A gene editing approach to inhibit aberrant splicing in stathmin 2 (STMN2) transcripts

Abstract

Provided is a method for inhibiting aberrant splicing in stathmin-2 (STMN2) transcripts, comprising genetically editing the STMN2 gene in a cell to delete (a) one or more nucleotides in the 3' splice site of intron 1 adjacent to exon 2a, (b) one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), thereby inhibiting production of STMN2 transcripts containing exon 2a and improving production of functional STMN2 transcripts in the cell. Also provided herein is a gene editing system for genetically modifying the STMN2 gene.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 549,007, filed February 2, 2024, U.S. Provisional Application No. 63 / 618,201, filed January 5, 2024, and U.S. Provisional Application No. 63 / 445,926, filed February 15, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy created on February 13, 2024 is named 063586-511001WO_SeqList_ST26.xml and is 1,675,184 bytes in size. [Background technology]

[0003] Amyotrophic lateral sclerosis (ALS) is a late-onset neurodegenerative disease characterized by the progressive loss of motor neurons in the spinal cord and brain. The majority of cases are sporadic, with the 10% caused by genetic mutations. A GGGGCC repeat expansion in open reading frame 72 on chromosome 9 (C9orf72) is the most frequent genetic cause of ALS. Many genes affected in ALS are also involved in frontotemporal dementia (FTD), another neurodegenerative disease.

[0004] Cytoplasmic accumulation of TDP-43 (transactivation response DNA-binding protein 43) is observed in both ALS and FTD. TDP-43 is a DNA / RNA-binding protein involved in RNA transcription, splicing, processing, transport, and stability. TDP-43 binds to thousands of pre-mRNA targets, and its reduction in the adult nervous system affects the splicing or expression of many RNAs. Recently, it has been noted that stathmin-2 mRNA is significantly lost after TDP-43 depletion.

[0005] The stathmin-2 gene (STMN2) encodes a microtubule-binding protein that is important for maintaining axonal health. STMN2 is aberrantly spliced ​​in ALS due to loss of function of TDP-43, generating a nonfunctional truncated form of STMN2 (exon 2a variant). Approaches that inhibit such aberrant splicing of STMN2 and enhance the production of functional STMN2 transcripts / proteins would be beneficial for the treatment of diseases such as ALS and FTD. Summary of the Invention

[0006] The present disclosure is based at least in part on the discovery that gene editing at a specific location of the STMN2 gene (for example, the 3' splice site of intron 1 and / or the region of intron 1 adjacent to the 3' splice site) significantly reduces the aberrant splicing of STMN2 (reducing the formation of non-functional transcripts containing cryptic exon 2a) and increases the production of full-length STMN2 transcripts.Therefore, the present disclosure provides a method and a gene editing system for inhibiting the aberrant splicing of STMN2 transcripts.Such methods and gene editing systems can be useful for treating diseases associated with loss of STMN2, such as ALS and FTD.

[0007] In some embodiments, the present disclosure provides a gene editing system comprising: (a) a type V nuclease (e.g., as disclosed herein, e.g., SEQ ID NO: 3, 4, 5, or 6, or a variant thereof similarly disclosed herein), or a nucleic acid encoding the nuclease; and (b) one or more guide RNAs (gRNAs) targeting the STMN2 gene, or one or more nucleic acids encoding the one or more gRNAs. The gene editing system effects (a) a deletion of one or more nucleotides in the 3' splice site adjacent to exon 2a in intron 1 of STMN2, (b) a deletion of one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), thereby reducing production of STMN2 transcripts containing exon 2a and increasing production of functional STMN2 transcripts in cells edited by the gene editing system.

[0008] In some embodiments, the gene editing system includes two or more gRNAs targeting the STMN2 gene, e.g., a first gRNA and a second gRNA. In some embodiments, the first gRNA induces a deletion of one or more nucleotides at the 3' splice site, and the second gRNA induces a deletion of one or more nucleotides in a downstream 10-base window. In other embodiments, the first gRNA induces a deletion at both the 3' splice site and the downstream 10-base window, and the second gRNA induces a deletion at the 3' splice site. In yet other embodiments, the first gRNA induces a deletion at both the 3' splice site and the downstream 10-base window, and the second gRNA induces a deletion at the downstream 10-base window. In yet other embodiments, each of the first gRNA and the second gRNA induces a deletion at both the 3' splice site and the downstream 10-base window.

[0009] In some examples, the gene editing system disclosed herein comprises (a) a Cas12i2 nuclease optionally comprising an amino acid sequence at least 90% identical to SEQ ID NO:3 or SEQ ID NO:266, and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 2. In specific examples, the gene editing system comprises a nuclease of SEQ ID NO:3 or SEQ ID NO:266 and a gRNA of G53, G55, or G56.

[0010] In some examples, the gene editing system disclosed herein includes (a) a type V nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4 or SEQ ID NO: 255, and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 3. In a specific example, the gene editing system includes a nuclease of SEQ ID NO: 4 or SEQ ID NO: 255 and a gRNA of A_STMN2_Splice2a_4 or A_STMN2_Splice2a_4. In one example, the gRNA is A_STMN2_Splice2a_4. In another example, the gRNA is A_STMN2_Splice2a_3.

[0011] In some examples, the gene editing system disclosed herein comprises (a) a type V nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 5; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 4.

[0012] In some examples, the gene editing system disclosed herein comprises (a) a type V nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO:6; and (b) one or more guide RNAs (gRNAs) selected from those listed in Table 5.

[0013] In some embodiments, the gene editing system disclosed herein comprises a nucleic acid encoding a type V CRISPR nuclease. In some examples, the nucleic acid is a vector comprising a nucleotide sequence encoding a type V CRISPR nuclease. The encoding nucleotide sequence can be operably linked to a promoter. In some examples, the vector can be an adeno-associated virus (AAV) vector (e.g., an AAVrhlO vector). In some examples, the promoter can be a synapsin 1 promoter.

[0014] Additionally, the disclosure features a method for inhibiting aberrant splicing in stathmin-2 (STMN2) transcripts, the method including: (i) gene editing the STMN2 gene in a cell to delete (a) one or more nucleotides in the 3' splice site of intron 1 adjacent to exon 2a, (b) one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), thereby inhibiting production of STMN2 transcripts containing exon 2a and improving production of functional STMN2 transcripts in the cell. In some embodiments, the method may further include (ii) measuring the level of STMN2 transcript and / or STMN2 protein in the cell after gene editing.

[0015] In some embodiments, the 3' splice site in (a) comprises the nucleotide sequence TTGCAG. Alternatively, or additionally, the region of exon 2a in (b) comprises the nucleotide sequence ACTCGGCAGA (SEQ ID NO: 2) (also referred to herein as the downstream 10-base window).

[0016] In some embodiments, gene editing step (i) can result in the deletion of one or more nucleotides in both (a) and (b). In some examples, gene editing step (i) is mediated by a gene editing system. For example, the gene editing system comprises a V-type nuclease and a guide RNA (gRNA) that targets the STMN2 gene.

[0017] In some examples, the type V nuclease is a Cas12i nuclease that optionally comprises an amino acid sequence at least 90% identical to SEQ ID NO: 3. In a specific example, the Cas12i nuclease is a Cas12i2 nuclease that comprises the amino acid sequence of SEQ ID NO: 3. In another example, the Cas12i nuclease is a Cas12i2 nuclease that comprises the amino acid sequence of SEQ ID NO: 266.

[0018] In other examples, the type V nuclease is a nuclease comprising the amino acid sequence of any of SEQ ID NOs: 4-6 or a variant thereof, where the variant may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 4, 5, or 6. In one example, the type V nuclease comprises the amino acid sequence of SEQ ID NO: 4. In another example, the type V nuclease comprises the amino acid sequence of SEQ ID NO: 255. In another example, the type V nuclease comprises the amino acid sequence of SEQ ID NO: 5. In yet another example, the type V nuclease comprises the amino acid sequence of SEQ ID NO: 6.

[0019] Any of the gene editing systems provided herein can be used in the methods of inhibiting aberrant splicing in stathmin-2 (STMN2) transcripts, also disclosed herein.

[0020] In some embodiments, the gene editing system disclosed herein may include two or more gRNAs targeting the STMN2 gene, such as a first gRNA and a second gRNA. In some examples, the first gRNA induces a deletion of one or more nucleotides at the 3' splice site, and the second gRNA induces a deletion of one or more nucleotides in a downstream 10-base window. In other examples, the first gRNA induces a deletion at both the 3' splice site and the downstream 10-base window, and the second gRNA induces a deletion at the 3' splice site. In yet other examples, the first gRNA induces a deletion at both the 3' splice site and the downstream 10-base window, and the second gRNA induces a deletion at the downstream 10-base window. In yet other examples, each of the first gRNA and the second gRNA induces a deletion at both the 3' splice site and the downstream 10-base window.

[0021] In some embodiments, the cells for gene editing disclosed herein are in cell culture.In some examples, the cells are derived from human patients with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).In some examples, the cells are brain cells, such as neuronal cells.In a specific example, the cells are motor neuron cells.

[0022] In other embodiments, the cells are neuronal cells in a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0023] In some embodiments, the method of inhibiting aberrant splicing in STMN2 transcripts disclosed herein comprises delivering a gene editing system to a subject in need thereof (e.g., a human patient with ALS or FTD). In some instances, the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection. In some instances, the gene editing system is delivered to the subject by intrathecal injection.

[0024] In another aspect, the disclosure features a gene-edited cell comprising: (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2 adjacent to exon 2a; (b) a deletion of one or more nucleotides in the region of intron 1 adjacent to the 3' splice site; or both (a) and (b). Such gene-edited cells result in reduced levels of STMN2 transcripts containing exon 2a and increased levels of functional STMN2 transcripts compared to their unedited counterparts. In some instances, the gene-edited cells are human brain cells, e.g., human neuronal cells. In some examples, the human neuronal cells are motor neuron cells. The gene-edited cells disclosed herein can be produced by any of the gene-editing methods disclosed herein.

[0025] The present disclosure further provides a gene editing system comprising: (a) a type V CRISPR nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4, or a nucleic acid encoding the type V CRISPR nuclease; and (b) a guide RNA (gRNA) targeting the stathmin-2 (STMN2) gene, or a nucleic acid encoding the gRNA. Such a gene editing system genetically modifies the STMN2 gene to inhibit production of an STMN2 transcript containing exon 2a. In some embodiments, the type V CRISPR comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the type V CRISPR comprises the amino acid sequence of SEQ ID NO: 255.

[0026] In some embodiments, the gene editing system disclosed herein comprises a nucleic acid encoding a type V CRISPR nuclease. In some examples, the nucleic acid is a vector comprising a nucleotide sequence encoding a type V CRISPR nuclease, wherein the nucleotide sequence is operably linked to a promoter. In some examples, the vector is an adeno-associated virus (AAV) vector (e.g., an AAVrhlO vector). In some examples, the promoter is a synapsin 1 promoter. In some instances, the vector disclosed herein (e.g., an AAV vector such as an AAVrhlO vector) may further comprise a nucleotide sequence encoding a gRNA disclosed herein.

[0027] Furthermore, the present disclosure provides a method for gene editing the STMN2 gene, the method comprising contacting a cell with any of the gene editing systems disclosed herein and allowing the gene editing system to gene edit the STMN2 gene in the cell.

[0028] In some embodiments, the method for inhibiting aberrant splicing in STMN2 transcripts disclosed herein comprises delivering a gene editing system to a subject (e.g., a human patient) in need thereof. In some instances, the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection. In some instances, the gene editing system is delivered to the subject by intrathecal injection.

[0029] Furthermore, the present disclosure provides a method of treating a disease associated with aberrant splicing of STMN2 (e.g., ALS or FTD), the method comprising administering to a subject in need thereof any of the gene editing systems disclosed herein, or modified cells produced by the gene editing system. Also provided herein are the gene editing systems disclosed herein for use in treating a target disease, as well as use of the gene editing system for manufacturing a medicament for use in treating a target disease.

[0030] Also provided herein are gene editing systems for gene editing the STMN2 gene to inhibit production of exon 2a-containing splice variants and for treating diseases associated with aberrant splicing of STMN2 (e.g., ALS or FTD), as well as the use of such gene editing systems for manufacturing pharmaceuticals for use in intended therapeutic applications.

[0031] The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the invention will become apparent from the following drawings, detailed description of certain embodiments, and the appended claims.

[0032] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure and can be better understood by reference to the drawings in combination with the detailed description of specific embodiments presented herein. [Brief explanation of the drawings]

