Compounds and methods for modulating alpha-synuclein expression

Abstract

Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of SNCA mRNA in a cell or subject, and in certain cases, for reducing the amount of alpha-synuclein protein in a cell or subject. Such compounds, pharmaceutical compositions, and methods of use are useful for ameliorating at least one symptom or characteristic of synucleinopathies. Such synucleinopathies include Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, and Alzheimer's disease.

Description

[Technical Field]

[0001] Sequence Listing This application is filed with an electronic Sequence Listing, which is provided under the file name BIOL0468SEQ.xml, created on February 2, 2024, and is 3,338 KB in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] Field Compounds, pharmaceutical compositions, and methods are provided for reducing the amount or activity of alpha-synuclein (SNCA) RNA in a cell or a subject, and in certain cases, for reducing the amount of alpha-synuclein protein in a cell or a subject. Such compounds, pharmaceutical compositions, and methods are useful for ameliorating at least one symptom or characteristic of synucleinopathy (or alpha-synucleinopathy). Such symptoms and characteristics include motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic dysfunction, ataxia, hallucinations, and seizures. Such synucleinopathies include Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, and Alzheimer's disease. [Background technology]

[0003] Alpha-synuclein is a small, highly charged 140-amino acid residue protein expressed primarily in central nervous system (CNS) neurons and localized at presynaptic terminals in close proximity to synaptic vesicles (Iwai, et al., Neuron. 1995. 14:467-475). Alpha-synuclein is encoded by the SNCA gene. As shown in vitro, alpha-synuclein can associate with lipid membranes by forming amphipathic α-helices (Davidson, et al., J. Biol. Chem. 1998. 273:9443-9449). Several studies suggest that alpha-synuclein is involved in regulating synaptic transmission, synaptic vesicle density, and neuroplasticity (Cabin et al., J. Neurosci. 2002. 22:8797-8807; Burre et al., Science. 2010. 329:1663-1667; and Burre et al., J. Neurosci. 2015. 35:5221-5232). SNCA has been shown to inhibit synaptic vesicle release and disrupt SNARE complex-mediated lipid membrane fusion (DeWitt et al., Biochemistry. 2013. 52:2385-2387; Abeliovich et al., Neuron. 2000. 25:239-252). Decreased SNARE complex assembly is associated with neurological dysfunction, thus indicating a link between presynaptic alpha-synuclein aggregates and neurodegeneration (Kramer and Schulz-Schaeffer, J. Neurosci. 2007. 27:1405-1410). Alpha-synuclein knockout mouse models are not lethal and brain morphology is intact, suggesting that alpha-synuclein is not required for neurodevelopment and / or that compensatory pathways exist (Abeliovich et al., Neuron. 2000. 25:239-252).

[0004] Alpha-synuclein misfolding, aggregation, and fibrillation have been implicated as key factors in several neurodegenerative diseases, including Parkinson's disease, the Lewy body variant of Alzheimer's disease, diffuse Lewy body disease, dementia with Lewy bodies, and multiple system atrophy (Schulz-Schaeffer, Acta Neuropathol. 2010. 120:131-143; Yoshida, Neuropathology. 2007. 27:484-493). In all of these cases, alpha-synuclein protein misfolds and aggregates into Lewy bodies and Lewy neurite aggregates (Uversky, J. Neurochem. 2007. 103:17-37).

[0005] Point mutations, genomic duplications, or genomic triplications in SNCA are associated with Parkinson's disease and other synucleinopathies. For example, six missense mutations in the SNCA gene are associated with autosomal dominant Parkinson's disease (A53T, A30P, E46K, H50Q, G51D, and A53E). These mutations are clustered within the membrane-binding domain, suggesting that this region contributes to SNCA dysfunction. See, for example, Bras et al., Cells. 2021.10:375.

[0006] Currently, there is a lack of acceptable options for treating synucleinopathies such as Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, and Alzheimer's disease. Accordingly, it is an object herein to provide compounds, pharmaceutical compositions, and methods of use for the treatment of such synucleinopathies. Summary of the Invention

[0007] Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of SNCA RNA, and in certain embodiments, for reducing the amount of alpha-synuclein protein in a cell or a subject. In certain embodiments, the subject has a synucleinopathy. In certain embodiments, the subject has Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronpathic Gaucher disease, or Alzheimer's disease. In certain embodiments, a compound useful for reducing the amount or activity of SNCA RNA is an oligomeric compound. In certain embodiments, a compound useful for reducing the amount or activity of SNCA RNA is a modified oligonucleotide. In certain embodiments, a compound useful for reducing the amount of alpha-synuclein protein is an oligomeric compound. In certain embodiments, a compound useful for reducing the amount of alpha-synuclein protein is a modified oligonucleotide.

[0008] Also provided is a method useful for improving at least one symptom or characteristic of synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease. In certain embodiments, the symptom or characteristic includes motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorder, hyposmia, autonomic failure, ataxia, hallucinations, or seizures. In certain embodiments, the improvement of one or more of these symptoms or characteristics results in improved motor function, reduced alpha-synuclein aggregation, delayed neurodegeneration, delayed cognitive decline, alleviated dementia, improved sleep, improved sense of smell, delayed autonomic failure, delayed ataxia, alleviated hallucinations, and / or alleviated seizures.

[0009] Various aspects of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings, in which: [Brief explanation of the drawings]

[0010] [Figure 1] Duration of action studies using exemplary modified oligonucleotides described herein are described. [Figure 2] 1 illustrates tissue concentrations of exemplary modified oligonucleotides described herein. [Figure 3] ASO concentrations are illustrated using exemplary modified oligonucleotides described herein. DETAILED DESCRIPTION OF THE INVENTION

[0011] It is to be understood that both the foregoing Summary of the Invention and the following Detailed Description are exemplary and explanatory only and not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Also, terms such as "element" or "component" encompass both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, listed in this application, including but not limited to patents, patent applications, articles, books, and papers, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0013] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings. As used herein, "2'-deoxyribonucleoside" refers to a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D deoxynucleoside, which contains a 2-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside containing an unmodified 2'-deoxyribosyl sugar moiety may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0015] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" refers to O-methoxyethyl.

[0016] As used herein, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).

[0017] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-O-methyl sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, 2'-OMe has a β-D ribosyl stereochemical configuration.

[0018] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0019] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D-ribosyl configuration.

[0020] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F modified sugar moiety.

[0021] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.

[0022] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0023] As used herein, "abasic sugar moiety" means a sugar moiety that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0024] As used herein, "administration" or "administering" means providing a pharmaceutical agent or composition to a subject.

[0025] As used herein, "improving" in relation to treatment refers to the improvement of at least one symptom or characteristic compared to the same symptom or characteristic in the absence of treatment.In certain embodiments, improvement refers to the alleviation or reduction of the severity or frequency of a symptom or characteristic, or the delay in the onset of a symptom or characteristic, or the delay in the progression of their severity or frequency.In certain embodiments, the symptom or characteristic is motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorder, hyposmia, autonomic dysfunction, ataxia, hallucinations, or seizures.The progression or severity of an indicator can be determined by subjective or objective measures known to those skilled in the art.

[0026] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0027] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0028] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0029] As used herein, "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0030] As used herein, " antisense oligonucleotide " refers to the oligonucleotide that can hybridize with target nucleic acid and can have at least one antisense activity, and comprises the oligonucleotide portion of antisense compound.Antisense oligonucleotide includes but is not limited to antisense RNAi oligonucleotide and antisense RNase H oligonucleotide.

[0031] As used herein, " sense oligonucleotide " refers to the oligonucleotide that comprises the oligonucleotide portion of sense compound, which can hybridize with antisense oligonucleotide.Sense oligonucleotide includes but is not limited to sense RNAi oligonucleotide.

[0032] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0033] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.

[0034] As used herein, "blunt" or "blunt ended," with respect to an oligomeric duplex formed by two oligonucleotides, means that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt.

[0035] As used herein, "cell targeting moiety" means a conjugate moiety or a portion of a conjugate moiety that is capable of binding to a particular cell type or types of cells.

[0036] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0037] As used herein, "chirally enriched" with respect to a population refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if that particular chiral center were stereorandom as defined herein. A chirally enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesyl phosphoramidate internucleoside linkage.

[0038] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved upon administration inside a subject, e.g., a cell, subject, or human.

[0039] As used herein, "complementary" with respect to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide, or one or more portions thereof, and another nucleic acid, or one or more portions thereof, can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine ( ... m Examples of modified nucleobases that pair with unmodified or other modified nucleobases include guanine (G) and guanine (C). Certain modified nucleobases that pair with unmodified or other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0040] As used herein, a "region of complementarity," with respect to an oligonucleotide, is the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0041] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that joins the conjugate moiety to the oligonucleotide.

[0042] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that attaches a conjugate moiety to an oligonucleotide.

[0043] As used herein, "conjugate moiety" means a group of atoms that, when covalently attached to a molecule, modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0044] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0045] As used herein, "constrained ethyl" or "cEt" or "cEt sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0046] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0047] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, at least 70% of which nucleosides contain a 2'-deoxy sugar moiety. In certain embodiments, each nucleoside is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0048] As used herein, "diluent" refers to an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, such as aCSF, PBS, or saline solution.

[0049] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that have folded back on themselves (e.g., a hairpin structure).

[0050] As used herein, "duplex" or "double-stranded region" refers to the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0051] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, interspersed between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides or nucleosides comprising the external regions. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings" or "wing segments." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5' end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides in the gap being 2'-β-D-deoxynucleosides. As used herein, "MOE gapmer" refers to a gapmer having a gap comprising wings comprising 2'-β-D-deoxynucleosides and 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0052] As used herein, a "hot spot region" refers to a range of nucleobases on a target nucleic acid that is susceptible to a reduction in the amount or activity of the target nucleic acid due to the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent. A hot spot region includes at least one portion that is complementary to an active antisense oligonucleotide.

[0053] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0054] As used herein, "internucleoside linkage" refers to the covalent bond between consecutive nucleosides in an oligonucleotide.As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage.A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0055] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0056] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3' to 3' and / or 5' to 5' internucleoside linkage.

[0057] As used herein, "linked nucleosides" are nucleosides that are joined in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0058] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0059] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to the corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned in opposite orientations.

[0060] As used herein, "motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0061] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0062] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" refers to an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0063] As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0064] As used herein, a "nucleobase sequence of" a reference SEQ ID NO: refers only to the nucleobase sequence provided in such SEQ ID NO: and therefore, unless otherwise indicated, includes compounds in which each sugar moiety and each internucleoside linkage may be modified or unmodified, with or without the modifications indicated in the reference SEQ ID NO:.

[0065] As used herein, "nucleoside" means a compound, or fragment of a compound, that includes a nucleobase and a sugar moiety, each of which independently is unmodified or modified.

[0066] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0067] As used herein, "oligomeric agent" means an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.

[0068] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0069] The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0070] As used herein, "oligonucleotide" means a polymer of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides.

[0071] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified.As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.An oligonucleotide can be paired with a second oligonucleotide that is complementary to the oligonucleotide, or can be unpaired.A "single-stranded oligonucleotide" is an unpaired oligonucleotide.A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0072] As used herein, "pharmaceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to a subject. Certain such carriers allow the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0073] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.

[0074] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0075] As used herein, "prodrug" refers to an inactive or less active form of a compound that, when administered to a subject, is metabolized to form an active or more active compound. In certain embodiments, a prodrug comprises a cell-targeting moiety and at least one active compound.

[0076] As used herein, "reducing or inhibiting the amount or activity" means a decrease or blockage of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete loss of transcriptional expression or activity.

[0077] As used herein, "RNA" means RNA transcripts, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0078] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act primarily through RNase H.

[0079] As used herein, "RNase H agent" refers to an antisense agent that acts via RNase H to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily via RISC / Ago2.

[0080] As used herein, "antisense RNase H oligonucleotide" means an oligonucleotide that is complementary to a target sequence and includes a region containing at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

[0081] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that is complementary to a target sequence and includes a region containing at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0082] As used herein with respect to oligonucleotides, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.

[0083] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a double strand. Single-stranded compounds can hybridize with a complementary nucleic acid to form a double strand, at which point they are no longer single-stranded.

[0084] As used herein, "stabilized phosphate group" means a 5'-phosphate analog that is more metabolically stable than the 5'-phosphate naturally occurring on DNA or RNA.

[0085] As used herein, "standard in vitro assay" means the assay described in Examples 1, 2, 3, 4, 5, 6, 7, or 8, and reasonable variations thereof.

[0086] As used herein, "standard in vivo assay" means the assay described in Examples 10, 11, 12, 13, 14, or 15, and reasonable variations thereof.

[0087] As used herein, "sterically random" or "sterically random chiral center" in the context of a population of molecules having the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis in a specific absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if it is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a population of molecules containing a stereochemically random chiral center, the number of molecules with the stereochemically random chiral center's (S) configuration may be the same as the number of molecules with the stereochemically random chiral center's (R) configuration ("racemic"). The stereochemical configuration of a chiral center is random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereochemically random chiral center is at the phosphorus atom of a stereochemically random phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0088] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.

[0089] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0090] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.

[0091] As used herein, "symptom or feature" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the feature becomes apparent during invasive diagnostic testing, including, but not limited to, postmortem testing. In certain embodiments, the symptom or feature includes motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

[0092] As used herein, "target nucleic acid" and "target RNA" refer to the nucleic acid that an antisense compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0093] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0094] As used herein, "terminal group" means a chemical group or group of atoms covalently linked to the end of an oligonucleotide.

[0095] As used herein, "treating" refers to improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0096] As used herein, "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that provides a therapeutic effect to a subject. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0097] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0098] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an SNCA nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0099] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-3334, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0100] Embodiment 3.1 consists of 2 to 50 linked nucleosides, and an isometric portion of nucleobases 16,692 to 16,716 of SEQ ID NO: 1 or nucleobases 18,758 to 18,782 of SEQ ID NO: 2; an isometric portion of nucleobases 18,568 to 18,593 of SEQ ID NO: 1 or nucleobases 20,634 to 20,659 of SEQ ID NO: 2; an isometric portion of nucleobases 18,621 to 18,649 of SEQ ID NO: 1 or nucleobases 20,687 to 20,715 of SEQ ID NO: 2; an isometric portion of nucleobases 18,721 to 18,752 of SEQ ID NO: 1 or nucleobases 20,787 to 20,818 of SEQ ID NO: 2; an isometric portion of nucleobases 19,423 to 19,443 of SEQ ID NO: 1 or nucleobases 21,489 to 21,509 of SEQ ID NO: 2; an isometric portion of nucleobases 19,555 to 19,575 of SEQ ID NO: 1 or nucleobases 21,621 to 21,641 of SEQ ID NO: 2; an isometric portion of nucleobases 21,457 to 21,501 of SEQ ID NO: 1 or nucleobases 23,523 to 23,567 of SEQ ID NO: 2; an isometric portion of nucleobases 22,008 to 22,030 of SEQ ID NO: 1 or nucleobases 24,074 to 24,096 of SEQ ID NO: 2; an isometric portion of nucleobases 22,507 to 22,529 of SEQ ID NO: 1 or nucleobases 24,573 to 24,595 of SEQ ID NO: 2; an isometric portion of nucleobases 22,614 to 22,637 of SEQ ID NO: 1 or nucleobases 24,680 to 24,703 of SEQ ID NO: 2; an isometric portion of nucleobases 25,049 to 25,090 of SEQ ID NO: 1 or nucleobases 27,115 to 27,156 of SEQ ID NO: 2; an isometric portion of nucleobases 26,367 to 26,388 of SEQ ID NO: 1 or nucleobases 28,433 to 28,454 of SEQ ID NO: 2; an isometric portion of nucleobases 26,508 to 26,531 of SEQ ID NO: 1 or nucleobases 28,574 to 28,597 of SEQ ID NO: 2; an isometric portion of nucleobases 30,207 to 30,226 of SEQ ID NO: 1 or nucleobases 32,273 to 32,292 of SEQ ID NO: 2; an isometric portion of nucleobases 31,412 to 31,438 of SEQ ID NO: 1 or nucleobases 33,478 to 33,504 of SEQ ID NO: 2; an isometric portion of nucleobases 33,027 to 33,057 of SEQ ID NO: 1 or nucleobases 35,093 to 35,123 of SEQ ID NO: 2; or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases complementary to an isometric portion of nucleobases 48,460 to 48,489 of SEQ ID NO: 1 or nucleobases 50,526 to 50,555 of SEQ ID NO: 2, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0101] Embodiment 4.1 consists of 2 to 50 linked nucleosides, and SEQ ID NO: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189, or 3271, SEQ ID NO: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184, or 3266; SEQ ID NO: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289, or 3313, SEQ ID NO: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176, or 3305; SEQ ID NO: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, or 3280; SEQ ID NO: 205, 2594, 2686, 3028, 3097, 3158, 3205, or 3287; SEQ ID NO: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193, or 3275; SEQ ID NO: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228, or 3310; SEQ ID NO: 196, 1814, 1909, 3042, 3109, 3170, 3217, or 3299; SEQ ID NO: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227, or 3309; SEQ ID NO: 24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195, or 3277, SEQ ID NO: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224, or 3306; SEQ ID NO: 210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197, or 3279; SEQ ID NO: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225, or 3307; SEQ ID NO: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226, or 3308; SEQ ID NO: 194, 277, 1113, 1185, 1309, 3024, 3093, 3154, 3201, or 3283, or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of SEQ ID NOs: 310, 803, 919, 1582, 1674, 3032, 3032, 3032, 3100, 3161, 3208, 3290, or 3290; An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0102] Embodiment 5. The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-9, when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0103] Embodiment 6. The modified oligonucleotide is 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 3 6. The oligomeric compound of any one of embodiments 1-5, consisting of 0, 16-50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, or 20-50 linked nucleosides.

[0104] Embodiment 7. The oligomeric compound of any of embodiments 1-6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0105] Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified nucleoside comprises a modified sugar moiety.

[0106] Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0107] Embodiment 10. The oligomeric compound of embodiment 9, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0108] Embodiment 11. The oligomeric compound of any of embodiments 7-10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0109] Embodiment 12. The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylosyl sugar moiety, or a 2'-α-L-deoxyribosyl sugar moiety.

