PKD-stabilizing oligonucleotides for the treatment of autosomal dominant polycystic kidney disease

Antisense oligonucleotides targeting the 3'UTR of PKD1 and PKD2 mRNA stabilize polycystin expression, addressing the lack of effective treatments for ADPKD by reducing cyst growth and delaying disease progression.

JP2026508247APending Publication Date: 2026-03-10BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-23
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Current treatments for autosomal dominant polycystic kidney disease (ADPKD) are lacking direct PKD1-potentiating drugs, leading to the relentless growth of fluid-filled cysts in the kidneys, causing renal enlargement and failure.

Method used

The use of antisense oligonucleotides (ASOs) that hybridize to the 3'UTR regulatory region of PKD1 and/or PKD2 mRNA, interfering with microRNA-17 binding to stabilize PKD1 and/or PKD2 mRNA expression, thereby increasing polycystin protein levels.

Benefits of technology

The ASOs effectively increase polycystin protein expression by 25% to 80%, reducing cyst growth and delaying disease progression in ADPKD models, including human primary cultures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026508247000001_ABST
    Figure 2026508247000001_ABST
Patent Text Reader

Abstract

The present disclosure provides, in part, antisense oligonucleotide strategies for increasing levels of polycystin 1 and / or polycystin 2 (PKD1 and / or PKD2). By targeting and inhibiting regulatory elements in the 3'UTR of PKD1 mRNA and / or PKD2 mRNA, the compositions of the disclosure can derepress PKD1 and / or PKD2 mRNA and increase expression of PKD1 and / or PKD2 protein. Additional methods for increasing expression of PKD1 and / or PKD2 in cells in vitro or in vivo are provided, as well as methods for treating autosomal dominant polycystic kidney disease using the antisense oligonucleotides provided herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 486,549, entitled "PKD-STABILIZING OLIGONUCLEOTIDE FOR THE TREATMENT OF AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY DISEASE," filed February 23, 2023, which is incorporated herein by reference in its entirety.

[0002] Government support approval This invention was made with government support under Grant No. DK079328 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Incorporation by reference to sequence listing This application has a Sequence Listing submitted in XML format via the Patent Center, which is incorporated herein by reference in its entirety. The CML file, created on February 22, 2024, is named 106546-786464_UTSD 4017_SequenceListing.xml and is approximately 47,000 bytes in size. [Background technology]

[0004] background 1. Field

[0005] The present disclosure relates to compositions and methods for increasing polycystin protein levels to treat autosomal dominant polycystic kidney disease. More specifically, the present disclosure provides antisense oligonucleotide strategies useful for targeting mRNA expression of PKD1 and / or PKD2.

[0006] 2. Consideration of related technologies

[0007] Autosomal dominant polycystic kidney disease (ADPKD) is a common genetic disorder affecting approximately 12.5 million people. Approximately 80% of ADPKD cases are due to mutations in the PKD1 gene. Despite its transformative potential, no direct PKD1-potentiating drugs are in clinical development. Individuals with ADPKD inherit one mutated PKD1 allele from an affected parent and one normal copy from an unaffected parent. The clinical hallmark of ADPKD is the relentless growth of numerous fluid-filled cysts in the kidneys, which replace normal parenchyma and, over decades, cause significant bilateral renal enlargement and renal failure. ADPKD results from heterozygous loss-of-function mutations in PKD1 (approximately 78% of cases) or PKD2 (approximately 15% of cases).

[0008] New methods and therapeutic agents are needed to treat this condition. Summary of the Invention [Means for solving the problem]

[0009] overview In certain embodiments of the present disclosure, antisense oligonucleotides (ASOs) are provided that hybridize to the 3'UTR regulatory region on the mRNA encoding polycystin 1 or polycystin 2 (PKD1 mRNA or PKD2 mRNA).

[0010] In certain embodiments, the ASOs provided herein can interfere with a microRNA that hybridizes to the 3'UTR regulatory region. In some embodiments, the microRNA is microRNA-17.

[0011] In various aspects, the 3'UTR regulatory region targeted by any of the ASOs of the present disclosure may contain a cis-inhibitory motif.

[0012] In any embodiment of the present disclosure, the ASO may stabilize PKD1 and / or PKD2 mRNA.

[0013] In any of the embodiments of the present disclosure, the ASO may contain at least 9 nucleotides. For example, in some embodiments, the ASO may contain 9 to 24 nucleotides. For example, in some embodiments, the ASO consists of 15 or 16 nucleotides.

[0014] In various embodiments, the ASO of the present disclosure can hybridize to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA). In some embodiments, the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 4-7.

[0015] In some embodiments, the ASO of the present disclosure can hybridize to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 2 (PKD2 mRNA). In some embodiments, the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD2 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 8-13.

[0016] In any of the foregoing or related embodiments, the ASO may comprise a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. For example, in some embodiments, the ASO has a nucleic acid sequence comprising or consisting of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0017] In any of the foregoing or related embodiments, the ASO may comprise at least one locked nucleic acid (LNA).

[0018] Also provided are pharmaceutical compositions comprising any of the ASOs provided herein. In some embodiments, the pharmaceutical composition further comprises a carrier or excipient.

[0019] Kits containing any of the pharmaceutical compositions provided herein are also provided.

[0020] A further aspect of the disclosure relates to a method for selectively increasing the expression of polycystin 1 and / or polycystin 2 in a cell, the method comprising delivering an ASO provided herein to the cell.

[0021] In various embodiments, the cells carry a mutation in at least one allele of the PKD1 and / or PKD2 gene and have reduced baseline expression of polycystin 1 and / or polycystin 2 compared to cells that do not carry the mutation. In further embodiments, delivering an ASO provided herein can increase expression of polycystin 1 and / or polycystin 2 in the cells. For example, in various embodiments, expression of polycystin 1 and / or polycystin 2 can be increased by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% compared to baseline.

[0022] In various aspects, the cell can be in vitro. In other aspects, the cell can be in vivo. In various aspects, the cell can be human or murine.

[0023] In a further aspect of the present disclosure, there is provided a method of treating autosomal dominant polycystic kidney disease (ADPKD) in a subject in need thereof, the method comprising administering a pharmaceutically effective amount of an antisense oligonucleotide (ASO) provided herein.