[0033] [Figure 1A] FIG. 1 shows TDP-43 knockdown in SH-SY5Y cells. 1.4-fold TDP-43 knockdown in SH-SY5Y cells using siTDP-43 RNA. [Figure 1B] FIG. 1 shows TDP-43 knockdown in SH-SY5Y cells, showing that knockdown of TDP-43 in the presence of a control RNP complex (i.e., an RNP complex that does not target STMN2 exon 2a) resulted in a 60-fold increase in the STMN2 exon 2a splice variant. [Figure 1C] Figure 1 shows TDP-43 knockdown in SH-SY5Y cells, showing that knockdown of TDP-43 in the presence of a control RNP complex (i.e., an RNP complex that does not target STMN2 exon 2a) resulted in a more than 90-fold reduction in the STMN2 full-length isoform. [Figure 2A]FIG. 10 shows indel activity and splice motif disruption of RNA guides tested in SH-SY5Y cells, showing that RNA guides 55 and 56 showed the highest motif disruption of all guides tested. [Figure 2B] FIG. 1 shows the indel activity and splice motif disruption of RNA guides tested in SH-SY5Y cells, showing the correlation between RNA guides that promoted full-length STMN2 restoration and untreated indels. [Figure 2C] FIG. 1 shows the indel activity and splice motif disruption of RNA guides tested in SH-SY5Y cells, demonstrating the correlation between motif disruption and RNA guides that promoted full-length STMN2 restoration. [Figure 3A] FIG. 3A shows the effect of targeting the STMN2 exon 2a splice site and TDP-43 binding site with Cas12i2 on STMN2 transcript production. The 3' splice site, 10-base window, and TDP-43 binding site in the corresponding region of the STMN2 gene are shown; the nucleotide sequence in FIG. 3A is set forth as SEQ ID NO: 256. [Figure 3B] Figure 1 shows the effect of targeting the STMN2 exon 2a splicing site and TDP-43 binding site with Cas12i2 on STMN2 transcript production. Disruption of the TDP-43 binding site by RNA guide 12 reproduced the effect of TDP-43 knockdown by siRNA. [Figure 3C] Figure 1 shows the effect of targeting the STMN2 exon 2a splice site and TDP-43 binding site with Cas12i2 on STMN2 transcript production. Disruption of the splice site by RNA guide 55 resulted in a reduction of the exon 2a splice variant in the absence of siRNA-mediated TDP-43 knockdown and in the presence of RNA guide 12. [Figure 3D]Figure 1 shows the effect of targeting the STMN2 exon 2a splice site and TDP-43 binding site with Cas12i2 on STMN2 transcript production. Disruption of the splice site with RNA guide 55 resulted in an increase in full-length STMN2 in the absence of siRNA-mediated TDP-43 knockdown and in the presence of RNA guide 12. NT: non-targeting guide; 12: guide 12 (targeting the TDP-43 binding site); 55: guide 55 (see Table 2). [Figure 4A] FIG. 1 shows a representative plot of one dataset analyzed, showing the maximum correlation observed in a 10 base window starting at amplicon position 106 (see SEQ ID NO: 1). Inter-guide correlation values ​​(y-axis) between positional indel rate and STMN2 recovery rate across all amplicon positions (x-axis) are plotted along with the position of maximum correlation (black dotted line). [Figure 4B] FIG. 1 shows a representative plot of one dataset analyzed, illustrating the maximum correlation observed in a 10 base window starting at amplicon position 106 (see SEQ ID NO: 1). A scatter plot of position indel rate (x-axis) versus STMN2 recovery rate (y-axis) for guides with a 10 base window starting at position 106 is shown. [Figure 5A] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. Guides that did not induce indels within any window showed minimal or no recovery of full-length STMN2. Guides G1–G3 are shown. [Figure 5B] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. For guides that did not induce indels within any window, minimal or no recovery of full-length STMN2 was observed. Guides G4–G6 are shown. [Figure 5C]Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. For guides that did not induce indels within any window, minimal or no recovery of full-length STMN2 was observed. Guides G7–G9 are shown. [Figure 5D] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. Guides that did not induce indels within any window showed minimal or no recovery of full-length STMN2. Guides G10, G11, and G50 are shown. [Figure 5E] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. For guides that did not induce indels within any window, minimal or no recovery of full-length STMN2 was observed. Guides G51–G53 are shown. [Figure 5F] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), while the y-axis shows the number of NGS reads. For guides that did not induce indels within any window, minimal or no recovery of full-length STMN2 was observed. Guides G54–G56 are shown. [Figure 5G] Figure 1 shows the location of indels induced by specific guides within the STMN2 amplicon (x-axis), with the y-axis showing the number of NGS reads. Minimal or no recovery of full-length STMN2 was observed for guides that did not induce indels within any window. Guides G57 and G58 are shown. The base pair (bp) numbers for indel positions on the x-axis are relative to SEQ ID NO: 1. 3' splice site: positions 99-104 (region defined by solid line, sequence TTGCAG); optimal 10-base window identified: positions 106-115 (region defined by dashed line, with sequence ACTCGGCAGA (SEQ ID NO: 2)). See SEQ ID NO: 1 below. [Figure 6]FIG. 1 shows RNA guides (marked in bold in Table 6) that resulted in more than 5% motif disruption. [Figure 7A] A diagram showing the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_1. [Figure 7B] A diagram showing the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_3. [Figure 7C] FIG. 10 shows the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), indicating the location of the indel induced by guide A_STMN2_Splice2a_2. [Figure 7D] A diagram showing the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_4. [Figure 7E] FIG. 10 shows the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_5. [Figure 7F] A diagram showing the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_7. [Figure 7G] A diagram showing the location of indels induced by specific guides shown relative to nuclease A within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide A_STMN2_Splice2a_6. [Figure 8A]A diagram showing the location of indels induced by specific guides shown relative to nuclease C within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide C_STMN2_Splice2a_36. [Figure 8B] A diagram showing the location of indels induced by specific guides shown relative to nuclease C within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide C_STMN2_Splice2a_38. [Figure 8C] A diagram showing the location of indels induced by specific guides shown relative to nuclease C within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide C_STMN2_Splice2a_37. [Figure 8D] A diagram showing the location of indels induced by specific guides shown relative to nuclease C within the STMN2 amplicon (x-axis). The location of the indel induced by guide C_STMN2_Splice2a_39 is shown. [Figure 8E] A diagram showing the location of indels induced by specific guides shown relative to nuclease C within the STMN2 amplicon (x-axis), showing the location of the indel induced by guide C_STMN2_Splice2a_43. [Figure 9A] FIG. 1 shows that the increase in STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides are shown in relation to nuclease A in SH-SY5Y cells. A 3-fold TDP-43 knockdown was observed in SH-SY5Y cells using siTDP-43 RNA. [Figure 9B]FIG. 1 shows that the increased production of STMN2 exon 2A splice variant caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides are shown in conjunction with nuclease A in SH-SY5Y cells. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in an 80-fold increase in STMN2 exon 2A splice variant. [Figure 9C] Figure 1 shows that the increased production of STMN2 exon 2A splice variant caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. Figure 1 shows the locations of indels induced by specific guides shown in conjunction with nuclease A in SH-SY5Y cells. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in a greater than 7.5-fold reduction in STMN2 full-length transcript. [Figure 9D] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. FIG. 2 shows the location of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells. FIG. 3 shows the indel activity of nuclease A in SH-SY5Y cells. [Figure 9E] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_1 indicated. [Figure 9F]FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_2 indicated. [Figure 9G] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_3. [Figure 9H] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_4. [Figure 9I] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_5 indicated. [Figure 9J] FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_6 indicated. [Figure 9K]FIG. 1 shows that the increased STMN2 exon 2A splice variant production caused by TDP-43 knockdown was restored by 3' splice site editing as disclosed herein. The locations of indels induced by specific guides shown in relation to nuclease A in SH-SY5Y cells are shown, with guide A_STMN2_Splice2a_7. [Figure 10A] Figure 1 shows that a gene editing system containing nuclease A or nuclease D and an exemplary gRNA targeting the 3' splice site effectively restored the increased production of the STMN2 exon 2A splice variant due to TDP-43 knockdown. Figure 1 shows that 3- and 5-fold TDP-43 knockdown was observed in SH-SY5Y cells using siTDP-43RNA when co-nucleofected with RNPs containing the indicated type V CRISPR nuclease variants. [Figure 10B] FIG. 1 shows that a gene editing system containing nuclease A or nuclease D and an exemplary gRNA targeting the 3' splice site effectively restored the increased production of the STMN2 exon 2A splice variant due to TDP-43 knockdown. Knocking down TDP-43 in the presence of a non-targeting control RNP complex resulted in a 120- and 130-fold increase in the STMN2 exon 2A splice variant when co-nucleofected with RNPs containing type V CRISPR nuclease variants as indicated. [Figure 10C] Figure 1 shows that a gene editing system containing nuclease A or nuclease D and an exemplary gRNA targeting the 3' splice site effectively restored the increased production of the STMN2 exon 2A splice variant due to TDP-43 knockdown. Figure 2 shows that siTDP-43 knockdown and RNPs containing the indicated type V CRISPR nuclease variants resulted in an 8-fold and 10-fold reduction in STMN2 full-length transcripts. [Figure 11A]Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in conjunction with Cas12i2 in motor neurons, demonstrating an inverse correlation between motif disruption-associated reduction in truncated exon 2a STMN2 transcripts and increase in full-length STMN2 transcripts. [Figure 11B] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in conjunction with Cas12i2 in motor neurons, demonstrating an inverse correlation between motif disruption-associated reduction in truncated exon 2a STMN2 transcripts and increase in full-length STMN2 transcripts. [Figure 11C] Figure 1 shows splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, as well as the location of indels induced by specific guides shown in conjunction with Cas12i2 in motor neurons, demonstrating that indel activity in motor neurons correlates with restoration of full-length STMN2 transcripts. gNT: non-targeting guide control. [Figure 11D] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, as well as the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_4 (G4) is shown. [Figure 11E] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, as well as the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_8 (G8) is shown. [Figure 11F]Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_9 (G9) is shown. [Figure 11G] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, as well as the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_10 (G10) is shown. [Figure 11H] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_50 (G50) is shown. [Figure 11I] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_51 (G51) is shown. [Figure 11J] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_52 (G52) is shown. [Figure 11K] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_53 (G53) is shown. [Figure 11L]Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_54 (G54) is shown. [Figure 11M] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_55 (G55) is shown. [Figure 11N] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_56 (G56) is shown. [Figure 11O] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_57 (G57) is shown. [Figure 11P] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing in human motor neurons, and the location of indels induced by specific guides shown in association with Cas12i2 in motor neurons. Guide STMN2_Splice2a_58 (G58) is shown. [Figure 12A] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in association with the nuclease, demonstrating an inverse correlation between motif disruption-associated reduction in truncated exon 2a STMN2 transcripts and increase in full-length STMN2 transcripts. [Figure 12B]Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in association with the nuclease, demonstrating an inverse correlation between motif disruption-associated reduction in truncated exon 2a STMN2 transcripts and increase in full-length STMN2 transcripts. [Figure 12C] Figure 1 shows splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown relative to the nuclease, demonstrating that indel activity in motor neurons correlates with restoration of full-length STMN2 transcripts. gNT: non-targeting guide control. [Figure 12D] Figure 1 illustrates splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, as well as the location of indels induced by specific guides shown in association with the nuclease. Figure 2 illustrates STMN2 motif disruption in motor neurons analyzed by digital droplet polymerase chain reaction (ddPCR) assay. [Figure 12E] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_1. [Figure 12F] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_2. [Figure 12G]Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_3. [Figure 12H] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_4. [Figure 12I] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_5. [Figure 12J] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_6. [Figure 12K] Diagram showing splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the location of indels induced by specific guides shown in relation to the nuclease, guide A_STMN2_Splice2a_7. [Figure 12L] FIG. 1 shows splice motif disruption and restoration of STMN2 aberrant splicing by nuclease A in human motor neurons, and the locations of indels induced by specific guides shown in relation to the nuclease. Controls are shown. [Figure 13A]Images and diagram illustrating phenotypic rescue in human motor neurons after restoration of STMN2 aberrant splicing by Cas12i2 and RNA guide G55. Representative images are shown from different conditions tested, including TDP43 knockdown and the presence or absence of a non-targeting control guide or guide 55. Cells are stained for B3-tubulin and STMN2, and nuclei are stained with Hoechst. [Figure 13B] Images and diagram illustrating phenotypic rescue in human motor neurons after restoration of STMN2 aberrant splicing by Cas12i2 and RNA-guided G55. Figure showing restoration of neuronal length and increase in STMN2-positive neurons observed after RNA-guided G55 treatment. [Figure 13C] Images and diagram illustrating phenotypic rescue in human motor neurons after restoration of STMN2 aberrant splicing by Cas12i2 and RNA-guided G55, showing that RNA-guided G55 treatment did not affect cell number. gNT: non-targeted guide control. [Figure 13D] Images and diagram illustrating phenotypic rescue in human motor neurons after restoration of STMN2 aberrant splicing by Cas12i2 and RNA-guided G55. Figure showing restoration of neuronal length and increase in STMN2-positive neurons observed after RNA-guided G55 treatment. [Figure 14A] Figure 1 shows gene editing of the STMN2 gene in mice delivered via AAV vector by gene editing described herein; Figure 2 shows quantification of AAV vector genomes, disruption of splice motifs, and restoration of STMN2 missplicing in vivo; and Figure 3 shows the number of VGs per diploid genome observed in mice injected ICV with four different vectors. [Figure 14B]Figure 1 shows gene editing of the STMN2 gene in mice delivered via AAV vector by gene editing described herein; Figure 2 shows quantification of AAV vector genome, disruption of splice motif, and restoration of STMN2 mis-splicing in vivo; Figure 3 shows motif disruption in vivo after injection of the tested vector. [Figure 14C] Figure 1 shows gene editing of the STMN2 gene in mice delivered via AAV vector by gene editing described herein; Figure 2 shows quantification of AAV vector genome, disruption of splice motifs, and restoration of STMN2 mis-splicing in vivo; Figure 3 shows reduction of truncated exon 2a STMN2 transcript in vivo after injection of the tested vectors. [Figure 14D] Figure 1 shows gene editing of the STMN2 gene in mice delivered via AAV vector using the gene editing methods described herein; Figure 2 shows quantification of the AAV vector genome, disruption of splice motifs, and restoration of STMN2 mis-splicing in vivo; Figure 3 shows an increase in full-length STMN2 transcripts in vivo after injection of the tested vectors. [Figure 14E] FIG. 1 shows gene editing of the STMN2 gene in mice delivered via an AAV vector by gene editing described herein. FIG. 2 shows the correlation between editing rate and STMN2 transcript levels in mice injected with nuclease A+g4. The correlation between editing rate and exon 2a STMN2 transcript is shown. [Figure 14F] FIG. 1 shows gene editing of the STMN2 gene in mice delivered via an AAV vector by gene editing described herein. FIG. 2 shows the correlation between editing rate and STMN2 transcript levels in mice injected with nuclease A+g4. FIG. 3 shows the correlation between editing rate and full-length STMN2 transcript levels. [Figure 14G](B) Gene editing of the STMN2 gene in mice delivered via an AAV vector by gene editing described herein. (C) Correlation between editing rate and STMN2 transcript levels in mice injected with nuclease A+g4, showing an inverse correlation between exon 2a STMN2 transcripts and full-length STMN2 transcripts. Control group: Mice injected with vehicle ICV. DETAILED DESCRIPTION OF THE INVENTION

[0034] Stathmin-2 (STMN2) (also known as SCG10) is a microtubule-associated protein abundant in the brain. STMN2 plays a critical role in promoting microtubule instability, which is necessary for normal axon outgrowth and regeneration. STMN2 expression is strongly regulated by the nuclear transactive response DNA-binding protein 43 kDa (TDP-43). TDP-43 binds to a site within intron 1 of the STMN pre-mRNA and regulates the production of functional STMN2 transcripts and, ultimately, functional STMN2 protein. Certain diseases, such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), are associated with loss of nuclear TDP-43, which causes aberrant splicing of STMN2, producing a nonfunctional transcript containing the cryptic exon 2a. Melamed et al., Nat. Neurosci. 2019 22(2):180-190.

[0035] It is reported herein that disrupting the 3' splice site within intron 1 (e.g., adjacent to cryptic exon 2a) and / or the region downstream and adjacent to the 3' splice site by gene editing significantly inhibits aberrant splicing of STMN2 and improves production of functional STMN2 transcripts (encoding functional STMN2 protein). Accordingly, methods and gene editing systems (e.g., including type V CRISPR nucleases) designed to inhibit or prevent aberrant splicing of STMN2 are provided herein. Such methods and gene editing systems may alleviate motor neuron dysfunction in diseases associated with aberrant splicing of STMN2, such as ALS and FTD.

[0036] I. Gene editing in the STMN2 gene to inhibit aberrant splicing The human STMN2 gene is located at 8q21.13. Reference is made to Gene ID: 11075 (ncbi.nlm.nih.gov / gene / 11075), which provides the sequence of the entire human STMN2 gene, the relevant disclosure of which is incorporated by reference for the subject matter and purposes referred to herein.

[0037] Provided herein is a method for gene editing at a specific location in intron 1 of STMN2 to inhibit or prevent aberrant splicing and increase production of functional STMN2 transcripts, and thus functional STMN2 protein. As used herein, "aberrant splicing of STMN2" refers to an RNA splicing event that produces a non-functional transcript containing the cryptic exon 2a. Due to the presence of a premature stop codon and premature poly(A) site in exon 2a (see below), the non-functional transcript will lead to the production of a truncated, non-functional STMN2 protein.

[0038] (a) Targeting of genetic sites In some embodiments, locations within intron 1 for gene editing include a 3' splice site within intron 1 of the STMN2 gene (e.g., a 3' splice site adjacent to and upstream of exon 2a sequence), a region within intron 1 adjacent to and downstream of the 3' splice site, or a combination thereof, where the gene editing results in the reduction or elimination of aberrant splicing of STMN2. For reference purposes, the nucleotide sequence of a fragment of STMN2 intron 1 is provided below:

[0039] [ka] (SEQ ID NO: 1) In the above sequence, the 3' splice site, TTGCAG, is shown in bold and underlined. The intron 1 region adjacent to and downstream of the 3' splice site, ACTCGGCAGA (SEQ ID NO: 2), also known as the optimal 10-base window (also known as the optimal disruption window), is shown in bold and italicized. Cryptic exon 2a begins with the "G" residue following the 3' splice site. Additionally, the premature stop codon, TAG (which would result in a truncated STMN2 protein if aberrant splicing occurs), and the premature poly(A) site, ATTAAA, are underlined.

[0040] In some embodiments, the gene editing methods disclosed herein target the 3' splice site, for example, by deleting one or more nucleotides at the 3' splice site, thereby disrupting its function as a 3' splice site. In other embodiments, the gene editing methods disclosed herein target the region adjacent to the 3' splice site, for example, by deleting one or more nucleotides within this region. In a specific example, the gene editing methods disclosed herein target both the 3' splice site and the downstream adjacent region, resulting in the deletion of one or more nucleotides in both regions.

[0041] As provided herein, targeting the 3' splice site, the optimal 10-base window, or both is expected to reduce the production of exon 2a-containing splice variants and increase the production of full-length STMN2 transcripts.

[0042] As used herein, the term "adjacent" refers to a nucleotide or amino acid sequence that is adjacent to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent (i.e., directly adjacent) to another nucleotide sequence if there are no nucleotides separating the two sequences. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if the two sequences are separated by a small number of nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by a maximum of 2 nucleotides, a maximum of 5 nucleotides, a maximum of 8 nucleotides, or a maximum of 10 nucleotides.

[0043] As used herein, the terms "upstream" and "downstream" refer to relative positions within a single nucleic acid (e.g., DNA) sequence. "Upstream" and "downstream" refer to the 5' to 3' direction in which RNA transcription occurs, respectively. When the 3' end of a first sequence occurs before the 5' end of a second sequence, the first sequence is upstream of the second sequence. When the 5' end of a first sequence occurs after the 3' end of the second sequence, the first sequence is downstream of the second sequence.