[0110] Embodiment 13. The oligomeric compound of any of embodiments 7-12, wherein the modified nucleoside comprises a sugar surrogate.

[0111] Embodiment 14. The oligomeric compound of embodiment 13, wherein the sugar surrogate is any of a morpholino, a modified morpholino, a glycol nucleic acid (GNA), a six-membered tetrahydropyran (THP), and an F-hexitol nucleic acid (F-HNA).

[0112] Embodiment 15. The oligomeric compound of any one of embodiments 1 to 14, wherein the modified oligonucleotide is a gapmer.

[0113] Embodiment 16. The oligomeric compound of any of embodiments 1 to 15, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0114] Embodiment 17 The oligomeric compound of embodiment 16, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

[0115] Embodiment 18 The oligomeric compound of embodiment 16 or embodiment 17, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0116] Embodiment 19. The oligomeric compound of any of embodiments 16-18, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0117] Embodiment 20. The oligomeric compound of any of embodiments 16-19, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

[0118] Embodiment 21. The oligomeric compound of any of embodiments 16, 18, or 19, wherein each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

[0119] Embodiment 22. The oligomeric compound of any of embodiments 16-18, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0120] Embodiment 23. The oligomeric compound of any of embodiments 16-22, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0121] Embodiment 24. The oligomeric compound of any of embodiments 16-21, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 internucleoside linkages of the modified oligonucleotide are mesyl phosphoramidate internucleoside linkages.

[0122] Embodiment 25. The modified oligonucleotide is 5'-soossssssssssos-3', 5'-soossssssssssoos-3', 5'sooossssssssssos-3', 5'-sooossssssssssoos-3', 5'-soooossssssssssooos-3', 5'-soossssssssssooos-3', 5'-soossssssssssssss-3', 5'-sssssssssssssssssss-3', 5'-sooooossssssssssoss-3', 5'-ssssszzzzssssssssss-3', 5'-soooszzzzssssssooss-3', 5'-sooosssssssssssooss-3', 5'-sosssssssssssssooss-3', 5'-sooosszzsssssoss-3', 5'-sossssssssssssssoss-3', 5'-soosszzzzssssssooss-3', 5'-sossszzzzssssssooss-3', 5'-sossszzzzsssssssoss-3', 5'-sssssszsszzszssssss-3', 5'-ssssssssszzsssssoss-3', 5'-ssooszsssssszsssoss-3', 5'-ssosszsssssszzssoss-3', 5'-sssoszzzsssssssssss-3', 5'-ssoosszzsssssssosss-3', 5'-ssssszzsssszzssssss-3', 5'-sssssszssssszsssoss-3', 5'-soossssssssssssooss-3', 5'-sossszzsssszzssosss-3', 5'-sossszzsssszzsssoss-3', 5'-sossszzsssszzssssss-3', 5'-ssssszzsssszzssooss-3', 5'-ssssszssssszzssssss-3', 5'-sssssszsssszzssssss-3', 5'-ssssszzssssszssssss-3', 5'-ssssszzsssszsssssss-3', 5'-sossszssssszzssosss-3', 5'-sosssszsssszzssosss-3', 5'-sossszzssssszssosss-3',5'-sossszzsssszsssosss-3', 5'-sossszssssszzsssoss-3', 5'-sosssszsssszzsssoss-3', 5'-soss szzssssszsssoss-3', 5'-sossszzsssszssssoss-3', 5'-szssszzsssszzsszzss-3', 5'-zzssszzssss zzsssszz-3', 5'-zsssszzsssszzsssssz-3', 5'-ssooszsssssszzssoss-3', 5'-sssoszssssszzssos s-3', 5'-ssooszsssssszzsssss-3', 5'-ssssszssssszzssoss-3', 5'-sssszzsssssszzsssss-3', 5'- soooszzssssszssooss-3', 5'-sooszzssssszzsooss-3', 5'-ssooszzssssszssooss-3', 5'-ssooszz ssssszzsooss-3', 5'-sssoszzssssszssooss-3', 5'-sssoszzssssszzsooss-3', 5'-sssoszzssssszs 21. The oligomeric compound of any of embodiments 16-20, having an internucleoside linkage motif selected from 5'-ssss-3', 5'-sssoszzssssszzsosss-3', and 5'-sssoszzssssszzsosss-3', wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.

[0123] Embodiment 26. The oligomeric compound of any of embodiments 1 to 25, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

[0124] Embodiment 27. The oligomeric compound of embodiment 26, wherein the modified nucleobase is 5-methylcytosine.

[0125] Embodiment 28 The oligomeric compound of embodiment 27, wherein each cytosine is a 5-methylcytosine.

[0126] Embodiment 29. The oligomeric compound of any of embodiments 1 to 28, wherein each nucleoside of the modified oligonucleotide is an unmodified adenine, an unmodified guanine, an unmodified thymine, an unmodified cytosine, or a 5-methylcytosine.

[0127] Embodiment 30. The oligomeric compound of any one of embodiments 1 to 29, wherein the modified oligonucleotide comprises a deoxy region.

[0128] Embodiment 31 The oligomeric compound of embodiment 30, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.

[0129] Embodiment 32. The oligomeric compound of embodiment 30 or embodiment 31, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

[0130] Embodiment 33 The oligomeric compound of any of Embodiments 30-32, wherein each nucleoside immediately adjacent to the deoxy tract comprises a modified sugar moiety.

[0131] Embodiment 34. The oligomeric compound of any of embodiments 30 to 33, wherein the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and adjacent on the 3' side to a 3' region consisting of 1 to 6 linked 3' region nucleosides, wherein at least one nucleoside in the 5' region comprises a modified sugar moiety, and at least one nucleoside in the 3' region comprises a modified sugar moiety.

[0132] Embodiment 35. The oligomeric compound of embodiment 34, wherein each nucleoside of the 5' region comprises a modified sugar moiety.

[0133] Embodiment 36. The oligomeric compound of embodiment 34 or embodiment 35, wherein each nucleoside of the 3' region comprises a modified sugar moiety.

[0134] Embodiment 37. The oligomeric compound of any of embodiments 1 to 36, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.

[0135] Embodiment 38. The oligomeric compound of any one of embodiments 1 to 37, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0136] Embodiment 39. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; 39. The oligomeric compound of any of embodiments 1-38, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0137] Embodiment 40. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; 40. The oligomeric compound of any of embodiments 1-39, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0138] Embodiment 41. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; The oligomeric compound of embodiment 40, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0139] Embodiment 42. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; 40. The oligomeric compound of any of embodiments 1-39, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0140] Embodiment 43. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; The oligomeric compound of embodiment 42, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0141] Embodiment 44. An oligomeric compound according to any one of embodiments 1 to 43, which consists of a modified oligonucleotide.

[0142] Embodiment 45. The oligomeric compound of any one of embodiments 1 to 43, wherein the oligomeric compound comprises a conjugate group.

[0143] Embodiment 46 The oligomeric compound of embodiment 45, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0144] Embodiment 47 The oligomeric compound of embodiment 46, wherein the conjugate linker is a phosphodiester linker.

[0145] Embodiment 48 The oligomeric compound of embodiment 46, wherein the conjugate linker consists of a single bond.

[0146] Embodiment 49. The oligomeric compound of any of embodiments 46 to 48, wherein the conjugate linker is cleavable.

[0147] Embodiment 50. The oligomeric compound of any of embodiments 46, 47, or 49, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to a conjugate moiety, a modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

[0148] Embodiment 51. The oligomeric compound of any of embodiments 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0149] Embodiment 52. The oligomeric compound of any of embodiments 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0150] Embodiment 53. The oligomeric compound of any of embodiments 1-49 or 51-52, wherein the oligomeric compound does not comprise a linker nucleoside.

[0151] Embodiment 54. The oligomeric compound of any one of embodiments 1 to 53, comprising a terminal group.

[0152] Embodiment 55. The oligomeric compound of embodiment 54, wherein the terminal group is an abasic sugar moiety.

[0153] Embodiment 56. The oligomeric compound of any one of embodiments 1 to 55, wherein the oligomeric compound is an RNase H agent.

[0154] Embodiment 57. The following chemical notation: A es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es m C e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3335), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

[0155] Embodiment 58. The following chemical notation: A es m C es G eoA eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es T e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3336), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

[0156] Embodiment 59. The following chemical notation: A es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds mC es T es G es m C es m C e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3337), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

[0157] Embodiment 60. The following chemical notation: A es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es T e 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3338), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

[0158] Embodiment 61. The oligomeric compound of any of embodiments 57 to 60, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

[0159] Embodiment 62. The oligomeric compound of embodiment 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0160] Embodiment 63. The oligomeric compound of any one of embodiments 1 to 62, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0161] Embodiment 64. The following chemical notation: N 1 es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es N 2 e An oligomeric compound according to (SEQ ID NO: 3346), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N 2 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group.

[0162] Embodiment 65. The following chemical notation: N 1 es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es N 3 eAn oligomeric compound according to (SEQ ID NO: 3347), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N 3 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group.

[0163] Embodiment 66. The following chemical notation: N 1 es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es G es m C es N 2e An oligomeric compound according to (SEQ ID NO: 3348), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N 2 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group.

[0164] Embodiment 67. The following chemical notation: N 1 es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es N3 e An oligomeric compound according to (SEQ ID NO: 3349), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N 3 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein the oligomeric compound optionally comprises a conjugate group.

[0165] Embodiment 68.N 1 68. The oligomeric compound of any of embodiments 64-67, wherein is an adenine nucleobase.

[0166] Embodiment 69.N 1 68. The oligomeric compound of any of embodiments 64-67, wherein is unmodified adenine.

[0167] Embodiment 70.N 1 68. The oligomeric compound according to any of embodiments 64-67, wherein is a modified adenine.

[0168] Embodiment 71.N 1 68. The oligomeric compound according to any of embodiments 64-67, wherein is hypoxanthine.

[0169] Embodiment 72.N 1 68. The oligomeric compound of any of embodiments 64-67, wherein is an abasic sugar moiety.

[0170] Embodiment 73.N 1 68. The oligomeric compound of any of embodiments 64-67, wherein is a terminal group.

[0171] Embodiment 74.N 1 68. The oligomeric compound of any of embodiments 64-67, wherein is absent.

[0172] Embodiment 75.N 2 75. The oligomeric compound according to any of embodiments 64-74, wherein is a modified cytosine.

[0173] Embodiment 76.N 2 The oligomeric compound of any of embodiments 64-74, wherein is 5-methylcytosine.

[0174] Embodiment 77.N 2 75. The oligomeric compound according to any of embodiments 64-74, wherein is an unmodified cytosine.

[0175] Embodiment 78.N 2 75. The oligomeric compound of any of embodiments 64-74, wherein is an abasic sugar moiety.

[0176] Embodiment 79.N 2 75. The oligomeric compound of any of embodiments 64-74, wherein is a terminal group.

[0177] Embodiment 80.N 2 75. The oligomeric compound of any of embodiments 64-74, wherein is absent.

[0178] Embodiment 81.N 3 75. The oligomeric compound of any of embodiments 64-74, wherein is a modified thymine.

[0179] Embodiment 82.N3 75. The oligomeric compound of any of embodiments 64-74, wherein is an unmodified thymine.

[0180] Embodiment 83.N 3 75. The oligomeric compound of any of embodiments 64-74, wherein is an abasic sugar moiety.

[0181] Embodiment 84.N 3 75. The oligomeric compound of any of embodiments 64-74, wherein is a terminal group.

[0182] Embodiment 85.N 3 75. The oligomeric compound of any of embodiments 64-74, wherein is absent.

[0183] Embodiment 86.N 1 is the adenine nucleobase, and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0184] Embodiment 87.N 1 is the adenine nucleobase, and N 2 87. The oligomeric compound according to any of embodiments 64-80 or 86, wherein is a modified cytosine.

[0185] Embodiment 88.N 1 is the adenine nucleobase, and N 2 87. The oligomeric compound of any of embodiments 64-80 or 86, wherein is an abasic sugar moiety.

[0186] Embodiment 89.N 1 is the adenine nucleobase, and N 2 87. The oligomeric compound of any one of embodiments 64-80 or 86, wherein is a terminal group.

[0187] Embodiment 90.N 1 is the adenine nucleobase, and N 287. The oligomeric compound of any of embodiments 64-80 or 86, wherein is absent.

[0188] Embodiment 91.N 1 is a modified adenine, and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0189] Embodiment 92.N 1 is a modified adenine, and N 2 92. The oligomeric compound according to any of embodiments 64-80 or 91, wherein is a modified cytosine.

[0190] Embodiment 93.N 1 is a modified adenine, and N 2 The oligomeric compound of any of embodiments 64-80 or 91, wherein is 5-methylcytosine.

[0191] Embodiment 94.N 1 is a modified adenine, and N 2 92. The oligomeric compound of any of embodiments 64-80 or 91, wherein is an abasic sugar moiety.

[0192] Embodiment 95.N 1 is a modified adenine, and N 2 92. The oligomeric compound of any one of embodiments 64-80 or 91, wherein is a terminal group.

[0193] Embodiment 96.N 1 is a modified adenine, and N 2 92. The oligomeric compound of any of embodiments 64-80 or 91, wherein is absent.

[0194] Embodiment 97.N 1 is hypoxanthine, and N 2 92. The oligomeric compound of any of embodiments 64-80 or 91, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0195] Embodiment 98.N 1 is hypoxanthine, and N 2 98. The oligomeric compound according to any of embodiments 64-80 or 97, wherein is a modified cytosine.

[0196] Embodiment 99.N 1 is hypoxanthine, and N 2 The oligomeric compound of any of embodiments 64-80 or 97, wherein is 5-methylcytosine.

[0197] Embodiment 100.N 1 is hypoxanthine, and N 2 98. The oligomeric compound of any of embodiments 64-80 or 97, wherein is an abasic sugar moiety.

[0198] Embodiment 101.N 1 is hypoxanthine, and N 2 98. The oligomeric compound of any of embodiments 64-80 or 97, wherein: is a terminal group.

[0199] Embodiment 102.N 1 is hypoxanthine, and N 2 98. The oligomeric compound of any of embodiments 64-80 or 97, wherein is absent.

[0200] Embodiment 103.N 1 is the abasic sugar moiety, and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0201] Embodiment 104.N 1 is the terminal group, and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0202] Embodiment 105.N 1does not exist and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

[0203] Embodiment 106.N 1 does not exist and N 2 81. The oligomeric compound of any of embodiments 64-80, wherein is absent.

[0204] Embodiment 107.N 1 is the adenine nucleobase, and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0205] Embodiment 108.N 1 is the adenine nucleobase, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 107, wherein is a thymine nucleobase.

[0206] Embodiment 109.N 1 is the adenine nucleobase, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 107, wherein is a modified thymine.

[0207] Embodiment 110.N 1 is the adenine nucleobase, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 107, wherein is an abasic sugar moiety.

[0208] Embodiment 111.N 1 is the adenine nucleobase, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 107, wherein is a terminal group.

[0209] Embodiment 112.N 1 is the adenine nucleobase, and N3 The oligomeric compound of any of embodiments 64-74, 81-85, or 107, wherein is absent.

[0210] Embodiment 113.N 1 is a modified adenine, and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0211] Embodiment 114.N 1 is a modified adenine, and N 3 114. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein is an unmodified thymine.

[0212] Embodiment 115.N 1 is a modified adenine, and N 3 114. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein is an abasic sugar moiety.

[0213] Embodiment 116.N 1 is a modified adenine, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein is a terminal group.

[0214] Embodiment 117.N 1 is a modified adenine, and N 3 114. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein is absent.

[0215] Embodiment 118.N 1 is hypoxanthine, and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0216] Embodiment 119.N 1 is hypoxanthine, and N3 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein is an unmodified thymine.

[0217] Embodiment 120.N 1 is hypoxanthine, and N 3 119. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein is an abasic sugar moiety.

[0218] Embodiment 121.N 1 is hypoxanthine, and N 3 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein is a terminal group.

[0219] Embodiment 122.N 1 is hypoxanthine, and N 3 119. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein is absent.

[0220] Embodiment 123.N 1 is the abasic sugar moiety, and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0221] Embodiment 124.N 1 is the terminal group, and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0222] Embodiment 125.N 1 does not exist and N 3 86. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

[0223] Embodiment 126.N 1does not exist and N 3 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein is absent.

[0224] Embodiment 127. The oligomeric compound according to any of embodiments 64 to 126, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0225] Embodiment 128. The oligomeric compound of embodiment 127, wherein the conjugate linker is a phosphodiester linker.

[0226] Embodiment 129. The oligomeric compound according to embodiment 127, wherein the conjugate linker consists of a single bond.

[0227] Embodiment 130. The oligomeric compound of any of embodiments 127-129, wherein the conjugate linker is cleavable.

[0228] Embodiment 131. The oligomeric compound of any of embodiments 127, 128, or 130, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to a conjugate moiety, an oligomeric compound, or another linker nucleoside by a phosphodiester bond.

[0229] Embodiment 132. The oligomeric compound of any of embodiments 64 to 131, wherein the conjugate group is attached to the oligomeric compound at the 5' end of the oligomeric compound.

[0230] Embodiment 133. The oligomeric compound of any of embodiments 64 to 131, wherein the conjugate group is attached to the oligomeric compound at the 3' end of the oligomeric compound.

[0231] Embodiment 134. The oligomeric compound of any of embodiments 64-133, wherein the oligomeric compound is a pharmaceutically acceptable salt.

[0232] Embodiment 135. The oligomeric compound of embodiment 133, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0233] Embodiment 136. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of any of embodiments 1 to 135.

[0234] Embodiment 137. The oligomeric duplex of embodiment 136, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide.

[0235] Embodiment 138. The oligomeric duplex of embodiment 136 or embodiment 137, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5'-stabilizing phosphate group.

[0236] Embodiment 139. The oligomeric duplex of embodiment 138, wherein the stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate.

[0237] Embodiment 140. The oligomeric duplex of any of embodiments 136 to 139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0238] Embodiment 141 The oligomeric duplex of embodiment 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0239] Embodiment 142. The oligomeric duplex of embodiment 141, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0240] Embodiment 143 The oligomeric duplex of embodiment 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0241] Embodiment 144 The oligomeric duplex of embodiment 143, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F modified sugar moiety, or a 2'-OMe modified sugar moiety.

