein said ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as 70% identical, to SEQ ID NO: 1; The concentration of the monovalent salt in the composition or sample is about ≦100 mM, about ≦75 mM, about ≦55 mM, about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM.
[0123] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 70% identical to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is about ≦100 mM, about ≦75 mM, about ≦55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM; The composition or sample is essentially free of free divalent metal cations, said divalent metal cations being preferably Mg2+ or Mn2+, said divalent metal cations being provided as inorganic salts such as MgCl2 or MnCl2.
[0124] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as at least 70% identical, to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is about ≦100 mM, about ≦75 mM, about ≦55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM; The concentration of free divalent metal cations is about ≦1 mM, and the divalent metal cations are preferably Mg 2+ or Mn 2+ wherein the divalent metal cation is provided as an inorganic salt such as MgCl or MnCl.
[0125] Also provided is a composition or sample comprising a ToxN endoribonuclease or an enzymatically active fragment thereof, wherein the ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or comprises an amino acid sequence that is at least 30% identical, such as at least 70% identical, to SEQ ID NO: 1; the concentration of the monovalent salt in the composition or sample is about ≦100 mM, about ≦75 mM, about ≦55 mM, preferably about 20 mM to about 75 mM, preferably about 20 mM to about 55 mM; the composition or sample comprises a ratio of the concentration of divalent metal cations to the concentration of divalent ion chelator in the composition or sample such that the concentration of free divalent metal cations present in the sample or composition is about ≦1 mM and the concentration of the divalent ion chelator is about ≦10 mM; The divalent metal cation is preferably Mg 2+ or Mn 2+ and provided as an inorganic salt such as MgCl or MnCl, The divalent ion chelator is preferably EDTA or EGTA.
[0126] As explained above, the free Mg in the sample 2+ or Mn 2+ is shown herein as not bound to EDTA or EGTA. Thus, for example, the ratio of the concentration of divalent metal cations to the concentration of divalent ion chelator in a composition or sample can be, for example, 2 mM:1 mM, 5 mM:5 mM, 5 mM:10 mM, 10 mM:10 mM, etc., or any other alternative ratio combination, so long as the concentration of free divalent metal cations in the composition or sample is about ≦1 mM and the concentration of divalent ion chelator is preferably about ≦10 mM.
[0127] Preparation of the ToxN endoribonuclease of the present invention Methods for preparing ToxN endoribonuclease are described in Manikandan, P. et al., Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E. coli, Nucleic acid research, 2022, vol. 50, no. 3, pp. 1687-1700, and further described in Example 1.
[0128] ToxN endoribonucleases and enzymatically active fragments thereof, or nucleic acid molecules encoding the endoribonucleases, can be isolated from natural sources such as bacteria, e.g., Escherichia coli, Pectobacterium atrosepticum, Bacillus thuringiensis subsp. Kurstaki, Lactococcus lactis subsp. lactis, or Eubacterium rectale.
[0129] Alternatively, the enzyme may be recombinantly produced in, isolated and purified from, a host cell, where the host cell is not, or is not derived from, an organism that naturally expresses the gene encoding the ToxN endoribonuclease, i.e., the host cell is a heterologous host cell such as a yeast cell, an insect cell, a human cell line, or a bacterial cell, preferably E. coli.
[0130] Nucleic acid sequences encoding the ToxN endoribonuclease or enzymatically active fragments thereof according to the invention can be amplified from genomic DNA using PCR and isolated as cDNA or ordered from suppliers such as GENEWIZ, Thermo Fisher Scientific's GeneArt, or Genscript.
[0131] As described above, nucleic acid sequences encoding ToxN endoribonuclease or enzymatically active fragments thereof can be codon-optimized for increased protein production in heterologous host cells. Various software programs that assist in codon optimization are well known in the art. CodonW is one example of an open-source software program that can be used. Preferably, the GeneOptimizer algorithm described by Raab, D., Graf, M., Notka, F., Schoedl, T., and Wagner, R. (2010), The GeneOptimizer Algorithm: Using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization. Systems and Synthetic Biology, 4(3), 215-225, is used to generate codon-optimized DNA sequences for expressing ToxN endoribonuclease in E. coli host cells.
[0132] A variety of molecular techniques are available for expressing proteins from DNA sequences by heterologous expression in a variety of host cell systems using well-known recombinant gene expression systems. For example, a nucleic acid molecule encoding a ToxN endoribonuclease or an enzymatically active fragment thereof can be inserted into an appropriate expression vector that contains the necessary transcription and translation elements for expression appropriate for the selected host cell. Examples of commonly used expression vectors include plasmids and viruses.
[0133] To ensure reliable transcription of the gene of interest, the expression vector can contain a strong promoter; bacteriophage T5 and T7 are examples of strong promoters for expression in E. coli. The promoter can be controlled by incorporating a chemical switch. Examples of inducible promoters used in E. coli include the commonly used lac promoter, which is induced by isopropyl-beta-D-thiogalactoside (IPTG) (Hansen LH, Knudsen S, Soerensen SJ, "The effect of the lacY gene on the induction of IPTG-inducible promoters, studied in Escherichia coli and Pseudomonas fluorescens," Curr. Microbiol. 1998, 36(6):341-7), or the XylS / Pm expression cassette containing a toluic acid-inducible promoter (Gawin, A. et al., "The XylS / Pm regulator / promoter system and its use in fundamental studies of bacterial gene expression, recombinant protein production, and metabolic engineering," Microb. Biotechnol., 2017, Vol. 10, No. 4, pp. 702-718). The XylS / Pm regulator / promoter system from Pseudomonas putida is widely used to control low- and high-level recombinant expression of genes and gene clusters in Escherichia coli and other bacteria.
[0134] A further aspect of the present invention is a method for expressing the ToxN endoribonuclease or an enzymatically active fragment thereof as described above in a suitable heterologous cell. The host cell may be a bacterial or yeast cell. Preferably, expression of the enzyme is in a bacterial host cell, more preferably in E. coli, BL21(DE3) cells.