[0024] In various embodiments, the ASO can be administered systemically (e.g., orally, intravenously, subcutaneously, or intraperitoneally).

[0025] In various embodiments, the ASO can be administered as a pharmaceutical composition.

[0026] In any of the foregoing or related embodiments, the subject may be a human. [Brief explanation of the drawings]

[0027] [Figure 1A-B]Figures 1A-1J show how Pkd1 mRNA is cis-repressed via its 3'-UTR miR-17 binding motif. Figure 1A shows a schematic of the CRISPR / Cas9 approach used to delete the miR-17 motif from the Pkd1 3'-UTR (Pkd1Δ17). Figure 1B shows a representative immunoblot showing the PKDR product obtained after amplification of tail DNA from mice with the indicated genotypes. The lower band represents the Δ17 deletion. n = 3 for all genotypes. Figure 1C shows the 3'-UTR nucleotide sequences of the wild-type (WT) and Pkd1Δ17 alleles. The miR-17 binding motif and sgRNA PAM site are highlighted in bold green and pink, respectively. The dashed pink line indicates the deleted nucleotide in Pkd1Δ17. Sanger sequencing chromatogram showing the nucleotide sequence of Pkd1Δ17. Figure 1D shows normal kidney histology in 8-week-old Pkd1+ / + and Pkd1Δ17 / Δ17 mice, showing H&E staining, Lotus Tetragonolobus lectin labeling (LTL, a proximal tubule marker), Tamm-Horsfall protein immunostaining (THP, a loop of Henle marker), and Dolichos biflorus agglutinin labeling (DBA, a collecting duct marker). Figure 1E-1F show normal levels of kidney weight to body weight (KW / BW) and serum blood urea nitrogen (BUN) in 8-week-old Pkd1+ / + and Pkd1Δ17 / Δ17 mice. Figure 1G-1H show images and cyst index quantification of E13.5 Pkd1+ / +, Pkd1Δ17 / +, and Pkd1Δ17 / Δ17 kidneys grown for 4 days in culture medium containing vehicle, 100 μM cAMP, or 100 μM cAMP + 250 μM SAM. Figure 1I shows representative immunoblots showing PKD1 expression in Pkd1+ / +, Pkd1Δ17 / +, and Pkd1Δ17 / Δ17 ex vivo kidneys treated with vehicle, cAMP, or cAMP + SAM. Actin is used as a loading control. Figure 1J shows images of E15.5 Pkd1+ / +, Pkd1Δ17 / +, and Pkd1Δ17 / Δ17 kidneys grown for 4 days in culture medium containing vehicle, cAMP, or cAMP + SAM. Allele-specific qRT-PKDR showing the amount of Pkd1 mRNA produced by the wild-type (+) and Δ17 alleles in Pkd1Δ17 / + kidneys (n=5) is shown. [Figure 1C] Same as above. [Figure 1D] Same as above. [Figure 1E-G] Same as above. [Figure 1H-J] Same as above.

[0028] [Figure 2A-C]Figures 2A-J show how monoallelic Pkd1 derepression alleviates polycystic kidney disease. Figure 2A shows immunoblots demonstrating reduced PKD1 expression in Pkd1RC / - cells compared to Pkd1RC / + cells. PKD1 levels were restored in Pkd1RCΔ17 / - cells. #1 and #2 refer to two independent Pkd1RCΔ17 / - clonal cell lines. Actin was used as a loading control. n = 3 biologically independent samples. Figures 2B-C show representative images and quantification demonstrating increased 3D cyst size in Pkd1RC / - cells compared to Pkd1RC / + cells cultured in Matrigel. Cyst size was normalized in Pkd1RCΔ17 / - cells. n = 300 cysts pooled from three independent experiments. Figure 2D shows a heatmap depicting proliferation, as assessed by Alamar Blue, of Pkd1RC / - and Pkd1RCΔ17 / - cells in the absence (-) or presence (+) of 100 μM cAMP, 17 mM glucose, or 100 μM SAM. n = 8, each circle represents a biological replicate. Figure 2E shows representative images demonstrating Mito-tracker labeling and anti-PKDreb1 immunostaining in Pkd1RC / +, Pkd1RC / -, and Pkd1RCΔ17 / - cells. n = 3 biologically independent experiments. Figure 2F shows whole kidneys and H&E-stained kidney sections from 18-day-old mice with the indicated genotypes. Data from three founder offspring are shown separately. Founder #1: Pkd1RC / + (n = 7), Pkd1RCΔ17 / + (n = 7), Pkd1RC / - (n = 8), and Pkd1RCΔ17 / - (n = 7). Founder #2: Pkd1RC / + (n = 15), Pkd1RCΔ17 / + (n = 19), Pkd1RC / - (n = 15), and Pkd1RCΔ17 / - (n = 17). Founder #3: Pkd1RC / + (n = 6), Pkd1RCΔ17 / + (n = 6), Pkd1RC / - (n = 8), and Pkd1RCΔ17 / - (n = 8). Figure 2G shows immunoblots showing PKD1 expression in the kidneys of 18-day-old mice with the indicated genotypes derived from the three founders. Actin was used as a loading control. n = 3 independent kidney samples for each genotype and founder.Figures 2H-I show the KW / BW ratio and BUN levels in mice with the indicated genotypes. Data from all three founders are shown: Founder #1 (blue circles), Founder #2 (light pink circles), and Founder #3 (orange circles). Figure 2J shows paired-end RNA-seq data demonstrating RC allele usage in Pkd1RC / - (gray circles, n = 5), Pkd1RCΔ17 / - Founder #2 (pink circles, n = 5), and Pkd1RCΔ17 / - Founder #3 (orange circles, n = 5). Error bars indicate SEM. Statistical analysis: one-way ANOVA, Tukey's multiple comparison test (c, h, i, j). Source data are provided as the Source Data file. [Figure 2D-E] Same as above. [Figure 2F-G] Same as above. [Figure 2H-I] Same as above. [Figure 2J] Same as above.