[0044] In other embodiments, the gene editing systems provided herein (e.g., comprising a type V nuclease having an amino acid sequence at least 90% identical to SEQ ID NO:4) can target genomic sites within the STMN2 gene to reduce production of exon 2a-containing splice variants. In some instances, such gene editing systems can target genomic sites within the STMN2 gene to disrupt expression of the STMN2 gene.

[0045] In other embodiments, the gene editing systems provided herein (e.g., comprising a type V nuclease having an amino acid sequence at least 90% identical to SEQ ID NO:4) can target genomic sites within the STMN2 gene to reduce production of exon 2a-containing splice variants. In some instances, such gene editing systems can target genomic sites within the STMN2 gene to disrupt expression of the STMN2 gene.

[0046] As disclosed herein, gene editing methods can result in gene editing at target positions.As used herein, the term "editing" refers to the introduction of one or more modifications into one or more target positions in the STMN2 gene.Editing can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof.As used herein, the term "substitution" refers to the replacement of a nucleotide or group of nucleotides with a different nucleotide or group of nucleotides compared to a reference sequence.As used herein, the term "insertion" refers to the gain of a nucleotide or group of nucleotides in a nucleic acid sequence compared to a reference sequence.As used herein, the term "deletion" refers to the loss of a nucleotide or group of nucleotides in a nucleic acid sequence compared to a reference sequence.

[0047] The gene editing methods disclosed herein, as also disclosed herein, can be performed on suitable cells (e.g., cells that produce STMN2 and may produce, or are at risk of producing, a non-functional transcript due to an aberrant splicing event) to edit a specific genetic location within intron 1 of STMN2. In some embodiments, suitable cells can be neuronal cells obtained from a human patient with a disease involving aberrant splicing of STMN2, such as ALS or FTD. In some instances, gene editing can be performed on cultured cells in vitro. Alternatively, gene editing can be performed in vivo to edit cells (e.g., neuronal cells) in a subject in need thereof (e.g., a human patient with ALS or FTD).

[0048] (ii) Gene editing method Gene editing of the STMN2 gene at the specific locations described herein can be achieved by gene editing systems known in the art, such as CRISPR / Cas-mediated gene editing systems (including, for example, CRISPR nucleases such as V-type nucleases), zinc finger nuclease (ZFN)-mediated gene editing systems, or transcription activator-like effector nuclease (TALEN)-mediated gene editing systems. Additional examples include the DICE (dual integrase cassette exchange) system, which utilizes phiC31 and Bxb1 integrases.

[0049] In some embodiments, gene editing of the STMN2 gene disclosed herein is achieved using a gene editing system comprising a CRISPR nuclease and one or more guide RNAs targeted to suitable genomic locations within the STMN2 gene, allowing for the introduction of desired edits at desired locations, including the 3' splice site and / or a 10-base downstream window, as disclosed herein. "CRISPR nuclease" refers to an RNA-guided effector that can bind to nucleic acids and introduce single- or double-strand breaks. In some embodiments, the CRISPR nuclease may be a type II CRISPR nuclease, which refers to a nuclease containing a RuvC domain and an HNH domain. The type II nuclease may be a type II-A nuclease, a type II-B nuclease, or a type II-C nuclease. In some embodiments, the type II nuclease requires a tracrRNA. In some embodiments, the type II nuclease is a Cas9 polypeptide. The Cas9 polypeptide cleaves double-stranded DNA targets or may be a nickase. In other embodiments, the CRISPR nuclease may be a type V CRISPR nuclease (see detailed disclosure below). In some embodiments, the CRISPR nuclease is an effector described in Makarova et al., "Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?" CRISPRJ.1(5):325-36 (2018).

[0050] In addition to the CRISPR methods disclosed herein, additional gene editing methods known in the art can be used to generate the genetically engineered T cells disclosed herein. Some examples include gene editing approaches involving zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), restriction endonucleases, meganuclease homing endonucleases, etc.

[0051] ZFN is a targeted nuclease that includes a nuclease fused to a zinc finger DNA binding domain (ZFBD), where ZFBD is a polypeptide domain that binds to DNA in a sequence-specific manner through one or more zinc fingers. The zinc finger is a domain of about 30 amino acids within the zinc finger binding domain, whose structure is stabilized by the coordination of zinc ions. Examples of zinc fingers include, but are not limited to, C2H2 zinc finger, C3H zinc finger, and C4 zinc finger. Designed zinc finger domains are domains that do not exist in nature, and their design / composition is primarily derived from rational criteria (for example, the application of substitution rules and computerized algorithms to process information in databases that store information on existing ZFP designs and binding data). For example, see U.S. Patent Nos. 6,140,081, 6,453,242, and 6,534,261, as well as International Publication Nos. 98 / 53058, 98 / 53059, 98 / 53060, 02 / 016536, and 03 / 016496. The selected zinc finger domain is a domain that does not exist in nature, and its production mainly results from empirical processes such as phage display, interaction trap, or hybrid selection. ZFN is described in more detail in U.S. Patent No. 7,888,121 and U.S. Patent No. 7,972,854. The most recognized example of ZFN is the fusion of FokI nuclease and zinc finger DNA binding domain.

[0052] TALENs are targeted nucleases containing a nuclease fused to a TAL effector DNA-binding domain. A "transcription activator-like effector DNA-binding domain," "TAL effector DNA-binding domain," or "TALE DNA-binding domain" is a polypeptide domain of a TAL effector protein responsible for binding to DNA. TAL effector proteins are secreted by plant pathogenic fungi of the genus Xanthomonas during infection. These proteins enter the nucleus of plant cells, bind to effector-specific DNA sequences via their DNA-binding domain, and activate gene transcription in these sequences via their transcription activation domain. The specificity of the TAL effector DNA-binding domain depends on a variable number of imperfect 34-amino acid repeats in the effector, which contain polymorphisms at selected repeat positions called repeat variable residues (RVDs). TALENs are described in further detail in U.S. Patent Application Publication No. 2011 / 0145940. The best known example of a TALEN in the art is a fusion polypeptide of a FokI nuclease to a TAL effector DNA binding domain.

[0053] Additional examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wβ / SPBc / TP901-1, which may be used individually or in combination.

[0054] Any of the nucleases disclosed herein can be delivered using vector systems, including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors, poxvirus vectors, herpesvirus vectors, and adeno-associated virus vectors, as well as combinations thereof. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids encoding nucleases and gRNAs into cells (e.g., T cells). In some examples, the gene editing system disclosed herein or its components (e.g., nucleases therein) can be delivered via an AAV vector, which may be a specific serotype (e.g., AAVrhlO) capable of infecting neuronal cells. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes and poloxamers. Viral vector delivery systems include DNA and RNA viruses that have either episomal or integrated genomes after delivery to cells. Non-viral methods for nucleic acid delivery include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid complexes, naked DNA, naked RNA, capped RNA, artificial virions, and drug-enhanced DNA uptake. Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Some specific examples are provided below.

[0055] Alternatively, the nucleases disclosed herein may be delivered by mRNA that may be associated with or encapsulated by lipid nanoparticles (LNPs).

[0056] To carry out the gene editing methods disclosed herein, a suitable gene editing system as disclosed herein can be delivered or introduced into a cell population (e.g., neuronal cells). In some instances, cells containing the desired gene edits can be collected and optionally cultured and expanded in vitro.

[0057] II. Type V nuclease-containing gene editing system In some embodiments, the present disclosure provides a CRISPR-type V nuclease-mediated gene editing system for introducing an edit (e.g., a deletion) at a desired genetic location in the STMN2 gene as disclosed herein, wherein the gene editing system includes an optimal 10-base window downstream of and adjacent to (upstream of) the 3' splice site of cryptic exon 2a within intron 1, thereby reducing or preventing incorporation of cryptic exon 2a and increasing production of a functional STMN2 transcript. In some embodiments, the CRISPR-type V nuclease-mediated gene editing system includes a type V nuclease or a nucleic acid encoding the nuclease and one or more nucleic acids encoding one or more RNA guides, or one or more gRNAs also disclosed herein, that target suitable genomic sites within the STMN2 gene (e.g., within intron 1).

[0058] (i) Type V nuclease As used herein, the terms "V-type" and "V-type nuclease" refer to an RNA-guided CRISPR nuclease having a RuvC domain. In some embodiments, a V-type nuclease does not require a tracrRNA. In some embodiments, a V-type nuclease requires a tracrRNA. In some embodiments, a V-type nuclease is a Cas12 polypeptide, such as a Cas12a (Cpf1), Cas12b (C2c1), Cas12c, Cas12d, Cas12e, Cas12f, Cas12h, Cas12i, or Cas12j (CasPhi) polypeptide.

[0059] (a) Cas12i nuclease As used herein, "Cas12i nuclease" (also referred to herein as Cas12i) refers to a polypeptide that binds to a target sequence on a target nucleic acid specified by an RNA guide, wherein the polypeptide has at least some amino acid sequence homology to a wild-type Cas12i nuclease. Such Cas12i polypeptides are known in the art or disclosed herein. See, e.g., WO2021 / 202800 and WO2022256440, the relevant disclosures of each of which are incorporated by reference for the subject matter and purposes disclosed herein.

[0060] In some embodiments, the Cas12i nuclease is a Cas12i2 polypeptide. By way of example, a Cas12i2 polypeptide for use in the gene editing systems and methods disclosed herein may comprise any of the following amino acid sequences: [ka] [ka] (SEQ ID NO: 266)

[0061] In some instances, the Cas12i2 polypeptide can comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 3 or SEQ ID NO: 266. In one example, the Cas12i2 polypeptide comprises the amino acid sequence of SEQ ID NO: 3. In another example, the Cas12i2 polypeptide comprises the amino acid sequence of SEQ ID NO: 266.

[0062] The "percent identity" (also known as sequence identity) of two nucleic acid or two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990 (modified by Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993). Such an algorithm has been incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program (score = 100, word length = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program (score = 50, word length = 3) to obtain amino acid sequences homologous to the protein molecules of the invention. When gaps exist between the two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0063] In some instances, the Cas12i2 polypeptide may contain one or more conservative amino acid substitutions compared to SEQ ID NO: 3. In some instances, the Cas12i2 polypeptide may contain one or more conservative amino acid substitutions compared to SEQ ID NO: 266. As used herein, a "conservative amino acid substitution" refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, such as those described in documents such as Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M.A.usubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative substitutions of amino acids include substitutions made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0064] (b) Other V-type nucleases Other V-type nucleases can also be used in the gene editing system and method disclosed herein.Examples of suitable V-type nucleases can be found in WO2019178427, WO2021202800, WO2021050534, WO2022192391, WO2024020567, WO2022192381, WO2024020557, WO2020018142 and WO2023039472, the relevant disclosures of which are incorporated by reference for the purposes and purposes referred to herein.Specific examples of V-type nucleases are shown in Table 1 below, and all of these are within the scope of the present disclosure.

[0065] In some instances, a type V nuclease may comprise an amino acid sequence that is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. Alternatively or additionally, a type V nuclease may comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 4. In a specific example, a type V nuclease comprises the amino acid sequence of SEQ ID NO: 4 (nuclease A listed in Table 1 below). In a specific example, a type V nuclease comprises the amino acid sequence of SEQ ID NO: 255 (nuclease D listed in Table 1 below).

[0066] In some instances, a type V nuclease may comprise an amino acid sequence at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5. Alternatively or additionally, a type V nuclease may comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 5. In a specific example, a type V nuclease comprises the amino acid sequence of SEQ ID NO: 5 (nuclease B listed in Table 1 below).

[0067] In some instances, a type V nuclease may comprise an amino acid sequence at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 6. Alternatively or additionally, a type V nuclease may comprise one or more conservative amino acid substitutions relative to SEQ ID NO: 6 (Nuclease C listed in Table 1 below). Table 1. Amino acid sequences of exemplary type V nucleases [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0068] Any of the type V nuclease polypeptides provided herein, e.g., Cas12i2 nuclease or other type V nucleases provided herein, can include one or more nuclear localization signals (NLS), e.g., at the N-terminus, C-terminus, or both.

[0069] (c) Preparation of type V nuclease In some embodiments, a type V nuclease, such as the Cas12i2 polypeptide disclosed herein or other type V nucleases (as well as any suitable nucleases for use in gene editing known in the art or disclosed herein) can be prepared by (a) culturing a host cell, such as a bacterial cell or a mammalian cell, capable of producing the protein, isolating the protein so produced, and optionally purifying the protein. The nuclease can also be prepared by (b) known genetic engineering techniques, specifically by isolating a gene encoding the nuclease from bacteria, constructing a recombinant expression vector, and then introducing the vector into a suitable host cell that expresses a guide RNA that forms a complex with the nuclease in the host cell. Alternatively, the nuclease can be prepared by (c) an in vitro coupled transcription-translation system, where the nuclease then forms a complex with a guide RNA.

[0070] Unless otherwise specified, all compositions, complexes, and polypeptides provided herein are made with reference to the activity level of the composition, complex, or polypeptide, and do not include impurities such as residual solvents or by-products that may be present in commercially available sources. The weight of the enzyme component is based on the total active protein. All percentages and ratios are calculated by weight unless otherwise specified. All percentages and ratios are calculated based on the total composition unless otherwise specified. In the exemplified compositions, the enzyme level is expressed by the pure enzyme relative to the weight of the total composition, and the components are expressed by the weight of the total composition unless otherwise specified.

[0071] vector The gene editing system disclosed herein may comprise a nucleic acid encoding a type V CRISPR nuclease. In some embodiments, the nucleic acid is a vector comprising a nucleotide sequence encoding a type V CRISPR nuclease. In some examples, the nucleotide sequence encoding a type V CRISPR nuclease may be operably linked to a promoter (e.g., synapsin 1 promoter). In some embodiments, the vector is an adeno-associated virus (AAV) vector, for example, an AAV vector of a suitable serotype that can infect neuronal cells. In one example, the AAV vector may be an AAVrhlO vector.

[0072] The present disclosure provides one or more vectors for expressing the type V nucleases disclosed herein (as well as other suitable nucleases similarly disclosed herein). In some embodiments, the vectors disclosed herein comprise a nucleotide sequence encoding the nuclease. The present disclosure also provides one or more vectors encoding a guide RNA. In some embodiments, the vector comprises a U6 promoter, a synapsin promoter, a Pol II promoter, and / or a Pol III promoter.

[0073] The expression of natural or synthetic polynucleotides is usually achieved by operably linking a polynucleotide encoding a gene of interest, such as a nucleotide sequence encoding a V-type nuclease, to a promoter, and incorporating the resulting construct into an expression vector. The expression vector is not particularly limited, as long as it contains a polynucleotide encoding a nuclease and / or a guide RNA, and can be suitable for replication and integration in eukaryotic cells.

[0074] Typical expression vectors include transcription and translation terminators, initiation sequences, and promoters useful for expressing the desired polynucleotide. For example, plasmid vectors (pSP64, pBluescript, etc.) carrying RNA polymerase recognition sequences can be used. Vectors, including those derived from retroviruses such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow long-term and stable integration of the transgene and proliferation in daughter cells. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. Expression vectors can be provided to cells in the form of viral vectors.

[0075] Viral vector technology is well known in the art and can be found in various virology and molecular biology manuals.Viruses useful as vectors include, but are not limited to, phage virus, retrovirus, adenovirus, adeno-associated virus, herpes virus and lentivirus.Generally, suitable vectors comprise a replication origin that functions in at least one organism, a promoter sequence, convenient restriction endonuclease site and one or more selectable markers.

[0076] The type of vector is not particularly limited, and a vector that can be expressed in a host cell can be appropriately selected. More specifically, a promoter sequence that ensures expression of a polypeptide(s) from a polynucleotide is appropriately selected depending on the type of host cell, and the promoter sequence and polynucleotide are inserted into any of various plasmids for preparing an expression vector.

[0077] Additional promoter elements, such as enhancer sequences, regulate the frequency of transcription initiation. Typically, these are located 30–110 bp upstream of the start site, although many promoters have recently been shown to contain functional elements downstream of the start site. Depending on the promoter, individual elements appear to function cooperatively or independently to activate transcription.