[0135] Transformation of the above expression vector containing the ToxN endoribonuclease can be carried out by methods well known to those skilled in the art, for example by using chemically competent cells.
[0136] As mentioned above, the ToxN endoribonuclease can be synthesized using recombinant DNA technology. Alternatively, the endoribonuclease can be produced using a cell-free expression system or chemically synthesizing the ToxN endoribonuclease.
[0137] The ToxN endoribonuclease enzyme containing the signaling peptide secreted into the cell culture medium can be isolated and purified from the host cell culture medium using any technique known in the art and well documented, including, but not limited to, precipitation, ultrafiltration, various chromatographic techniques such as size exclusion chromatography, immobilized metal affinity column chromatography, and / or immunoadsorption chromatography.
[0138] Intracellularly produced ToxN endoribonuclease can also be isolated and purified using techniques well known to those skilled in the art. Examples of methods for preparing cell lysates from E. coli cells include homogenization, sonication, or enzymatic lysis using lysozyme. After the ToxN endoribonuclease is released from the lysed cells, the enzyme can be subjected to any purification method, such as size exclusion chromatography, immobilized metal affinity column chromatography, and / or immunoadsorption chromatography.
[0139] The ToxN endoribonuclease may contain a C-terminal or N-terminal His tag to facilitate isolation, purification, and / or identification of the enzyme. An N-terminal polyhistidine-tagged ToxN endoribonuclease is shown in SEQ ID NO:2.
[0140] The purified ToxN endoribonuclease or enzymatically active fragment thereof can ultimately be stored in a buffer. The purified ToxN endoribonuclease enzyme or an enzymatically active fragment thereof can ultimately be stored in an appropriate buffer. Suitable buffers for storing ToxN endoribonuclease are known to those skilled in the art.
[0141] The ToxN enzyme has been found to be particularly stable when stored in a buffer containing about 100 mM to about 500 mM of a monovalent salt, which can be selected from NaCl, HCl ... Preferably, the alkali metal ion of the salt is selected from Na+, K+, Li+, and Rb+.
[0142] The anion of the salt containing an alkali metal ion is preferably selected from fluorine (F), chlorine (Cl), bromine (Br), iodine (I), sulfate, phosphate, or hydroxide, or any suitable combination thereof.
[0143] Preferably, the alkali metal salt is NaCl, KCl, Na2SO4, K2SO4, KOH, NaOH, sodium phosphate, potassium phosphate, or any suitable combination.
[0144] Kit containing ToxN endoribonuclease The compositions and samples of the present invention comprise endoribonucleases that are not inhibited by the presence of divalent ion chelators, which are often added to enzymatic reactions to halt the catalytic activity of the enzyme. Accordingly, ToxN endoribonucleases can be advantageously utilized in a variety of molecular biology techniques that previously employed other enzymes. Such methods are described in more detail below. Accordingly, in a further aspect, i) a composition comprising a ToxN endoribonuclease as defined above, and ii) a second composition comprising a second enzyme selected from the group consisting of an RNA polymerase, an RNA ligase for ligating single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or other nucleic acid- or ribonucleic acid-modifying enzyme, and at least one further ToxN endoribonuclease having a recognition site different from the ToxN endoribonuclease of a).
[0145] The second enzyme may be another ToxN endoribonuclease having a different recognition site than the ToxN enzyme mentioned under i). Kits containing ToxN endoribonuclease may include appropriate buffers for carrying out the digestion of RNA.
[0146] Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above. Methods for cleaving single-stranded RNA The enzymatic activity of ToxN endoribonucleases makes such enzymes particularly suitable for use in methods involving cleavage of single-stranded RNA.
[0147] Different ToxN endoribonucleases cleave single-stranded RNA molecules at different recognition sites. Thus, in one embodiment, a composition comprising ToxN endoribonuclease can be a solution for application to a sample, the sample comprising at least one isolated single-stranded RNA molecule comprising at least one cleavage site for the ToxN endoribonuclease.
[0148] In a further aspect, a method for cleaving single-stranded RNA molecules in a sample is provided, the method comprising: a. providing a sample comprising at least one single-stranded RNA molecule comprising at least one cleavage site for ToxN endoribonuclease; and b. contacting the sample with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample.
[0149] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above. Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above.
[0150] The digestion step is typically an incubation step, as described above and in the Examples. Suitable incubations include incubation at about 10°C to about 50°C, e.g., about 10°C to 30°C, preferably about 15°C, for 1 minute to about 2 hours, e.g., about 5 minutes to about 1.5 hours, e.g., about 15 minutes to about 1 hour.
[0151] The single-stranded RNA molecules in the sample may be concatemers containing multiple copies of any of the following precursors: mRNA, siRNA, circular RNA, precursor, microRNA, or ribozyme, and the concatemeric RNA molecules contain a cleavage site for ToxN endoribonuclease between each copy of the mRNA, siRNA, circular RNA, microRNA, or ribozyme precursor.
[0152] Methods for preparing circular RNA molecules The 5' and 3' ends of the RNA generated by ToxN can be utilized by subjecting the RNA to the RtcB ligase reaction. This reaction ligates the 3'-PO4 end and the 5'-OH end of the RNA, resulting in a circular RNA. The mechanism for creating circular RNA using RtcB ligase is described in Tanaka, N. et al., "Novel mechanism of RNA repair by RtcB via sequential 2',3'-cyclic phosphodiesterase and 3'-phosphate / 5'-hydroxyl ligation reactions," J. Biol. Chem., 2011, vol. 286, no. 50, pp. 43134-43143.
[0153] In a further aspect, a method is provided for preparing single-stranded circular RNA molecules present in a sample, the RNA molecules comprising a cleavage site for ToxN endoribonuclease, by contacting the RNA molecules with ToxN endoribonuclease under conditions allowing digestion of at least a portion of the RNA molecules present in the sample to produce RNA molecules comprising a 3'-PO4 end and a 5'-OH end, and by contacting the digested RNA molecules with RtcB ligase under conditions allowing ligation to produce the circular RNA.