[0029] [Figure 3A]Figures 3A-3D show how Pkd1 derepression attenuates cyst pathogenic events and disease progression. Figure 3A shows whole kidney images and H&E-stained kidney sections from 18-week-old mice with the indicated genotypes derived from founder #3. miR-17 motif deletion was associated with sustained benefit and suppressed long-term PKD progression. n = 3 (Pkd1RC / +), n = 3 (Pkd1RCΔ17 / +), n = 8 (Pkd1RC / -), and n = 7 (Pkd1RCΔ17 / -). Figure 3B shows KW / BW, BUN, and serum creatinine (Scr) levels in 18-week-old offspring of founder #3. Figure 3C shows a heatmap depicting global mRNA expression profiles of kidneys from 18-day-old mice with the indicated genotypes. mRNAs that were dysregulated in Pkd1RC / - compared with Pkd1RC / + kidneys but showed improved expression in Pkd1RCΔ17 / - kidneys were selected for visualization. #3 = Founder #3; #2 = Founder #2. n = 3 (Pkd1RC / +), n = 3 (Pkd1RCΔ17 / + Founder 2), n = 3 (Pkd1RCΔ17 / + Founder 3), n = 5 (Pkd1RC / -), n = 5 (Pkd1RCΔ17 / - Founder 2), and n = 5 (Pkd1RCΔ17 / - Founder 3). Figure 3D shows representative images showing phospho-histone-H3 (pHH3), mannose receptor type C 1 (MRC1), or PKDreb1 immunostaining in kidney sections from 18-day-old and 18-week-old Pkd1RC / - (n=5) and Pkd1RCΔ17 / - (n=5) mice. Sections were co-labeled with DBA to mark collecting duct-derived cysts. Error bars indicate SEM. Statistical analysis: one-way ANOVA, Tukey's multiple comparison test (b). Source data is provided as a Source Data file. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above.

[0030] [Figure 4A-C]Figures 4A-4K provide data showing that Pkd2 derepression delays cyst growth in a Pkd1 mutant model. Figure 4A shows immunoblots demonstrating polycystin-2 (PKD2) expression in cells with the indicated genotypes. Deletion of the miR-17 motif from the Pkd2 3'-UTR results in higher PKD2 expression in Pkd1RC / - cells. Actin is used as a loading control. #1 and #2 refer to two independent Pkd1RC / -;Pkd2Δ17 / Δ17 cell lines. n = 3 biologically independent samples for both clones. Figures 4B-4C show representative images and quantification of 3D cyst size in cells with the indicated genotypes grown in Matrigel culture. n = 300 cysts pooled from three independent experiments. Figure 4D shows representative images demonstrating mitotracker labeling and anti-PKDreb1 immunostaining in cells with the indicated genotypes. n = 3 biologically independent experiments. Figure 4E shows a representative heatmap showing proliferation, assessed by Alamar Blue, of Pkd1RC / - and Pkd1RC / -;Pkd2Δ17 / Δ17 cells in the absence (-) or presence (+) of cAMP, glucose, or SAM. n = 8, each circle represents a biological replicate. Figure 4F shows H&E-stained kidney sections from 18-day-old mice with the indicated genotypes: n = 3 (Pkd1RC / +;Pkd2+ / +), n = 3 (Pkd1RC / +;Pkd2Δ17 / Δ17), n = 8 (Pkd1RC / -;Pkd2+ / +), and n = 11 (Pkd1RC / -;Pkd2Δ17 / Δ17). Figure 4G shows immunoblots demonstrating PKD2, Yap1, and c-Myc expression in the kidneys of 18-day-old mice with the indicated genotypes (n = 3 for each group). Figures 4H-4I show KW / BW and serum creatinine levels in 18-day-old mice with the indicated genotypes. Figure 4J shows representative images demonstrating pHH3 and MRC1 immunostaining in kidney sections from 18-day-old mice with the indicated genotypes (n = 3 for each group). Figure 4K shows a heatmap showing differential mRNA expression in the kidneys of 18-day-old mice with the indicated genotypes (n = 3).mRNAs that were dysregulated in Pkd1RC / - compared to Pkd1RC / + kidneys but showed improved expression in Pkd1RC / -;Pkd2Δ17 / Δ17 kidneys were selected for heatmap visualization. Error bars indicate SEM. Statistical analysis: One-way ANOVA, Tukey's multiple comparison test (b, h, and i). [Figure 4D-E] Same as above. [Figure 4F-G] Same as above. [Figure 4H-I] Same as above. [Figure 4J] Same as above. [Figure 4K] Same as above.

[0031] [Figure 5A-B]Figures 5A-5N show data demonstrating that acute Pkd1 and Pkd2 derepression attenuates PKD. Figures 5A-5B show qRT-PKDR and immunoblot analyses showing Pkd1 / PKD1 and Pkd2 / PKD2 expression in Pkd1RC / - cells transfected with vehicle (PBS), 100 μM control oligonucleotide, or 100 μM RGLS4326, illustrating one aspect of the present subject matter, according to one embodiment. Figure 5C shows images and quantification of 3D cyst size in Pkd1RC / - cells cultured in Matrigel before (day 4) or after (day 7) transfection with vehicle (PBS), 100 μM control oligonucleotide, or 100 μM RGLS4326. Figure 5D shows H&E-stained kidney sections from 18-day-old Pkd1RC / - mice injected with either vehicle (PBS), 20 mg / kg control oligonucleotide, or 20 mg / kg RGLS4326 at P10, P11, P12, and P16. H&E-stained kidney sections from untreated 18-day-old wild-type mice are shown for reference. Figures 5E-5G show KW / BW, BUN, and serum creatinine levels in 18-day-old Pkd1RC / - mice treated with vehicle (PBS), 20 mg / kg control oligonucleotide, or 20 mg / kg RGLS4326. Data from untreated 18-day-old wild-type mice are shown as a reference. Figure 5H shows H&E-stained kidney sections from 26-day-old Pkd1RC / - mice injected with 20 mg / kg control oligonucleotide or 20 mg / kg RGLS4326 at P16 and P17. H&E-stained kidney sections from genetically matched but untreated 16-day-old Pkd1RC / - mice are shown to demonstrate disease before treatment began. Figures 5I-5K show KW / BW, BUN, and serum creatinine levels in untreated 16-day-old or treated 26-day-old Pkd1RC / - mice. Figures 5L-5N show data from an experiment in which Pkd1RC / - mice were injected with vehicle, 20 mg / kg RGLS4326, or 20 mg / kg control oligonucleotide at P16 and P17. These mice then received the respective treatment regimen weekly until 18 weeks of age.A fourth cohort of Pkd1RC / - mice received 20 mg / kg RGLS4326 treatment on P16 and P17, and then bimonthly thereafter. Figure 5L shows H&E-stained kidney sections from 125-day-old Pkd1RC / - mice treated with vehicle or RGLS4326. Figure 5M shows Kaplan-Meier survival curves for Pkd1RC / - mice in the four treatment groups. Survival of untreated wild-type mice is shown as a reference. Figure 5N shows the KW / BW ratios for mice surviving up to 125 days. Wild-type mice: n = 3; Pkd1RC / - mice: n = 2 (vehicle treatment), n = 5 (weekly RGLS4326 treatment), and n = 7 (biannual RGLS4326 treatment). Error bars indicate SEM. Statistical analysis: one-way ANOVA, Tukey's multiple comparison test (a, c, e, k, and n); Mantel-Cox (m). [Figure 5C] Same as above. [Figure 5D-E] Same as above. [Figure 5F-G] Same as above. [Figure 5H-I] Same as above. [Figure 5J-K] Same as above. [Figure 5L-N] Same as above.