[0242] Embodiment 145. The oligomeric duplex of any of embodiments 136 to 144, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.

[0243] Embodiment 146. The oligomeric duplex of embodiment 145, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0244] Embodiment 147. The oligomeric duplex of any of embodiments 136 to 146, wherein at least one internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage.

[0245] Embodiment 148. The oligomeric duplex of any of embodiments 145 to 147, wherein at least one internucleoside linkage of the second modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.

[0246] Embodiment 149. The oligomeric duplex of any of embodiments 136 to 148, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.

[0247] Embodiment 150. The oligomeric duplex of any of embodiments 136 to 149, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0248] Embodiment 151. The oligomeric duplex of embodiment 150, wherein at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

[0249] Embodiment 152. The oligomeric duplex of any of embodiments 136 to 151, wherein the second modified oligonucleotide comprises a conjugate group.

[0250] Embodiment 153. The oligomeric duplex of embodiment 152, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0251] Embodiment 154. The oligomeric duplex of embodiment 153, wherein the conjugate linker consists of a single bond.

[0252] Embodiment 155. The oligomeric duplex of embodiment 153 or embodiment 154, wherein the conjugate linker is cleavable.

[0253] Embodiment 156. The oligomeric duplex of embodiment 153 or embodiment 155, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to a conjugate moiety, a modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

[0254] Embodiment 157. The oligomeric duplex of any of embodiments 153 to 156, wherein the conjugate linker is a phosphodiester linker.

[0255] Embodiment 158. The oligomeric duplex of any of embodiments 152 to 157, wherein the conjugate group is attached to the 5' end of the second modified oligonucleotide.

[0256] Embodiment 159. The oligomeric duplex of any of embodiments 152 to 157, wherein the conjugate group is attached to the 3' end of the second modified oligonucleotide.

[0257] Embodiment 160. The oligomeric duplex of any of embodiments 152 to 157, wherein the conjugate group is attached via the 2' position of the ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

[0258] Embodiment 161. The oligomeric duplex of any of embodiments 152-160, wherein the conjugate group comprises C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0259] Embodiment 162. The oligomeric duplex of any of embodiments 152 to 161, wherein the conjugate group comprises a cell-targeting moiety.

[0260] Embodiment 163. The oligomeric duplex of any of embodiments 136 to 162, wherein the second modified oligonucleotide comprises a terminal group.

[0261] Embodiment 164. The oligomeric duplex of embodiment 163, wherein the terminal group is an abasic sugar moiety.

[0262] Embodiment 165. An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of embodiments 1 to 135.

[0263] Embodiment 166. An antisense agent, wherein the antisense agent is an oligomeric duplex according to any one of embodiments 136 to 164.

[0264] Embodiment 167. The antisense agent is i) an RNase H agent capable of reducing the amount of SNCA nucleic acid by activating RNase H, or ii) An antisense agent according to embodiment 165 or embodiment 166, which is an RNAi agent capable of reducing the amount of SNCA nucleic acid by activating RISC / Ago2.

[0265] Embodiment 168. The antisense agent of any of embodiments 165 to 167, wherein the antisense agent comprises a conjugate group, and the conjugate group comprises a cell-targeting moiety.

[0266] Embodiment 169. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3335), or a pharmaceutically acceptable salt thereof.

[0267] Embodiment 170. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3336), or a pharmaceutically acceptable salt thereof.

[0268] Embodiment 171. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3337), or a pharmaceutically acceptable salt thereof.

[0269] Embodiment 172. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3338), or a pharmaceutically acceptable salt thereof.

[0270] Embodiment 173. The modified oligonucleotide of any of embodiments 169 to 172, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0271] Embodiment 174. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3335).

[0272] Embodiment 175. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3336).

[0273] Embodiment 176. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3337).

[0274] Embodiment 177. The following chemical structure: [ka] A modified oligonucleotide according to (SEQ ID NO: 3338).

[0275] Embodiment 178. A population of oligomeric compounds according to any one of embodiments 1 to 135, or a population of modified oligonucleotides according to any one of embodiments 169 to 177, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0276] Embodiment 179. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0277] Embodiment 180. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0278] Embodiment 181. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0279] Embodiment 182. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0280] Embodiment 183. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0281] Embodiment 184. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp configuration, the Sp configuration, and the Rp configuration in the 5' to 3' direction.

[0282] Embodiment 185. A population of oligomeric compounds according to any one of embodiments 1 to 135, modified oligonucleotides according to any one of embodiments 169 to 177, oligomeric duplexes according to any one of embodiments 136 to 164, or antisense agents according to any one of embodiments 165 to 168, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

[0283] Embodiment 186. A population of oligomeric compounds according to any one of embodiments 1 to 135, modified oligonucleotides according to any one of embodiments 169 to 177, oligomeric duplexes according to any one of embodiments 136 to 164, or antisense agents according to any one of embodiments 165 to 168, wherein all of the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotides are sterically random.

[0284] Embodiment 187. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 135, a modified oligonucleotide according to any one of embodiments 169 to 177, an oligomeric duplex according to any one of embodiments 136 to 164, an antisense agent according to any one of embodiments 165 to 168, or a population according to any one of embodiments 178 to 186, and a pharmaceutically acceptable diluent.

[0285] Embodiment 188. The pharmaceutical composition of embodiment 187, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0286] Embodiment 189. The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any of embodiments 1 to 135, a modified oligonucleotide of any of embodiments 169 to 177, an oligomeric duplex of any of embodiments 136 to 164, an antisense agent of any of embodiments 165 to 168, or a population of any of embodiments 178 to 186, and aCSF.

[0287] Embodiment 190. The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any of embodiments 1 to 135, a modified oligonucleotide of any of embodiments 169 to 177, an oligomeric duplex of any of embodiments 136 to 164, an antisense agent of any of embodiments 165 to 168, or a population of any of embodiments 178 to 186, and PBS.

[0288] Embodiment 191. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 135, a modified oligonucleotide according to any one of embodiments 169 to 177, an oligomeric duplex according to any one of embodiments 136 to 164, an antisense agent according to any one of embodiments 165 to 168, a population according to any one of embodiments 178 to 186, or a pharmaceutical composition according to any one of embodiments 187 to 190.

[0289] Embodiment 192. The method of embodiment 191, wherein the subject has or is at risk of developing a synucleinopathy.

[0290] Embodiment 193. The method of embodiment 191, wherein the subject has or is at risk of developing Parkinson's disease.

[0291] Embodiment 194. The method of embodiment 191, wherein the subject has or is at risk of developing multiple system atrophy (MSA).

[0292] Embodiment 195. The method of embodiment 191, wherein the subject has or is at risk of developing dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, neuropathic Gaucher disease, or Alzheimer's disease.

[0293] Embodiment 196. A method of treating a synucleinopathy, comprising administering to a subject having or at risk of developing a synucleinopathy a therapeutically effective amount of an oligomeric compound according to any of embodiments 1 to 135, a modified oligonucleotide according to any of embodiments 169 to 177, an oligomeric duplex according to any of embodiments 136 to 164, an antisense agent according to any of embodiments 165 to 168, a population according to any of embodiments 178 to 186, or a pharmaceutical composition according to any of embodiments 187 to 190.

[0294] Embodiment 197. The method of embodiment 196, wherein the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronpathic Gaucher disease, or Alzheimer's disease.

[0295] Embodiment 198. The method of embodiment 196, wherein the synucleinopathy is Parkinson's disease.

[0296] Embodiment 199. The method of embodiment 196, wherein the synucleinopathy is multiple system atrophy (MSA).

[0297] Embodiment 200. The method of any of embodiments 196-199, wherein at least one symptom or feature of a synucleinopathy is ameliorated.

[0298] Embodiment 201. The method of embodiment 200, wherein the symptom or characteristic is motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorder, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

[0299] Embodiment 202. The method of any of embodiments 196 to 201, wherein administering the oligomeric compound of any of embodiments 1 to 135, the modified oligonucleotide of any of embodiments 169 to 177, the oligomeric duplex of any of embodiments 136 to 164, the antisense agent of any of embodiments 165 to 168, the population of any of embodiments 178 to 186, or the pharmaceutical composition of any of embodiments 187 to 190 reduces or delays the onset or progression of motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

[0300] Embodiment 203. The method of any of embodiments 191 to 202, wherein the oligomeric compound of any of embodiments 1 to 135, the modified oligonucleotide of any of embodiments 169 to 177, the oligomeric duplex of any of embodiments 136 to 164, the antisense agent of any of embodiments 165 to 168, the population of any of embodiments 178 to 186, or the pharmaceutical composition of any of embodiments 187 to 190 is administered to the central nervous system or systemically.

[0301] Embodiment 204. The method of any of embodiments 191 to 203, wherein the oligomeric compound of any of embodiments 1 to 135, the modified oligonucleotide of any of embodiments 169 to 177, the oligomeric duplex of any of embodiments 136 to 164, the antisense agent of any of embodiments 165 to 168, the population of any of embodiments 178 to 186, or the pharmaceutical composition of any of embodiments 187 to 190 is administered intrathecally.

[0302] Embodiment 205. The method of any one of embodiments 191 to 204, wherein the subject is a human.

[0303] Embodiment 206. A method for reducing expression of SNCA in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 135, a modified oligonucleotide according to any one of embodiments 169 to 177, an oligomeric duplex according to any one of embodiments 136 to 164, an antisense agent according to any one of embodiments 165 to 168, a population according to any one of embodiments 178 to 186, or a pharmaceutical composition according to any one of embodiments 187 to 190.

[0304] Embodiment 207. The method of embodiment 206, wherein the cells are brain cells.

[0305] Embodiment 208. The method of embodiment 206 or embodiment 207, wherein the cell is a neuron or an oligodendrocyte.

[0306] Embodiment 209. The method of any one of embodiments 206 to 208, wherein the cells are human cells.

[0307] Embodiment 210. Use of an oligomeric compound according to any one of embodiments 1 to 135, a modified oligonucleotide according to any one of embodiments 169 to 177, an oligomeric duplex according to any one of embodiments 136 to 164, an antisense agent according to any one of embodiments 165 to 168, a population according to any one of embodiments 178 to 186, or a pharmaceutical composition according to any one of embodiments 187 to 190 for treating a synucleinopathy.

[0308] Embodiment 211. Use of an oligomeric compound according to any one of embodiments 1 to 135, a modified oligonucleotide according to any one of embodiments 169 to 177, an oligomeric duplex according to any one of embodiments 136 to 164, an antisense agent according to any one of embodiments 165 to 168, a population according to any one of embodiments 178 to 186, or a pharmaceutical composition according to any one of embodiments 187 to 190 for the manufacture of a medicament for treating a synucleinopathy.

[0309] Embodiment 212. The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease.

[0310] Embodiment 213. The use according to embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson's disease.

[0311] Embodiment 214. The use according to embodiment 210 or embodiment 211, wherein the synucleinopathy is multiple system atrophy (MSA).

[0312] I. Certain Oligonucleotides In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides consisting of linked nucleosides.The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides.Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA.That is, modified oligonucleotides contain at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.Some specific modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0313] A. Certain modified nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into an oligonucleotide:

[0314] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions in other types of modified sugar moieties.

[0315] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety containing one or more acyclic substituents, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0316] In certain embodiments, a non-bicyclic modified sugar moiety comprises a 2'-substituent. Examples of suitable substituents at the 2'-position of a modified sugar moiety include, but are not limited to, -F, -OCH ("OMe" or "O-methyl"), and -OCHCHOCH ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF, OCF, O-C-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m)-alkynyl, O-alkenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), or 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087.

[0317] Methods for synthesizing some of these 2'-substituents can be found, for example, in Cook et al., US 6,531,584 and Cook et al., US 5,859,221. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0318] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R mand R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is alkyl.

[0319] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a sugar moiety comprising a 2'-substituent selected from F, OCF3, OCH3, OCH2CHOCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0320] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a 2'-substituent selected from F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0321] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0322] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2020 / 072991. 2'-modified sugar moieties have an additional stereocenter at the 2' position compared to 2'-deoxyfuranosyl sugar moieties, and therefore, such sugar moieties have a total of 16 possible isomeric configurations. The modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0323] In certain embodiments, the non-bicyclic modified sugar moiety is a stereoisomer of DNA, e.g., a 2'-β-D-deoxyxylosyl sugar moiety: [ka] is.

[0324] In certain embodiments, non-bicyclic modified nucleosides comprise a 2'-α-L-deoxyribosyl sugar moiety: [ka] Includes:

[0325] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.

[0326] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0327] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 5' position. Examples of suitable substituents at the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), and alkyl (e.g., methyl (R or S), ethyl).

[0328] In certain embodiments, the non-bicyclic modified sugar moiety comprises two or more non-bridging sugar substituents, for example, a 2'-F-5'-methyl sugar moiety such as those described in Migawa et al., US2010 / 0190837, or an alternative 2'- and 5'-modified sugar moiety as described in Rajeev et al., US2013 / 0203836.

[0329] In naturally occurring nucleic acids, sugars are linked to each other from 3' to 5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, for example, at the 2' position, or inverted 5' to 3' positions. For example, if the linkage is at the 2' position, the 2'-substituent may be at the 3' position instead.

[0330] Certain modified sugar moieties include substituents that bridge two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH 2-N(R)-2', 4'-CH(CHOCH)-O-2' ("constrained MOE" or "cMOE") and analogs, 4'-C(CH)(CH)-O-2' and analogs, 4'-CH-N(OCH)-2' and analogs, 4'-CH-ON(CH)-2', 4'-CH-C(H)(CH)-2', 4'-CH-C(=CH)-2' and analogs), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C1-C 12Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to, Imanishi et al., U.S. Pat. No. 7,427,672; Swayze et al., U.S. Pat. No. 7,741,457; and Swayze et al., U.S. Pat. No. 8,022,193; Seth et al., U.S. Pat. No. 8,278,283; Prakash et al., U.S. Pat. No. 8,278,425; Seth et al., U.S. Pat. No. 8,278,426.

[0331] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, and x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), wherein each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0332] Additional bicyclic sugar moieties are known in the art, see, e.g., Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., US8,080,644; Ramasamy et al., US6,525,191; Seth et al., US7,547,684; and Seth et al., US7,666,854.

[0333] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] Alpha-L-methyleneoxy (4'-CH2-O-2') or alpha-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).The addition of locked nucleic acid to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol.Canc.Ther.6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).In this specification, the term bicyclic nucleosides refers to both isomer configurations. Where positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0334] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0335] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, the modified sugar moiety also includes a bridging and / or non-bridging substituent as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' and / or 5' positions.

[0336] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA"), fluoroHNA: [ka] ("F-HNA", see, e.g., Egli, et. al., J Am Chem (2011) 133(41):16642-16649, Swayze et al., US 8,088,904, and Swayze et al., US 8,440,803) (F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides containing additional modified THP compounds having the formula: [ka] wherein, independently for each of the modified THP nucleosides: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group; and q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C 1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, wherein each of R1 and R2 is independently selected from among hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, wherein X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0337] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0338] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported. As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka] In certain embodiments, morpholinos can be modified, for example, by adding or changing various substituents from the morpholino structures described above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0339] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids, and the nucleosides and oligonucleotides described in Manoharan et al., US 10,913,767. Representative US patents that teach the preparation of PNA compounds include, but are not limited to, US Patent Nos. 5,539,082, 5,714,331, and 5,719,262.

[0340] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is a nucleoside in which one of the linkages of the sugar moiety is removed to form the unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0341] In certain embodiments, the sugar surrogate is glycerol, as found in GNA (glycol nucleic acid) nucleosides, shown below: [ka] Bx represents any nucleic acid base.

[0342] Many other bicyclic and tricyclic sugars and sugar surrogates that can be used in modified nucleosides are known in the art.

[0343] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides contain one or more nucleosides containing unmodified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides containing modified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase, called abasic nucleosides. In certain embodiments, modified oligonucleotides contain one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleobases). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0344] In certain embodiments, the modified adenine has the structure (I): [ka] R 2A is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, or substituted C1-C6 thioalkyl, C1-C6 alkyloxy, or substituted C1-C6 alkyloxy; R 6A is H, N(R a )(R b ), acetyl, formyl, or O-phenyl, and Y 7A is N and R 7A is absent or C1-C6 alkyl, or Y 7A is C and R 7A is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8A is N and R 8A does not exist or Y 8A is C and R 8Ais selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle (Y 7A is N and Y 8A is C and R 8A is H and R 2A is H and R 6A (unmodified adenine) except when

[0345] In certain embodiments, the modified guanine has the structure (II): [ka] R 2G is N(R a )(R b ) and R 6G is oxo and R 1G is H or R 6G is selected from O-C1-C6 alkyl or S-C1-C6 alkyl, R 1G does not exist, and Y 7G is N and R 7A is absent or C1-C6 alkyl, or Y 7G is C and R 7G is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8G is N and R 8G does not exist or Y 8G is C and R 8G is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle (Y 7Gis N and Y 8G is C and R 8G is H and R 2G is NH2 and R 6G except when =O) (unmodified guanosine).

[0346] In certain embodiments, the modified thymine or uracil has the structure (III): [ka] X is selected from O or S, and R 5U H, OH, halogen, O-C1-C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and when each X is O, R 5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0347] In certain embodiments, the modified cytosine has the structure (IV): [ka] X is selected from O or S, and R 4C is N(R a )(R b ) and R 5C H, OH, halogen, O-C1-C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and R a and R bare independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5-7 membered heterocycle (X is O and R 4C is NH2 and R 5C (unmodified cytosine) unless H.

[0348] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza, and Other 8-substituted purines, 5-halo (especially 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0349] Publications that teach the preparation of certain of the above-described modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Rogers et al., US 5,134,066; Benner et al., US 5,432,272; Matteucci et al., US 5,502,177; Froehler et al., US 5,594,121; and Cook et al., US 5,681,941.

[0350] In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from the group consisting of A, G, C, T, U, and m C is selected.

[0351] In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from the group consisting of A, G, T, and m C (i.e., unmodified purines and 5-methylpyrimidines).