[0154] A method for preparing multiple copies of RNA by rolling circle transcription (RCT) Rolling circle transcription (RCT), which uses small circular single-stranded DNA as a template, has been well studied over the past two decades. Interestingly, transcription by the rolling circle mechanism is achieved using T7 RNA polymerase, but it can also occur in the absence of a specific canonical promoter, generating transcripts that are tandemly repeated sequences complementary to the circular template. The use of RNase H (Wang et al., Preparation of small RNAs using rolling circle transcription and site-specific RNA disconnection, Molecular Therapy - Nucleic Acids, 2015, e215) or ribozymes (WO 2020 / 023741) has been reported in the literature.
[0155] By adapting this method for the use of the site-specific ToxN endoribonuclease, the method is simplified and does not require the use of RNase H and helper DNA fragments, or synthetic ribozymes or ribozymes encoded in the transcript.
[0156] Thus, in a further aspect, there is provided a method for synthesizing RNA by rolling circle transcription (RCT), as outlined in Figure 11. The method comprises: providing a single-stranded DNA plasmid comprising a sequence encoding an RNA recognition site for ToxN endoribonuclease, optionally adjacent to a recognition site (also called a promoter) for an RNA polymerase; · RNA amplification step; Once the cycle is complete, RNA polymerase continues amplifying the RNA, forming long strands containing multiple copies of the RNA of interest; This involves the production of multiple copies of RNA by cleaving the RNA with ToxN. This process can occur simultaneously with RNA polymerase, resulting in the production of new RNA all the time.
[0157] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above. Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above.
[0158] Methods for preparing double-stranded siRNA Small interfering RNA (siRNA), also known as short interfering RNA or silencing RNA, is a type of double-stranded RNA typically 20-24 base pairs in length, usually around 21 base pairs, similar to miRNA. siRNA functions within the RNA interference (RNAi) pathway, interfering with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription, thereby inhibiting translation.
[0159] In a further aspect, a method for synthesizing siRNA is provided, the method comprising: a. providing a sample containing at least one rolling-circle transcribed concatemeric RNA molecule containing cleavage sites for two different ToxN endoribonucleases, ToxN-A and ToxN-B, which have different recognition sites, wherein the recognition site for ToxN-B is located between the tandem repeats and the recognition sequence for ToxN-A is located within the tandem repeat; b. contacting the sample with ToxN-B endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the RNA molecules present in the sample, thereby generating a single repeat sequence that forms a hairpin structure based on the sense-antisense sequence information; contacting the formed hairpin structure with a second ToxN-A enzyme that cleaves the RNA within the loop structure to form a double-stranded RNA molecule; and c) Removing the resulting overhang, which contains part of the ToxN recognition site, using a standard single-strand-specific ribonuclease, such as RNase T1, to generate double-stranded siRNA. This method is shown in Figure 12.
[0160] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above. Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above.
[0161] Methods for analyzing RNA modifications The ToxN endoribonuclease family is extremely useful for RNA analysis, especially for long modified RNA molecules that need to be cleaved into fragments to aid in the analysis of RNA modifications.
[0162] Similar to the well-known DNA endoribonuclease enzymes commonly used in in vitro molecular cloning methods of double-stranded DNA, the ToxN endoribonuclease family is a group of enzymes that cleave single-stranded RNA at specific recognition sequences without the need for complexes with guide RNAs, ribozymes, or DNA probes.
[0163] 5'-capping of synthetically produced mRNA is important for efficient translation of that mRNA into functional proteins or peptides in the body. However, it is known that RNA capping during mRNA production is an incomplete process, and a portion of the produced mRNA remains uncapped. The completeness of capping can be assessed by methods such as LC-MS, IP RP HPLC, and gel electrophoresis such as PAGE and capillary gel electrophoresis (CGE).
[0164] The addition of a cap structure alters the molecular weight of the RNA fragments to a level that is undetectable by standard molecular biology analyses. Furthermore, the heterogeneity of the RNA product solution in terms of product lengths makes it even more difficult to assess molecular weight changes across the entire RNA population.
[0165] Thus, the expected length harmonization of the entire RNA population will ultimately produce only 2–5 subpopulations that differ in molecular weight depending on the capping state. Various types of mRNA capping structures are well known to those skilled in the art. Chan, SH et al., RNase H-based analysis of synthetic mRNA 5' cap incorporation, RNA 2022, vol. 28, pp. 1144-1155, discloses several examples of 5' mRNA capping structures. Chan, SH et al., 2022, also discloses an example in which newly synthesized mRNA was cleaved with RNase H guided by a DNA-RNA chimera to analyze the efficiency of mRNA 5' capping. However, the problem with RNase H in this method is that it is difficult to obtain uniform cleavage, as the reaction must be optimized for both optimal DNA-RNA hybridization and the enzyme's ability to produce uniform cleavage. Another advantage of ToxN endoribonuclease is that only a pentamer is required as a recognition site.
[0166] The use of ribozymes to replace RNase H has been proposed (EP 3183340), but ribozymes require an excess of the enzyme and the enzyme is highly dependent on the 3D structure of the RNA for cleavage.
[0167] Recently, capping of other RNA molecules has also been detected in eukaryotes, bacteria, and archaea. These non-canonical caps are primarily NAD + , FAD + The non-conical cap may affect RNA stability, mitochondrial function, and RNA translation (Doamekpor et al. 2022).
[0168] The present inventors have shown for the first time that the ToxN endoribonuclease family can overcome the problems of prior art endoribonucleases, as it can digest single-stranded RNA without the need for a hybridized DNA probe, a guide RNA, or a specific 3D structure of the RNA molecule for RNA cleavage.
[0169] A method for analyzing the 5' capping efficiency of in vitro transcription, including co-transcriptional 5' capping of mRNA using ToxN enzyme, is outlined in Figure 9a. mRNA is in vitro transcribed and contains a recognition site for ToxN enzyme in the 5' UTR.