[0078] Furthermore, the present disclosure should not be limited to the use of constitutive promoters.Inducible promoters are also contemplated as part of the present disclosure.The use of inducible promoters provides a molecular switch, which can turn on the expression of the polynucleotide sequence to which it is operably linked when expression is desired, or turn off expression when expression is undesirable.Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0079] In some embodiments, the expression vectors provided herein may contain a nucleotide sequence encoding any of the type V nucleases disclosed herein (e.g., SEQ ID NO:3, SEQ ID NO:266, or SEQ ID NO:4) and a nucleotide sequence encoding a guide RNA also disclosed herein. For example, an expression vector may contain a nucleotide sequence encoding a type V nuclease of SEQ ID NO:3 or SEQ ID NO:266 and a nucleotide sequence encoding a guide of G53, G55, or G56. In other examples, an expression vector may contain a nucleotide sequence encoding a type V nuclease of SEQ ID NO:4 or SEQ ID NO:255 and a nucleotide sequence encoding a guide of A_STMN2_Splice2a_4 or A_STMN2_Splice2a_3. In some instances, the nuclease coding sequence and the gRNA coding sequence may each be operably linked to a suitable promoter. For example, the nuclease coding sequence may be operably linked to a synapsin 1 promoter, and the gRNA coding sequence may be operably linked to a U6 promoter.

[0080] The introduced expression vector can also contain a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a cell population to be transfected or infected via a viral vector. In other embodiments, the selectable marker can be carried on a separate DNA fragment and used in a cotransfection procedure. Both the selectable marker and the reporter gene can be flanked by appropriate transcriptional regulatory sequences to enable expression in the host cell. Examples of such markers include the dihydrofolate reductase gene and neomycin resistance gene for eukaryotic cell culture, and the tetracycline resistance gene and ampicillin resistance gene for culturing E. coli and other bacteria. The use of such selectable markers can confirm that a polynucleotide encoding a polypeptide(s) of the present invention has been introduced into a host cell and subsequently expressed.

[0081] The method for preparing a recombinant expression vector is not particularly limited, and examples thereof include methods using a plasmid, a phage, or a cosmid.

[0082] Method of Expression The present disclosure includes methods for expressing type V nucleases (and other suitable nucleases) in a host cell of interest.

[0083] In some embodiments, the host cells described herein are used to express type V nucleases (and other suitable nucleases) and / or guide RNAs. The host cells are not particularly limited, and various known cells can be suitably used. Specific examples of host cells include bacteria such as Escherichia coli, yeast (Saccharomyces cerevisiae, and Schizosaccharomyces pombe), Caenorhabditis elegans, Xenopus laevis oocytes, and animal cells (e.g., CHO cells, COS cells, and HEK293 cells). The method for introducing the expression vector into the host cells, i.e., the transformation method, is not particularly limited, and known methods such as electroporation, calcium phosphate method, liposome method, and DEAE-dextran method can be used.

[0084] After transforming a host with an expression vector, the host cells may be cultured, cultivated, or grown to produce the V-type nuclease and / or guide RNA. After expression of the nuclease and / or guide RNA, the host cells may be harvested, and the nuclease and / or guide RNA may be purified from the culture or the like using conventional methods (e.g., filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).

[0085] Various methods can be used to determine the production level of mature type V nuclease (or other suitable nuclease) and / or guide RNA in a host cell. Such methods include, but are not limited to, methods utilizing protein-specific polyclonal or monoclonal antibodies or any of the labeling tags described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (MA), fluorescent immunoassay (FIA), and fluorescence-activated cell sorting (FACS). These and other assays are well known in the art (see, e.g., Maddox et al., J. Exp. Med. 158:1211

[1983] ).

[0086] The present disclosure provides methods for expressing a nuclease and / or guide RNA in a cell (e.g., a neuronal cell) in vivo. Such methods may include providing a suitable cell (e.g., a neuronal cell) with polyribonucleotides encoding the nuclease and / or guide RNA. Expression of the nuclease and guide RNA in the cell may result in desired gene editing in the cell. In some examples, the type V nuclease and gRNA disclosed herein may be delivered to a host cell (e.g., a neuronal cell, such as a motor neuron cell) via one or more viral vectors, such as an AAV vector (e.g., AAVrhlO). In some examples, expression of the type V nuclease in the neuronal cell may be under the control of a suitable promoter, such as the synapsin 1 promoter. In some examples, expression of the gRNA nuclease in the neuronal cell may be under the control of a suitable promoter, such as the synapsin 1 promoter or the U6 promoter.

[0087] (ii) Guide RNA (gRNA) All gene editing systems disclosed herein include one or more guide RNAs (gRNAs) that target suitable genomic sites within the STMN2 gene (e.g., within intron 1 of the STMN2 gene), resulting in gene editing at the desired location of STMN2, including the 3' splice site within intron 1 (to encompass cryptic exon 2a) and the 10-base downstream window disclosed herein. See SEQ ID NO: 1 provided above. The gRNA mediates cleavage of the target nucleic acid via a CRISPR nuclease, also included in the gene editing system. The RNA guide (or gRNA) includes a nuclease-binding sequence and a DNA-binding sequence (spacer). The nuclease-binding sequence may include one or more binding sites that can be recognized by the CRISPR nuclease for binding. In some instances, the gRNA is a single RNA molecule that includes both the nuclease-binding sequence and the spacer. Alternatively, the gRNA may include the nuclease-binding sequence and the spacer as two separate RNA molecules.

[0088] As used herein, the term "RNA guide" or "RNA guide sequence" refers to an RNA molecule that facilitates targeting of a CRISPR nuclease described herein to a desired genomic site. For example, an RNA guide can be a molecule that recognizes (e.g., binds to) a site in a non-PAM strand that is complementary to a target sequence in the PAM strand, e.g., designed to be complementary to a specific nucleic acid sequence. An RNA guide can include a spacer sequence and a nuclease binding sequence (e.g., a direct repeat (DR) sequence). The terms "CRISPR RNA (crRNA)," "crRNA precursor," and "mature crRNA" are also used herein to refer to an RNA guide. The 5' or 3' end of the RNA guide can be fused to the RT donor RNA disclosed herein.

[0089] As used herein, the term "protospacer adjacent motif" or "PAM sequence" refers to a DNA sequence adjacent to a target sequence. In some embodiments, the PAM sequence is required for enzymatic activity. In a double-stranded DNA molecule, the strand containing the PAM motif is referred to as the "PAM strand," and the complementary strand is referred to as the "non-PAM strand." The RNA guide binds to a site in the non-PAM strand that is complementary to the target sequence disclosed herein, and the PAM sequence described herein is present in the PAM strand.

[0090] As used herein, the term "PAM strand" refers to the strand of a target nucleic acid (duplex) that contains a PAM motif. In some embodiments, the PAM strand is the coding (e.g., sense) strand. In other embodiments, the PAM strand is the non-coding (e.g., antisense) strand. The term "non-PAM strand" refers to the complementary strand of the PAM strand.

[0091] A guide RNA typically comprises a spacer sequence and a scaffold sequence. The spacer sequence (also known as a DNA-binding sequence) is an RNA version of a target sequence (DNA sequence). The spacer comprises a sequence that can bind to the non-PAM strand through base pairing at a site complementary to the target sequence (in the PAM strand). Such a spacer is also known as being specific for the target sequence. In some instances, the spacer can be at least 75% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) to the target sequence, excluding differences between the RNA and DNA sequences. In some instances, the spacer can be 100% identical to the target sequence, excluding differences between the RNA and DNA sequences. The scaffold sequence comprises a motif that can be recognized by a nuclease (e.g., a V-type nuclease as disclosed herein).

[0092] As used herein, the term "target sequence" refers to a DNA fragment adjacent to a PAM motif (on the PAM strand). The complementary region of the target sequence is on the non-PAM strand. The target sequence may be directly adjacent to the PAM motif. Alternatively, the target sequence and the PAM may be separated by a short sequence segment (e.g., up to 5 nucleotides, e.g., up to 4, 3, 2, or 1 nucleotide). The target sequence may be located at the 3' end of the PAM motif or the 5' end of the PAM motif, depending on the CRISPR nuclease known in the art that recognizes the PAM motif. For example, in a Cas12i polypeptide (e.g., a Cas12i2 polypeptide such as those disclosed herein) or other type V nucleases disclosed herein (see Table 1 above), the target sequence is located at the 3' end of the PAM motif.

[0093] As used herein, the term "complementary" refers to a first polynucleotide (e.g., a spacer sequence of an RNA guide) having a degree of complementarity to a second polynucleotide (e.g., a complementary sequence of a target sequence), thereby allowing the first and second polynucleotides to form a double-stranded complex through base pairing and allowing an effector polypeptide (e.g., a type V nuclease or a variant thereof) complexed with the first polynucleotide to act on (e.g., cleave) the second polynucleotide. In some embodiments, the first polynucleotide may be substantially complementary to the second polynucleotide, i.e., have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity to the second polynucleotide. In some embodiments, a first polynucleotide can be fully complementary to a second polynucleotide, ie, has 100% complementarity to the second polynucleotide.

[0094] Nuclease binding sequence (direct repeat) In some embodiments, the nuclease binding sequence in a gRNA disclosed herein is a CRISPR nuclease binding sequence (e.g., the nuclease binding sequence can bind a type V nuclease or a type II nuclease). In some embodiments, the nuclease binding sequence comprises a direct repeat sequence. In certain embodiments, the nuclease binding sequence comprises a direct repeat sequence linked to a DNA binding sequence (e.g., a DNA target sequence or a spacer). In some embodiments, the nuclease binding sequence comprises a direct repeat sequence and a DNA binding sequence, or a direct repeat-DNA binding sequence-direct repeat sequence. In some embodiments, the nuclease binding sequence comprises a truncated direct repeat sequence and a DNA binding sequence, which is typical of processed or mature crRNAs.

[0095] In embodiments where the nuclease binding sequence is a direct repeat for a publicly available CRISPR nuclease, the direct repeat sequences are known in the art. In some embodiments, the direct repeat sequences capable of binding to a CRISPR nuclease are those described in WO2021055874, WO2020206036, WO2020191102, WO2020186213, WO2020028555, WO2020033601, WO2019126762, WO2019126774, WO2019071048, WO2019018423, WO2019005866, WO2018191388, WO2018170333, WO2018035388, WO2018035 387, WO2017219027, WO2017189308, WO2017184768, WO2017106657, WO2016205749, WO2017070605, WO2016205764, WO2016205711, WO20160 28682, WO2015089473, WO2014093595, WO2015089427, WO2014204725, WO2015070083, WO2014093655, WO2014093694, WO2014093712, WO2014 093635, WO2021133829, WO2021007177, WO2020197934, WO2020181102, WO2020181101, WO2020041456, WO2020023529, WO2020005980, WO20 19104058, WO2019089820, WO2019089808, WO2019089804, WO2019089796, WO2019036185, WO2018226855, WO2018213351, WO2018089664, WO2 018064371, WO2018064352, WO2017106569, WO2017048969, WO2016196655, WO2016106239, WO2016036754, WO2015103153, WO2015089277, W O2014150624, WO2013176772, WO2021119563, WO2021118626, WO2020247883, WO2020247882, WO2020223634, WO2020142754, WO2020086475,WO2020028729, WO2019241452, WO2019173248, WO2018236548, WO2018183403, WO2017027423, WO2018106727, WO201 8071672, WO2017096328, WO2017070598, WO2016201155, WO2014150624, WO2013098244, WO2021113522, WO202105053 4, WO2021046442, WO2021041569, WO2021007563, WO2020252378, WO2020180699, WO2020018142, WO2019222555, WO2019178428, WO2019178427, or WO2019006471, which applications are incorporated by reference for the subject matter and purposes referenced herein.

[0096] In some embodiments, the direct repeat sequence of the RNA guide has a length of 12 to 100, 13 to 75, 14 to 50, or 15 to 40 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides).

[0097] In some examples, the nuclease binding sequence can bind to a Cas12i polypeptide (e.g., SEQ ID NO: 3 or SEQ ID NO: 266, or a variant thereof, as disclosed herein). See Table 2 below. For example, a direct repeat sequence that can be recognized by a Cas12i2 nuclease (e.g., SEQ ID NO: 3 or SEQ ID NO: 266) can comprise (e.g., consist of) the nucleotide sequence 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO: 36).

[0098] In other examples, the nuclease binding site can bind to other type V nucleases disclosed herein, such as SEQ ID NO: 4, 5, or 6, or variants thereof (e.g., SEQ ID NO: 255). See Tables 3-5 below. For example, a direct repeat sequence that can be recognized by type V nuclease A and its variants (e.g., SEQ ID NO: 4 or SEQ ID NO: 255) can comprise (e.g., consist of) the nucleotide sequence 5'-CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAAC-3' (SEQ ID NO: 56).

[0099] DNA binding sequence (spacer) The RNA guide also includes a DNA-binding sequence (also known as a spacer). The spacer can have a length of about 7 nucleotides to about 100 nucleotides. For example, the spacer can have a length of about 7 nucleotides to about 80 nucleotides, about 7 nucleotides to about 50 nucleotides, about 7 nucleotides to about 40 nucleotides, about 7 nucleotides to about 30 nucleotides, about 7 nucleotides to about 25 nucleotides, about 7 nucleotides to about 20 nucleotides, or about 7 nucleotides to about 19 nucleotides. For example, the spacer can have a length of about 7 nucleotides to about 20 nucleotides, about 7 nucleotides to about 25 nucleotides, about 7 nucleotides to about 30 nucleotides, about 7 nucleotides to about 35 nucleotides, about 7 nucleotides to about 40 nucleotides, about 7 nucleotides to about 45 nucleotides, about 7 nucleotides to about 50 nucleotides, about 7 nucleotides to about 60 nucleotides, about 7 nucleotides to about 70 nucleotides, about 7 nucleotides to about 80 nucleotides, about 7 nucleotides to about 90 nucleotides, about 7 nucleotides to about 100 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 10 nucleotides to about 35 nucleotides, about 10 nucleotides to about 40 nucleotides, about 10 nucleotides to about 45 nucleotides, about 10 nucleotides to about 50 nucleotides, about 10 nucleotides to about 60 nucleotides, about 10 nucleotides to about 70 nucleotides, about 10 nucleotides to about 80 nucleotides, about 10 nucleotides to about 90 nucleotides, or about 10 nucleotides to about 100 nucleotides.

[0100] In some embodiments, the spacer in the RNA guide generally has a length of 7-50 nucleotides or 15-35 nucleotides (e.g., 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides) and can be designed to be complementary to a specific target sequence.

[0101] In some embodiments, the DNA binding sequence has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a target sequence described herein and is capable of binding to a complementary region of the target sequence via base pairing.

[0102] In some embodiments, the DNA binding sequence comprises only RNA bases. In some embodiments, the DNA binding sequence comprises DNA bases (e.g., the spacer comprises at least one thymine). In some embodiments, the DNA binding sequence comprises RNA and DNA bases (e.g., the DNA binding sequence comprises at least one thymine and at least one uracil).

[0103] In some instances, the RNA guides disclosed herein may further comprise linker sequences, 5'-end and / or 3'-end protection fragments (see disclosure herein), or combinations thereof.

[0104] The spacer in any of the RNA guides disclosed herein can be specific to the target sequence, i.e., can bind to the complementary region of the target sequence through base pairing. In some instances, the target sequence can be located within the genomic site of interest, e.g., the site where gene editing is required.

[0105] In some embodiments, the target sequence is adjacent to PAM sequence.PAM sequence is known in the art.In some embodiments, the PAM sequence that can be recognized by CRISPR nuclease is WO2021055874, WO2020206036, WO2020191102, WO2020186213, WO2020028555, WO2020033601, WO2019126762, WO2019126774, WO2019071048, WO2019018423, WO2019005866, WO2018191388, WO2018170333, WO2018035388, WO20180353 87, WO2017219027, WO2017189308, WO2017184768, WO2017106657, WO2016205749, WO2017070605, WO2016205764, WO2016205711, WO20160286 82, WO2015089473, WO2014093595, WO2015089427, WO2014204725, WO2015070083, WO2014093655, WO2014093694, WO2014093712, WO201409363 5, WO2021133829, WO2021007177, WO2020197934, WO2020181102, WO2020181101, WO2020041456, WO2020023529, WO2020005980, WO201910405 8, WO2019089820, WO2019089808, WO2019089804, WO2019089796, WO2019036185, WO2018226855, WO2018213351, WO2018089664, WO2018064371 , WO2018064352, WO2017106569, WO2017048969, WO2016196655, WO2016106239, WO2016036754, WO2015103153, WO2015089277, WO2014150624 , WO2013176772, WO2021119563, WO2021118626, WO2020247883, WO2020247882, WO2020223634, WO2020142754, WO2020086475, WO2020028729,WO2019241452, WO2019173248, WO2018236548, WO2018183403, WO2017027423, WO2018106727, WO2018071672, W O2017096328, WO2017070598, WO2016201155, WO2014150624, WO2013098244, WO2021113522, WO2021050534, WO 2021046442, WO2021041569, WO2021007563, WO2020252378, WO2020180699, WO2020018142, WO2019222555, WO2019178428, WO2019178427, or WO2019006471, the relevant disclosures of each of which are incorporated herein by reference in their entirety for the purposes of this application.