[0352] 3. Certain modified internucleoside linkages The naturally occurring internucleoside bond in RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, the nucleosides of modified oligonucleotides may be linked to each other using one or more modified internucleoside linkages. Two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, including phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkages include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0353] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage comprises the formula: [ka] For each such internucleoside linkage group of the modified oligonucleotide, independently: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0354] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linkage having the formula: [ka] The mesyl phosphoramidate internucleoside linkage contains a chiral center. In certain embodiments, modified oligonucleotides contain (Rp) and / or (Sp) mesyl phosphoramidates, each represented by the following formula, where "B" represents a nucleobase: [ka]

[0355] In certain embodiments, phosphorothioate internucleoside linkages may contain chiral centers. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka]

[0356] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates.Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a group of modified oligonucleotides containing sterically random internucleoside linkages, or as a group of modified oligonucleotides containing such internucleoside linkages in a specific stereochemical configuration.In certain embodiments, a group of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are sterically random.In certain embodiments, a group of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, and all of the mesyl phosphoramidate internucleoside linkages are sterically random.Such modified oligonucleotides can be produced using a synthetic method that randomly selects the stereochemical configuration of each internucleoside linkage with a chiral center.Nevertheless, each individual internucleoside linkage with a chiral center of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate and / or mesyl phosphoramidate internucleoside linkages, each of which is independently in a specific, independently selected stereochemical configuration.In certain embodiments, the specific configuration of the phosphorothioate and / or mesyl phosphoramidate linkages is present in at least 65% of the molecules in the population.In certain embodiments, the specific configuration of the phosphorothioate and / or mesyl phosphoramidate linkages is present in at least 70% of the molecules in the population.In certain embodiments, the specific configuration of the phosphorothioate and / or mesyl phosphoramidate linkages is present in at least 80% of the molecules in the population.In certain embodiments, the specific configuration of the phosphorothioate and / or mesyl phosphoramidate linkages is present in at least 90% of the molecules in the population.In certain embodiments, a specific arrangement of a specific phosphorothioate and / or mesyl phosphoramidate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nucleic Acids Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates and / or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates and / or mesyl phosphoramidates in the (Rp) configuration. Unless otherwise indicated, the internucleoside linkages containing chiral centers of the modified oligonucleotides described herein can be stereo-random or in a specific stereochemical configuration.

[0357] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., "Carbohydrate Modifications in Antisense Research"; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH constituent moieties.

[0358] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, as shown below: [ka] Each Bx independently represents any nucleobase.

[0359] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0360] In certain embodiments, the nucleic acids can be linked via a 2' to 5' linkage rather than the standard 3' to 5' linkage. Such linkages are described below. [ka] Each Bx represents any nucleic acid base.

[0361] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moiety, nucleobase, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases independent of the sequence of the nucleobases).

[0362] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.

[0363] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.

[0364] In certain embodiments, the deoxy region is adjacent on the 5' side to a 5' region consisting of linked 5' region nucleosides and on the 3' side to a 3' region consisting of linked 3' region nucleosides, wherein the 3'-most nucleoside of the 5' region is a modified nucleoside and the 5'-most nucleoside of the 3' region is a modified nucleoside. At least one nucleoside of the 5' region contains a modified sugar moiety, and at least one nucleoside of the 3' region contains a modified sugar moiety. The three regions (5' region, deoxy region, and 3' region) form a contiguous nucleoside sequence. In certain embodiments, the sugar moiety of the 3'-most nucleoside of the 5' region and the sugar moiety of the 5'-most nucleoside of the 3' region are each different from the sugar moieties of the respective adjacent nucleosides of the deoxy region, thereby defining the boundaries between the 5' region, the deoxy region, and the 3' region. In certain embodiments, each nucleoside in the 5' region and each nucleoside in the 3' region comprises a modified sugar moiety. In certain embodiments, the nucleosides in the 5' region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5' region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3' region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3' region comprise two or more different sugar modifications.

[0365] In certain embodiments, the 5' and 3' regions of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5' region comprises 1 to 7 nucleosides. In certain embodiments, the 5' region comprises 1 to 6 nucleosides. In certain embodiments, the 5' region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3' region comprises 1 to 7 nucleosides. In certain embodiments, the 3' region comprises 1 to 6 nucleosides. In certain embodiments, the 3' region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0366] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a continuous sequence of nucleosides, with at least some of the sugar moieties of each nucleoside in the wing being different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that are different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0367] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0368] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0369] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-β-D-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0370] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, where each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0371] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides contain a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of five linked nucleosides with modified sugar moieties in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked nucleosides with modified sugar moieties in the 3'-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing, two different modified sugar moieties in the gap region, or a combination thereof.

[0372] In certain embodiments, the modified oligonucleotides disclosed herein are modified with specific sugar modifications. In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-4 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-4 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer.

[0373] In certain embodiments, the modified oligonucleotides disclosed herein are modified with two or more sugar modifications. In certain embodiments, the modified oligonucleotide is a 3-10-3 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 3-10-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 3-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 4-9-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 6-10-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0374] In certain embodiments, the modified oligonucleotides disclosed herein are modified with two or more sugar modifications in the gap region. In certain embodiments, the modified oligonucleotide is a 3-10-3 mixed gapmer, in which each nucleoside in the 5' and 3' wings comprises a 2'-cEt sugar moiety, and each nucleoside in the gap comprises a sugar moiety selected from a 2'-OMe sugar moiety or a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, in which each nucleoside in the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside in the gap comprises a sugar moiety selected from a 2'-β-D-deoxyxylosyl sugar moiety, a 2'-α-L-deoxyribosyl sugar moiety, and a 2'-β-D-deoxyribosyl sugar moiety.

[0375] In certain embodiments, the modified oligonucleotide is 5'-kkkddddddddddkkk-3', 5'-kkkddddddddddddkkk-3', 5'-kkkddddddddddddkkk-3', 5'-kkkkddddddddddddkkk-3', 5'-kkkkddddddddddddkkk-3', 5'-kkkkddddddddddddkkkk-3', 5'-kkkdyddddddddkkk-3', 5'-kkkddddddddddddkeee-3', 5'-kkkddddddddddkkee-3', 5'-kkkddddddddddkeeee-3', 5'-ekkddddddddddkeeee-3', 5'-kkkddddddddddkkeee-3', 5'-eeeeeddddddddddeeeee-3', 5'-eeeeeeddddddddddeeee- 3', 5'-eeeeeeedddddddddddkkee-3', 5'-eeeeed[bDdx]dddddddeeeee-3', 5'-eeeeedd[bDdx]ddddddde eeee-3', 5'-eeeeed[aLdr]ddddddddeeeee-3', 5'-eeeeedd[aLdr]dddddddeeeee-3', and 5'-eekkdddd dddddkkee-3', where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, each "[bDdx]" represents a 2'-β-D-deoxyxylosyl sugar moiety, and each "[aLdr]" represents a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif of 5'-eeeeeddddddddddeeeee-3', where each "e" represents a 2'-MOE sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5'-eeeeeeddddddddddeeee-3', where each "e" represents a 2'-MOE sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0376] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0377] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0378] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleobase. In certain such embodiments, one nucleoside containing a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0379] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or its region within a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a sterically random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0380] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are sterically random. In certain embodiments, all of the phosphorothioate linkages within the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0381] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif that comprises one or more mesyl phosphoramidate nucleoside linkage groups.In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motif herein are replaced with mesyl phosphoramidate linkage groups.

[0382] In certain embodiments, the modified oligonucleotide is 5’-soossssssssssos-3’, 5’-soossssssssssoos-3’, 5’-sooossssssssssos-3’, 5’-sooossssssssssoos-3’, 5’-soooossssssssssooos-3’, 5’-soossssssssssooos-3’, 5’-soossssssssssssss-3’, 5’-sssssssssssssssssss-3’, 5’-sooooossssssssssoss-3’, 5’-ssssszzzzssssssssss-3’, 5’-soooszzzzssssssooss-3’, 5’-sooosssssssssssooss-3’, 5’-sosssssssssssssooss-3’, 5’-sooosszzsssssoss-3’, 5’-sossssssssssssssoss-3’, 5’-soosszzzzssssssooss-3’, 5’-sossszzzzssssssooss-3’, 5’-sossszzzzsssssssoss-3’, 5’-sssssszsszzszssssss-3’, 5’-ssssssssszzsssssoss-3’, 5’-ssooszsssssszsssoss-3’, 5’-ssosszsssssszzssoss-3’, 5’-sssoszzzsssssssssss-3’, 5’-ssoosszzsssssssosss-3’, 5’-ssssszzsssszzssssss-3’, 5’-sssssszssssszsssoss-3’, 5’-soossssssssssssooss-3’, 5’-sossszzsssszzssosss- (and so on, with the sequence continuing in the same pattern). It should be noted that the "soos" and other such sequences seem rather unusual and might be specific to a non-standard or made-up context in the original text. If there are any inaccuracies in the translation due to unclear or incorrect original content, please let me know. Also, the original text seems to have a large number of similar sequences which might be more clearly presented or explained in the source material for a more accurate and meaningful translation.5'-sossszzsssszsssosss-3', 5'-sossszssssszzsssoss-3', 5'-sosssszsssszzsssoss-3', 5'- sossszzssssszsssoss-3', 5'-sossszzsssszssssoss-3', 5'-szssszzsssszzsszzss-3', 5'-zzs sszzsssszzsssszz-3', 5'-zsssszzsssszzsssssz-3', 5'-ssooszsssssszzssoss-3', 5'-sssosz sssssszzssoss-3', 5'-ssooszsssssszzsssss-3', 5'-ssssszsssssszzssoss-3', 5'-sssszzsss ssszzsssss-3', 5'-sooszzssssszssooss-3', 5'-sooszzssssszzsooss-3', 5'-ssooszzsssss zssooss-3', 5'-ssooszzssssszzsooss-3', 5'-sssoszzssssszssooss-3', 5'-sssoszzssssszzs In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of 5'-sssssssssssss-3', 5'-sssoszzssssssss-3', or 5'-sssoszzssssssssss-3', where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of 5'-sssssssssssssss-3', where each "s" represents a phosphorothioate internucleoside linkage and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5'-ssooszsssssszsssoss-3', where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5'-sssszzzzssssssssss-3',Each "s" represents a phosphorothioate internucleoside linkage and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, the modified oligonucleotide has a 5'-sooooosssssssssssoss-3' internucleoside linkage motif, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0383] C. A certain length It is possible to increase or decrease the length of an oligonucleotide without losing activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of target RNA in an oocyte injection model. 25 nucleobase-long oligonucleotides with eight or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of target RNA, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0384] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, an oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27 , 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0385] In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.

[0386] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each of these parameters is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, any modifications are independent of the nucleobase sequence.

[0387] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides in which all of the modified oligonucleotides in the population have the same molecular formula can be a stereo-random population or a chiral enriched population.All chiral centers of all modified oligonucleotides are stereo-random in a stereo-random population.In a chiral enriched population, at least one specific chiral center is not stereo-random in the modified oligonucleotides of the population.In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched in β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereo-random.In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0388] F. Nucleic Acid Sequence In certain embodiments, the oligonucleotide (or a portion thereof) has a nucleobase sequence that is complementary to a specified reference nucleic acid (or a portion thereof), such as a second oligonucleotide or target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a specified reference nucleic acid (or a portion thereof), such as a second oligonucleotide or target nucleic acid.

[0389] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group may be attached to either or both ends of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, the conjugate group is attached to either or both ends of the oligonucleotide (such conjugate groups are also terminal groups). In certain such embodiments, the conjugate group or terminal group is attached to the 3'-end and / or 5'-end of the oligonucleotide.

[0390] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0391] In certain embodiments, the conjugation of one or more carbohydrate moieties to a modified oligonucleotide can change one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a ribose-replacement modified subunit (RRMS), which is a modified sugar moiety. The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0392] In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide, for example, a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucleic Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucleic Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate palmityl moiety (Mishra et al., Biochim. Biophys.Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0393] In certain embodiments, the conjugate group consists of a lipid and a conjugate linker. In certain embodiments, the conjugate group is a phosphate-linked lipid having the following structure: [ka]

[0394] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0395] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.

[0396] In certain embodiments, the conjugate moiety is selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0397] In certain embodiments, the conjugate group is selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0398] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker.In some oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond).In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0399] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0400] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl groups and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl groups and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0401] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are known in the art to be useful for bifunctional conjugate groups, for example, for linking conjugate moieties to compounds such as the oligonucleotides provided herein. Generally, bifunctional linking moieties contain at least two functional groups. One of these functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties contain one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0402] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C-C 10 A non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0403] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker nucleoside is preferably cleaved from the oligomeric compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the rest of the oligomeric compound via a cleavable bond. In certain embodiments, this cleavable bond is a phosphodiester bond.

[0404] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group containing 1 to 10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and may not comprise a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise specified, a conjugate linker contains 10 or less linker nucleosides. In certain embodiments, a conjugate linker contains 5 or less linker nucleosides. In certain embodiments, a conjugate linker contains 3 or less linker nucleosides. In certain embodiments, a conjugate linker contains 2 or less linker nucleosides. In certain embodiments, a conjugate linker contains 1 or less linker nucleoside.

[0405] In certain embodiments, it is preferred that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but it is desirable that the conjugate group be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide once the oligomeric compound is taken up.Therefore, certain conjugate linkers may contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group with one, two, three, four, or five or more cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved within a cell or intracellular compartment such as a lysosome.In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0406] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0407] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0408] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO2011 / 131693, WO2014 / 064257.

[0409] In certain embodiments, the conjugate group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including, but not limited to, those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US7,208,174, US9,034,329, and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0410] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US10,138,483.

[0411] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0412] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises an inverted abasic sugar moiety. In certain embodiments, the inverted abasic sugar moiety may be further attached to a conjugate group. In certain embodiments, the terminal group comprises one or more 2'-linked nucleoside or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety. Such terminal abasic sugar moieties can be attached to either or both ends of the oligonucleotide.

[0413] III. Antisense Activity In certain embodiments, oligomeric compounds can hybridize to target nucleic acids to produce at least one antisense activity. In certain embodiments, oligomeric compounds form oligomeric duplexes with a second oligomeric compound containing a complementary nucleobase sequence. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds are considered to have antisense activity if they reduce or inhibit the amount or activity of the target nucleic acid by 50% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that produces significantly undesired antisense activity.

[0414] In certain antisense activities, the hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are permitted in the gap of a gapmer.

[0415] In certain antisense activity, antisense compound or a part of antisense compound is loaded into RNA-induced silencing complex (RISC), and finally causes target nucleic acid to be cut.For example, certain antisense compound causes target nucleic acid to be cut by Argonaute.The antisense compound that is incorporated into RISC is RNAi agent.RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0416] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0417] Antisense activity can be observed directly or indirectly.In certain embodiments, observing or detecting antisense activity involves observing or detecting changes in the amount of target nucleic acid or the protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in the phenotype of cells or subjects.

[0418] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, which comprise introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is located entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0419] A. Complementarity / Mismatch with Target Nucleic Acid and Double-Stranded Complementarity In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0420] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also exhibited potent antitumor activity in vivo. Maher and Dolnick (Nucleic Acids Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotide, for their ability to terminate the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest degree than the 28 or 42 nucleobase oligonucleotides.

[0421] In certain embodiments, oligonucleotide comprises one or more mismatched nucleobases compared with target nucleic acid.In certain embodiments, the antisense activity of target is reduced by this mismatch, but the activity of non-target is reduced more significantly.Therefore, in certain embodiments, the selectivity of oligonucleotide is improved.

[0422] In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the wing region.

[0423] B.SNCA In certain embodiments, the oligomeric compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is SNCA. In each of the above-described embodiments, the oligomeric compound may target the SNCA nucleic acid. In certain embodiments, the SNCA nucleic acid is selected from the group consisting of SEQ ID NO: 1 (Ensembl Accession No. ENSG00000145335.17, Ensembl Release 106 - April 2022), SEQ ID NO: 2 (complement of GENBANK Accession No. NT_016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), SEQ ID NO: 3 (GENBANK Accession No. NM_001146055.1), SEQ ID NO: 4 (Ensembl ID ENST00000618500.4, Ensembl Release 106 - April 2022), SEQ ID NO:5 (GENBANK Accession No.: NM_000345.3), SEQ ID NO:6 (GENBANK Accession No.: JN709863.1), SEQ ID NO:7 (GENBANK Accession No.: BC013293.2), SEQ ID NO:8 (GENBANK Accession No.: NM_001146054.2), or SEQ ID NO:9 (GENBANK Accession No.: HQ830269.1). In certain embodiments, contacting a cell with an oligomeric compound described herein complementary to any of SEQ ID NOs: 1-9 reduces the amount of SNCA RNA, and in certain embodiments, reduces the amount of alpha-synuclein protein. In certain embodiments, contacting a cell with an oligomeric compound described herein complementary to any of SEQ ID NOs: 1-9 results in a reduction in alpha-synuclein protein aggregation. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0424] In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to any of SEQ ID NOS: 1-9 reduces the amount of SNCA RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to any of SEQ ID NOS: 1-9 reduces the amount of alpha-synuclein protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound described herein that is complementary to any of SEQ ID NOS: 1-9 ameliorates one or more symptoms or characteristics of a synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease. In certain embodiments, the one or more symptoms or characteristics comprise Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, and Alzheimer's disease.

[0425] In certain embodiments, oligomeric compounds described herein complementary to any of SEQ ID NOS: 1-9, when administered according to a standard in vitro assay, are capable of reducing the amount of SNCA RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds described herein complementary to any of SEQ ID NOS: 1-9, when administered according to a standard in vivo assay, are capable of reducing the amount of SNCA RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds described herein complementary to any of SEQ ID NOS: 1-9 are capable of reducing the amount of alpha-synuclein protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, oligomeric compounds described herein complementary to any of SEQ ID NOS: 1-9 are capable of reducing the amount of alpha-synuclein protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds described herein complementary to any of SEQ ID NOs: 1-9 can reduce the amount of SNCA RNA in a subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, the oligomeric compounds described herein complementary to any of SEQ ID NOs: 1-9 can reduce the amount of alpha-synuclein protein or the amount of alpha-synuclein protein aggregates in a subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0426] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, and the target nucleic acid is expressed in pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS). Such tissues include the brain and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes the motor cortex, frontal cortex, caudate nucleus, putamen, amygdala, pons, substantia nigra, amygdala, cerebellar peduncle, corpus callosum, deep cerebellar nuclei (DCN), entorhinal cortex (Entocortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculus, and basal forebrain. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell includes a neuron and an oligodendrocyte.