[0032] [Figure 6A-B]Figures 6A-6H show data demonstrating that PKD1Δ17 or PKD2Δ17 reduces 3D cyst growth in primary human ADPKD cultures. Specifically, CRISPR / Cas9 editing was used to delete the miR-17 motif from the PKD1 3'-UTR (PKD1Δ17) or PKD2 3'-UTR (PKD2Δ17) in primary ADPKD cultures from four human donors (#1-#4). Figures 6A-6B show immunoblots demonstrating higher PKD1 expression in PKD1Δ17 ADPKD cultures and higher PKD2 expression in PKD2Δ17 ADPKD cultures compared to the respective unedited (UE) parental ADPKD cultures. Protein bands are 460 kDa (Figure 6A) and 110-120 kDa (Figure 6B). Actin is used as a loading control. Figures 6C-6F show images and quantification demonstrating reduced cyst size in PKD1Δ17 and PKD2Δ17 ADPKD cultures compared to their respective unedited (UE) parental ADPKD cultures. Figures 6G-6H show images demonstrating higher mitotracker labeling (red) and reduced PKDREB1 immunostaining (green) in PKD1Δ17 and PKD2Δ17 ADPKD cultures compared to their respective unedited parental ADPKD cultures. n = 3 biologically independent experiments for each cell line. Error bars represent SEM. Statistical analysis: two-tailed Student's t-test (e-f). Source data are provided as a Source Data file. [Figure 6C-D] Same as above. [Figure 6E-F] Same as above. [Figure 6G-H] Same as above.

[0033] [Figure 7A] FIG. 7A shows H&E-stained kidney sections from 6-week-old Pkd1+ / + and Pkd1Δ17 / Δ17 mice.

[0034] [Figure 7B-C]Figures 7B-7C show kidney weight-to-body weight (KW / BW) ratios and BUN levels in 6-week-old Pkd1+ / + and Pkd1Δ17 / Δ17 mice. Error bars indicate SEM. Statistical analysis: two-tailed Student's t-test.

[0035] [Figure 7D] Figure 7D shows immunoblots showing PKD1 expression in Pkd1+ / +, Pkd1- / - cell lines and kidneys from 6- or 18-week-old Pkd1+ / + and Pkd1Δ17 / Δ17 mice (n = 5 for each genotype). Lysates from Pkd1- / - cells served as a negative control and showed no PKD1 expression.

[0036] [Figure 8] Figures 8A-8B show data for validation of the 7E12 PKD1 antibody by testing in Pkd1+ / + and Pkd1- / - collecting duct cell lines. Figure 8A shows qRT-PKDR, demonstrating that Pkd1- / - cells do not express Pkd1 mRNA. Figure 8B shows an immunoblot demonstrating the absence of full-length PKD1 protein in the Pkd1- / - cell line. n=3 biologically independent samples from the indicated cell lines.

[0037] [Figure 9] Figure 9 shows data demonstrating that miR-17 family expression declines with postnatal kidney maturation. Microarray signal intensity values ​​for miRNAs belonging to the miR-17 family, miR-17, miR-20a, miR-20b, miR-106a, miR-106b, or miR-93, in mouse kidneys at ages P2, P7, P14, P21, and P35. miR-17 family members show an age-dependent decrease in expression. n=4 mouse kidneys at P2, and n=3 mouse kidneys at P7, P14, P21, or P35. Error bars represent SEM. Statistical analysis: One-way ANOVA, test for linear trend.

[0038] [Figure 10]Figures 10A-10C show data demonstrating that Pkd1 is cis-inhibited via its miR-17 3'-UTR motif. Allele-specific qRT-PKDR analysis showing the amount of Pkd1 mRNA produced by the wild-type (+) and Δ17 alleles in ex vivo kidney cultures from Pkd1Δ17 / + mice treated with vehicle (Figure 10A), c-AMP (Figure 10B), or c-AMP + SAM (Figure 10C). The Pkd1Δ17 allele produced more mRNA transcripts compared to the Pkd1+ allele. This difference was even more pronounced in the presence of c-AMP. n=5 ex vivo kidney cultures. Statistical analysis: paired t-test. Error bars indicate SEM.

[0039] [Figure 11] Figures 11A-11B relate to the characterization of CRISPR-edited Pkd1RC / - cell lines. Figure 11A shows the PKDR products obtained after amplifying DNA (encoding the Pkd1 3'UTR segment) from the parental and CRISPR-edited cell lines. The lower band indicates the Δ17 / - genotype. Figure 11B shows a graphical representation of Sanger sequencing results from the Δ17 / - band of each clone, confirming the deletion of the miR-17 motif from both Pkd1 alleles.

[0040] [Figure 12A-B]Figures 12A-12C relate to the phenotypic characterization of CRISPR-edited Pkd1RCΔ17 cell lines. Figure 12A shows an Alamar Blue assay demonstrating reduced proliferation of Pkd1 clones lacking the miR-17 motif compared to the Pkd1RC / - parental cell line at 12 hours (n=9 biologically independent experiments). Figure 12B shows Mitotracker images and IF staining of PKDreb1, demonstrating restored mitochondrial membrane potential (red) and reduced PKDreb1 (green) expression in Pkd1RCΔ17 / - clone #2 compared to the parental cell line (n=3 biologically independent experiments). Figure 12C shows Western blot characterization of both Pkd1RCΔ17 / - cell lines, demonstrating reduced expression of the pro-cystic genes Yap1, PKDreb1, and c-Myc compared to the parental Pkd1RC / - cells. As an appropriate control, PKD2 expression remained unchanged. Actin is used as a loading control. n = 3 biologically independent experiments. Error bars indicate SEM. Statistical analysis: One-way ANOVA, Tukey's multiple comparison test (a). [Figure 12C] Same as above.