[0106] When the gene editing system includes a Cas12i polypeptide, the PAM sequence includes 5'NTTN-3' (or 5'-TTN-3'), where N is any nucleotide (e.g., A, G, T, or C). The PAM sequence is upstream of the target sequence. PAM sequences associated with other CRISPR nucleases may include the sequence 5'-TTY-3' or 5'-TTB-3', where Y is C or T and B is G, T, or C. The PAM sequence may be immediately adjacent to the target sequence or may be within a few nucleotides (e.g., 1, 2, 3, 4, or 5) from the target sequence.

[0107] When the gene editing system includes other Type V nucleases disclosed herein, the PAM comprises a 5'NTTR-3' motif, where N is any of A, T, G, and C, and R is A or G. The PAM motif is located 5' of the target sequence.

[0108] The PAM sequences of nucleases A to D are listed in Tables 3 to 5.

[0109] In some embodiments, a gRNA for a Cas12i2 (e.g., SEQ ID NO: 3 or SEQ ID NO: 266) nuclease may contain the same spacer sequence as any of the gRNAs listed in Table 2 below. As one example, a gRNA may contain the same spacer sequence as gRNA G53 (CUACCUUUCUCUCGAAGGUC, SEQ ID NO: 267). As another example, a gRNA may contain the same spacer sequence as gRNA G55 (CUCUCGAAGGUCUUCUGCCG, SEQ ID NO: 268). As yet another example, a gRNA may contain the same spacer sequence as gRNA G56 (UCUCGAAGGUCUUCUGCCGA, SEQ ID NO: 269). Exemplary gRNAs for Cas12i2 (e.g., SEQ ID NO: 3 or SEQ ID NO: 266) nuclease are set forth in Table 2 below, and all of these gRNAs are within the scope of the present disclosure.

[0110] In some embodiments, the gRNAs for nucleases A-D may contain the same spacer sequence as the gRNAs listed in Tables 3-5 below. As an example, the gRNA may contain the same spacer sequence as gRNA A_STMN2_Splice2a_4 (UAUUCAUAUUGCAGGACUCG, SEQ ID NO: 270). As another example, the gRNA may contain the same spacer sequence as gRNA A_STMN2_Splice2a_3 (AAAUUAUAUUCAUAUUGCAG, SEQ ID NO: 271). Exemplary gRNAs for nucleases A-D are listed in Tables 3-5 below, and all of these gRNAs are within the scope of the present disclosure.

[0111] Nucleic acid modification Any of the gRNAs in the gene editing systems disclosed herein can contain one or more modifications.

[0112] Exemplary modifications can include modifications to the sugar, the nucleobase, the internucleoside linkage (e.g., phosphate linkage / phosphodiester linkage / phosphodiester backbone), and any combination thereof. Some of the exemplary modifications provided herein are detailed below.

[0113] The gRNA may include any useful modifications to the sugar, nucleobase, or internucleoside linkage (e.g., phosphate linkage / phosphodiester linkage / phosphodiester backbone). One or more atoms of a pyrimidine nucleobase may be substituted or replaced with an optionally substituted amino group, an optionally substituted thiol group, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halogen (e.g., chloro or fluoro). In certain embodiments, a modification (e.g., one or more modifications) is present in each of the sugar and internucleoside linkage. The modification may be from ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof. Additional modifications are described herein.

[0114] In some embodiments, the modification may include chemically or cellularly induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described in Lewis and Pan, "RNA modifications and structures cooperate to guide RNA-protein interactions" (Nat Reviews Mol Cell Biol, 2017, 18:202-210).

[0115] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) can be present at various positions in the sequence. One of skill in the art will understand that nucleotide analogs or other modification(s) can be present at any position(s) in the sequence such that the function of the sequence is not substantially diminished. Sequences can contain from about 1% to about 100% modified nucleotides (relative to the overall nucleotide content or to one or more nucleotide types, i.e., any one or more of A, G, U, or C), or any intervening percentage therebetween (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-9 ... 5%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100% modified nucleotides.

[0116] In some embodiments, sugar modifications or substitutions (e.g., at the 2' or 4' position) in one or more ribonucleotides of the sequence can include phosphodiester bond modifications or substitutions, as well as backbone modifications. Specific examples of sequences include, but are not limited to, sequences containing modified backbones or sequences containing internucleoside modifications, including non-natural internucleoside linkages, e.g., phosphodiester bond modifications or substitutions. Sequences with modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For purposes of this application, and as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered oligonucleosides. In certain embodiments, the sequence includes ribonucleotides that have a phosphorus atom in their internucleoside backbone.

[0117] Modified sequence backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, such as 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linkage analogs, and those with reverse polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.Various salts, mixed salts, and free acid forms are also included.In some embodiments, the sequence may be negatively or positively charged.

[0118] Modified nucleotides that can be incorporated into a sequence can be modified on the internucleoside linkage (e.g., the phosphate backbone). In the context of polynucleotide backbones, the terms "phosphate" and "phosphodiester" are used interchangeably herein. The backbone phosphate group can be modified by replacing one or more of the oxygen atoms with different substituents. Furthermore, modified nucleosides and nucleotides can include a wide variety of modifications of the unmodified phosphate moiety with other internucleoside linkages described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. In phosphorodithioates, both non-linking oxygens are replaced with sulfur. Phosphate linkers can also be modified by replacing linking oxygens with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0119] The α-thio-substituted phosphate moieties are provided to confer stability to RNA and DNA polymers via unnatural phosphorothioate backbone linkages, which provide increased nuclease resistance and consequently longer half-lives in the cellular environment.

[0120] In certain embodiments, the modified nucleoside comprises an α-thio-nucleoside (e.g., 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine (α-thio-cytidine), 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine).

[0121] Other internucleoside linkages that can be used in accordance with the present invention, including internucleoside linkages that do not contain a phosphorus atom, are described herein.

[0122] In some embodiments, the sequence may include one or more cytotoxic nucleosides, for example, cytotoxic nucleosides may be incorporated into the sequence as bifunctional modifications. Cytotoxic nucleosides include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4'-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-β-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-1-β-D-arabinofuranosylcytosine, N4-octadecyl-1-β-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabino-pentofuranosyl)cytosine, and P-4055 (cytarabine 5'-elaidate).

[0123] In some embodiments, the sequence comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, polyA sequences, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than 100 different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27:196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA is selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5 and at least one nucleoside selected from the group consisting of 1-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.In some embodiments, the mRNA is selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4- The compound comprises at least one nucleoside selected from the group consisting of thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, the mRNA is selected from the group consisting of 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopropyl)ade ... and at least one nucleoside selected from the group consisting of N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0124] The sequence may be uniformly modified or unmodified throughout the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., natural nucleotides, purines or pyrimidines, or one or more or all of A, G, U, C, I, and pU) may be uniformly modified or unmodified throughout the sequence or in a given sequence region. In some embodiments, the sequence contains pseudouridine. In some embodiments, the sequence contains inosine, which may assist the immune system in characterizing the sequence as endogenous or viral RNA. Incorporation of inosine may also mediate increased RNA stability / reduced degradation. See, e.g., Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as "self". Cell Res. 25, 1283-1284, which is incorporated herein by reference in its entirety.

[0125] In some embodiments, any gRNA described herein can include a terminal modification (e.g., a 5'-end modification or a 3'-end modification). In some embodiments, the terminal modification is a chemical modification. In some embodiments, the terminal modification is a structural modification. See the disclosure herein. As a specific example, the gRNA can include 2'-o-methylation and phosphorothioate linkages, for example, at the 5'-end and / or 3'-end.

[0126] (iii) delivery of the gene editing system to the cell In some embodiments, any of the gene editing systems disclosed herein, or components thereof, can be formulated, for example, with a carrier, such as a carrier and / or polymeric carrier, such as a liposome or lipid nanoparticle, and delivered to cells (e.g., neuronal cells) by known methods, including, but not limited to, transfection (e.g., lipid-mediated, cationic polymer, calcium phosphate, dendrimer), electroporation or other membrane disruption methods (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV), microinjection, microprojectile bombardment ("gene gun"), fusine, direct ultrasound loading, cell squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, exosome-mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof.

[0127] In some embodiments, the method includes delivering one or more nucleic acids (e.g., nucleic acids encoding type V CRISPR nucleases and / or one or more gRNAs), one or more transcription products thereof, and / or preformed ribonucleoproteins into cells. Exemplary intracellular delivery methods include, but are not limited to, viruses or virus-like agents; chemical-based transfection methods such as using calcium phosphate, dendrimers, liposomes, or cationic polymers (e.g., DEAE-dextran or polyethyleneimine); non-chemical methods such as microinjection, electroporation, cell squeezing, sonoporation, optical transfection, impalement, protoplast fusion, bacterial conjugation, plasmid or transposon delivery; particle-based methods such as gene guns, magnetofection or magnetically assisted transfection, particle guns; and hybrid methods such as nucleofection. In some embodiments, the present application further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) that contain or are produced from such cells. In some embodiments, the compositions of the present invention are further delivered with an agent (e.g., a compound, molecule, or biomolecule) that affects DNA repair or DNA repair mechanisms. In some embodiments, the compositions of the present invention are further delivered with an agent (e.g., a compound, molecule, or biomolecule) that affects the cell cycle.

[0128] In some embodiments, a first composition comprising a type V CRISPR nuclease is delivered to the cell. In some embodiments, a second composition comprising a gRNA guide is delivered to the cell. In some embodiments, the first composition is contacted with the cell before the second composition is contacted with the cell. In some embodiments, the first composition is contacted with the cell simultaneously with the second composition. In some embodiments, the first composition is contacted with the cell after the second composition has contacted the cell. In some embodiments, the first composition is delivered by a first delivery method and the second composition is delivered by a second delivery method. In some embodiments, the first delivery method is the same as the second delivery method. For example, in some embodiments, the first composition and the second composition are delivered via viral delivery. In some embodiments, the first delivery method is different from the second delivery method. For example, in some embodiments, a first composition is delivered by viral delivery, a second composition is delivered by lipid nanoparticle-mediated transfer, and a second composition is delivered by viral delivery; or, alternatively, a first composition is delivered by lipid nanoparticle-mediated transfer, and a second composition is delivered by viral delivery.

[0129] Alternatively, components of the gene editing system provided herein (e.g., a type V nuclease or its encoding nucleic acid and a guide RNA or its encoding nucleic acid) can be formulated into a single composition and delivered to a host cell of interest. For example, the gene editing system can include a messenger RNA encoding a type V nuclease and a gRNA, which can be formulated with a lipid excipient and delivered to a host cell via lipid nanoparticle-mediated transfer. In another example, the gene editing system includes a type V nuclease and a gRNA that can form a ribonucleoprotein (RNP) complex. The RNP complex can be delivered to a host cell via a suitable route as known in the art. As yet another example, the gene editing system can include an expression vector capable of producing both a type V nuclease and a gRNA. When introduced into a host cell, such an expression vector produces the nuclease and the gRNA. See the above description of such expression vectors.

[0130] III. Therapeutic applications Any of the gene editing systems disclosed herein or modified cells (e.g., modified neuronal cells) produced using such gene editing systems can be used to treat diseases associated with aberrant splicing of STMN2, such as ALS or FTD, as disclosed herein.

[0131] Amyotrophic lateral sclerosis (or ALS) is a progressive neurological disease that affects nerve cells in the brain and spinal cord, causing loss of muscle control. ALS often begins with muscle twitching and weakness in the limbs or slurred speech. Eventually, ALS affects muscle control needed for movement, speaking, eating, and breathing. There is currently no cure for this fatal disease. The signs and symptoms of ALS vary greatly from person to person, depending on which neurons are affected. It generally begins with muscle weakness that spreads and worsens over time. Exemplary signs and symptoms of ALS include difficulty walking or performing normal daily activities; stumbling and falling; weakness in the legs, feet, or ankles; weakness or clumsiness in the hands; slurred speech or difficulty swallowing; muscle spasms and twitching in the arms, shoulders, and tongue; inappropriate crying, laughing, or yawning; and / or cognitive and behavioral changes.

[0132] Frontotemporal dementia (or FTD), a common cause of dementia, is a group of disorders that occur when nerve cells are lost in the frontal and temporal lobes of the brain. This causes the lobes to shrink. FTD can affect behavior, personality, language, and movement. The most common types of FTD include behavioral dyspraxia (affecting behavior and personality), primary progressive aphasia (difficulty communicating), which includes progressive non-fluent aphasia (affecting the ability to speak), and semantic dementia (affecting the ability to use and understand language). Less common forms of FTD affect movement, causing symptoms similar to Parkinson's disease or amyotrophic lateral sclerosis.

[0133] In some embodiments, provided herein are methods of treating a target disease disclosed herein (e.g., ALS or FTD), the method comprising administering any of the gene editing systems disclosed herein to a subject (e.g., a human patient) in need of treatment. The gene editing system can be delivered to a specific tissue (e.g., the brain) or specific cell type (e.g., a neuronal cell) where gene editing is required. The gene editing system can include a LNP, which includes one or more of the components, one or more vectors (e.g., viral vectors) encoding one or more of the components, or a combination thereof. The components of the gene editing system can be formulated to form a pharmaceutical composition, which may further include one or more pharmaceutically acceptable carriers.

[0134] In some embodiments, modified cells produced using any of the gene editing systems disclosed herein can be administered to a subject (e.g., a human patient) in need of treatment. The modified cells can contain a desired gene edit in the STMN2 gene, including a deletion at a desired location (the 3' splice site and / or a downstream 10-base window) as described herein. The modified cells can be prepared using neuronal cells isolated from a human patient (e.g., an ALS patient or an FTD patient). The modified cells prepared in this manner have reduced levels of non-functional STMN2 transcripts due to aberrant splicing events and increased levels of functional STMN2 transcripts (and thus functional STMN protein) compared to their non-edited counterparts.

[0135] In some embodiments, provided herein is a composition comprising a gene editing system or component thereof disclosed herein (e.g., a Cas12i2 polypeptide or a type V CRISPR nuclease disclosed herein and a corresponding gRNA targeting a genomic site of interest within the STMN2 gene, also disclosed herein). Such a composition may be a pharmaceutical composition. Useful pharmaceutical compositions can be prepared, packaged, or sold as a formulation for a suitable delivery route, e.g., parenteral, intralesional, intraorgan, or other route of administration. Pharmaceutical compositions of the present disclosure can be prepared, packaged, or sold in bulk, as a single unit dose, or as multiple single unit doses. As used herein, a "unit dose" refers to a discrete amount of a pharmaceutical composition (e.g., a gene editing system or component thereof) administered to a subject, or a convenient fraction of such a dose, e.g., one-half or one-third of such a dose.

[0136] Pharmaceutical compositions suitable for parenteral administration may include an active agent (e.g., a gene editing system or its components, or modified cells) combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or continuous administration. Some injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampoules or multi-dose containers containing a preservative. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations may further comprise one or more additional ingredients, including, but not limited to, suspending agents, stabilizing agents, or dispersing agents.

[0137] The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oily suspension or solution. These suspensions or solutions can be formulated according to known techniques and may contain, in addition to the cells, additional ingredients such as dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations can be prepared using non-toxic, parenterally acceptable diluents or solvents, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic saline, and fixed oils, such as synthetic mono- or diglycerides. Other useful parenterally administrable formulations include those containing the cells in a packaged form, in a liposomal formulation, or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric or hydrophobic materials, such as emulsions, ion exchange resins, poorly soluble polymers, or poorly soluble salts.