[0427] V. Certain Methods and Uses Certain embodiments provided herein relate to methods of reducing or inhibiting SNCA expression or activity, which may be useful for treating, preventing, or ameliorating a synucleinopathy in a subject. In certain embodiments, the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease.

[0428] In certain embodiments, the method comprises administering to the subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to an SNCA nucleic acid. In certain embodiments, the subject has or is at risk of developing a synucleinopathy. In certain embodiments, the subject has or is at risk of developing Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronpathic Gaucher disease, or Alzheimer's disease. In certain embodiments, the subject has Parkinson's disease. In certain embodiments, the subject has dementia with Lewy bodies (DLB). In certain embodiments, the subject has diffuse Lewy body disease. In certain embodiments, the subject has Parkinson's disease dementia (PDD). In certain embodiments, the subject has pure autonomic failure. In certain embodiments, the subject has multiple system atrophy (MSA). In certain embodiments, the subject has neuropathic Gaucher disease. In certain embodiments, the subject has Alzheimer's disease.

[0429] In certain embodiments, a method for treating a synucleinopathy comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to an SNCA nucleic acid. In certain embodiments, the subject has or is at risk of developing a synucleinopathy. In certain embodiments, the subject has or is at risk of developing Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronpathic Gaucher disease, or Alzheimer's disease. In certain embodiments, the subject has Parkinson's disease. In certain embodiments, the subject has multiple system atrophy (MSA). In certain embodiments, the subject has Alzheimer's disease. In certain embodiments, at least one symptom or characteristic of a synucleinopathy is ameliorated. In certain embodiments, the at least one symptom or feature is motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

[0430] In certain embodiments, a method for reducing SNCA, e.g., RNA, or alpha-synuclein protein expression in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to an SNCA nucleic acid. In certain embodiments, the subject has or is at risk of developing a synucleinopathy. In certain embodiments, the subject has or is at risk of developing Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronpathic Gaucher disease, or Alzheimer's disease. In certain embodiments, the subject has Parkinson's disease. In certain embodiments, the subject has multiple system atrophy (MSA). In certain embodiments, the subject has Alzheimer's disease. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron. In certain embodiments, the cells are oligodendrocytes, hi certain embodiments, the cells are human cells.

[0431] Certain embodiments are directed to an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent, any of which has a nucleobase sequence complementary to an SNCA nucleic acid, for use in treating a synucleinopathy or for use in the manufacture of a medicament for treating a synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease.

[0432] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent may be any described herein.

[0433] VI. Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0434] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0435] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, disodium phosphate anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or about 7.2, using a suitable pH adjuster, for example, an acid such as hydrochloric acid or an alkali such as sodium hydroxide.

[0436] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0437] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0438] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure also covers pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0439] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0440] Lipid moieties are used in various ways in nucleic acid therapy.In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made with a mixture of cationic lipids and neutral lipids.In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to lipid tissues.In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissues.

[0441] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including pharmaceutical compositions containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0442] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0443] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an absolute ethanol solution containing 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v of polyethylene glycol 300. The proportions of such cosolvent systems can be varied significantly without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants can be substituted for Polysorbate 80™, the fraction size of polyethylene glycol can be changed, other biocompatible polymers can replace polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.

[0444] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0445] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in a protonated (free acid) form or an ionized, cation-associated (salt) form, and aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphodiester bonds of an oligonucleotide in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of multiple forms, all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include corresponding forms as well. As used herein, a structure depicting the free acid of a compound followed by the term "or a pharmaceutically acceptable salt thereof" expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with a cation or combination of cations. In certain embodiments, one or more specific cations are specified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term "or a pharmaceutically acceptable salt thereof" expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0446] In certain embodiments, modified oligonucleotide or oligomer compound is present in sodium aqueous solution.In certain embodiments, modified oligonucleotide or oligomer compound is present in potassium aqueous solution.In certain embodiments, modified oligonucleotide or oligomer compound is present in PBS.In certain embodiments, modified oligonucleotide or oligomer compound is present in water.In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0447] In this specification, certain dosages are described.Dosages can be in the form of dosage units.For clarity, the dosage (or dosage unit) of modified oligonucleotide or oligomer compound in milligrams refers to the mass of modified oligonucleotide or oligomer compound in free acid form.As mentioned above, in aqueous solution, free acid is in equilibrium with anion form and salt form.However, for the purpose of calculating dosage, modified oligonucleotide or oligomer compound is assumed to exist as solvent-free, sodium acetate-free, anhydrous, free acid.

[0448] In certain embodiments, when modified oligonucleotides or oligomeric compounds are in a solution containing sodium (e.g., saline), the modified oligonucleotides or oligomeric compounds may be partially or completely deprotonated and associated with sodium ions. However, the mass of protons is still counted in the dose weight, and the mass of sodium ions is not counted in the dose weight. Thus, for example, a dose or dosage unit of 10 mg of Compound No. 1482139 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing Compound No. 1482139.

[0449] In certain embodiments, when a modified oligonucleotide or oligomeric compound is in a solution containing sodium, potassium, calcium, and magnesium, such as aCSF, the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons still counts toward the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions does not count toward the dose weight.

[0450] In certain embodiments, when an oligomeric compound includes a conjugate group, the mass of the conjugate group can be included in calculating the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for dosage calculation purposes.

[0451] VII. Certain Oligomeric Compounds In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-3334. In certain such embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.

[0452] In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of 5'-ACAGATATTTTTGTTCTGCC-3' (SEQ ID NO: 3318). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylosyl sugar moiety, and a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, modified internucleoside bond is selected from phosphorothioate internucleoside bond and mesyl phosphoramidate internucleoside bond.In certain embodiments, each nucleobase of modified oligonucleotide is unmodified nucleobase.In certain embodiments, at least one nucleobase of modified oligonucleotide is modified nucleobase.In certain embodiments, oligomeric compound comprises conjugate group.In certain embodiments, oligomeric compound does not contain conjugate group.In certain embodiments, oligomeric compound comprises terminal group.In certain embodiments, oligomeric compound does not contain terminal group.

[0453] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from phosphorothioate internucleoside linkages and mesyl phosphoramidate internucleoside linkages. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.

[0454] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') ssssszzzzssssssssss, where each "s" is a phosphorothioate internucleoside linkage and each "z" is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine in the modified oligonucleotide is a 5-methylcytosine.

[0455] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') ssssssssssssss, where each "s" is a phosphorothioate internucleoside linkage and each "z" is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine in the modified oligonucleotide is a 5-methylcytosine.

[0456] In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of 5'-ACGACATTTTCTTGCCTCTT-3' (SEQ ID NO: 3319). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylosyl sugar moiety, and a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, modified internucleoside bond is selected from phosphorothioate internucleoside bond and mesyl phosphoramidate internucleoside bond.In certain embodiments, each nucleobase of modified oligonucleotide is unmodified nucleobase.In certain embodiments, at least one nucleobase of modified oligonucleotide is modified nucleobase.In certain embodiments, oligomeric compound comprises conjugate group.In certain embodiments, oligomeric compound does not contain conjugate group.In certain embodiments, oligomeric compound comprises terminal group.In certain embodiments, oligomeric compound does not contain terminal group.

[0457] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3319. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from phosphorothioate internucleoside linkages and mesyl phosphoramidate internucleoside linkages. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.

[0458] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3319. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') ssooszsssssszsssoss, where each "s" is a phosphorothioate internucleoside linkage, each "o" is a phosphodiester internucleoside linkage, and each "z" is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine in the modified oligonucleotide is a 5-methylcytosine.

[0459] In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of 5'-ATCACGACATTTTCTTGCCT-3' (SEQ ID NO: 3328). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylosyl sugar moiety, and a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, modified internucleoside bond is selected from phosphorothioate internucleoside bond and mesyl phosphoramidate internucleoside bond.In certain embodiments, each nucleobase of modified oligonucleotide is unmodified nucleobase.In certain embodiments, at least one nucleobase of modified oligonucleotide is modified nucleobase.In certain embodiments, oligomeric compound comprises conjugate group.In certain embodiments, oligomeric compound does not contain conjugate group.In certain embodiments, oligomeric compound comprises terminal group.In certain embodiments, oligomeric compound does not contain terminal group.

[0460] In certain embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeeddddddddddeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from phosphorothioate internucleoside linkages and mesyl phosphoramidate internucleoside linkages. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.

[0461] In certain embodiments, a modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, a modified oligonucleotide has a modified sugar motif of (5' to 3') eeeeeeddddddddddeeee, where each "e" is a 2'-MOE sugar moiety and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, a modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') soooooossssssssssoss, where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of a modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of a modified oligonucleotide is a 5-methylcytosine.

[0462] In certain embodiments, the following chemical notation: 1es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es N 2 e An oligomeric compound according to (SEQ ID NO: 3346), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N 2 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; Disclosed herein are oligomeric compounds, wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N 1 is an adenine nucleobase. In certain embodiments, N 1is an unmodified adenine. 1 is a modified adenine. 1 is hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine. 2 is 5-methylcytosine. 2 is an unmodified cytosine. 2 is an abasic sugar moiety. 2 is a terminal group. In certain embodiments, N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. 3 is an abasic sugar moiety. 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is a modified adenine, and N 2is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 2 is a modified cytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 2 is absent. In certain embodiments, N 1 is hypoxanthine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2 is a modified cytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 3 is a thymine nucleobase. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a modified thymine. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is absent. In certain embodiments, N 1 is a modified adenine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 3 is absent. In certain embodiments, N 1 is hypoxanthine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 3 is an unmodified thymine. In certain embodiments, N1 is hypoxanthine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 3 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 3 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 does not exist.

[0463] In certain embodiments, the following chemical notation: 1 es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es N 3 e An oligomeric compound according to (SEQ ID NO: 3347), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N 3 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; o is a phosphodiester internucleoside linkage; Disclosed herein are oligomeric compounds, wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N 1 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine. 1 is a modified adenine. 1 is hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine. 2 is 5-methylcytosine. 2 is an unmodified cytosine. 2 is an abasic sugar moiety. 2is a terminal group. In certain embodiments, N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. 3 is an abasic sugar moiety. 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is a modified adenine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 2 is a modified cytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 2 is absent. In certain embodiments, N 1is hypoxanthine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2 is a modified cytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 3 is a thymine nucleobase. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a modified thymine. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase, and N 3 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is absent. In certain embodiments, N 1 is a modified adenine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 3 is absent. In certain embodiments, N 1 is hypoxanthine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is hypoxanthine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 3 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 3 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 does not exist.

[0464] In certain embodiments, the following chemical notation: 1 es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es G es m C es N 2 e An oligomeric compound according to (SEQ ID NO: 3348), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N 2 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; Disclosed herein are oligomeric compounds, wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N 1 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine. 1 is a modified adenine. 1 is hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine. 2 is 5-methylcytosine. 2 is an unmodified cytosine. 2 is an abasic sugar moiety. 2 is a terminal group. In certain embodiments, N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. 3 is an abasic sugar moiety. 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is a modified adenine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 2 is a modified cytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 2 is absent. In certain embodiments, N 1 is hypoxanthine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2 is a modified cytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 3 is a thymine nucleobase. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a modified thymine. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is absent. In certain embodiments, N 1 is a modified adenine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 3is absent. In certain embodiments, N 1 is hypoxanthine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is hypoxanthine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 3 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 3 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 does not exist.

[0465] In certain embodiments, the following chemical notation: 1 es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds Tds G eo m C es m C es N 3 e An oligomeric compound according to (SEQ ID NO: 3349), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N 1 is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N 1 is absent, then the sugar and internucleoside linkage are also absent, N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N 3 is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; Disclosed herein are oligomeric compounds, wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N 1 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine. 1 is a modified adenine. 1 is hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine.2 is 5-methylcytosine. 2 is an unmodified cytosine. 2 is an abasic sugar moiety. 2 is a terminal group. In certain embodiments, N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. 3 is an abasic sugar moiety. 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is a modified adenine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 2 is a modified cytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a modified adenine, and N 2 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 2 is absent. In certain embodiments, N 1 is hypoxanthine, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2 is a modified cytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is 5-methylcytosine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is absent. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 3 is a thymine nucleobase. In certain embodiments, N1 is an adenine nucleobase, and N 3 is a modified thymine. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 3 is absent. In certain embodiments, N 1 is a modified adenine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is a modified adenine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine, and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine, and N 3 is absent. In certain embodiments, N 1 is hypoxanthine, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 3 is an unmodified thymine. In certain embodiments, N 1 is hypoxanthine, and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is hypoxanthine, and N 3 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 3 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 3is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 3 does not exist.

[0466] VIII. Certain Compositions 1. Compound No. 1601260 Compound No. 1601260 is a 5-10-5 linked nucleoside having the nucleobase sequence (5' to 3') ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). It is characterized as an MOE gapmer, in which (from 5' to 3') nucleosides 1 to 5 and 16 to 20 are each a 2'-MOE nucleoside, nucleosides 6 to 15 are each a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, the internucleoside linkages between nucleosides 6 and 7, 7 and 8, 8 and 9, and 9 and 10 are mesylphosphoramidate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0467] Compound number 1601260 has the following chemical designation: A es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds Tds T ds m C es T es G es m C es m C e (SEQ ID NO: 3335), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage and the compound does not contain a conjugate group or a terminal group.

[0468] Compound number 1601260 has the following chemical structure: [ka] (SEQ ID NO: 3335) (Structure 1), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of Compound No. 1601260 include one or more cations selected from sodium, potassium, calcium, and magnesium.

[0469] The sodium salt of compound number 1601260 has the following chemical structure: [ka] (SEQ ID NO: 3335) (Structure 2).

[0470] 2. Compound No. 1616039 Compound No. 1616039 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having (5' to 3') the nucleobase sequence of ACGACATTTTCTTGCCTCTT (SEQ ID NO: 3319), wherein (5' to 3') nucleosides 1-5 and 16-20 each are a 2'-MOE nucleoside, nucleosides 6-15 each are a 2'-β-D-deoxynucleoside, and nucleosides 1 and 2, 2 and 3, 5 and 6, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and The internucleoside linkages between nucleosides 3 and 4, 4 and 5, and 17 and 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 6 and 7 and 13 and 14 are mesyl phosphoramidate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0471] Compound number 1616039 has the following chemical designation: A es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es T e (SEQ ID NO: 3336), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; is a phosphodiester internucleoside linkage and the compound does not contain a conjugate group or a terminal group.

[0472] Compound number 1616039 has the following chemical structure: [ka] (SEQ ID NO: 3336) (Structure 3), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of Compound No. 1616039 include one or more cations selected from sodium, potassium, calcium, and magnesium.

[0473] The sodium salt of compound number 1616039 has the following chemical structure: [ka] (SEQ ID NO: 3336) (Structure 4).

[0474] 3. Compound No. 1616357 Compound No. 1616357 is a 5-10-5 linked nucleoside having the nucleobase sequence (5' to 3') ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). It is characterized as an MOE gapmer, in which (from 5' to 3') nucleosides 1 to 5 and 16 to 20 are each a 2'-MOE nucleoside, nucleosides 6 to 15 are each a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 14 and 15, 15 and 16, 16 and 17, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, the internucleoside linkages between nucleosides 6 and 7, 7 and 8, 12 and 13, and 13 and 14 are mesylphosphoramidate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0475] Compound number 1616357 has the following chemical designation: A es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es G es m C es m C e (SEQ ID NO: 3337), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage and the compound does not contain a conjugate group or a terminal group.

[0476] Compound number 1616357 has the following chemical structure: [ka] (SEQ ID NO: 3337) (Structure 5), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of Compound No. 1616357 contain one or more cations selected from sodium, potassium, calcium, and magnesium.

[0477] The sodium salt of compound number 1616357 has the following chemical structure: [ka] (SEQ ID NO: 3337) (Structure 6).

[0478] 4. Compound No. 1620605 Compound No. 1620605 is a 6-10-4 linked nucleoside having the nucleobase sequence (5' to 3') ATCACGACATTTTCTTGCCT (SEQ ID NO: 3328). It is characterized as an MOE gapmer, in which (from 5' to 3') nucleosides 1 to 6 and 17 to 20 are each a 2'-MOE nucleoside, nucleosides 7 to 16 are each a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, the internucleoside linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, and 17 and 18 are phosphodiester internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0479] Compound number 1620605 has the following chemical designation: A es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es T e (SEQ ID NO: 3338), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; is a phosphodiester internucleoside linkage and the compound does not contain a conjugate group or a terminal group.

[0480] Compound number 1620605 has the following chemical structure: [ka] (SEQ ID NO: 3338) (Structure 7), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of compound number 1620605 contain one or more cations selected from sodium, potassium, calcium, and magnesium.

[0481] The sodium salt of compound number 1620605 has the following chemical structure: [ka] (SEQ ID NO: 3338) (Structure 8).

[0482] IX. Certain Comparative Compositions In certain embodiments, compound 827599 is a comparative compound and was previously described in WO 2019 / 164562. Compound 827599 consists of (5' to 3') the nucleobase sequence: ACAGATATTTTTGTTCTGCC, designated herein as SEQ ID NO: 3318. The sugar motif of compound No. 827599 is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of compound No. 827599 is (5' to 3') sossssssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 827599 is a 5-methylcytosine.

[0483] In certain embodiments, compound 763364 is a comparative compound and was previously described in WO 2019 / 164562. Compound 763364 consists of (5' to 3') the nucleobase sequence: ACGACATTTTCTTGCCTCTT, designated herein as SEQ ID NO: 3319. The sugar motif of compound No. 763364 is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of compound No. 763364 is (5' to 3') soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 763364 is a 5-methylcytosine.

[0484] In certain embodiments, the compounds described herein are superior to the compounds described in WO2019 / 164562 because they exhibit one or more improved properties, such as duration of action and efficacy.