[0041] [Figure 13]Figures 13A-13B show PKD1 derepression in CRISPR-edited Pkd1RCΔ17 / - cell lines and mouse kidneys, where two independent PKD1 antibodies (7E12 from Santa Cruz and E8-8C3C10 from the University of Maryland) were used to examine PKD1 expression in the Pkd1RCΔ17 / - cell line and kidneys. The 7E12 antibody detects the full-length 462 kDa PKD1, while the E8-8C3C10 antibody detects the 140 kDa c-terminal fragment (CTF) of the PKD1 protein. Figure 13A shows an exemplary immunoblot demonstrating full-length PKD1 and PKD1-CTF expression in Pkd1RCΔ17 / - clones #1 and #2 compared to control Pkd1RC / + and Pkd1RC / - clones. n=3 biologically independent experiments. Figure 13B shows immunoblots using E8 antibody showing PKD1 expression in the kidneys of mice with the indicated genotypes. Analysis of offspring from all three founders (#1, #2, #3) is shown. PKD1 Western blots using 7E12 antibody are shown in Figure 2. Both antibodies show consistent results in cells and kidney tissue. Actin is used as a loading control. n=3 biologically independent kidney samples for each genotype.

[0042] [Figure 14] Figure 14 shows a diagram of Sanger sequencing of tail DNA from three CRISPR-edited founders for the characterization of CRISPR-edited Pkd1RC / RC mice. Founders #1 and #2 have 108-bp and 53-bp deletions, respectively, including the miR-17 motif. Founder #3 also lacked the miR-17 motif but acquired a 72-bp insertion (blue), resulting in a net deletion of 18 base pairs in the 3'-UTR sequence.

[0043] [Figure 15A-B]Figures 15A-15F present data demonstrating that monoallelic Pkd1 derepression suppresses disease progression, in which a cohort of offspring derived from founder #2 was prospectively monitored until 8 weeks of age. Figure 15A shows H&E-stained kidney sections from mice of the indicated genotypes that survived to 8 weeks of age: Pkd1RC / + (n = 3), Pkd1RCΔ17 / + (n = 3), Pkd1RC / - (n = 4), and Pkd1RCΔ17 / - (n = 16). Figure 15B shows Kaplan-Meier survival curves for mice with the indicated genotypes. Figures 15C-15E show KW / BW, serum creatinine (Scr), and BUN levels for surviving 8-week-old mice with the indicated genotypes. Figure 15F shows immunoblots for Yap1 and c-Myc expression in the kidneys of 18-day-old mice with the indicated genotypes (n = 3 for all genotypes). Actin was used as a loading control. Error bars indicate SEM. Statistical analysis: one-way ANOVA, Tukey's multiple comparison test (ce); log-rank Mantel-Cox (b). [Figure 15C-F] Same as above.

[0044] [Figure 16] Figures 16A-B relate to the characterization of Pkd1RC / - cell lines lacking the miR-17 motif from the Pkd2 3'-UTR. Figure 16A shows the PKDR products obtained after amplifying DNA (encoding the Pkd2 3'UTR segment) from the parental and CRISPR-edited cell lines. The lower band indicates the Δ17 genotype. Figure 16B shows a graphical representation of the Sanger sequencing results from the Δ17 / - bands of each clone, confirming the deletion of the miR-17 motif from both Pkd2 alleles.

[0045] [Figure 17]Figures 17A-17C relate to the phenotypic characterization of CRISPR-edited Pkd1RC / -;Pkd2Δ17 / Δ17? cell lines. Figure 17A shows qRT-PKDR analysis demonstrating Pkd2 derepression in both Pkd1RC / -;Pkd2Δ17 / Δ17? clones #1 and #2 compared to the parental Pkd1RC / - cell line. n=3 biologically independent samples from the indicated cell lines. Figure 17B shows Western blot characterization demonstrating reduced expression of the pro-cyst genes Yapl, Mettl3, c-Myc, and PKDreb1 in both Pkd1RC / -;Pkd2Δ17 / Δ17? clones compared to the parental Pkd1RC / - cell line. Correlatively, PKD1 expression remained unchanged. Actin is used as a loading control. n=3 biologically independent samples from the indicated cell lines. Figure 17C shows Mitotracker images and IF staining of PKDreb1, demonstrating restored mitochondrial membrane potential (red) and reduced PKDreb1 (green) expression, respectively, in Pkd1RC / -;Pkd2Δ17 / Δ17 clone #2 compared to the parental cell line (n=3 biologically independent samples from the indicated cell lines).

[0046] [Figure 18] Figure 18 shows CRISPR editing and characterization of Pkd2Δ17 mice (see Figure 1A), which lack the miR-17 motif in the Pkd2 3'-UTR. It shows a schematic and Sanger sequencing results of the PKDR product from tail DNA of founder mice showing a 139 base pair deletion from the Pkd2 3'-UTR, including the miR-17 motif.

[0047] [Figure 19A-C]Figures 19A-19E show the phenotypic characterization of RGLS4326 treatment on Pkd1RC / - cells transfected with 100 μM RGLS4326, 100 μM control oligonucleotide, or vehicle control. After 72 hours, cells were seeded equally into 96-well plates for 12 hours for Alamar Blue assay or placed in Matrigel for 7 days for 3D cyst assay. Figure 19A shows the reduced proliferation of Pkd1RC / - cells treated with RGLS4326 compared to cells treated with control oligonucleotide or vehicle control. n=9 biologically independent experiments for each treatment group. Figures 19B-19C show representative images, and quantification demonstrates the reduced cyst size of RGLS4326-treated cells compared to vehicle- or control oligonucleotide-treated Pkd1RC / - cells. No significant changes in cyst size were observed between the vehicle control and control oligonucleotide-treated groups. Figure 19D shows immunoblots demonstrating the expression of Yapl, c-Myc, and PKDreb1 in Pkd1RC / - cells transfected with vehicle, control oligonucleotide, or RGLS4326. Actin is a loading control. n = 3 biologically independent experiments for each treatment group. Figure 19E shows mitotracker labeling and anti-PKDreb1 immunostaining of Pkd1RC / - cells transfected with vehicle, control oligonucleotide, or RGLS4326. n = 3 biologically independent experiments for each treatment group. Error bars represent SEM. Statistical analysis: one-way ANOVA, Tukey's multiple comparison test (a, c). [Figure 19D-E] Same as above.