[0170] The ToxN recognition sequence is positioned a predetermined number of ribonucleotides away from the 5' end of a synthetically transcribed, 5'-capped mRNA. Digestion of the 5'-capped RNA with ToxN generates a population of 5'-capped mRNA molecules of equal ribonucleotide length.
[0171] Analysis of mRNA modifications has shown that for long RNA molecules, the difference in molecular weight caused by the modifications is small. A long RNA molecule is an RNA molecule that is at least 10, 100, 200, 500, or 1000 nucleotides in length. Preferably, the RNA molecule has a length of 5 to 50,000 nucleotides, 10 to 30,000 nucleotides, 100 to 25,000 nucleotides, 200 to 20,000 nucleotides, or 500 to 15,000 nucleotides.
[0172] In one aspect, the 5'-capped mRNA fragments generated after digestion with ToxN enzyme contain 2 to 100 ribonucleotides, preferably 5 to 50 ribonucleotides, and more preferably 5 to 10 ribonucleotides.
[0173] Alternatively, to examine RNA modifications at internal positions in an RNA molecule, recognition sequences for the ToxN enzyme can be transcriptionally introduced on both sides of a potential RNA fragment. Alternatively, to examine the distribution of polyA tail lengths in mRNA molecules, a recognition sequence for the ToxN enzyme can be transcriptionally introduced before the polyA tail of a potential mRNA fragment.
[0174] Thus, in one aspect, there is provided a method for determining the 5' capping efficiency of a modification of an RNA molecule, the method comprising: a. providing a sample containing at least one single-stranded mRNA molecule containing a ToxN endoribonuclease cleavage site in the 5'UTR of the mRNA; b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the single-stranded RNA molecules to generate at least one 5'-end RNA fragment and at least one 3'-end RNA fragment; c. separating the RNA fragments from step b) and determining the presence of 5' capping modifications at the 5' ends of said 5' end RNA fragments.
[0175] In a further embodiment, the separation and detection in step c) of the above method is performed based on the different molecular weight, charge, or length of the generated RNA fragments. Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.
[0176] Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above. Thus, in another aspect, there is provided a method for determining the length distribution of poly-A tails of RNA molecules, the method comprising: a. providing a sample containing at least one single-stranded mRNA molecule containing a ToxN endoribonuclease cleavage site in the 3' UTR of the mRNA located upstream of the polyA tail; b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow cleavage of at least a portion of the single-stranded RNA molecules to generate at least one 5'-terminal RNA fragment and at least one 3'-terminal RNA fragment; c. isolating the RNA fragments from step b) and determining the presence and length of poly-A tails at the 3' ends of said 3'-end RNA fragments.
[0177] 3'-end RNA fragments containing polyA tails can be enriched by using an oligo-dT-based enrichment step, thereby removing the polyA-free fraction. Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.
[0178] Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above. In a further embodiment, the separation and detection in step c) of the above method is performed based on the different molecular weight, charge, or length of the generated RNA fragments.
[0179] In a further embodiment, separation and detection of RNA fragments is selected from gel electrophoresis, capillary electrophoresis, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, LC-UV.
[0180] As mentioned above, capping analysis after cleavage by E. coli ToxN1 can be performed similarly to other methods using LC-MS, FFF (Fast Flow Fractionation), or similar techniques. The pentamer recognition site is highly versatile and can be placed anywhere in the 5' UTR. The enzyme does not require an overhang and cleaves ssRNA starting from the cleavage site. Therefore, the shortest fragment that EcoToxN1 can generate is three nucleotides long, GAA for direct cleavage of the 5' site (see Table 1 above).
[0181] Because no excess additional oligos are present in the capping assay using E. coli ToxN1, the assay can be performed on a simple urea / acrylamide gel. Examples 10a-c and Figures 9b-d demonstrate that ToxN endoribonuclease can be used in methods to analyze RNA modifications, such as 5' capping of RNA.
[0182] RNA fingerprinting Similar to DNA fingerprinting using DNA restriction enzymes, RNA restriction enzymes can be used to exploit different positions of cleavage sites in ssRNA. RNA fingerprinting is an important tool in diagnostics and therapeutics. The use of ToxN endoribonucleases for analytical RNA fingerprinting offers several advantages, including fast and reliable fragmentation of single-stranded RNA molecules of defined lengths, which can be analyzed by gel electrophoresis, capillary electrophoresis, high-pressure liquid chromatography (HPLC), mass spectrometry (MS), or LC-MS and LC-UV.
[0183] A method of RNA fingerprinting is provided as shown in FIG. 10a, comprising: a. providing a sample containing single-stranded RNA molecules of unknown sequence; b. contacting the sample from step a) with ToxN endoribonuclease or an enzymatically active fragment thereof under conditions that allow for cleavage of at least a portion of the RNA molecules present in the sample to obtain a plurality of RNA fragments; c. Separating and detecting the fragmented RNA molecules from step b) to obtain a fingerprint of the RNA molecule of unknown sequence, and comparing the obtained fingerprint with fingerprints of RNA molecules of known RNA sequence.
[0184] Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above. Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above.
[0185] As described in WO 2022 / 212711, the determination of RNA species in polyvalent RNA compositions is another RNA fingerprinting method that uses ToxN endoribonuclease, a method that simplifies and improves upon RNase H enzymes, which require DNA probes hybridized at their recognition sites.
[0186] The method is based on an RNA composition comprising one or more different RNA species (e.g., RNAs encoding different proteins), each of which contains a unique nucleotide sequence that can be used to distinguish the RNA species. By incorporating a unique distinguishing and / or ratio-determining (IDR) sequence into the different RNA species of the RNA composition at at least one position (e.g., within a non-coding region), a unique fingerprint is inferred for each RNA species.
[0187] From WO 2022 / 212711, without wishing to be bound by theory, it is believed that RNA can be digested to release RNA fragments that contain IDR sequences, and analytical methods can be used to quantify the type and amount of each IDR-containing RNA fragment, generating a profile of the type and / or amount of each RNA species in an RNA composition.