[0485] For example, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each exhibited a longer duration of action in vivo compared to Compound No. 827599 in the assay described in Example 13. Specifically, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 achieved a 48%, 58%, and 60% reduction in human SNCA RNA, respectively, at 224 days post-administration. In comparison, Compound No. 827599 achieved a 0% reduction in human SNCA RNA at 224 days post-administration. Thus, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each exhibited a longer duration of action compared to Compound No. 827599 in this assay.

[0486] For example, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each demonstrated improved efficacy in vivo compared to Compound No. 827599 (see Example 14) and Compound No. 763364 (see Example 22). Specifically, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 demonstrated EDTA of 46 μg, 29 μg, and 23 μg of cortical brain tissue, respectively. 50 In comparison, compound 827599 achieved an ED400 in 122 μg of cortical brain tissue. 50 Compound No. 763374 achieved an ED of 63 μg of cortical brain tissue. 50 Thus, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 were each more potent than Compound No. 827599 and Compound No. 763364 in these assays.

[0487] X. Certain hotspot areas 1. Nucleic acid bases 16,692 to 16,716 of SEQ ID NO: 1 or nucleic acid bases 18,758 to 18,782 of SEQ ID NO: 2 In certain embodiments, nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0488] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0489] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0490] The nucleobase sequences of SEQ ID NOs: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189, and 3271 are complementary to an equal length portion within nucleobases 16,692 to 16,716 of SEQ ID NO: 1 or nucleobases 18,758 to 18,782 of SEQ ID NO: 2.

[0491] The nucleobase sequences of compound numbers 1483635, 1484499, 1485433, 1486327, 1486437, 1486657, 1535220, 1535277, 1535335, 1535391, 1535466, 1535496, 1535524, 1535578, and 1535629 are complementary to an isometric portion within nucleobases 16,692 to 16,716 of SEQ ID NO:1 or nucleobases 18,758 to 18,782 of SEQ ID NO:2.

[0492] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 16,692-16,716 of SEQ ID NO:1 or nucleobases 18,758-18,782 of SEQ ID NO:2 achieve at least a 72% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 16,692-16,716 of SEQ ID NO:1 or nucleobases 18,758-18,782 of SEQ ID NO:2 achieve an average of 88.9% reduction in SNCA mRNA in a standard in vitro assay.

[0493] 2. Nucleic acid bases 18,568 to 18,593 of SEQ ID NO: 1 or nucleic acid bases 20,634 to 20,659 of SEQ ID NO: 2 In certain embodiments, nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0494] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0495] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0496] The nucleobase sequences of SEQ ID NOs: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184, and 3266 are complementary to an equal length portion within nucleobases 18,568 to 18,593 of SEQ ID NO: 1 or nucleobases 20,634 to 20,659 of SEQ ID NO: 2.

[0497] The nucleobase sequences of compound numbers 1482920, 1484352, 1534261, 1534329, 1534428, 1534460, 1535214, 1535272, 1535330, 1535386, 1535439, 1535460, 1535518, and 1535573 are complementary to an isometric portion within nucleobases 18,568 to 18,593 of SEQ ID NO:1 or nucleobases 20,634 to 20,659 of SEQ ID NO:2.

[0498] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,568-18,593 of SEQ ID NO:1 or nucleobases 20,634-20,659 of SEQ ID NO:2 achieve at least a 73% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,568-18,593 of SEQ ID NO:1 or nucleobases 20,634-20,659 of SEQ ID NO:2 achieve an average of 88.1% reduction in SNCA mRNA in a standard in vitro assay.

[0499] 3. Nucleic acid bases 18,621 to 18,649 of SEQ ID NO: 1 or nucleic acid bases 20,687 to 20,715 of SEQ ID NO: 2 In certain embodiments, nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0500] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0501] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0502] The nucleobase sequences of SEQ ID NOs: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289, and 3313 are complementary to an isometric portion within nucleobases 18,621 to 18,649 of SEQ ID NO: 1 or nucleobases 20,687 to 20,715 of SEQ ID NO: 2.

[0503] Compound numbers 1485236, 1485314, 1485897, 1486071, 1486591, 1533975, 1534327, 1535209, 1535240, 1535266, 1535297, 1535315, 1535324, 1535355, 1535381, 1535411, 153 The nucleobase sequences of 5437, 1535455, 1535487, 1535513, 1535543, 1535568, 1535598, and 1535628 are complementary to an equal length portion within nucleobases 18,621 to 18,649 of SEQ ID NO:1 or nucleobases 20,687 to 20,715 of SEQ ID NO:2.

[0504] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,621-18,649 of SEQ ID NO:1 or nucleobases 20,687-20,715 of SEQ ID NO:2 achieve at least a 61% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,621-18,649 of SEQ ID NO:1 or nucleobases 20,687-20,715 of SEQ ID NO:2 achieve an average of 85.7% reduction in SNCA mRNA in a standard in vitro assay.

[0505] 4. Nucleic acid bases 18,721 to 18,752 of SEQ ID NO: 1 or nucleic acid bases 20,787 to 20,818 of SEQ ID NO: 2 In certain embodiments, nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is an MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0506] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0507] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0508] The nucleobase sequences of SEQ ID NOs: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176, and 3305 are complementary to an equal length portion within nucleobases 18,721 to 18,752 of SEQ ID NO: 1 or nucleobases 20,787 to 20,818 of SEQ ID NO: 2.

[0509] The nucleobase sequences of compound numbers 1482396, 1483241, 1485037, 1485579, 1486302, 1486305, 1533429, 1534037, 1534406, 1535257, 1535316, 1535372, 1535428, 1535446, 1535504, 1535615, and 1535621 are complementary to an isometric portion within nucleobases 18,721 to 18,752 of SEQ ID NO:1 or nucleobases 20,787 to 20,818 of SEQ ID NO:2.

[0510] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,721-18,752 of SEQ ID NO:1 or nucleobases 20,787-20,818 of SEQ ID NO:2 achieve at least 66% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 18,721-18,752 of SEQ ID NO:1 or nucleobases 20,787-20,818 of SEQ ID NO:2 achieve an average of 85.6% reduction in SNCA mRNA in a standard in vitro assay.

[0511] 5. Nucleic acid bases 19,423 to 19,443 of SEQ ID NO: 1 or nucleic acid bases 21,489 to 21,509 of SEQ ID NO: 2 In certain embodiments, nucleobases 19,423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0512] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0513] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0514] The nucleobase sequences of SEQ ID NOs: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, and 3280 are complementary to an equal length portion within nucleobases 19,423 to 19,443 of SEQ ID NO: 1 or nucleobases 21,489 to 21,509 of SEQ ID NO: 2.

[0515] The nucleobase sequences of compound numbers 1484583, 1485328, 1485484, 1534314, 1534320, 1535215, 1535230, 1535287, 1535345, 1535401, 1535477, 1535533, and 1535588 are complementary to an isometric portion within nucleobases 19,423 to 19,443 of SEQ ID NO:1 or nucleobases 21,489 to 21,509 of SEQ ID NO:2.

[0516] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19,423-19,443 of SEQ ID NO:1 or nucleobases 21,489-21,509 of SEQ ID NO:2 achieve at least 79% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19,423-19,443 of SEQ ID NO:1 or nucleobases 21,489-21,509 of SEQ ID NO:2 achieve an average of 88.6% reduction in SNCA mRNA in a standard in vitro assay.

[0517] 6. Nucleic acid bases 19,555 to 19,575 of SEQ ID NO: 1 or nucleic acid bases 21,621 to 21,641 of SEQ ID NO: 2 In certain embodiments, nucleobases 19,555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0518] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0519] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0520] The nucleobase sequences of SEQ ID NOs: 205, 2594, 2686, 3028, 3097, 3158, 3205, and 3287 are complementary to an equal length portion within nucleobases 19,555 to 19,575 of SEQ ID NO: 1 or nucleobases 21,621 to 21,641 of SEQ ID NO: 2.

[0521] The nucleobase sequences of compound numbers 1485166, 1486157, 1534324, 1535238, 1535292, 1535295, 1535352, 1535409, 1535484, 1535540, and 1535596 are complementary to an isometric portion within nucleobases 19,555 to 19,575 of SEQ ID NO:1 or nucleobases 21,621 to 21,641 of SEQ ID NO:2.

[0522] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19,555-19,575 of SEQ ID NO:1 or nucleobases 21,621-21,641 of SEQ ID NO:2 achieve at least a 77% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19,555-19,575 of SEQ ID NO:1 or nucleobases 21,621-21,641 of SEQ ID NO:2 achieve an average of 89.5% reduction in SNCA mRNA in a standard in vitro assay.

[0523] 7. Nucleic acid bases 21,457 to 21,501 of SEQ ID NO: 1 or nucleic acid bases 23,523 to 23,567 of SEQ ID NO: 2 In certain embodiments, nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0524] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0525] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0526] The nucleobase sequences of SEQ ID NOs: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193, and 3275 are complementary to an equal length portion within nucleobases 21,457 to 21,501 of SEQ ID NO: 1 or nucleobases 23,523 to 23,567 of SEQ ID NO: 2.

[0527] The nucleobase sequences of compound numbers 1483319, 1483650, 1483923, 1485260, 1534362, 1535224, 1535282, 1535339, 1535396, 1535470, 1535528, 1535563, 1535583, and 1535631 are complementary to an isometric portion within nucleobases 21,457 to 21,501 of SEQ ID NO:1 or nucleobases 23,523 to 23,567 of SEQ ID NO:2.

[0528] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 21,457-21,501 of SEQ ID NO:1 or nucleobases 23,523-23,567 of SEQ ID NO:2 achieve at least a 73% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 21,457-21,501 of SEQ ID NO:1 or nucleobases 23,523-23,567 of SEQ ID NO:2 achieve an average of 86.6% reduction in SNCA mRNA in a standard in vitro assay.

[0529] 8. Nucleic acid bases 22,008 to 22,030 of SEQ ID NO: 1 or nucleic acid bases 24,074 to 24,096 of SEQ ID NO: 2 In certain embodiments, nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0530] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0531] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0532] The nucleobase sequences of SEQ ID NOs: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228, and 3310 are complementary to an equal length portion within nucleobases 22,008 to 22,030 of SEQ ID NO: 1 or nucleobases 24,074 to 24,096 of SEQ ID NO: 2.

[0533] The nucleobase sequences of compound numbers 1483819, 1484024, 1486466, 1534334, 1534403, 1535206, 1535263, 1535321, 1535377, 1535434, 1535452, 1535510, 1535565, and 1535625 are complementary to an isometric portion within nucleobases 22,008 to 22,030 of SEQ ID NO:1 or nucleobases 24,074 to 24,096 of SEQ ID NO:2.

[0534] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,008-22,030 of SEQ ID NO:1 or nucleobases 24,074-24,096 of SEQ ID NO:2 achieve at least 75% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,008-22,030 of SEQ ID NO:1 or nucleobases 24,074-24,096 of SEQ ID NO:2 achieve an average of 89% reduction in SNCA mRNA in a standard in vitro assay.

[0535] 9. Nucleic acid bases 22,507 to 22,529 of SEQ ID NO: 1 or nucleic acid bases 24,573 to 24,595 of SEQ ID NO: 2 In certain embodiments, nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal length portion within nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0536] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0537] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0538] The nucleobase sequences of SEQ ID NOs: 196, 1814, 1909, 3042, 3109, 3170, 3217, and 3299 are complementary to equal length portions within nucleobases 22,507 to 22,529 of SEQ ID NO: 1 or nucleobases 24,573 to 24,595 of SEQ ID NO: 2.

[0539] The nucleobase sequences of compound numbers 1484851, 1485878, 1534284, 1535251, 1535308, 1535365, 1535422, 1535440, 1535498, 1535553, and 1535609 are complementary to an isometric portion within nucleobases 22,507 to 22,529 of SEQ ID NO:1 or nucleobases 24,573 to 24,595 of SEQ ID NO:2.

[0540] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,507-22,529 of SEQ ID NO:1 or nucleobases 24,573-24,595 of SEQ ID NO:2 achieve at least 78% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,507-22,529 of SEQ ID NO:1 or nucleobases 24,573-24,595 of SEQ ID NO:2 achieve an average of 89.4% reduction in SNCA mRNA in a standard in vitro assay.

[0541] 10. Nucleic acid bases 22,614 to 22,637 of SEQ ID NO: 1 or nucleic acid bases 24,680 to 24,703 of SEQ ID NO: 2 In certain embodiments, nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0542] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0543] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooossssssssssos, soooossssssssssoos, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0544] The nucleobase sequences of SEQ ID NOs: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227, and 3309 are complementary to an equal length portion within nucleobases 22,614 to 22,637 of SEQ ID NO: 1 or nucleobases 24,680 to 24,703 of SEQ ID NO: 2.

[0545] The nucleobase sequences of compound numbers 1482571, 1486455, 1533179, 1534179, 1534332, 1535205, 1535262, 1535320, 1535376, 1535433, 1535451, 1535509, and 1535564 are complementary to an isometric portion within nucleobases 22,614 to 22,637 of SEQ ID NO:1 or nucleobases 24,680 to 24,703 of SEQ ID NO:2.

[0546] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,614-22,637 of SEQ ID NO:1 or nucleobases 24,680-24,703 of SEQ ID NO:2 achieve at least 57% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22,614-22,637 of SEQ ID NO:1 or nucleobases 24,680-24,703 of SEQ ID NO:2 achieve an average of 87.2% reduction in SNCA mRNA in a standard in vitro assay.

[0547] 11. Nucleic acid bases 25,049 to 25,090 of SEQ ID NO: 1 or nucleic acid bases 27,115 to 27,156 of SEQ ID NO: 2 In certain embodiments, nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0548] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0549] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0550] The nucleobase sequences of SEQ ID NOs: 24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195, and 3277 are complementary to an isometric portion within nucleobases 25,049 to 25,090 of SEQ ID NO: 1 or nucleobases 27,115 to 27,156 of SEQ ID NO: 2.

[0551] The nucleobase sequences of compound numbers 1484502, 1484512, 1484515, 1485351, 1485506, 1485716, 1534281, 1534299, 1534409, 1534422, 1534454, 1535227, 1535284, 1535342, 1535398, 1535472, 1535530, 1535585, 1535592, and 1535633 are complementary to an isometric portion within nucleobases 25,049 to 25,090 of SEQ ID NO:1 or nucleobases 27,115 to 27,156 of SEQ ID NO:2.

[0552] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25,049-25,090 of SEQ ID NO:1 or nucleobases 27,115-27,156 of SEQ ID NO:2 achieve at least a 71% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25,049-25,090 of SEQ ID NO:1 or nucleobases 27,115-27,156 of SEQ ID NO:2 achieve an average of 85.5% reduction in SNCA mRNA in a standard in vitro assay.

[0553] 12. Nucleic acid bases 26,367 to 26,388 of SEQ ID NO: 1 or nucleic acid bases 28,433 to 28,454 of SEQ ID NO: 2 In certain embodiments, nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0554] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0555] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0556] The nucleobase sequences of SEQ ID NOs: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224, and 3306 are complementary to an equal length portion within nucleobases 26,367 to 26,388 of SEQ ID NO: 1 or nucleobases 28,433 to 28,454 of SEQ ID NO: 2.

[0557] The nucleobase sequences of compound numbers 1485739, 1486339, 1534264, 1534442, 1534444, 1535258, 1535317, 1535373, 1535429, 1535447, 1535505, 1535560, 1535616, and 1535622 are complementary to an isometric portion within nucleobases 26,367 to 26,388 of SEQ ID NO:1 or nucleobases 28,433 to 28,454 of SEQ ID NO:2.

[0558] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 26,367-26,388 of SEQ ID NO:1 or nucleobases 28,433-28,454 of SEQ ID NO:2 achieve at least 76% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 26,367-26,388 of SEQ ID NO:1 or nucleobases 28,433-28,454 of SEQ ID NO:2 achieve an average of 90.5% reduction in SNCA mRNA in a standard in vitro assay.

[0559] 13. Nucleic acid bases 26,508 to 26,531 of SEQ ID NO: 1 or nucleic acid bases 28,574 to 28,597 of SEQ ID NO: 2 In certain embodiments, nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0560] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0561] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0562] The nucleobase sequences of SEQ ID NOs: 210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197, and 3279 are complementary to an equal length portion within nucleobases 26,508 to 26,531 of SEQ ID NO: 1 or nucleobases 28,574 to 28,597 of SEQ ID NO: 2.

[0563] The nucleobase sequences of compound numbers 1484579, 1485953, 1534266, 1534267, 1534268, 1534341, 1534391, 1535203, 1535229, 1535286, 1535344, 1535400, 1535476, 1535532, 1535587, and 1535636 are complementary to an isometric portion within nucleobases 26,508 to 26,531 of SEQ ID NO:1 or nucleobases 28,574 to 28,597 of SEQ ID NO:2.

[0564] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 26,508-26,531 of SEQ ID NO:1 or nucleobases 28,574-28,597 of SEQ ID NO:2 achieve at least 78% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 26,508-26,531 of SEQ ID NO:1 or nucleobases 28,574-28,597 of SEQ ID NO:2 achieve an average of 89.3% reduction in SNCA mRNA in a standard in vitro assay.

[0565] 14. Nucleic acid bases 30,207 to 30,226 of SEQ ID NO: 1 or nucleic acid bases 32,273 to 32,292 of SEQ ID NO: 2 In certain embodiments, nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0566] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0567] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0568] The nucleobase sequences of SEQ ID NOs: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225, and 3307 are complementary to an equal length portion within nucleobases 30,207 to 30,226 of SEQ ID NO: 1 or nucleobases 32,273 to 32,292 of SEQ ID NO: 2.

[0569] The nucleobase sequences of compound numbers 1485060, 1485105, 1486348, 1534322, 1535260, 1535318, 1535374, 1535430, 1535448, 1535506, 1535561, 1535617, and 1535623 are complementary to an isometric portion within nucleobases 30,207 to 30,226 of SEQ ID NO:1 or nucleobases 32,273 to 32,292 of SEQ ID NO:2.

[0570] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 30,207-30,226 of SEQ ID NO:1 or nucleobases 32,273-32,292 of SEQ ID NO:2 achieve at least 81% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 30,207-30,226 of SEQ ID NO:1 or nucleobases 32,273-32,292 of SEQ ID NO:2 achieve an average of 92.9% reduction in SNCA mRNA in a standard in vitro assay.