[0048] [Figure 20A-C]Figures 20A-20G characterize RGLS4326 treatment of CRISPR-edited Pkd1RCΔ17 / - or Pkd1RC / -;Pkd2Δ17 / Δ17?? cell lines. Figures 20A-20C show Pkd1RC / - (Figure 20A), Pkd1RCΔ17 / - clone #1 (Figure 20B), and Pkd1RCΔ17 / - clone #2 (Figure 20C) cells were transfected with 100 uM RGLS4326 or vehicle control. After 72 hours, proteins from these cells were analyzed by Western blot to assess PKD1 and PKD2 expression. Figure 20A: PKD1 and PKD2 expression increased in Pkd1RC / - cells upon RGLS4326 treatment. Figures 20B-20C: No additional PKD1 upregulation was observed in Pkd1RCΔ17 / - clones #1 or #2 after RGLS4326 treatment, indicating that this oligo mediates PKD1 derepression via the miR-17 motif in the Pkd1 3'-UTR. As expected, PKD2 expression increased in Pkd1RCΔ17 / - clones #1 and #2 with RGLS4326 treatment. Actin was used as a loading control. Quantification of the Western blots is shown in the graphs below (n = 3 biologically independent samples from each of the indicated cell lines and treatment groups). Figures 20D-20E show representative images and quantification showing cyst size in vehicle- or 100 μM RGLS4326-treated Pkd1RC / -, Pkd1RCΔ17 / - (clone #1), or Pkd1RCΔ17 / - (clone #2). Figures 20F-G show representative images and quantification of cyst size in vehicle- or 100 μM RGLS4326-treated Pkd1RC / -, Pkd1RC / -;Pkd2Δ17 / Δ17 (clone #1), or Pkd1RC / -;Pkd2Δ17 / Δ17 (clone #2). Error bars indicate SEM. Statistical analysis: two-tailed Student's t-test (a-c); one-way ANOVA, Tukey's multiple comparison test (e and g). [Figure 20D-E] Same as above. [Figure 20F-G] Same as above.

[0049] [Figure 21A] Figures 21A-C relate to the characterization of long-term RGLS4326 treatment in Pkd1RC / - mice. Figure 21A shows low- and high-magnification images of H&E-stained kidneys from P125-day-old Pkd1RC / - mice treated with vehicle or RGLS4326. The high-magnification image is from the area marked by the black inset on the low-magnification image. Substantially preserved histology was observed in the kidneys of RGLS4326-treated Pkd1RC / - mice compared to vehicle. Figure 21B shows BUN levels in Pkd1RC / - mice treated with vehicle (gray, n = 1) or RGLS4326 (blue shades, n = 6). BUN from age-matched non-cystic controls (brown, n = 4) is shown as a reference for normal values. Comparisons are limited because blood for renal function measurements was available from only one of the two surviving vehicle-treated Pkd1RC / - mice. BUN levels are not available for control oligo-treated Pkd1RC / - mice because none of the mice survived to the end of the study at day 125. Figure 21C shows IF staining demonstrating reduced expression of fibrosis markers, α-SMA and vimentin, in the kidneys of Pkd1RC / - mice treated with RGLS4326 compared to vehicle (n = 2 for vehicle, n = 3 for each treatment group). Statistical analysis: ANOVA, Tukey's multiple comparison test (b). [Figure 21B] Same as above. [Figure 21C] Same as above.

[0050] [Figure 22A-B]Figures 22A-22D relate to the genotyping of CRISPR-edited primary human ADPKD cultures. Figures 22A-22B show PKDR products obtained after amplifying DNA encoding the 3'UTR segment of PKD1 (Figure 22A) or PKD2 (Figure 22B) from unedited parental and CRISPR-edited human ADPKD cultures. Arrows indicate the PKDR bands resulting from the miR17 motif deletion in the PKD1 (Figure 22A) and PKD2 (Figure 22B) genes. Figures 22C-22D show Sanger sequencing of the PKDR products (black rectangles) aligned with the human genome (purple rectangles). The deleted region contains the miR-17 binding site (green rectangle). [Figure 22C-D] Same as above.

[0051] [Figure 23] Figures 23A-B show data demonstrating reduced proliferation in PKD1Δ17 and PKD2Δ17 edited ADPKD cultures, showing Alamar Blue-assessed proliferation of ADPKD donor cultures CRISPR-edited to remove the miR-17 motif in either the PKD1 (pink, Figure 23A) or PKD2 (green, Figure 23B) gene compared to the respective unedited (UE) parental controls (gray). Error bars indicate SEM. n indicates biologically independent experiments for each cell line and treatment. Statistical test: two-tailed Student's t-test, separate for each cell line.

[0052] [Figure 24A] FIG. 24A is a diagrammatic illustration of a PKD1 stabilizing oligo that binds to the 3′ untranslated region (UTR) of PKD1 mRNA, preventing engagement of miR-17.

[0053] [Figure 24B] FIG. 24B shows the alignment of the PKD1 3′UTR and the conserved track, annotated with the location of the miR-17 seed (gray) and PKD1 oligo target region (green).

[0054] [Figure 24C] Figure 24C is a plot showing the luminescence activity measured 72 hours after transfection in IMCD3 cells transfected with the pls-PKD1-3'-UTR reporter plasmid, microRNA mimic (sc or miR-17), and scrambled (ctl) or Pkd1 oligos. The luminescence activity measured 72 hours after transfection reveals an increased signal in cells treated with PKD1 oligos.

[0055] [Figure 24D] FIG. 24D is a plot of the results of qRT-PKDR for Pkd1 mRNA spanning exons 4-5 in scrambled oligo and Pkd1 oligo treated mouse kidney epithelial cells.