[0188] The use of IDR sequences in analyses allows for the characterization of multivalent RNA compositions containing several different RNA species, even when the RNA species are difficult to distinguish based on length or coding sequence. For example, a multivalent RNA composition containing eight RNA species, each encoding a different serotype of the same protein, may have similar lengths and coding sequences, but each RNA species may contain different IDR patterns in the coding or non-coding regions.
[0189] Because each IDR sequence uniquely identifies a particular RNA species, the abundance of RNA encoding each serotype can be determined by measuring the abundance of IDR sequences. Furthermore, the coding sequences of one or more RNA species in a multivalent RNA composition may be modified independently of the IDR sequences (e.g., to alter the structure of the encoded therapeutic protein or antigen), such that the same analytical methods can be used to evaluate RNA compositions in which one or more RNA coding sequences have been modified.
[0190] Accordingly, a method for analyzing RNA species in a polyvalent RNA composition is provided, the method comprising: a. providing a sample comprising a multivalent RNA composition comprising a first RNA species and a second RNA species, wherein the first RNA species and the second RNA species comprise a cleavage site for ToxN endoribonuclease at at least one position; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow for cleavage of the first and second RNA species, thereby releasing a plurality of first and second RNA fragments from the first and second RNA species; c. Separating and detecting the presence and / or amount of the released first and second RNA fragments.
[0191] The RNA molecule may be selected from mRNA, viral RNA, in vitro transcribed mRNA, therapeutic RNA. Preferably, the ToxN endoribonuclease is a ToxN endoribonuclease as defined above.
[0192] Suitable RNA digestion buffers and reaction conditions for carrying out RNA cleavage are described in detail above. The separation and detection in step c) of the above method can be based on the different molecular weight, charge or length of the generated RNA fragments.
[0193] In a further embodiment, separation and detection of RNA fragments is selected from gel electrophoresis, capillary electrophoresis, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, LC-UV.
[0194] Example 11 and Figures 10b and 10c demonstrate that endoribonucleases from type III toxin-antitoxin (TA) systems, such as those of the ToxN subfamily, can be used in methods of RNA fingerprinting. Figure 10b shows two synthetic RNA oligos of identical length (20 bases) that migrate equally in a urea / acrylamide gel (lanes 1 and 8). However, each RNA oligo contains an E. coli ToxN1 (ET-N1) cleavage site at a different position within the RNA sequence. This allows RNA molecules present in a mixture to be identified by their unique patterns of RNA fragmentation. Furthermore, the band intensities can be used to estimate the ratio of two RNA molecules in the mixture (see Figure 10c).
[0195] Having generally described the present invention, it can be further understood by reference to specific examples which illustrate the properties and effects of ToxN endoribonucleases according to the present invention and are provided herein for purposes of illustration only and not limitation.
[0196] Example Example 1 - Cloning, expression and purification of E. coli ToxN1 (ET-N1) endoribonuclease of SEQ ID NO: 1 As described in Manikandan, P. et al., Identification, functional characterization, assembly, and structure of ToxIN type III toxin-antitoxin complex from E. coli, Nucleic acid research, 2022, vol. 50, no. 3, pp. 1687-1700, the E. coli ToxN1 (ET-N1) enzyme (toxin) was cloned into the pBAD / HisA vector, and the RNA (antitoxin) was inserted into the pRSFDuet vector. TMThe toxin and antitoxin were cloned into E. coli BL21(DE3) cells. Plasmids containing the toxin and antitoxin were cotransformed into E. coli BL21(DE3) cells and grown overnight at 37°C and 180 rpm, followed by subculture at 37°C and 180 rpm until the OD600 reached approximately 0.5. The culture was incubated at 15°C for 30 minutes without shaking, induced with IPTG to a final concentration of 1 mM toxin, and incubated at 15°C and 180 rpm for 24 hours. Cells were harvested by centrifugation at 6000 rpm for 15 minutes. Cells were resuspended in lysis buffer (50 mM Tris, 300 mM NaCl, 10 mM imidazole, 10% glycerol, 2 mM 2-mercaptoethanol pH 7.5, 25°C) and lysed by sonication. The lysate was centrifuged at 13,000 rpm for 30 minutes, and the supernatant was collected using Ni 2+ The complex was loaded onto an NTA column. The complex was eluted using elution buffer (lysis buffer + 200 mM imidazole). The complex-containing fraction was dialyzed against ion exchange buffer (50 mM NaCl, 50 mM Tris-HCl, 1 mM DTT pH 7.5) and purified using anion exchange chromatography with an increasing gradient of NaCl from 50 to 1000 mM over a 100 ml volume. Separate fractions were obtained: toxin, E. coli ToxN1 (ET-N1) (approximately 300 mM NaCl), antitoxin, RNA (approximately 600 mM NaCl), and E. coli ToxN1-RNA complex (approximately 500 mM NaCl). These were further purified by size exclusion chromatography (SEC) using an S200 column (GE).
[0197] [ka]
[0198] Example 2 - In vitro transcription and generation of RNA oligos containing ToxN recognition and cleavage sites In vitro transcription was performed in a 50 μL reaction volume containing 30 U T7 RNA polymerase (ThermoScientific, EP0111) and the provided 5X reaction buffer (200 mM Tris-HCl pH 7.9, 30 mM MgCl2, 50 mM DTT, 50 mM NaCl, 10 mM spermidine), 50 U RiboLock RNase inhibitor (ThermoScientific, EO0381), 2 mM NTPs (ThermoScientific, R1481), and 1 μg linearized (ScaI-digested) pGEMEX-1 template. As an alternative template, any linearized plasmid containing a T7 promoter and ToxN cleavage site, or a PCR product containing a T7 promoter and ToxN cleavage site, can be used. The transcription reaction continued for 2 h at 37°C, was inactivated by adding 10 μL of 60 mM ETDA, and then incubated at 65°C for 10 min. The reaction was cleaned up using the RNeasy MiniElute Cleanup Kit (Qiagen, 74204), and purified RNA was eluted in RNase-free water.