[0138] In some instances, the gene editing system for therapeutic applications disclosed herein may include a viral vector, such as an AAV vector, containing a coding sequence for a V-type nuclease disclosed herein. Such an AAV vector (e.g., AAVrhlO) can be used to deliver the nuclease to a subject in need of treatment (e.g., a specific cell type, such as a neuronal cell, in need of STMN2 gene editing). In some examples, the AAV vector can also carry a coding sequence for an RNA guide, allowing the RNA guide to be produced in the host cell. Alternatively, the RNA guide may be co-delivered with the AAV vector to a subject in need of treatment.

[0139] IV. Kit for inhibiting aberrant splicing of STMN2 and alleviating targeted diseases The present disclosure also provides kits that can be used, for example, to perform the gene editing methods described herein to genetically modify the STMN2 gene disclosed herein. In some embodiments, the kits can include an RNA guide and a type V nuclease (e.g., a Cas12i polypeptide or another type V nuclease provided herein, such as those listed in Table 1). In some embodiments, the kits include an RNA guide and a type V nuclease. In other embodiments, the kits include a polynucleotide encoding such a type V nuclease, optionally contained within a vector, e.g., as described herein. In some embodiments, the kits include a polynucleotide encoding an RNA guide disclosed herein. The type V nuclease (or polynucleotide encoding the type V nuclease) and the RNA guide (e.g., as a ribonucleoprotein) can be packaged within the same or other container within the kit, or alternatively, can be packaged in separate vials or other containers, the contents of which can be mixed prior to use.

[0140] The V-type nuclease and RNA guide may be packaged in the same or other container within the kit, or alternatively may be packaged in separate vials or other containers, the contents of which may be mixed prior to use. The kit may optionally further include buffers and / or instructions for use of the RNA guide and V-type nuclease.

[0141] General Technology The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1989) Academic Press; Culture(RIFreshney,ed.1987);Introuction to Cell and Tissue Culture(JPMather and PERoberts,1998)Plenum Press;Cell and Tissue Culture:Laboratory Procedures(A.Doyle,JBGriffiths,and DGNewell,eds.1993-8)J.Wiley and Sons;Methods in Enzymology(Academic Press,Inc.);Handbook of Experimental Immunology (DMWeir and CCBlackwell, eds.): Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (JEColigan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988 - 1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J.D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985; Transcription and Translation (B.D. Hames & S.J. Higgins, eds.(1984; Animal Cell Culture (R.I. Freshney, ed.(1986; Immobilized Cells and Enzymes (lRL Press,(1986; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.) etc. are fully described in the literature.

[0142] Without further elaboration, it is believed that one skilled in the art can, based on the preceding description, utilize the present invention to its fullest extent. Accordingly, the following specific embodiments are merely illustrative, and should not be construed as limiting in any way to the remainder of the disclosure. All publications cited herein are incorporated by reference for the purpose or subject matter referenced herein.

[0143] Example 1 - Targeting the STMN2 exon 2a splice site using Cas12i2 in SH-SY5Y cells This example shows that using Cas12i2 complexed with an RNA guide designed to disrupt the exon 2a splice site of STMN2 (the 3' splice site within intron 1 disclosed herein) resulted in a decrease in the STMN2 exon 2a splice variant and a corresponding increase in the full-length STMN2 transcript.

[0144] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours until they reached 70-80% confluency. Cells were detached with TrypLE (Gibco), counted, washed with PBS, and resuspended in Lonza SF nucleofection buffer + supplement (Lonza, V4XC-2024) at a concentration of 20,000 cells / µL. Two million cells were used per electroporation reaction.

[0145] Each RNA guide in Table 2, designed to target the 3' splice site of STMN2 intron 1 (the splice site of exon 2a), was complexed with mutant Cas12i2 (SEQ ID NO: 3). The mutant Cas12i2 / RNA guide RNP complex was generated by mixing Cas12i2 (50 mM HEPES, 700 mM NaCl, 0.5 mM TECEP (tris(2-carboxyethyl)phosphine), 5% glycerol, pH 7.5) with the RNA guide (in 250 mM NaCl) at a molar ratio of 1:2.5 on ice for 60 minutes. RNP was added to each reaction at a final concentration of 20 μM (Cas12i2) and 50 μM RNA guide in the presence of 1 μM siTARDBP (siTDP-43 RNA; Horizon Discovery Biosciences ON-TARGETplus Human TARDP [GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 7), CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 8), GGGCUUCGCUACAGGAAUC (SEQ ID NO: 9), and CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 10)]) or siNon-targeting Pool (siCont RNA; Horizon Discovery Biosciences ON-TARGETplus Non-targeting Pool). Table 2. Cas12i2 RNA guides targeting human stathmin-2 [Table 2-1] [Table 2-2] [Table 2-3] *Spacer sequences are indicated in bold.

[0146] The nuclease-binding fragment in an exemplary gRNA for Cas12i2 has the nucleotide sequence AGAAAUCCGUCUUUCAUUGACGG (SEQ ID NO: 36).

[0147] The cuvettes were electroporated using an electroporation device (Program CA-137, Lonza 4D-nucleofector). After electroporation, the cells were allowed to settle for 10 minutes before being added to prewarmed culture medium and gently mixed by pipetting. 90% of the cells were plated for downstream RNA analysis, and 10% for next-generation sequencing (NGS). The cells were then incubated at 37°C for 72 hours. Next, the cells were washed with PBS and lysed with QuickExtract™ (DNA extraction solution; Lucigen) or RLT+ (Qiagen). The cells in QuickExtract were incubated at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes before being analyzed by next-generation sequencing (NGS). Samples for NGS were prepared by two-round PCR. The first round (PCR1) was used to amplify specific genomic regions depending on the target. The second round PCR (PCR2) was performed to add Illumina adapters and indexes. The reactions were then pooled and purified by column purification. Sequencing runs were performed using a NEXTSEQ™ (Illumina) 500 / 550 High Output v2.5 Kit for 300 cycles.

[0148] For RLT+ cells, RNA was isolated using QIAshredder columns and the RNeasy plus Micro Kit (Qiagen). RNA (2 μg) was converted to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription-PCR was performed using the Faststart Universal Probe Master (Rox) (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). TaqMan probes and PCR primers were used to detect the STMN2 exon 2a splice variant.

[0149] As shown in Figure 1A, a 30-fold TDP-43 knockdown was observed in SHSY5Y cells using siTDP-43 RNA. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in a 60-fold increase in the STMN2 exon 2a splice variant and a more than 90-fold decrease in the full-length STMN2 transcript (Figure 1B and Figure 1C). The increase in exon 2a was partially or completely mitigated by RNP guides G9, G10, G11, G50, G52, G53, G54, G55, G56, G48, and G17 (Figure 1B). An inverse correlation was observed between exon 2a and full-length STMN2 RNA (Figure 1C). Significant recovery of full-length STMN2 signal, which was reduced by TDP-43 depletion, was observed with guides G8, G9, G10, G52, G53, G54, G55, and G56. Guides G9, G55 and G56 showed the highest fold changes in both full-length and aberrantly spliced ​​transcripts.

[0150] Figures 2A-2C show the indel activity and splice site disruption of the tested RNA guides in SH-SY5Y cells. A correlation was observed between guides that promoted full-length STMN2 restoration and motif disruption (Figure 2C), as well as between untreated indels and full-length STMN2 restoration (Figure 2B). Guide 9 showed approximately 36% splice site motif disruption and 97.2% total editing, with over 35% of the total editing disrupting splice sites (Figure 2A). Guides G55 and G56 showed the highest indel activity and resulted in the highest motif disruption among all the guides tested (Figure 2A). Guide G55 showed 93.5% splice site motif disruption and 97.3% total editing, with over 95% of the total editing disrupting splice sites. Guide G56 showed approximately 87% splice site motif disruption and 91% total editing, with over 95% of the total editing disrupting splice sites.

[0151] Thus, this example shows that in the presence of TDP-43 knockdown, Cas12i2- and RNA-guided editing targeting the STMN2 exon 2a splice site not only disrupts the DNA splice site, resulting in a reduction of the exon 2a splice variant, but also in an increase in the corresponding full-length STMN2.

[0152] Example 2 - Targeting the STMN2 exon 2a splice site and TDP-43 binding site with Cas12i2 in SH-SY5Y cells This example shows that an RNA guide designed to disrupt the TDP-43 binding site recapitulates the effect of siRNA-mediated TDP-43 knockdown, demonstrating the efficacy of RNA-guided disruption of the STMN2 exon 2a site.

[0153] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours until they reached 70-80% confluency. Cells were detached with TrypLE (Gibco), counted, washed with PBS, and resuspended in Lonza SF nucleofection buffer + supplement (Lonza, V4XC-2024) at a concentration of 20,000 cells / µL.

[0154] Two million cells were co-nucleofected with RNP complexes containing an RNA guide targeting the TDP-43 binding site (guide 12: AGAAAUCCGUCUUUCAUUGACGGGGCUCUCUGUGUGAGCAUGU; SEQ ID NO: 39), an RNA guide targeting the STMN2 exon 2a splice site (guide 55: AGAAAUCCGUCUUUCAUUGACGGCUCUCGAAGGUCUUCUGCCG; SEQ ID NO: 40), or a non-targeting guide (AGAAAUCCGUCUUUCAUUGACGGAGUGCGUACGAGCUCGGACG; SEQ ID NO: 41) in both the presence and absence of siRNA-mediated TDP-43 knockdown, as described in Example 1. See Figure 3A for the locations of the 3' splice site, 10-base window, and TDP-43 binding motif in the corresponding region of the STMN2 gene.

[0155] Figure 3B shows that disruption of the TDP-43 binding site by RNA guide 12 recapitulates the effects of siRNA-mediated TDP-43 knockdown. Downstream effects of splice site disruption by guide G55 (a decrease in the exon 2a splice variant and an increase in full-length STMN2) are also observed in the absence of siRNA-mediated TDP-43 knockdown and in the presence of guide 12 (Figure 3C and Figure 3D, respectively).

[0156] Thus, this example demonstrates that co-nucleofection of Cas12i2 RNPs targeting the TDP-43 binding site and exon 2a splice site results in a reduction of STMN2 exon 2a and an increase in full-length STMN2, with or without siRNA-induced TDP-43 knockdown. These results demonstrate the feasibility of this in vivo strategy using mice carrying a humanized STMN2 gene with a constitutively disrupted TDP-43 binding site. Such a strategy allows for investigation of the in vivo effects of the RNA-guided STMN2 exon 2a splice site disruption disclosed herein without the need to knock down TDP-43 in animals, as knocking down TDP-43 in vivo may result in consequences unrelated to STMN2.

[0157] Example 3 - Computational analysis of indels induced by Cas12i2 In this example, we performed computational analysis on the samples from Example 1 to determine how indels within or near the 3' splice site of exon 2a correlate with the recovery of full-length STMN2. Full-length STMN2 transcript refers to the mRNA containing exons 1 to 5 that encode functional STMN2 protein.

[0158] To identify optimal disruption regions, we used sliding windows of variable size (1-10 bases) to calculate positional indel rates from the nucleotides within the window. This was performed for each guide (n=20) tested across the STMN2 amplicon sequence. The correlation between window-position indel rates and STMN2 recovery rates was calculated for each position and window size. The amplicon position and window size with the highest correlation coefficient were determined, indicating which disruption site / motif maximized STMN2 transcript recovery.

[0159] Figures 4A-4B show representative plots from one analyzed dataset, demonstrating that maximum correlation was observed in a 10-base window starting at amplicon position 106. Figure 4A plots the correlation values ​​of position indel rate and STMN2 recovery rate between guides (y-axis) across all amplicon positions (x-axis), indicating the position of maximum correlation (dashed black line). Figure 4B shows a scatter plot of guide-position indel rate (x-axis) and STMN2 recovery rate (y-axis) in a 10-base window starting at position 106.

[0160] Figures 5A-5G show the locations of indels induced by specific guides within the STMN2 amplicon (x-axis). The y-axis is the number of NGS reads. The region defined by the solid lines on the left indicates the location of the splice sites defined in the literature. The region defined by the dashed lines on the right indicates the location of the optimal disruption window identified above. Little or no recovery of full-length STMN2 was observed with guides that did not induce indels within any of the windows. See, for example, RNA guides G1, G2, G3, G7, and G11 in Figures 5A, 5C, and 5D. Measurable recovery of full-length STMN2 was observed with guides that induced indels primarily within the splice sites defined in the literature (e.g., see RNA guide G4 in Figure 5B) or primarily within the optimal disruption window defined herein (e.g., see guides G9, G10, G53, and G54 in Figures 5C, 5D, 5E, and 5F). The greatest recovery of full-length STMN2 was observed for guides that induce indels within the 3' splice site and the optimal disruption window identified herein (see, e.g., RNA guides G55 and G56 in Figure 5F).

[0161] These results indicate that disruption of nucleotides within a 10-base window downstream of the 3' splice site of STMN2 provides a high rate of recovery of full-length STMN2.

[0162] Example 4 - Editing of STMN2 with Type V CRISPR nucleases In this example, RNA guides were designed to target the optimal disruption window in exon 2a of STMN2 identified in Example 3 above. Indels were assessed in cells after transfection with plasmids encoding the type V nucleases listed in Table 1 above and the RNA guides listed in Tables 3-5 below. Table 3. Nuclease A RNA guide and target sequences [Table 3] *Nuclease A RNA guide contains the nuclease binding fragment CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAAC (SEQ ID NO: 56). The spacer sequence of each guide RNA is underlined. Table 4. Nuclease B RNA guide and target sequences [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11] *The RNA guide for nuclease B contains the nuclease binding fragment CCUGUUGUGAAUACUCUUUUAUAGGUAUCAAACAAC (SEQ ID NO: 183). The spacer sequence of each guide RNA is underlined. Table 5. Nuclease C RNA guide and target sequences [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] *The nuclease C RNA guide contains the nuclease binding fragment GGUCCCAUCGGAACGGGUUGUGGUUCCGAC (SEQ ID NO: 38). The spacer sequence of each guide RNA is underlined.

[0163] Editing Efficiency Exemplary type V nucleases A, B, and C listed in Table 1 were individually cloned into plasmids containing a CMV promoter. Fragments encoding the RNA guides in Tables 3-5 were cloned into a pUC19 backbone (New England Biolabs) containing the hU6 promoter. Plasmids were then maxiprepped and diluted.

[0164] Approximately 16 hours before transfection, 25,000 HEK293T cells in DMEM / 10% FBS + Pen / Strep (D10 medium) were seeded into each well of a 96-well plate. On the day of transfection, the cells were 70-90% confluent. For each well to be transfected, a mixture of LIPOFECTAMINE® 2000 transfection reagent (ThermoFisher) and Opti-MEM® reduced serum medium (ThermoFisher) was prepared and incubated at room temperature for 5 minutes (Solution 1). After incubation, the LIPOFECTAMINE® 2000, Opti-MEM® (transfection reagent (ThermoFisher), reduced serum medium (ThermoFisher)) mixture was added to another mixture containing the nuclease plasmid, RNA guide plasmid, and Opti-MEM® reduced serum medium (ThermoFisher) (Solution 2). For the negative control, no RNA guide plasmid was included in Solution 2. Solutions 1 and 2 were mixed by pipetting eight times and then incubated at room temperature for 25 minutes. After incubation, the mixture of Solutions 1 and 2 was added dropwise to each well of a 96-well plate containing cells. 72 hours after transfection, TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher) was added to the center of each well and incubated at 37°C for approximately 5 minutes to resuspend the cells. D10 medium was then added to each well and mixed to resuspend the cells. The resuspended cells were pelleted by centrifugation at 500xg for 10 minutes, and the supernatant was discarded. QUICKEXTRACT™ (DNA extraction solution, Lucigen) extraction reagent was added to each well to lyse the pelleted cells. The cells were then incubated at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes.

[0165] Samples for NGS were prepared by two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions depending on the target. The second round PCR (PCR2) was performed to add Illumina adapters and indexes. The reactions were then pooled and purified by column purification. Sequencing was performed using a 300-cycle NEXTSEQ™ (Illumina) 500 / 550 High Output v2.5 Kit.