[0056] [Figure 24E] FIG. 24E is a plot showing that Pkd1 oligo binding prevents cDNA synthesis at the Pkd1-3′-UTR binding site as evidenced by the lack of Pkd1 3′-UTR transcript detection in Pkd1 oligo-treated cells.

[0057] [Figure 24F] FIG. 24F is an exemplary immunoblot showing increased polycystin 1 (PKD1) in Pkd1 oligo-treated kidney epithelial cells.

[0058] [Figure 25A] Figure 25A shows the luminescence activity measured from Pkd1RC / - cells transfected with the Pls-PKD1-3'-UTR reporter plasmid and Pkd1 or scrambled oligos. Luminescence activity measured after 72 hours indicates increased Pkd1-3'-UTR activity in Pkd1 oligo-treated cells.

[0059] [Figure 25B]FIG. 25B shows the levels of Pkd1 mRNA transcripts spanning exons 4-5 (left) or Pkd1 3′-UTR transcripts (right) in Pkd1RC / − cells transfected with Pkd1 oligos or scrambled oligos.

[0060] [Figure 25C-D] Figures 25C-25D show plots of Pkd1 (Figure 25C) and c-Myc (Figure 25D) mRNA transcript abundance in Pkd1RC / - cells transfected with scrambled or Pkd1 oligos and treated with actinomycin to inhibit transcription 48 hours after transfection. Samples were taken at 0, 4, and 8 hours to measure mRNA transcript abundance. Pkd1 mRNA degradation is inhibited by Pkd1 oligos. c-Myc transcripts are equally degraded in both scrambled and Pkd1 oligo-treated samples.

[0061] [Figure 25E-F] Figures 25E-25F show representative fluorescence images (Figure 25F) and quantification (Figure 25E) of Pkd1 mRNA abundance in cells transfected with pDAC565 plasmids carrying guide RNAs targeting exon 4 of the scrambled (Sc) or Pkd1 gene (Pkd1RC / -).

[0062] [Figure 25G-H] Figures 25G-H show representative fluorescence images (Figure 25G) and quantification (Figure 25H) of Pkd1 mRNA abundance in cells transfected with scrambled (Sc) or dDAC565 plasmids carrying Pkd1 oligos and guide RNAs targeting exon 4 of the Pkd1 gene (Pkd1 oligos).

[0063] [Figure 25I]FIG. 25I shows Western blot and quantification demonstrating increased polycystin 1 protein (PKD-1) expression in Pkd1 oligo-treated Pkd1RC / - cells (pink) compared to scramble-treated cells (purple).

[0064] [Figure 25J] FIG. 25J shows phase contrast images and quantification demonstrating reduced cyst size in Pkd1 oligo-treated Pkd1RC / − cells (pink) compared to scramble-treated cells (purple).

[0065] [Figure 25K] FIG. 25K shows representative fluorescence images of Pkd1 oligo-treated cells showing increased mitochondrial activity as measured by MitoTracker signal (red) and decreased PKDREB (green) expression.

[0066] [Figure 26A] FIG. 26A shows a representative immunoblot demonstrating increased PKD1 expression of the remaining PKD1 allele in three immortalized human ADPKD kidney epithelial cell lines treated with Pkd1 oligos.

[0067] [Figure 26B] Figure 26B shows phenotypic and molecular analysis of two immortalized human ADPKD kidney epithelial cell lines treated with Pkd1 oligos, showing decreased cyst size, increased MitoTracker signal (red), and decreased PKDREB expression (green).

[0068] [Figure 27A] Figure 27A shows, from left to right, plots showing the levels of Pkd1 full transcript (far left), Pkd1 3-UTR transcript (center), and representative immunoplots showing polycystin 1 (PC1) expression (far right) in mouse Pkd1RC / - cells treated with scrambled (SC), Pkd1 oligo #1 (1), or Pkd1 oligo #2 (2).

[0069] [Figure 27B] Figure 27B shows, from left to right, plots showing the levels of Pkd1 full transcript (far left), Pkd1 3-UTR transcript (center), and representative immunoplots showing polycystin 1 (PC1) expression (far right) in a human ADPKD cell line (donor 3) treated with scrambled (SC), Pkd1 oligo #1 (1), or Pkd1 oligo #2 (2).

[0070] [Figure 27C] Figure 27C shows, from left to right, plots showing the levels of Pkd1 full transcript (far left), Pkd1 3-UTR transcript (center), and representative immunoplots showing polycystin 1 (PC1) expression (far right) in a human ADPKD cell line (donor 4) treated with scrambled (SC), Pkd1 oligo #1 (1), or Pkd1 oligo #2 (2).

[0071] [Figure 27D] Figure 27D shows, from left to right, plots showing the levels of Pkd1 full transcript (far left), Pkd1 3-UTR transcript (center), and representative immunoplots showing polycystin 1 (PC1) expression (far right) in a human ADPKD cell line (WT9-7) treated with scrambled (SC), Pkd1 oligo #1 (1), or Pkd1 oligo #2 (2).

[0072] [Figure 28] Figure 28 shows plots showing PKD2 expression in mIMCD3 cells treated with scrambled miR ("sc") or miR-17 ("17") together with scrambled oligo ("sc") or Pkd2 oligo ("Pkd2", SEQ ID NO: 3). DETAILED DESCRIPTION OF THE INVENTION

[0073] Detailed Description The following detailed description refers to the accompanying drawings, which illustrate various aspects of the present disclosure. The drawings and description are intended to explain aspects and embodiments of the present disclosure in sufficient detail to enable those skilled in the art to practice the disclosure. Other components may be utilized, and changes may be made, without departing from the scope of the present disclosure. Accordingly, the following description should not be construed in a limiting sense.

[0074] The present disclosure is based, at least in part, on the discovery of compositions and methods for treating autosomal dominant polycystic kidney disease through targeted modulation of polycystin 1 (PKD1) and / or polycystin 2 (PKD2) protein expression using 3' UTR masking compositions. The present disclosure demonstrates that antisense oligonucleotides (ASOs) targeting the 3' UTR of PKD1 mRNA and / or PKD2 mRNA are useful for regulating protein expression by partially blocking repressive sites (e.g., cis-inhibitory sites targeted by specific microRNAs, such as miR-17). Specifically, the present disclosure relates to the surprising discovery that elimination of cis-inhibitory (microRNA-17 binding) motifs from the 3'-UTR of mRNA expressed from a non-mutated PKD1 allele copy is sufficient to improve PKD1 dosage and reverse PKD1 deficiency in mice. To this end, applicants have designed antisense oligonucleotides to selectively increase the levels of PKD1 and / or PKD2 by targeting cis-inhibitory motifs in their mRNAs. Further aspects of the present disclosure also provide therapeutic strategies for selectively increasing PKD1 and / or PKD2 protein expression for subjects in need thereof.