[0199] Recognition site: E. coli toxin N (ET-N1): GAA^AU P. atrosepticum ToxN:GAA^AU B. thuringiensis ToxN (BT-N1): AAA^AAA L. lactis ToxN(AbiQ):AA^AA [Eubacterium]rectalCptIN:GA^AAG Escherichia albertii ToxN / AbiQ (ET-N5): 5'..GAAA↓AAC..3' and 5'.AAAA↓AUC..3' Example 3 - Endoribonuclease Activity - Determination of Optimal Enzyme Concentration This experiment was carried out to verify that the use of E. coli ToxN1 (NCBI Acc. No.: WP_059274511) according to the present invention exhibits endoribonuclease activity against single-stranded RNA substrates.
[0200] Digestion of a 50-nucleotide single-stranded RNA oligo with E. coli ToxN1. The recognition site, GAAAU, is in the center of this oligo, resulting in a 26-nucleotide product. The results of analysis on a polyacrylamide / urea gel are shown in Figure 2.
[0201] E. coli ToxN1 (ET-N1) The sequence of a 50-nucleotide single-stranded RNA oligo containing the cleavage site (underlined) : 5'-CGCAAUUGCCGCAUUACAAGG GAAAU AACUUCGUACGUUGUUGUUAGCAU / 3'-FAM Assay conditions (25 μl): 0nM~120nM ToxN enzyme 50mM Tris-HCl pH 7.5 50mM NaCl 1mM DTT 0.125 μM RNA oligo 1 hour at 15°C Example 4 - Activity profiling of E. coli ToxN1 (ET-N1) endoribonuclease: Monovalent salt concentration and pH Digestion of a 50-nucleotide single-stranded RNA oligo with ToxN. The recognition site, GAAAU, is located in the center of this oligo, resulting in a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The results are shown in Figure 3 and demonstrate that the ToxN enzyme can cleave single-stranded RNA over a pH range of 7.0 to 9.0. Furthermore, the results demonstrate that the specificity of the enzyme depends on the monovalent ion concentration and is optimal at NaCl concentrations of 50 mM or less. Above 50 mM, the specificity of RNA cleavage decreases, and the enzyme digests the RNA at the second most closely related sequence recognition site.
[0202] Assay conditions 125nM RNA oligo 40nM E. coli ToxN1 50mM Tris-HCl pH 7.0 to pH 9.0 NaCl 0mM~175mM 1 hour at 15°C Polyacrylamide / urea gel analysis results Example 5 - Activity profiling of ToxN endoribonuclease: divalent salt concentration a) Digestion of a 50-nucleotide single-stranded RNA oligo with E. coli ToxN1 (ET-N1). The recognition site, GAAAU, is located in the center of this oligo, resulting in a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The results are shown in Figure 4a. E. coli ToxN1 (ET-N1) enzyme activity is significantly inhibited by concentrations of MgCl2 above 1 mM (lanes E-J).
[0203] [Table 3]
[0204] Assay conditions 50mM TrisHCl pH 8.0 25mM NaCl 125nM RNA oligo 40nM E. coli ToxN1 1 hour at 15°C b) Digestion of a 50-nucleotide single-stranded RNA oligo with ToxN. The recognition site, GAAAU, is central to this oligo, resulting in a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The results are shown in Figure 4b. The activity of the ToxN enzyme is significantly inhibited by concentrations of MgCl2 above 3 mM and MnCl2 above 1 mM.
[0205] Assay conditions 25mM Tris / HCl pH 7.5 25mM NaCl 0.5 μM RNA oligo 10nM E. coli ToxN1 37°C 10 min Example 6 - Activity profiling of E. coli ToxN1 (ET-N1) endoribonuclease: Concentrations of divalent salts, EDTA, and DTT Digestion of a 50 nucleotide RNA single-stranded oligo with the ToxN1 recognition sequence. The recognition site, GAAAU, is in the center of this oligo, resulting in a 26 nucleotide product (the sequence of the oligo is shown in Example 3).
[0206] The results of the experiment are shown in Fig. 5 and show that ToxN1 endoribonuclease activity is restored by the addition of EDTA, a divalent cation scavenger (lanes G, H).
[0207] [Table 4]
[0208] Assay conditions 50mM TrisHCl pH 8.0 25mM NaCl 125nM RNA oligo 40nM E. coli ToxN1(ET-N1) 1 hour at 15°C Example 7 - Activity profiling of E. coli ToxN1 (ET-N1) endoribonuclease: incubation time at 15°C Digestion of a 50-nucleotide single-stranded RNA oligo with E. coli ToxN1 (ET-N1) at increasing incubation times. The recognition site, GAAAU, is central to this oligo, yielding a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The results are shown in Figure 6 and demonstrate the high efficiency of this enzyme. At the optimal assay temperature of 15°C, 50% of the RNA oligo is cleaved after 5 minutes (lane C).
[0209] [Table 5]
[0210] Assay conditions 50mM Tris-HCl pH 8.0 25mM NaCl 125nM RNA oligo 40nM ToxN1 (ET-N1) 15℃ Example 8 - Activity profiling of ToxN endoribonuclease: incubation temperature Digestion of a 50-nucleotide single-stranded RNA oligo with E. coli ToxN1 (ET-N1). The recognition site, GAAAU, is located in the center of this oligo, resulting in a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The goal of this study was to profile the enzyme activity at various incubation temperatures. The results are shown in Figure 7.
[0211] [Table 6]
[0212] 50mM TrisHCl pH 8.0 25mM NaCl 125nM RNA oligo 40nM ToxN1 (ET-N1) 30 minutes at the specified temperature Example 9 - Activity profiling of E. coli ToxN1 endoribonuclease: incubation temperature Digestion of a 50-nucleotide single-stranded RNA oligo with E. coli ToxN1 (ET-N1). The recognition site, GAAAU, is located in the center of this oligo, yielding a 26-nucleotide product (the sequence of the oligo is shown in Example 3). The goal of this study was to profile the enzyme activity at various incubation temperatures. The results are shown in Figure 8 and demonstrate that enzyme specificity decreases at temperatures above 30°C.