[0571] 15. Nucleic acid bases 31,412 to 31,438 of SEQ ID NO: 1 and nucleic acid bases 33,478 to 33,504 of SEQ ID NO: 2 In certain embodiments, nucleobases 31,412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0572] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In certain embodiments, the sugar motif of a mixed cEt / MOE gapmer is (5' to 3') kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee, where "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0573] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is (5' to 3') soossssssssssos, soossssssssssoos, sooossssssssssooos, soooosssssssssssos, sooossssssssssss, sooossssssssssss, or sooooossssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0574] The nucleobase sequences of SEQ ID NOs: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226, and 3308 are complementary to an equal length portion within nucleobases 31,412 to 31,438 of SEQ ID NO: 1 or nucleobases 33,478 to 33,504 of SEQ ID NO: 2.

[0575] The nucleobase sequences of compound numbers 1484891, 1485806, 1486424, 1486626, 1535204, 1535261, 1535319, 1535375, 1535432, 1535449, 1535508, 1535562, and 1535624 are complementary to an isometric portion within nucleobases 31,412 to 31,438 of SEQ ID NO:1 or nucleobases 33,478 to 33,504 of SEQ ID NO:2.

[0576] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 31,412-31,438 of SEQ ID NO:1 or nucleobases 33,478-33,504 of SEQ ID NO:2 achieve at least 79% reduction in SNCA mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 31,412-31,438 of SEQ ID NO:1 or nucleobases 33,478-33,504 of SEQ ID NO:2 achieve an average of 86.8% reduction in SNCA mRNA in a standard in vitro assay.

[0577] 16. Nucleic acid bases 33,027 to 33,057 of SEQ ID NO: 1 or nucleic acid bases 35,093 to 35,123 of SEQ ID NO: 2 In certain embodiments, nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal-length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 17 nucleobases in length. In certain embodiments, a modified oligonucleotide is 18 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a modified oligonucleotide is a cEt gapmer. In certain embodiments, a modified oligonucleotide is a MOE gapmer. In certain embodiments, a modified oligonucleotide is a mixed cEt / MOE gapmer.

[0578] In certain embodiments, the gapmer is a 3-10-3 cEt gapmer. In certain embodiments, the gapmer is a 3-10-4 cEt gapmer. In certain embodiments, the gapmer is a 4-10-3 cEt gapmer. In certain embodiments, the gapmer is a 4-10-4 cEt gapmer. In certain embodiments, the gapmer is a 5-10-5 cEt gapmer. In cer...

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of an SNCA nucleic acid, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

2. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-3334, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

3. consisting of 12 to 50 linked nucleosides, and an isometric portion of nucleobases 16,692 to 16,716 of SEQ ID NO: 1 or nucleobases 18,758 to 18,782 of SEQ ID NO: 2; an isometric portion of nucleobases 18,568 to 18,593 of SEQ ID NO: 1 or nucleobases 20,634 to 20,659 of SEQ ID NO: 2; an isometric portion of nucleobases 18,621 to 18,649 of SEQ ID NO: 1 or nucleobases 20,687 to 20,715 of SEQ ID NO: 2; an isometric portion of nucleobases 18,721 to 18,752 of SEQ ID NO: 1 or nucleobases 20,787 to 20,818 of SEQ ID NO: 2; an isometric portion of nucleobases 19,423 to 19,443 of SEQ ID NO: 1 or nucleobases 21,489 to 21,509 of SEQ ID NO: 2; an isometric portion of nucleobases 19,555 to 19,575 of SEQ ID NO: 1 or nucleobases 21,621 to 21,641 of SEQ ID NO: 2; an isometric portion of nucleobases 21,457 to 21,501 of SEQ ID NO: 1 or nucleobases 23,523 to 23,567 of SEQ ID NO: 2; an isometric portion of nucleobases 22,008 to 22,030 of SEQ ID NO: 1 or nucleobases 24,074 to 24,096 of SEQ ID NO: 2; an isometric portion of nucleobases 22,507 to 22,529 of SEQ ID NO: 1 or nucleobases 24,573 to 24,595 of SEQ ID NO: 2; an isometric portion of nucleobases 22,614 to 22,637 of SEQ ID NO: 1 or nucleobases 24,680 to 24,703 of SEQ ID NO: 2; an isometric portion of nucleobases 25,049 to 25,090 of SEQ ID NO: 1 or nucleobases 27,115 to 27,156 of SEQ ID NO: 2; an isometric portion of nucleobases 26,367 to 26,388 of SEQ ID NO: 1 or nucleobases 28,433 to 28,454 of SEQ ID NO: 2; an isometric portion of nucleobases 26,508 to 26,531 of SEQ ID NO: 1 or nucleobases 28,574 to 28,597 of SEQ ID NO: 2; an isometric portion of nucleobases 30,207 to 30,226 of SEQ ID NO: 1 or nucleobases 32,273 to 32,292 of SEQ ID NO: 2; an isometric portion of nucleobases 31,412 to 31,438 of SEQ ID NO: 1 or nucleobases 33,478 to 33,504 of SEQ ID NO: 2; an isometric portion of nucleobases 33,027 to 33,057 of SEQ ID NO: 1 or nucleobases 35,093 to 35,123 of SEQ ID NO: 2; or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases complementary to an isometric portion of nucleobases 48,460 to 48,489 of SEQ ID NO:1 or nucleobases 50,526 to 50,555 of SEQ ID NO:2, An oligomeric compound, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

4. consisting of 12 to 50 linked nucleosides, and SEQ ID NOs: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189, or 3271; SEQ ID NOs: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184, or 3266; SEQ ID NOs: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289, or 3313, SEQ ID NOs: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176, or 3305; SEQ ID NOs: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, or 3280; SEQ ID NO: 205, 2594, 2686, 3028, 3097, 3158, 3205, or 3287; SEQ ID NOs: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193, or 3275; SEQ ID NOs: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228, or 3310; SEQ ID NO: 196, 1814, 1909, 3042, 3109, 3170, 3217, or 3299; SEQ ID NOs: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227, or 3309; SEQ ID NOs: 24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195, or 3277, SEQ ID NOs: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224, or 3306; SEQ ID NOs: 210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197, or 3279; SEQ ID NOs: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225, or 3307; SEQ ID NOs: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226, or 3308; SEQ ID NO: 194, 277, 1113, 1185, 1309, 3024, 3093, 3154, 3201, or 3283, or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of SEQ ID NOs: 310, 803, 919, 1582, 1674, 3032, 3032, 3032, 3100, 3161, 3208, 3290, or 3290; An oligomeric compound, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

5. 5. The oligomeric compound of any one of claims 1 to 4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-9, when measured across the entire nucleobase sequence of the modified oligonucleotide.

6. The modified oligonucleotides are 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30 6. The oligomeric compound of any one of claims 1 to 5, consisting of 16-50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, or 20-50 linked nucleosides.

7. The oligomeric compound of any one of claims 1 to 6, wherein at least one nucleoside of said modified oligonucleotide is a modified nucleoside.

8. The oligomeric compound of claim 7 , wherein the modified nucleoside comprises a modified sugar moiety.

9. 9. The oligomeric compound of claim 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

10. The bicyclic sugar moiety is —O—CH ２ - and -O-CH(CH ３ 10. The oligomeric compound of claim 9, comprising a 2'-4' bridge selected from:

11. The oligomeric compound of any one of claims 7 to 10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

12. 12. The oligomeric compound of claim 11, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylosyl sugar moiety, or a 2'-α-L-deoxyribosyl sugar moiety.

13. The oligomeric compound of any one of claims 7 to 12, wherein the modified nucleoside comprises a sugar surrogate.

14. 14. The oligomeric compound of claim 13, wherein the sugar surrogate is one of a morpholino, a modified morpholino, a glycol nucleic acid (GNA), a six-membered tetrahydropyran (THP), and an F-hexitol nucleic acid (F-HNA).

15. The oligomeric compound of any one of claims 1 to 14, wherein the modified oligonucleotide is a gapmer.

16. The oligomeric compound of any one of claims 1 to 15, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

17. 17. The oligomeric compound of claim 16, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

18. 18. The oligomeric compound of claim 16 or 17, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

19. 19. The oligomeric compound of any one of claims 16 to 18, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

20. 20. The oligomeric compound of any one of claims 16-19, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

21. 20. The oligomeric compound of any one of claims 16, 18, or 19, wherein each internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

22. 19. The oligomeric compound of any one of claims 16 to 18, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

23. 23. The oligomeric compound of any one of claims 16-22, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

24. 22. The oligomeric compound of any one of claims 16-21, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 internucleoside linkages of said modified oligonucleotide are mesyl phosphoramidate internucleoside linkages.

25. The modified oligonucleotide is 5’-soossssssssssos-3’, 5’-soossssssssssoos-3’, 5’-sooosssssssssos-3’, 5’-sooosssssssssoos-3’, 5’-soooosssssssssooos-3’, 5’-soossssssssssooos-3’, 5’-soossssssssssssssss-3’, 5’-ssssssssssssssssssss-3’, 5’-soooosssssssssosss-3’, 5’-sssssssszzzzssssssss-3’, 5’-soooszzzzssssssssoosss-3’, 5’-sooosssssssssssssosss-3’, 5’-sosssssssssssssssosss-3’, 5’-sooosssssssssosss-3’, 5’-sosssssssssssssssosss-3’, 5’-soosszzzzssssssssoosss-3’, 5’-sosssszzzzssssssssoosss-3’, 5’-sosssszzzzssssssssssosss-3’, 5’-sssssssszszzszssssssss-3’, 5’-ssssssssszssssssssosss-3’, 5’-ssooszssssssssszssss-3’, 5’-ssossszsssssssszzssss-3’, 5’-sssoszzzzssssssssssssss-3’, 5’-ssossszssssssssssssosss-3’, 5’-sssssssszzssssssssssss-3’, 5’-ssssssssszssssssssosss-3’, 5’-ssssssssszssssssssssosss-3’, 5’-ssssssssszssssssssssosss-3’, 5’-sssssssszzssssssssssosss-3’, 5’-ssssssssszssssssssssss-3’, 5’-sosssszsssssssszzssss-3’, 5’-sosssssszsssssssszzssss-3’, 5’-sosssszssssssssszzssss-3’5'-sossszzssssszsssoss-3', 5'-sossszssssszzsssoss-3', 5'-sosssszsssszzsssoss-3', 5'-soss szzsssssszsssoss-3', 5'-sossszzsssszssssoss- 3', 5'-szssszzsssszzsszzss-3', 5'-zzssszzssss zzsssszz-3', 5'-zsssszzsssszzsssssz-3', 5'-s sooszsssssszzssoss-3', 5'-sssoszsssssszzssos s-3', 5'-ssooszsssssszzsssss-3', 5'-ssssszsssssszzsssss-3', 5'-sssszzssssssszzsssss-3', 5'- soooszzssssszssooss-3', 5'-sooszzsssssssooss-3', 5'-ssooszzssssssssooss-3', 5'-ssooszz ssssszzsooss-3', 5'-ssszzsssssssssooss-3', 5'-ssszzssssszzsooss-3', 5'-sssszzssssssss 21. The oligomeric compound of any one of claims 16 to 20, having an internucleoside linkage motif selected from 5'-sss-3', 5'-sssoszzssssszzsssss-3', and 5'-sssoszzzzssssszzsss-3', wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.

26. 26. The oligomeric compound of any one of claims 1 to 25, wherein at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase.

27. 27. The oligomeric compound of claim 26, wherein said modified nucleobase is 5-methylcytosine.

28. 28. The oligomeric compound of claim 27, wherein each cytosine is a 5-methylcytosine.

29. 29. The oligomeric compound of any one of claims 1 to 28, wherein each nucleoside of said modified oligonucleotide is an unmodified adenine, an unmodified guanine, an unmodified thymine, an unmodified cytosine, or a 5-methylcytosine.

30. The oligomeric compound of any one of claims 1 to 29, wherein the modified oligonucleotide comprises a deoxy region.

31. 31. The oligomeric compound of claim 30, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside.

32. 32. The oligomeric compound of claim 30 or 31, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

33. 33. The oligomeric compound of any one of claims 30-32, wherein each nucleoside immediately adjacent to the deoxy tract comprises a modified sugar moiety.

34. 34. The oligomeric compound of any one of claims 30 to 33, wherein the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and adjacent on the 3' side to a 3' region consisting of 1 to 6 linked 3' region nucleosides, wherein at least one nucleoside in the 5' region comprises a modified sugar moiety, and at least one nucleoside in the 3' region comprises a modified sugar moiety.

35. 35. The oligomeric compound of claim 34, wherein each nucleoside of said 5' region comprises a modified sugar moiety.

36. 36. The oligomeric compound of claim 34 or 35, wherein each nucleoside of said 3' region comprises a modified sugar moiety.

37. 37. The oligomeric compound of any one of claims 1 to 36, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.

38. 38. The oligomeric compound of any one of claims 1 to 37, wherein said modified oligonucleotide consists of 20 linked nucleosides.

39. the modified oligonucleotide is a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; 39. The oligomeric compound of any one of claims 1 to 38, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

40. the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; 40. The oligomeric compound of any one of claims 1 to 39, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

41. the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; 41. The oligomeric compound of claim 40, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

42. the modified oligonucleotide is a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; 40. The oligomeric compound of any one of claims 1 to 39, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

43. the modified oligonucleotide is a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; 43. The oligomeric compound of claim 42, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

44. 44. The oligomeric compound of any one of claims 1 to 43, consisting of said modified oligonucleotide.

45. 44. The oligomeric compound of any one of claims 1 to 43, wherein the oligomeric compound comprises a conjugate group.

46. 46. ​​The oligomeric compound of claim 45, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

47. 47. The oligomeric compound of claim 46, wherein the conjugate linker is a phosphodiester linker.

48. 47. The oligomeric compound of claim 46, wherein the conjugate linker consists of a single bond.

49. The oligomeric compound of any one of claims 46 to 48, wherein the conjugate linker is cleavable.

50. 50. The oligomeric compound of any one of claims 46, 47, or 49, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

51. 51. The oligomeric compound of any one of claims 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

52. 51. The oligomeric compound of any one of claims 45 to 50, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

53. 53. The oligomeric compound of any one of claims 1-49 or 51-52, wherein the oligomeric compound does not include a linker nucleoside.

54. 54. The oligomeric compound of any one of claims 1 to 53, comprising a terminal group.

55. 55. The oligomeric compound of claim 54, wherein said terminal group is an abasic sugar moiety.

56. 56. The oligomeric compound of any one of claims 1 to 55, wherein the oligomeric compound is an RNase H agent.

57. The following chemical notation: A ｅｓ ｍ C ｅｓ A ｅｓ G ｅｓ A ｅｓ T ｄｚ A ｄｚ T ｄｚ T ｄｚ T ｄｓ T ｄｓ T ｄｓ G ｄｓ T ｄｓ T ｄｓ ｍ C ｅｓ T ｅｓ G ｅｓ ｍ C ｅｓ ｍ C ｅ 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3335), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group or a terminal group.

58. The following chemical notation: A ｅｓ ｍ C ｅｓ G ｅｏ A ｅｏ ｍ C ｅｓ A ｄｚ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ T ｄｓ T ｄｚ G ｄｓ ｍ C ｄｓ ｍ C ｅｓ T ｅｏ ｍ C ｅｓ T ｅｓ T ｅ An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3336), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group or a terminal group.

59. The following chemical notation: A ｅｓ ｍ C ｅｓ A ｅｓ G ｅｓ A ｅｓ T ｄｚ A ｄｚ T ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｚ G ｄｚ T ｄｓ T ｄｓ ｍ C ｅｓ T ｅｓ G ｅｓ ｍ C ｅｓ ｍ C ｅ 1. An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3337), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group or a terminal group.

60. The following chemical notation: A ｅｓ T ｅｏ ｍ C ｅｏ A ｅｏ ｍ C ｅｏ G ｅｏ A ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ T ｄｓ T ｄｓ G ｅｏ ｍ C ｅｓ ｍ C ｅｓ T ｅ An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 3338), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group or a terminal group.

61. 61. The oligomeric compound of any one of claims 57 to 60, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

62. 62. The oligomeric compound of claim 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

63. 63. The oligomeric compound of any one of claims 1 to 62, wherein the oligomeric compound is a single-stranded oligomeric compound.

64. The following chemical notation: N １ ｅｓ ｍ C ｅｓ A ｅｓ G ｅｓ A ｅｓ T ｄｚ A ｄｚ T ｄｚ T ｄｚ T ｄｓ T ｄｓ T ｄｓ G ｄｓ T ｄｓ T ｄｓ ｍ C ｅｓ T ｅｓ G ｅｓ ｍ C ｅｓ N ２ ｅ An oligomeric compound according to (SEQ ID NO: 3346), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N １ is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N １ is absent, then the sugar and internucleoside linkage are also absent, N ２ is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N ２ If is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group.

65. The following chemical notation: N １ ｅｓ ｍ C ｅｓ G ｅｏ A ｅｏ ｍ C ｅｓ A ｄｚ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ T ｄｓ T ｄｚ G ｄｓ ｍ C ｄｓ ｍ C ｅｓ T ｅｏ ｍ C ｅｓ T ｅｓ N ３ ｅ An oligomeric compound according to (SEQ ID NO: 3347), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N １ is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N １ is absent, then the sugar and internucleoside linkage are also absent, N ３ is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N ３ If is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group.

66. The following chemical notation: N １ ｅｓ ｍ C ｅｓ A ｅｓ G ｅｓ A ｅｓ T ｄｚ A ｄｚ T ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｚ G ｄｚ T ｄｓ T ｄｓ ｍ C ｅｓ T ｅｓ G ｅｓ ｍ C ｅｓ N ２ ｅ An oligomeric compound according to (SEQ ID NO: 3348), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N １ is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N １ is absent, then the sugar and internucleoside linkage are also absent, N ２ is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N ２ If is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; z is a mesyl phosphoramidate internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group.