[0166] The percentage of NGS reads containing indels (indel rate) and the percentage of NGS reads containing indels within the 10-bp optimal window described herein (motif disruption rate) are shown in Table 6 for the RNA guides in Tables 2-4. Seven RNA guides that showed greater than 5% motif disruption are shown in bold (Table 6). These are further illustrated in Figure 6. Two other RNA guides showed apparent motif disruption rates greater than 5%, but further evaluation revealed that these high rates (shown in italics) were due to high background (e.g., A_STMN2_Splice2a_7 (Figure 7F) and C_STMN2_Splice2a_43 (Figure 8E)). Table 6. Disruption of STMN2 Splice2a by Nucleases A, B, and C [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] When co-delivered with nuclease A, the RNA guides A_STMN2_Splice2a_3, A_STMN2_Splice2a_4, A_STMN2_Splice2a_5, and A_STMN2_Splice2a_6 resulted in greater than 5% motif disruption.

[0167] The RNA guides used in this example that induce indels within the 3' splice site disclosed herein and / or the optimal disruption window identified in Example 3 above enable the restoration of functional STMN2 (e.g., full-length STMN2 transcripts) in cells such as SH-SY5Y cells and neurons. Nuclease A guides that exhibited the highest overall indel rates and high rates of motif disruption were selected for further testing in SH-SY5Y cells (Example 5).

[0168] Computational analysis of indels induced by type V nucleases Computational analysis was performed on the samples described in Example 4 above to determine how indels within or near the 3' splice site of exon 2a correlate with the restoration of full-length STMN2. Full-length STMN2 transcripts refer to mRNAs that contain exons 1-5 and encode functional STMN2 protein. The methods used here are similar to those described in Example 3.

[0169] Figures 7A–7G show the locations of indels induced by nuclease A and seven different STMN2 guides within the STMN2 amplicon (x-axis). The y-axis is the number of NGS reads. The gray bars on the left indicate the splice site locations (99–104) as defined in the literature. The gray bars on the right indicate the locations of the optimal 10-base disruption windows identified above (106–115). Consistent with the indel data in Table 4, guide A_STMN2_Splice2a_4 (Figure 7D, lower panel) showed the greatest rate of motif disruption, with peak reads within the optimal 10-base window. Overall, the highest rate of motif disruption corresponded to an increasing number of reads within the optimal 10-base disruption window.

[0170] Figures 8A-8E show the locations of indels induced by nuclease C and four representative STMN guides within the STMN2 amplicon (x-axis). The y-axis is the number of NGS reads. The gray bars on the left indicate the location of splice sites as defined in the literature. The gray bars on the right indicate the location of the optimal 10-base disruption window identified above. The plots show that the highest motif disruption rate correlates with peak reads within the optimal 10-base window.

[0171] Figures 7F and 8E show guides with high background and indel peaks outside either the canonical splice sites or the optimal window defined herein; therefore, these gRNAs were not used for further testing.

[0172] The indel patterns observed in Figures 7A-7G and Figures 8A-8E, combined with the motif disruption rates seen in Table 6, support the selection of nuclease A guides for further studies of functional STMN2 restoration in SH-SY5Y cells and neurons.

[0173] Example 5 - Targeting the STMN2 exon 2A splice site with type V CRISPR nucleases in SH-SY5Y cells This example shows that using a type V CRISPR nuclease (nuclease D listed in Table 1 above) complexed with an RNA guide (Table 3) designed to disrupt the STMN2 exon 2A splice site (the 3' splice site within intron 1 disclosed herein) results in a decrease in the STMN2 exon 2A splice variant and a corresponding increase in the full-length STMN2 transcript.

[0174] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours until they reached 70-80% confluency. Cells were detached with TrypLE (Gibco), counted, washed with PBS, and resuspended in Lonza SF nucleofection buffer + supplement (Lonza, V4XC-2024). Two million cells were used per electroporation reaction.

[0175] Each RNA guide in Table 3 was designed to target the 3' splice site of STMN2 intron 1 (the splice site of exon 2A) and complexed with nuclease D. A non-targeting control guide was also used (CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAACAGUGCGUACGAGCUCGGACG, SEQ ID NO: 260). RNP complexes were generated by mixing Type V CRISPR nuclease (in 20 mM HEPES pH 7.8, 500 mM NaCl, 10% Glycerol, 0.5 mM TCEP) with the RNA guide (in 250 mM NaCl) at a 1:2.5 molar ratio on ice for 60 minutes. RNP was added to each reaction in the presence of 1 μM siTARDBP (siTDP-43 RNA; Horizon Discovery Biosciences ON-TARGETplus Human TARDP [GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 7), CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 8), GGGCUUCGCUACAGGAAUC (SEQ ID NO: 9), and CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 10)]) or siNon-targeting Pool (siCont RNA; Horizon Discovery Biosciences ON-TARGETplus Non-targeting Pool) to a final concentration of 10 μM nuclease and 25 μM RNA guide.

[0176] The cuvettes were electroporated using an electroporation device (Program CA-137, Lonza 4D-nucleofector). After electroporation, the cells were allowed to rest for 10 minutes before being added to prewarmed culture medium and gently mixed by pipetting. The cells were then incubated at 37°C for 72 hours. Next, the cells were washed with PBS and lysed with RLT+ (Qiagen). RNA was isolated using QIAshredder columns and the RNeasy plus Micro Kit (Qiagen). RNA (2 μg) was converted to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription-PCR was performed using the Faststart Universal Probe Master (Rox) (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). The STMN2 exon 2A splice variant was detected using a custom TaqMan probe and PCR primers (Baughn et al., Science 379 (2023): forward primer CTTTCTCTAGCACGGTCCCAC (SEQ ID NO: 257), reverse primer ATGCTCACACAGAGAGCCAAATT (SEQ ID NO: 258), probe CTCTCGAAGGTCTTCTGCCG (SEQ ID NO: 259)).

[0177] The RNA guides and corresponding target sequences are shown in Table 3 above, and for sample identifier references see Figures 9A-9K and Table 7 below. Table 7. Sample identifiers and corresponding RNA guides [Table 7]

[0178] As shown in Figure 9A, a three-fold TDP-43 knockdown was observed in SH-SY5Y cells using siTDP-43 RNA. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in an 80-fold increase in the STMN2 exon 2A splice variant and a more than 7.5-fold decrease in STMN2 full-length transcript (Figure 9B and Figure 9C). The increase in exon 2A was significantly alleviated by the RNP guides A_STMN2_Splice2a_3 and A_STMN2_Splice2a_4 (Figure 9B). Significant recovery of the decrease in STMN2 full-length signal due to TDP-43 depletion was observed with the RNA guides A_STMN2_Splice2a_3 and A_STMN2_Splice2a_4 (Figure 9C). Nuclease A indel activity using the various gRNAs indicated in SH-SY5Y cells is shown in Figure 9D. Computational analysis of indel locations induced in the STMN2 sequence by specific guides in association with nuclease A in SH-SY5Y cells is shown in Figures 9E–9K. The data demonstrate that guides that showed the greatest increase in full-length STMN2 transcripts (Figure 9C) and corresponding decrease in exon 2A transcripts (Figure 9B) also exhibited the highest indel activity within the desired optimal disruption window (Figures 9G and 9H).

[0179] Example 6 - Disruption of STMN2 exon 2A splice site by CRISPR nuclease variants in SH-SY5Y cells In this example, we compare the disruption of the exon 2A splice site of STMN2 using the type V CRISPR nuclease variants of nuclease A and nuclease D listed in Table 1 above, and their effects on the expression levels of STMN2 exon 2A splice variants and full-length STMN2.

[0180] SH-SY5Y cells were cultured in DMEM / F12 (Gibco #10565018) containing 10% FBS (Hyclone, heat-inactivated #SH30071.03) for 48 hours until they reached 70-80% confluency. Cells were detached with TrypLE (Gibco), counted, washed with PBS, and resuspended at a concentration of 20,000 cells / µL in Lonza SF nucleofection buffer + supplement (Lonza, V4XC-2024).

[0181] Two million cells were co-nucleofected with RNP complexes containing the RNA guide A_STMN2_Splice2a_4 (see G4 in Table 3 above, Figures 10A-10C) or a non-targeting control guide (CUUGUUGUAUAUGUCCUUUUAUAGGUAUUAAACAACAGUGCGUACGAGCUCGGACG, SEQ ID NO: 260: Control G).

[0182] As shown in Figure 10A, 3- and 5-fold TDP-43 knockdown was observed in SH-SY5Y cells using siTDP-43 RNA when co-nucleofected with RNPs containing the V-type CRISPR nuclease variants, nuclease D and nuclease A, respectively. Knockdown of TDP-43 in the presence of a non-targeting control RNP complex resulted in a 120- and 130-fold increase in the STMN2 exon 2A splice variant when co-nucleofected with RNPs containing the V-type CRISPR nuclease variants, nuclease D and nuclease A, respectively (Figure 10B). An 8- and 10-fold decrease in STMN2 full-length transcript was observed with siTDP-43 knockdown and RNPs containing the V-type CRISPR nuclease variants, nuclease D and nuclease A, respectively (Figure 10C). The increase in exon 2A was significantly alleviated by the RNA guide A_STMN2_Splice2a_4 (Figure 10B). A significant recovery of the decrease in STMN2 full-length signal due to TDP-43 depletion was observed with the RNA guide A_STMN2_Splice2a_4 (Figure 10C).

[0183] Example 7 - Targeting the STMN2 exon 2a splice site with Cas12i2 in human iPSC-derived motor neurons This example shows that using Cas12i2 and an RNA guide designed to disrupt the exon 2a splice site of STMN2 (the 3' splice site within intron 1 disclosed herein) reduces the STMN2 exon 2a splice variant and correspondingly increases the full-length STMN2 transcript.

[0184] Human iPSC-derived motor neurons (BrainXell) were thawed and cultured according to the manufacturer's protocol. Briefly, motor neurons were thawed very quickly from liquid nitrogen in a 37°C water bath. Cells were grown in a 1:1 DMEM / F12 (Thermo Fisher #11330-032) and Neurobasal medium (Life Technologies #21103-049) supplemented with 1x B27 (Thermo Fisher #17504-044), 1x N2 (Thermo Fisher #17502-048), 0.5 mM GlutaMAX (Thermo Fisher #35050-061), 10 ng / ml BDNF (Peprotech #450-02), 10 ng / ml GDNF (Peprotech #450-10), 1 ng / ml TGF-β1 (Peprotech #100-21C), 15 μg / ml Geltrex (Life Technologies #A1413201), and 1x Motor Neuron Seeding Supplement (BrainXell). Cells were then counted for viability using trypan blue and plated onto plates pre-coated with poly-D-lysine (Thermo Fisher #A3890401). Four days after plating, neurons were transduced with Cas12i2 (SEQ ID NO: 3) and RNA-guided lentivirus at an MOI of 10. Seventy-two hours later, neurons were further transduced with TDP43 shRNA lentivirus (VectorBuilder hTARDBP shRNA [AGATCTTAAGACTGGTCATTCCTCGAGGAATGACCAGTCTTAAGATCT; SEQ ID NO: 261]) or non-targeting shRNA (VectorBuilder Scramble shRNA [CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG; SEQ ID NO: 262]) at an MOI of 10.

[0185] Ten days after transduction with nucleases and RNA guides (14 days after thawing), neurons were harvested for downstream RNA analysis and next-generation sequencing (NGS). Cells were washed with PBS and lysed with QuickExtract™ (DNA extraction solution, Lucigen) or RLT Plus (Qiagen). Cells in QuickExtract were incubated at 65°C for 15 minutes, 68°C for 15 minutes, and 98°C for 10 minutes before analysis by next-generation sequencing (NGS). Samples for next-generation sequencing (NGS) were prepared by two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions depending on the target. The second round (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. Sequencing runs were performed using a 300-cycle NEXTSEQ™ (Illumina) 500 / 550 High Output v2.5 Kit.

[0186] For cells in RLT Plus, RNA was isolated using QIAshredder columns and the RNeasy Plus Micro Kit (Qiagen). RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription PCR was performed using the Faststart Universal Probe Master (Rox) (Roche) and TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). TaqMan probes and PCR primers were used to detect the STMN2 exon 2a splice variant.

[0187] Knockdown of TDP-43 in the presence of a non-targeting control guide RNA resulted in a 75-fold decrease in full-length STMN2 transcripts and a 700-fold increase in the STMN2 exon 2a splice variant (Figures 11A and 11B). The increase in exon 2a was partially mitigated by the RNA guides G9 and G10, and more significantly by G52, G53, G54, G55, and G56 (Figure 11B). An inverse correlation was observed between exon 2a and full-length STMN2 RNA, and the same RNA guides significantly restored the decrease in full-length STMN2 signal (Figure 11A).

[0188] Figure 11C shows the indel activity of the tested RNA guides in motor neurons. A correlation was observed between guides that promoted the restoration of full-length STMN2 and intact indels. Guides G53 and G55 showed the highest indel rates, 67.7% and 62.5%, respectively.

[0189] Figures 11D-11P show the locations of indels induced by the indicated specific guides in association with Cas12i2 within the STMN2 amplicon (x-axis) in motor neurons.

[0190] Thus, this example shows that in the presence of TDP-43 knockdown, editing using Cas12i2 and RNA guides targeting the STMN2 exon 2a splice site disrupts the DNA splice site and the optimal disruption window, not only reducing the exon 2a splice variant but also promoting a corresponding increase in full-length STMN2.

[0191] Example 8 - Targeting the STMN2 exon 2a splice site with nuclease A in human iPSC-derived motor neurons This example demonstrates that the use of a type V nuclease (Nuclease A listed in Table 1 above) complexed with an RNA guide designed to disrupt the exon 2a splice site of STMN2 (the 3' splice site within intron 1 disclosed herein) results in a decrease in the STMN2 exon 2a splice variant in motor neurons and a corresponding increase in full-length STMN2 transcripts. Human iPSC-derived motor neurons (BrainXell) were thawed and cultured according to the manufacturer's protocol. Briefly, motor neurons were thawed and placed in a 1:1 DMEM / F12 (Thermo Fisher #11330-032) and Neurobasal medium (Life Technologies #21103-049) supplemented with 1x B27 (Thermo Fisher #17504-044), 1x N2 (Thermo Fisher #17502-048), 0.5 mM GlutaMAX (Thermo Fisher #35050-061), 10 ng / ml BDNF (Peprotech #450-02), 10 ng / ml GDNF (Peprotech #450-10), 1 ng / ml TGF-β1 (Peprotech #100-21C), 15 μg / ml Geltrex (Life Technologies #A1413201), and 1x Motor Neuron Seeding Supplement (BrainXell). Motor neurons were first transduced with nuclease A (SEQ ID NO: 4) and RNA guide lentivirus, and then transduced with TDP43 shRNA lentivirus (VectorBuilder hTARDBP shRNA) or non-targeting shRNA (VectorBuilder Scramble shRNA). The RNA guides and corresponding target sequences are listed in Table 3 above, and for sample identifier references, see Figures 12A-12D, Table 7.

[0192] Ten days after transduction with nucleases and RNA guides, neurons were harvested for downstream RNA analysis and next-generation sequencing (NGS). Cells were washed with PBS and lysed with QuickExtract™ (DNA extraction solution, Lucigen) or RLT Plus (Qiagen). Samples for next-generation sequencing were prepared by two rounds of PCR. The first round (PCR1) was used to amplify specific genomic regions depending on the target. The second round (PCR2) was performed to add Illumina adapters and indexes. Reactions were then pooled and purified by column purification. Sequencing runs were performed using a 300-cycle NEXTSEQ™ (Illumina) 500 / 550 High Output v2.5 Kit.

[0193] RNA was isolated from cells in RLT Plus using QIAshredder columns and the RNeasy plus Micro Kit (Qiagen). RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription-PCR was performed using the Faststart Universal Probe Master (Rox) (Roche) with TaqMan probes for TARDP (Hs00606522_m1, Thermo Fisher Scientific), STMN2 (Hs00975900_m1, Thermo Fisher Scientific), and GAPDH (Hs02786624_g1, Thermo Fisher Scientific). TaqMan probes and PCR primers were used to detect the STMN2 exon 2a splice variant.

[0194] Knockdown of TDP-43 in the presence of a non-targeting control guide RNA resulted in a 60-fold decrease in full-length STMN2 transcripts and a ∼380-fold increase in the STMN2 exon 2a splice variant (Figures 12A and 12B). The increase in exon 2a was significantly mitigated by RNA guides G3 and G4 (Figure 12B). An inverse correlation was observed between exon 2a and full-length stathmin-2 RNA, and the same RNA guides partially restored the reduced full-length STMN2 signal (Figure 12A).