[0213] [Table 7]
[0214] Assay conditions 50mM TrisHCl pH 8.0 25mM NaCl 125 nM RNA oligo 40 nM ToxN1 (ET-N1) 30 minutes at the specified temperature Example 10a - Analysis of 5'-cap status In vitro translation (IVT) to generate RNA constructs was performed using standard protocols.
[0215] Digestion of IVT RNA was carried out at 37 °C. After stopping the IVT reaction with EDTA, a portion of the IVT reaction mixture was mixed with 10 - 90 nM of Escherichia coli ToxN1 (ET-N1) in IVT buffer for 10 - 20 minutes. Urea gel loading buffer (95% formamide, 0.25 M EDTA, bromophenol blue) was added to stop the reaction, and the samples were loaded onto a 20% urea / acrylamide gel. The samples were visualized with SYBR® Gold.
[0216] The results of the analysis of 5'-cap status are shown in Figure 9b. Example 10b - Analysis of post-transcriptional capping efficiency of mRNA pGEM3Zf-ETN1+13 was linearized with HincII and used for the T7 RNAP IVT reaction. Half of the resulting GEM3Zf mRNA was capped using vaccinia capping enzyme and purified by silica column. Next, half of the capped mRNA and the uncapped mRNA were digested using Escherichia coli ToxN1 (ET-N1) endoribonuclease and loaded onto a 10% polyacrylamide gel containing 7 M urea (TBE, Sybr® Gold).
[0217] FIJI was used to quantify the relative band intensities of the capped (<<pl) and uncapped (p2) mRNA fragments (the average peak height of three slices is denoted as "a, b, c" for capped mRNA and "d, e, f" for uncapped mRNA). The mRNA was diluted 1:1 with RNA loading buffer, heated at 65 °C for 10 minutes, and then approximately 150 ng of mRNA was loaded per lane.
[0218] Constructs used in IVT: pGEM3Zf: TAATACGACTCACTATA_GGGCGAATTCGAA↓ATCGGTACCCGGGGATCCTCTAGAGTC*GAC Resulting mRNA GEM3Zf: (5' Cap)GGGCGAAUUCGAA↓AUCGGUACCCGGGGAUCCUCUAGAGUC ↓ToxN / E. coli ToxN1 / (ET-N1) cleavage site *HincII cleavage site (for plasmid linearization) _ indicates the transcription start site The results of the 5' cap status analysis are shown in Figure 9c, which shows that 56% of the mRNA is capped by this method.
[0219] Example 10c - Analysis of co-transcriptional capping efficiency of mRNA pAZ_01 was linearized with PpuMI and used in T7 RNAP IVT reactions with and without cotranscriptional capping with cap analogs. Half of the capped and uncapped pAZ_01 mRNA was digested with Escherichia coli ToxN1 (ET-N1) endoribonuclease and loaded onto a 10% polyacrylamide gel containing 7 M urea (stained with Sybr® Gold). The ET-N1-digested uncapped and capped mRNAs showed a single large band, suggesting capping efficiency close to 100%. Approximately 150 ng of mRNA or 15 ng of RNA oligos were loaded per lane after 1:1 dilution with RNA loading buffer and heating at 65°C for 10 min.
[0220] Constructs used in IVT: pAZ_01: TAATACGACTCACTATA_AGGTCTTCTGGTCCCCACAGAA↓ATCTCAGAGAGAACCCACCATGGAGGACGCAAAGAACATAAAAAAAG*GACCC Resulting mRNA AZ_01: (5' Cap)AGGUCUUCUGGUCCCCACAGAA↓AUCUCAGAGAGAACCCACCAUGGAGGACGCAAAGAACAUAAAAAAAG ↓ToxN / E. coli ToxN1 / (ET-N1) cleavage site *PpuMI cleavage site (for plasmid linearization) _ indicates the transcription start site The results of the analysis of the 5' cap state are shown in Figure 9d.
[0221] Example 11 - Fingerprinting by analysis of ratios of RNA mixtures RNA fingerprinting by simultaneous digestion of two 20-nucleotide RNA substrates (MOD-UTR: GGGAA↓AUAAGAGAGAAAAGA-FAM and Dist1: GCCGAA↓AUAGUGACCCUGCA-FAM). The FAM-labeled products differ by a single nucleotide, resulting in 15-nucleotide and 14-nucleotide product bands, respectively. Reaction conditions: 10 nM E. coli ToxN1 (ET-N1), 500 nM substrate, 37°C for 10 minutes. Only the FAM-labeled product is visible.
[0222] The results of the fingerprint analysis are shown in Figure 10b, and Figure 10c shows the ratio of the two RNA molecules in the mixture calculated by measuring the intensity of the bands. Example 12 - RNA synthesis Mango aptamer production. Concatemers of the Mango aptamer produced by IVT were digested with E. coli ToxN1 (ET-N1) at 37°C for 20 minutes using decreasing enzyme concentrations in a buffer containing 25 mM Tris / HCl, 25 mM NaCl, pH 7.5. The Mango aptamer was described in Dolgosheina et al., 2014; doi:10.1021 / cb500499x.
[0223] Example 13 - Stability of E. coli ToxN1 (ET-N1) enzyme in the presence of monovalent salts in storage buffers 100mM NaCl to 500mM NaCl. Example 14 - Digestion of RNA by other ToxN endoribonucleases of the ToxIN family 25mM Tris pH 7.5, 25mM NaCl 37°C 10 min 500nM RNA substrate 10nM endoribonuclease 20 μL total volume
[0224] [ka]
[0225] The results are shown in Figure 14. BT-N1 recognizes and cleaves AAA↓AAA with high reliability. ET-N5 cleaves GAAA↓AAC and AAAA↓AUC with similar efficiency. This example demonstrates that additional members of the ToxN enzyme family according to the pFam classification also cleave single-stranded RNA under the same buffer conditions as ToxN (ET-N1), despite the % protein sequence identity between ET-N1 and ET-N5 being only 40.88% and between ET-N1 and BT-N1 being only 30.95%. % identity is calculated using Clustal Omega, a multiple protein sequence alignment tool from EMBL-EBE, with default settings.