67. The following chemical notation: N １ ｅｓ T ｅｏ ｍ C ｅｏ A ｅｏ ｍ C ｅｏ G ｅｏ A ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ T ｄｓ T ｄｓ G ｅｏ ｍ C ｅｓ ｍ C ｅｓ N ３ ｅ An oligomeric compound according to (SEQ ID NO: 3349), A is an adenine nucleobase; ｍ C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; N １ is an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N １ is absent, then the sugar and internucleoside linkage are also absent, N ３ is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, and N ３ If is not present, the sugar is also not present, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage; An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group.

68. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein is an adenine nucleobase.

69. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein is unmodified adenine.

70. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein is a modified adenine.

71. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein is hypoxanthine.

72. N １ 68. The oligomeric compound of any one of claims 64-67, wherein is an abasic sugar moiety.

73. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein: is a terminal group.

74. N １ 68. The oligomeric compound of any one of claims 64 to 67, wherein:

75. N ２ 75. The oligomeric compound of any one of claims 64 to 74, wherein is a modified cytosine.

76. N ２ 75. The oligomeric compound of any one of claims 64 to 74, wherein is 5-methylcytosine.

77. N ２ 75. The oligomeric compound of any one of claims 64 to 74, wherein is an unmodified cytosine.

78. N ２ is an abasic sugar moiety.

79. N ２ The oligomeric compound of any one of claims 64 to 74, wherein is a terminal group.

80. N ２ 75. The oligomeric compound of any one of claims 64 to 74, wherein:

81. N ３ 75. The oligomeric compound of any one of claims 64 to 74, wherein is a modified thymine.

82. N ３ 75. The oligomeric compound of any one of claims 64 to 74, wherein is unmodified thymine.

83. N ３ is an abasic sugar moiety.

84. N ３ The oligomeric compound of any one of claims 64 to 74, wherein is a terminal group.

85. N ３ 75. The oligomeric compound of any one of claims 64 to 74, wherein:

86. N １ is an adenine nucleobase, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

87. N １ is an adenine nucleobase, and N ２ 87. The oligomeric compound of any one of claims 64 to 80 or 86, wherein is a modified cytosine.

88. N １ is an adenine nucleobase, and N ２ 87. The oligomeric compound of any one of claims 64-80 or 86, wherein is an abasic sugar moiety.

89. N １ is an adenine nucleobase, and N ２ 87. The oligomeric compound of any one of claims 64 to 80 or 86, wherein: is a terminal group.

90. N １ is an adenine nucleobase, and N ２ 87. The oligomeric compound of any one of claims 64 to 80 or 86, wherein is absent.

91. N １ is a modified adenine, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

92. N １ is a modified adenine, and N ２ 92. The oligomeric compound of any one of claims 64 to 80 or 91, wherein is a modified cytosine.

93. N １ is a modified adenine, and N ２ 92. The oligomeric compound of any one of claims 64 to 80 or 91, wherein is 5-methylcytosine.

94. N １ is a modified adenine, and N ２ 92. The oligomeric compound of any one of claims 64-80 or 91, wherein is an abasic sugar moiety.

95. N １ is a modified adenine, and N ２ 92. The oligomeric compound of any one of claims 64 to 80 or 91, wherein: is a terminal group.

96. N １ is a modified adenine, and N ２ 92. The oligomeric compound of any one of claims 64 to 80 or 91, wherein is absent.

97. N １ is hypoxanthine, and N ２ 92. The oligomeric compound of any one of claims 64-80 or 91, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

98. N １ is hypoxanthine, and N ２ 98. The oligomeric compound of any one of claims 64 to 80 or 97, wherein is a modified cytosine.

99. N １ is hypoxanthine, and N ２ 98. The oligomeric compound of any one of claims 64 to 80 or 97, wherein is 5-methylcytosine.

100. N １ is hypoxanthine, and N ２ 98. The oligomeric compound of any one of claims 64-80 or 97, wherein is an abasic sugar moiety.

101. N １ is hypoxanthine, and N ２ 98. The oligomeric compound of any one of claims 64 to 80 or 97, wherein: is a terminal group.

102. N １ is hypoxanthine, and N ２ 98. The oligomeric compound of any one of claims 64 to 80 or 97, wherein:

103. N １ is an abasic sugar moiety, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

104. N １ is a terminal group, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

105. N １ does not exist, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.

106. N １ does not exist, and N ２ 81. The oligomeric compound of any one of claims 64 to 80, wherein:

107. N １ is an adenine nucleobase, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

108. N １ is an adenine nucleobase, and N ３ 108. The oligomeric compound of any one of claims 64-74, 81-85, or 107, wherein is a thymine nucleobase.

109. N １ is an adenine nucleobase, and N ３ 108. The oligomeric compound of any one of claims 64-74, 81-85, or 107, wherein is a modified thymine.

110. N １ is an adenine nucleobase, and N ３ is an abasic sugar moiety.

111. N １ is an adenine nucleobase, and N ３ 108. The oligomeric compound of any one of claims 64-74, 81-85, or 107, wherein: is a terminal group.

112. N １ is an adenine nucleobase, and N ３ 108. The oligomeric compound of any one of claims 64-74, 81-85, or 107, wherein is absent.

113. N １ is a modified adenine, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

114. N １ is a modified adenine, and N ３ 114. The oligomeric compound of any one of claims 64-74, 81-85, or 113, wherein is an unmodified thymine.

115. N １ is a modified adenine, and N ３ is an abasic sugar moiety.

116. N １ is a modified adenine, and N ３ 114. The oligomeric compound of any one of claims 64-74, 81-85, or 113, wherein: is a terminal group.

117. N １ is a modified adenine, and N ３ 114. The oligomeric compound of any one of claims 64-74, 81-85, or 113, wherein is absent.

118. N １ is hypoxanthine, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

119. N １ is hypoxanthine, and N ３ 119. The oligomeric compound of any one of claims 64-74, 81-85, or 118, wherein is an unmodified thymine.

120. N １ is hypoxanthine, and N ３ is an abasic sugar moiety.

121. N １ is hypoxanthine, and N ３ 119. The oligomeric compound of any one of claims 64-74, 81-85, or 118, wherein: is a terminal group.

122. N １ is hypoxanthine, and N ３ 119. The oligomeric compound of any one of claims 64-74, 81-85, or 118, wherein is absent.

123. N １ is an abasic sugar moiety, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

124. N １ is a terminal group, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

125. N １ does not exist, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.

126. N １ does not exist, and N ３ 86. The oligomeric compound of any one of claims 64-74 or 81-85, wherein is absent.

127. 127. The oligomeric compound of any one of claims 64 to 126, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

128. 128. The oligomeric compound of claim 127, wherein the conjugate linker is a phosphodiester linker.

129. 128. The oligomeric compound of claim 127, wherein the conjugate linker consists of a single bond.

130. 130. The oligomeric compound of any one of claims 127 to 129, wherein the conjugate linker is cleavable.

131. 131. The oligomeric compound of any one of claims 127, 128, or 130, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the oligomeric compound, or another linker nucleoside by a phosphodiester bond.

132. 132. The oligomeric compound of any one of claims 64-131, wherein the conjugate group is attached to the oligomeric compound at the 5' end of the oligomeric compound.

133. 132. The oligomeric compound of any one of claims 64-131, wherein the conjugate group is attached to the oligomeric compound at the 3' end of the oligomeric compound.

134. 134. The oligomeric compound of any one of claims 64 to 133, wherein the oligomeric compound is a pharmaceutically acceptable salt.

135. 134. The oligomeric compound of claim 133, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

136. 136. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein said first oligomeric compound is the oligomeric compound of any one of claims 1 to 135.

137. 137. The oligomeric duplex of Claim 136, wherein said second modified oligonucleotide consists of from 12 to 50 linked nucleosides and wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of said first modified oligonucleotide.

138. 138. The oligomeric duplex of claim 136 or 137, wherein said modified oligonucleotide of said first oligomeric compound comprises a 5'-stabilizing phosphate group.

139. 139. The oligomeric duplex of claim 138, wherein the stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate.

140. 140. The oligomeric duplex of any one of claims 136-139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

141. 141. The oligomeric duplex of claim 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

142. the bicyclic sugar moiety of the second modified oligonucleotide is —O—CH ２ - and -O-CH(CH ３ 142. The oligomeric duplex of claim 141, comprising a 2'-4' bridge selected from:

143. 141. The oligomeric duplex of claim 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

144. 144. The oligomeric duplex of claim 143, wherein said non-bicyclic modified sugar moiety of said second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F modified sugar moiety, or a 2'-OMe modified sugar moiety.

145. 145. The oligomeric duplex of any one of claims 136 to 144, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.

146. 146. The oligomeric duplex of claim 145, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

147. 147. The oligomeric duplex of any one of claims 136 to 146, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

148. 148. The oligomeric duplex of any one of claims 145 to 147, wherein at least one internucleoside linkage of said second modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.

149. 149. The oligomeric duplex of any one of claims 136-148, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.

150. 150. The oligomeric duplex of any one of claims 136-149, wherein said second modified oligonucleotide comprises at least one modified nucleobase.

151. 151. The oligomeric duplex of claim 150, wherein said at least one modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

152. 152. The oligomeric duplex of any one of claims 136 to 151, wherein the second modified oligonucleotide comprises a conjugate group.

153. 153. The oligomeric duplex of claim 152, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

154. 154. The oligomeric duplex of claim 153, wherein the conjugate linker consists of a single bond.

155. 155. The oligomeric duplex of claim 153 or 154, wherein the conjugate linker is cleavable.

156. 156. The oligomeric duplex of claim 153 or 155, wherein the conjugate linker comprises one to three linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

157. 157. The oligomeric duplex of any one of claims 153 to 156, wherein the conjugate linker is a phosphodiester linker.

158. 158. The oligomeric duplex of any one of claims 152 to 157, wherein the conjugate group is attached to the 5' end of the second modified oligonucleotide.

159. 158. The oligomeric duplex of any one of claims 152 to 157, wherein the conjugate group is attached to the 3' end of the second modified oligonucleotide.

160. 158. The oligomeric duplex of any one of claims 152-157, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

161. 161. The oligomeric duplex of any one of claims 152-160, wherein the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C17 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C17 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl.

162. 162. The oligomeric duplex of any one of claims 152-161, wherein the conjugate group comprises a cell targeting moiety.

163. 163. The oligomeric duplex of any one of claims 136-162, wherein the second modified oligonucleotide comprises a terminal group.

164. 164. The oligomeric duplex of claim 163, wherein the terminal group is an abasic sugar moiety.

165. 136. An antisense agent comprising or consisting of an antisense compound, said antisense compound being an oligomeric compound according to any one of claims 1 to 135.

166. 165. An antisense agent, wherein said antisense agent is an oligomeric duplex of any one of claims 136-164.

167. the antisense agent i) an RNase H agent capable of reducing the amount of SNCA nucleic acid by activating RNase H, or ii) An antisense agent according to claim 165 or 166, which is an RNAi agent capable of reducing the amount of SNCA nucleic acid by activating RISC / Ago2.

168. 168. The antisense agent of any one of claims 165-167, wherein the antisense agent comprises a conjugate group, and the conjugate group comprises a cell targeting moiety.

169. The chemical structure below: 【Chemistry 1】 (SEQ ID NO: 3335), or a pharmaceutically acceptable salt thereof.

170. The chemical structure below: 【Chemistry 2】 (SEQ ID NO: 3336), or a pharmaceutically acceptable salt thereof.

171. The chemical structure below: 【Transformation 3】 (SEQ ID NO: 3337), or a pharmaceutically acceptable salt thereof.

172. The chemical structure below: 【Chemistry 4】 (SEQ ID NO: 3338), or a pharmaceutically acceptable salt thereof.

173. 173. The modified oligonucleotide of any one of claims 169 to 172, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

174. The chemical structure below: 【Transformation 5】 A modified oligonucleotide according to (SEQ ID NO: 3335).

175. The chemical structure below: 【Transformation 6】 A modified oligonucleotide according to (SEQ ID NO: 3336).

176. The chemical structure below: 【Transformation 7】 A modified oligonucleotide according to (SEQ ID NO: 3337).

177. The chemical structure below: 【Transformation 8】 A modified oligonucleotide according to (SEQ ID NO: 3338).

178. 178. A population of oligomeric compounds according to any one of claims 1 to 135, or a population of modified oligonucleotides according to any one of claims 169 to 177, said population being chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

179. 179. The population of claim 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

180. 179. The population of claim 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.

181. 179. The population of claim 178, wherein the population is chirally enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

182. 179. The population of claim 178, wherein the population is chirally enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

183. 179. The population described in claim 178, wherein the population is chirally enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

184. 179. The population of claim 178, wherein the population is chirally enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp configuration, the Sp configuration, and the Rp configuration in the 5' to 3' direction.

185. 168. A population of oligomeric compounds according to any one of claims 1-135, modified oligonucleotides according to any one of claims 169-177, oligomeric duplexes according to any one of claims 136-164, or antisense agents according to any one of claims 165-168, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

186. 166. A population of oligomeric compounds of any one of claims 1-135, modified oligonucleotides of any one of claims 169-177, oligomeric duplexes of any one of claims 136-164, or antisense agents of any one of claims 165-168, wherein all of the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotides are sterically random.

187. 187. A pharmaceutical composition comprising the oligomeric compound of any one of claims 1-135, the modified oligonucleotide of any one of claims 169-177, the oligomeric duplex of any one of claims 136-164, the antisense agent of any one of claims 165-168, or the population of any one of claims 178-186, and a pharmaceutically acceptable diluent.

188. 188. The pharmaceutical composition of claim 187, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

189. 189. The pharmaceutical composition of claim 188, wherein said pharmaceutical composition consists essentially of an oligomeric compound of any one of claims 1-135, a modified oligonucleotide of any one of claims 169-177, an oligomeric duplex of any one of claims 136-164, an antisense agent of any one of claims 165-168, or a population of any one of claims 178-186, and aCSF.

190. 189. The pharmaceutical composition of claim 188, wherein said pharmaceutical composition consists essentially of an oligomeric compound of any one of claims 1-135, a modified oligonucleotide of any one of claims 169-177, an oligomeric duplex of any one of claims 136-164, an antisense agent of any one of claims 165-168, or a population of any one of claims 178-186, and PBS.

191. 190. A method comprising administering to a subject an oligomeric compound of any one of claims 1-135, a modified oligonucleotide of any one of claims 169-177, an oligomeric duplex of any one of claims 136-164, an antisense agent of any one of claims 165-168, a population of any one of claims 178-186, or a pharmaceutical composition of any one of claims 187-190.

192. 192. The method of claim 191, wherein the subject has or is at risk of developing a synucleinopathy.

193. 192. The method of claim 191, wherein the subject has or is at risk of developing Parkinson's disease.

194. 192. The method of claim 191, wherein the subject has or is at risk of developing multiple system atrophy (MSA).

195. 192. The method of claim 191, wherein the subject has or is at risk of developing dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, neuropathic Gaucher disease, or Alzheimer's disease.

196. 190. A method of treating a synucleinopathy, comprising administering to a subject having or at risk of developing a synucleinopathy a therapeutically effective amount of the oligomeric compound of any one of claims 1-135, the modified oligonucleotide of any one of claims 169-177, the oligomeric duplex of any one of claims 136-164, the antisense agent of any one of claims 165-168, the population of any one of claims 178-186, or the pharmaceutical composition of any one of claims 187-190.

197. 197. The method of claim 196, wherein the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease.

198. 197. The method of claim 196, wherein the synucleinopathy is Parkinson's disease.

199. 197. The method of claim 196, wherein the synucleinopathy is multiple system atrophy (MSA).

200. 200. The method of any one of claims 196 to 199, wherein at least one symptom or feature of a synucleinopathy is ameliorated.

201. 201. The method of claim 200, wherein the symptom or characteristic is motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

202. 202. The method of any one of claims 196-201, wherein administering the oligomeric compound of any one of claims 1-135, the modified oligonucleotide of any one of claims 169-177, the oligomeric duplex of any one of claims 136-164, the antisense agent of any one of claims 165-168, the population of any one of claims 178-186, or the pharmaceutical composition of any one of claims 187-190 reduces or delays the onset or progression of motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucinations, or seizures.

203. 203. The method of any one of claims 191 to 202, wherein the oligomeric compound of any one of claims 1 to 135, the modified oligonucleotide of any one of claims 169 to 177, the oligomeric duplex of any one of claims 136 to 164, the antisense agent of any one of claims 165 to 168, the population of any one of claims 178 to 186, or the pharmaceutical composition of any one of claims 187 to 190 is administered to the central nervous system or systemically.

204. 204. The method of any one of claims 191 to 203, wherein the oligomeric compound of any one of claims 1 to 135, the modified oligonucleotide of any one of claims 169 to 177, the oligomeric duplex of any one of claims 136 to 164, the antisense agent of any one of claims 165 to 168, the population of any one of claims 178 to 186, or the pharmaceutical composition of any one of claims 187 to 190 is administered intrathecally.

205. The method of any one of claims 191 to 204, wherein the subject is a human.

206. 190. A method of reducing expression of SNCA in a cell, comprising contacting the cell with an oligomeric compound of any one of claims 1-135, a modified oligonucleotide of any one of claims 169-177, an oligomeric duplex of any one of claims 136-164, an antisense agent of any one of claims 165-168, a population of any one of claims 178-186, or a pharmaceutical composition of any one of claims 187-190.

207. 207. The method of claim 206, wherein the cell is a brain cell.

208. 208. The method of claim 206 or 207, wherein the cell is a neuron or an oligodendrocyte.

209. The method of any one of claims 206 to 208, wherein the cell is a human cell.

210. 192. Use of an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, a population according to any one of claims 178 to 186, or a pharmaceutical composition according to any one of claims 187 to 190 for the treatment of a synucleinopathy.

211. 192. Use of an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, a population according to any one of claims 178 to 186, or a pharmaceutical composition according to any one of claims 187 to 190 for the manufacture of a medicament for the treatment of a synucleinopathy.

212. The use of claim 210 or 211, wherein the synucleinopathy is Parkinson's disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuropathic Gaucher disease, or Alzheimer's disease.

213. 212. The use of claim 210 or 211, wherein the synucleinopathy is Parkinson's disease.

214. 212. The use of claim 210 or 211, wherein the synucleinopathy is multiple system atrophy (MSA).

Images