[0195] Figure 12C shows the indel activity of the tested RNA guides in motor neurons. A correlation was observed between guides that promoted full-length STMN2 restoration and intact indels. Guides G3 and G4 showed the highest indel rates, at 35% and 27%, respectively.

[0196] FIG. 12D shows disruption of the STMN2 motif in motor neurons analyzed by digital droplet polymerase chain reaction (ddPCR) assay.

[0197] Figures 12E-12L include diagrams showing the locations of indels induced by specific guides shown in relation to nuclease A in motor neurons within the STMN2 amplicon (x-axis).

[0198] Thus, this example shows that in the presence of TDP-43 knockdown, nuclease A and RNA-guided editing targeting the STMN2 exon 2a splice site not only disrupts the DNA splice site and reduces exon 2a-containing splice variants, but also promotes a corresponding increase in full-length STMN2.

[0199] Example 9 - Restoration of phenotypic defects caused by mis-splicing of STMN2 in human iPSC-derived motor neurons This example demonstrates that the use of Cas12i2 (SEQ ID NO: 3) and an RNA guide (STMN2-exon2a-55, SEQ ID NO: 31 (G55)) designed to disrupt the exon 2a splice site of STMN2 (the 3' splice site within intron 1 disclosed herein) rescues the aberrant neuronal outgrowth phenotype promoted by TDP-43 knockdown in human iPSC-derived motor neurons.

[0200] Human iPSC-derived motor neurons were generated as described by Du et al. (2015). At 20–22 days after the initiation of iPSC differentiation, neurons were transduced with Cas12i2 (SEQ ID NO: 3) and RNA-guided lentivirus. Seventy-two hours later, neurons were also transduced with TDP43 shRNA lentivirus or non-targeting shRNA.

[0201] Twenty-five days after nuclease and RNA-guided transduction, neurons were fixed, blocked, permeabilized, and incubated with primary antibodies (rabbit anti-STMN2, Abcam, #ab185956, 1:500; mouse anti-β3-tubulin, R&D Systems, #MAB1195, 1:1,000) at 4°C overnight. Cells were then washed with PBS and incubated with secondary antibodies (Alexa Fluor 488 and 555, Life Technologies, 1:1,000) at room temperature. Nuclei were stained with Hoechst 33342 (1 μg / ml). Images were captured and analyzed using an Operetta CLS High-Content Analysis System (Perkin Elmer).

[0202] Knockdown of TDP-43 in the presence of a guide RNA targeting the STMN2 intron 3' splice site versus a non-targeting guide RNA (non-targeting control) resulted in a 50% reduction in neuronal outgrowth in motor neurons (Figure 13A, center panel, and Figure 13B), as determined by measuring the length of Tuj1-positive neurons. This impairment was dramatically restored in the presence of the RNA guide G55 (Figure 13A, right panel, and Figure 13B). After treatment with the RNA guide G55, no significant change in cell number was observed (Figure 13C), but a significant increase in the percentage of STMN2-positive neurons was observed (Figure 13D). This increased from 6% STMN2-positive neurons under the non-targeting guide shTDP43 condition to 60% STMN2-positive neurons with G55 and TDP43 knockdown.

[0203] Thus, this example shows that in the presence of TDP-43 knockdown, editing with Cas12i2 and RNA-guided G55 targeting the STMN2 exon 2a splice site and optimal disruption window not only disrupts the DNA splice site, resulting in molecular phenotypic recovery (Example 7), but also promotes corresponding phenotypic recovery by restoring impaired neuronal outgrowth and increasing the number of STMN2-positive neurons.

[0204] Example 10 - Gene editing reduces aberrant splicing of STMN2 in exon 2a in humanized mice This example demonstrates that Cas12i2 and type V nucleases and corresponding RNA guides designed to disrupt the exon 2a splice site of STMN2 (the 3' splice site within intron 1 disclosed herein) reduce aberrant splicing of STMN2 in exon 2A-humanized mice.

[0205] Stmn2 em8(STMN2*)Mice were provided by The Jacksons Laboratories (Jax) (RRID: MMRRC_069792-JAX; available on the World Wide Web at jax.org / strain / 035721). In these mice, the STMN2-like gene was engineered by CRISPR / Cas9 to generate a mutant containing 222 nucleotides of human STMN2 exon 2a. Furthermore, the STMN2 sequence was modified to contain the human MS2 stem-loop sequence and replace the TDP43 binding site. Animal experiments were performed at Jax. Briefly, on post-gestational day 1 (P1), mouse pups received bilateral ICV injections of 2.5 μl of vector into each lateral ventricle (2×10 per injection). 11 AAV vector genome). Sample identifiers and corresponding nucleases and RNA guides are shown in Table 8. Table 8. Sample identifiers and corresponding nucleases and RNA guides [Table 8]

[0206] The AAV genome expresses Cas12i2 (SEQ ID NO: 266) under the control of the synapsin promoter and the gRNA under the control of the U6 promoter.

[0207] Twenty-eight days after injection, animals were euthanized. Brains were removed and cut sagitally to separate the right and left hemispheres, and the cerebellum was removed. Frozen mouse brain hemispheres were homogenized using a TissueLyser II (Qiagen) in RLT Plus buffer (Qiagen) containing β-mercaptoethanol (Sigma-Aldrich). DNA and RNA were isolated using an All Prep Universal kit (Qiagen). RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription PCR was performed using Faststart Universal Probe Master (Rox) (Roche) and TaqMan probes were used to detect full-length STMN2 (IDT Stock Assay #Mm.PT.58.13787385) and the exon 2a splice variant. The primers / probes used to detect exon 2a were forward primer: GCCTTACTCAGACTCCTCTCTC (SEQ ID NO: 263), reverse primer: TCTTCTGCCGAGTCCCATT (SEQ ID NO: 264), and probe: CTGGACCCTTCTCCTTTGCCTTCG (SEQ ID NO: 265) (Baughn MW et al., Science, 2023 Mar 17;379(6637):1140-1149).

[0208] DNA was analyzed to determine the efficiency of nuclease cleavage at defined STMN2 splice sites by a digital droplet polymerase chain reaction (ddPCR) assay, which involves compartmentalizing genomic DNA into oily droplets, followed by amplification and fluorescent detection to quantify the number of events with or without STMN2 disruption.

[0209] The motif disruption observed in vivo after injection of each tested vector is shown in Figure 14B. The number of vector genomes per diploid genome (VG / dg) was determined relative to the copy number of bovine growth hormone (bGH) and is shown in Figure 14A. The highest motif disruption was observed in animals injected with nuclease A + RNA guide 4 (A_STMN2_Splice2a_4), followed by animals injected with Cas12i2 + g55, Cas12i2 + g53, and Cas12i2 + g56 (averages of 17.8%, 13.8%, 13.5%, and 9.4%, respectively). Exon 2a levels observed in animals injected with vehicle (Ctrl) showed a significant decrease after treatment with all vectors, most notably in animals receiving nuclease A + RNA guide 4 (65% decrease, Figure 14C). A significant increase in full-length stathmin-2 RNA was also observed in these mice (26% increase, FIG. 14D).

[0210] The correlation between editing rates and STMN2 transcript levels in mice injected with nuclease A+g4 is shown in Figures 14E-14G.

[0211] Other embodiments All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

[0212] From the above description, those skilled in the art can easily ascertain the essential features of the present invention, and can make various changes and modifications to the present invention to adapt it to various uses and conditions without departing from the spirit and scope thereof. Accordingly, other embodiments are also within the scope of the appended claims.

[0213] equivalent While several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions described herein and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is deemed to be within the scope of the embodiments of the invention described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application for which the teachings of the invention are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Accordingly, it should be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and their equivalents, embodiments of the invention may be practiced otherwise than as specifically described and claimed. The inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. Additionally, any combination of two or more such features, systems, articles, materials, kits, and / or methods is within the inventive scope of the present disclosure, provided that such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0214] All definitions defined and used herein should be construed in preference to dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0215] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, and in some cases may include the entire document.

[0216] The indefinite articles "a" and "an," as used in this specification and claims, unless the context clearly indicates otherwise, should be understood to mean "at least one."

[0217] The phrase "and / or," as used in the specification and claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are present conjunctively in some cases and disjunctively in other cases. Multiple elements listed with "and / or" should be construed in the same manner, i.e., "one or more" of the elements so conjoined. Other elements other than the elements specifically identified by the "and / or" clause may optionally be present, whether related to those elements specifically identified or not. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended terminology such as "comprising," may, in one embodiment, refer to A only (optionally including elements other than B); in another embodiment, refer to B only (optionally including elements other than A); in yet another embodiment, refer to both A and B (optionally including other elements), etc.

[0218] As used in this specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., the inclusion of at least one of some of the elements or list, but also the inclusion of more than one, and optionally, the inclusion of additional items not in the list. Only terms clearly dictated otherwise by context, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," shall refer to the inclusion of some of the elements or exactly one element of a list. In general, the term "or" as used herein shall be interpreted to indicate exclusive alternatives (i.e., "either or the other, but not both") only when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0219] As used in this specification and claims, the phrase "at least one," when referring to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element specifically listed within the list of elements, nor excluding any combinations of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") may refer in one embodiment to at least one (optionally multiple) A (and optionally including elements other than B) in the absence of B; in another embodiment to at least one (optionally multiple) B (and optionally including elements other than A) in the absence of A; in yet another embodiment to at least one (optionally multiple) A and at least one (optionally multiple) B (and optionally including other elements), etc.

[0220] Also, unless the context clearly indicates otherwise, it should be understood that in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are recited.

Claims

1. 1. A gene editing system comprising: (a) a V-type CRISPR nuclease or a nucleic acid encoding the nuclease; (b) one or more guide RNAs (gRNAs) targeting the stathmin-2 (STMN2) gene, or one or more nucleic acids encoding said one or more gRNAs; The gene editing system results in (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2 adjacent to exon 2a, (b) a deletion of one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), thereby reducing the production of STMN2 transcripts including exon 2a and increasing the production of functional STMN2 transcripts in cells edited with the gene editing system.

2. 2. The gene editing system of claim 1, wherein the Type V CRISPR nuclease is optionally a Cas12i2 nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO:

3.

3. The gene editing system of claim 2, wherein the V-type CRISPR nuclease comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

266.

4. 2. The gene editing system of claim 1, wherein the Type V CRISPR nuclease is a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 4-6 or a variant thereof, and optionally the variant comprises an amino acid sequence at least 90% identical to SEQ ID NO: 4, 5, or 6.

5. The gene editing system of claim 3, wherein the V-type CRISPR nuclease comprises the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO:

255.

6. (a) the Type V CRISPR nuclease is optionally a Cas12i2 nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 3 or SEQ ID NO: 266; (b) the one or more guide RNAs (gRNAs) are selected from those listed in Table 2, optionally wherein the gRNA is G53, G55, or G56.

7. (a) the V-type CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 4; (b) the one or more guide RNAs (gRNAs) are selected from those listed in Table 3, and optionally the gRNA is A_STMN2_Splice2a_4, or A_STMN2_Splice2a_3.

2. The gene editing system of claim 1, wherein:

8. (a) the V-type CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 5; 2. The gene editing system of Claim 1, wherein (b) the one or more guide RNAs (gRNAs) are selected from those listed in Table 4.

9. (a) the V-type CRISPR nuclease is a nuclease comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 6; (b) the guide RNA (gRNA) is selected from those listed in Table 5. The gene editing system of claim 1.

10. The gene editing system of any one of claims 1 to 9, comprising the nucleic acid encoding the V-type CRISPR nuclease.

11. 11. The gene editing system of claim 10, wherein the nucleic acid is a vector comprising a first nucleotide sequence encoding the V-type CRISPR nuclease, the first nucleotide sequence being operably linked to a first promoter.

12. 12. The gene editing system of Claim 11, wherein the vector further comprises a second nucleotide sequence encoding the gRNA, the second nucleotide sequence being operably linked to a second promoter.

13. 13. The gene editing system of claim 11 or 12, wherein the vector is an adeno-associated virus (AAV) vector, optionally an AAVrhlO vector.

14. The gene editing system of any one of claims 11 to 13, wherein the first promoter is a synapsin 1 promoter.

15. 1. A method for inhibiting aberrant splicing in a stathmin-2 (STMN2) transcript, comprising: (i) Gene editing an STMN2 gene in a cell to delete (a) one or more nucleotides in the 3' splice site of intron 1 adjacent to exon 2a, (b) one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), thereby inhibiting production of STMN2 transcripts comprising exon 2a and improving production of functional STMN2 transcripts in the cell.

16. the 3' splice site in (a) comprises the nucleotide sequence TTGCAG, and / or 16. The method of claim 15, wherein the region of exon 2a in (b) comprises the nucleotide sequence ACTCGGCAGA (SEQ ID NO: 2).

17. 17. The method of claim 15 or 16, wherein step (i) results in deletions in both (a) and (b).

18. 18. The method of any one of claims 15 to 17, wherein the gene editing step (i) is mediated by a gene editing system.

19. 19. The method of Claim 18, wherein the gene editing system comprises: (i) a type V CRISPR nuclease, or a first nucleic acid encoding the nuclease; and (ii) a guide RNA (gRNA) targeting the STMN2 gene, or a second nucleic acid encoding the gRNA.

20. The method according to claim 19, wherein the editing system is according to any one of claims 2 to 13.

21. 21. The method of any one of claims 15 to 20, wherein the cells are in cell culture, and optionally the cells are derived from a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

22. 22. The method of claim 21, further comprising measuring the level of STMN2 transcript and / or STMN2 protein in the cell after the gene editing.

23. The method of any one of claims 15 to 22, wherein the cells are brain cells, optionally neuronal cells.

24. 24. The method of claim 23, wherein the cell is a motor neuron cell.

25. 25. The method of claim 23 or 24, wherein the neuronal cells are in a human patient with amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

26. 26. The method of claim 25, comprising delivering the gene editing system of any one of claims 1 to 14 to a subject in need thereof.

27. 27. The method of Claim 26, wherein the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection or intrathecal injection.

28. A gene-edited cell comprising (a) a deletion of one or more nucleotides in the 3' splice site of intron 1 of STMN2 adjacent to exon 2a, (b) a deletion of one or more nucleotides in the region of intron 1 adjacent to the 3' splice site, or both (a) and (b), wherein the level of STMN2 transcript containing exon 2a is reduced and the level of functional STMN2 transcript is increased compared to the unedited counterpart.

29. 1. A gene editing system comprising: (a) a V-type CRISPR nuclease comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4, or a first nucleic acid encoding the V-type CRISPR nuclease; (b) a guide RNA (gRNA) targeting the stathmin-2 (STMN2) gene, or a second nucleic acid encoding the gRNA; The gene editing system genetically modifies the STMN2 gene to inhibit production of STMN2 transcripts containing exon 2a.

30. 30. The gene editing system of claim 29, wherein the V-type CRISPR comprises the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO:

255.

31. 31. The gene editing system of Claim 29 or 30, comprising the first nucleic acid encoding the V-type CRISPR nuclease.

32. 32. The gene editing system of Claim 31, wherein the nucleic acid is a vector comprising a first nucleotide sequence encoding the V-type CRISPR nuclease, wherein the first nucleotide sequence is operably linked to a first promoter.

33. 33. The gene editing system of Claim 32, wherein the vector further comprises a second nucleotide sequence encoding the gRNA, the second nucleotide sequence operably linked to a second promoter.

34. 34. The gene editing system of claim 32 or 33, wherein the vector is an adeno-associated virus (AAV) vector, optionally an AAVrhlO vector.

35. The gene editing system of any one of claims 32 to 34, wherein the first promoter is a synapsin 1 promoter.

36. 36. A method for gene editing a stathmin-2 (STMN2) gene, comprising contacting a cell with the gene editing system of any one of claims 29 to 35 to enable gene editing of the STMN2 gene in the cell by the gene editing system.

37. 37. The method of Claim 36, wherein the contacting step is carried out by administering the gene editing system to a subject in need thereof.

38. 38. The method of Claim 37, wherein the gene editing system is delivered to the subject by intracerebroventricular (ICV) injection or intrathecal injection.

39. A method for treating a disease associated with aberrant splicing of STMN2, comprising administering to a subject in need thereof an effective amount of a gene editing system described in any one of claims 1 to 13 and claims 29 to 34.

40. 40. The method of claim 39, wherein the subject is a human patient.

41. 41. The method of claim 39 or 40, wherein the disease is ALS or FTD.

Images