[0226] [Table 8]
[0227] Sequence Listing
[0228] [Table 9-1]
[0229] [Table 9-2]
[0230] Table 9-3
[0231] Table 9-4
Claims
1. 1. A composition comprising an isolated ToxN endoribonuclease or an enzymatically active fragment thereof, A composition, wherein the concentration of monovalent salt in said composition is ≦150 mM, for example about ≦100 mM, and said monovalent salt is preferably an alkali metal salt.
2. A sample comprising at least one polyribonucleotide and an isolated ToxN endoribonuclease or an enzymatically active fragment thereof, - A sample, wherein the concentration of monovalent salt in said composition is ≦150 mM, such as about ≦100 mM, and said monovalent salt is preferably an alkali metal salt.
3. 1. A method for cleaving single-stranded RNA molecules in a sample, comprising: a. providing a sample containing at least one single-stranded RNA molecule containing a cleavage site for ToxN endoribonuclease; and b. contacting ToxN endoribonuclease or an enzymatically active fragment thereof with said at least one RNA molecule in said sample under conditions that allow cleavage of at least a portion of said RNA molecule present in said sample, wherein the concentration of a monovalent salt in said sample is about ≦150 mM, such as about ≦100 mM, and said monovalent salt is preferably an alkali metal salt.
4. 4. The method of claim 3, wherein the single-stranded RNA molecule in step a) is a concatemer comprising multiple copies of a precursor of either mRNA, siRNA, circular RNA, microRNA, or ribozyme, and the concatemeric RNA molecule comprises a cleavage site for ToxN endoribonuclease between each copy of the precursor of mRNA, siRNA, circular RNA, microRNA, or ribozyme.
5. 1. A method for determining the 5′-capping efficiency of an RNA molecule, comprising: a. providing a sample comprising at least one single-stranded mRNA molecule, said at least one single-stranded mRNA molecule comprising a cleavage site for ToxN endoribonuclease in the 5' UTR of said mRNA; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow cleavage of at least a portion of the single-stranded RNA molecules to generate at least one 5'-end RNA fragment and at least one 3'-end RNA fragment, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, e.g., about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the RNA fragments from step b) and determining the presence of a 5'-capping modification at the 5'-end of said 5'-terminal RNA fragments.
6. 1. A method for RNA fingerprinting, comprising: a. providing a sample containing at least one single-stranded RNA molecule having an unknown sequence; b. contacting the sample from step a) with ToxN endoribonuclease under conditions that allow for cleavage of at least a portion of the RNA molecules to obtain a plurality of RNA fragments, wherein the concentration of a monovalent salt in the sample is about ≦150 mM, e.g., about ≦100 mM, and the monovalent salt is preferably an alkali metal salt; and c. Separating and detecting the fragmented RNA molecules from step b) to obtain a fingerprint of said RNA molecule of unknown sequence, and comparing the obtained fingerprint with fingerprints of RNA molecules of known sequence.
7. 7. The method of claim 5 or 6, wherein the separation and detection steps are selected from gel electrophoresis, capillary gel electrophoresis (CGE), PAGE, high pressure liquid chromatography (HPLC), mass spectrometry (MS) or LC-MS, IP RP HPLC, and LC-UV.
8. 7. The method of claim 6, wherein the RNA molecule is selected from mRNA, an RNA virus, an immunogenic RNA molecule, a viroid, a long non-coding RNA, and a ribozyme.
9. The composition or sample is essentially free of divalent metal cations, and the divalent metal cations are preferably Mg 2+ or Mn 2+ The sample or method according to any one of claims 1 to 6, wherein
10. The concentration of divalent metal cations in the composition or sample is about ≦3 mM, such as about ≦2 mM, for example about ≦1 mM, and the divalent metal cations are preferably Mg 2+ or Mn 2+ The composition, sample or method according to any one of claims 1 to 6, wherein
11. The composition or sample comprises a ratio of the concentration of divalent metal cations in the composition or sample to the concentration of divalent ion chelator, provided that the concentration of free divalent metal cations present in the composition is about ≦3 mM, such as about ≦2 mM, for example about ≦1 mM, and the divalent metal cation is preferably Mg 2+ or Mn 2+ The composition, sample or method according to any one of claims 1 to 6, wherein
12. 7. The composition, sample or method of any one of claims 1 to 6, wherein the composition or sample comprises a divalent ion chelator at a concentration of about ≦10 mM.
13. 7. The composition, sample or method of any one of claims 1 to 6, wherein the isolated ToxN endoribonuclease comprises the amino acid sequence of SEQ ID NO: 1 or an enzymatically active fragment thereof, or wherein the ToxN endoribonuclease comprises an amino acid sequence that is at least 30% identical to SEQ ID NO:
1.
14. 14. The composition or sample of claim 1, claim 2, or claim 13, wherein the isolated ToxN endoribonuclease is not complexed with ToxI RNA.
15. A kit comprising: a. the composition of any one of claims 1 and 9 to 14, and b. A second composition comprising a second enzyme selected from the group consisting of an RNA polymerase, an RNA ligase that ligates single-stranded RNA molecules, a pyrophosphatase, a phosphatase, a kinase, or other enzyme that modifies nucleic acids or ribonucleic acids, and at least one additional ToxN endoribonuclease having a recognition site different from that of the ToxN endoribonuclease of a). Kit including:
Citation Information
Patent Citations
Compositions and methods of RNA analysis
AU2016297778A1
Methods for RNA analysis
WO2015101416A1