[0075] I. Terminology It is to be understood that the language and terminology used herein is for purposes of description and should not be regarded as limiting. For example, the use of singular terms such as "a" does not limit the number of items. Also, without limitation, the use of relative terms such as "top," "bottom," "left," "right," "upper," "lower," "lower side," "upper," and "lateral" is used in the description for clarity with specific reference to the drawings and is not intended to limit the concepts of the invention or the appended claims.

[0076] Furthermore, because the inventive concept is applicable to embodiments in a wide variety of forms, the present disclosure is intended to be considered an example of the principles of the inventive concept, and is not intended to limit the inventive concept to the specific embodiments shown and described. Any one of the features of the inventive concept can be used separately or in combination with any other feature. References herein to terms such as "embodiment," "embodiments," and the like mean that the referenced feature and / or each feature is included in at least one aspect of the present specification. Individual references herein to terms such as "embodiment," "embodiments," and the like do not necessarily refer to the same embodiment, nor are they mutually exclusive, unless expressly stated otherwise or as readily apparent to those skilled in the art from the description herein. For example, features, structures, processes, steps, operations, etc. described in one embodiment may, but are not necessarily, included in other embodiments. Thus, the inventive concept may include various combinations and / or integrations of the embodiments described herein. Additionally, not all aspects of the present disclosure described herein are essential to its implementation. Similarly, other systems, methods, features, and advantages of the inventive concept will be, or will become, apparent to one skilled in the art upon examination of the drawings and description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the inventive concept, and be encompassed by the claims. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0077] As used in this specification and the appended claims, any term relating to degree, such as, without limitation, "substantially," should be understood to include exact or similar but less exact configurations. For example, a "substantially flat surface" means having a perfectly flat surface or a similar but less flat surface. Similarly, the terms "about" or "approximately" as used in this specification and the appended claims should be understood to include the stated value or values ​​that are three times the stated value or one-third of that value. For example, about 3 mm includes all values ​​from 1 mm to 9 mm, and about 50 degrees includes all values ​​from 16.6 degrees to 150 degrees. For example, they can refer to less than or equal to ±5%, e.g., less than or equal to ±2%, e.g., less than or equal to ±1%, e.g., less than or equal to ±0.5%, e.g., less than or equal to ±0.2%, e.g., less than or equal to ±0.1%, or e.g., less than or equal to ±0.05%.

[0078] The terms "comprising," "including," and "having" are used interchangeably in this disclosure. The terms "comprising," "including," and "having" mean including, but not necessarily limited to, the items set forth.

[0079] Finally, the terms "or" and "and / or" as used herein should be construed as being inclusive or meaning any one or any combination. Thus, "A, B or C" or "A, B and / or C" means any of the following: "A", "B", or "C"; "A and B"; "A and C"; "B and C"; "A, B and C". Exceptions to this definition occur only where combinations of elements, features, steps, or operations are inherently mutually exclusive in some way.

[0080] As used herein, the term "hybridize under stringent conditions" is intended to refer to conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%, preferably 75%) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those of skill in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. A non-limiting example of stringent hybridization conditions is hybridization in 6x sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by one or more washes in 0.2x SSC, 0.1% SDS at 50-65°C (e.g., 50°C, 60°C, or 65°C). Preferably, isolated nucleic acid molecules of the present invention that hybridize under stringent conditions correspond to naturally occurring nucleic acid molecules. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that is found in natural human cells (e.g., encodes a natural protein).

[0081] As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA or miRNA), as well as analogs of DNA or RNA made using nucleotide analogs. Nucleic acid molecules can be single-stranded or double-stranded.

[0082] An "isolated nucleic acid molecule" means that the material is removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring polynucleotide present in a living animal is not isolated; the same polynucleotide or polypeptide separated from some or all of the coexisting materials of the natural system would be isolated even if it were subsequently reintroduced into the natural system. Such a polynucleotide may be part of a vector or other composition and still be isolated in that such vector or composition is not part of its natural environment.

[0083] A "nucleic acid vector" is a nucleic acid sequence designed to be propagated and / or transcribed upon exposure to a cellular environment, such as a cell lysate or whole cells. A "gene therapy vector" refers to a nucleic acid vector that also has functional aspects for transfection into whole cells, with the intention of increasing the expression of one or more genes or proteins. In either case, such vectors usually contain a "vector propagation sequence," which is an origin of replication recognized by cells to allow the vector to propagate within the cell. A wide range of nucleic acid vectors and gene therapy vectors are well known to those skilled in the art.

[0084] miRNA is a small non-coding RNA molecule that functions in the transcriptional and post-transcriptional regulation of gene expression.miRNA functions through base pairing with complementary sequences in mRNA molecules, and usually leads to gene silencing through translational repression or target degradation.Mature miRNA is processed through a series of steps from larger primary RNA transcripts (pri-miRNA) or from introns (mirtrons) containing miRNA to create stem-loop pre-miRNA structures containing miRNA sequences.Then, pre-miRNA is cleaved to create mature miRNA.

[0085] Primary miRNA transcripts are transcribed by RNA polymerase II and can range in size from hundreds to thousands of nucleotides in length (pri-mRNA). Pri-miRNAs can encode a single miRNA but can also contain clusters of several miRNAs. The pri-miRNA is then processed by the nuclear ribonuclease III (RNase III) endonuclease Drosha into an approximately 70-nucleotide hairpin (pre-miRNA). Therefore, the isolated nucleic acid molecules of the present invention have various preferred lengths depending on their intended target. When targeted to a pri-miRNA, preferred lengths vary between 100 and 200 nucleotides, e.g., 100, 120, 150, 180, or 200 nucleotides. In the cytoplasm, a second RNAse III, Dicer, together with its dsRBD protein partner, cleaves the pre-miRNA in the stem region of the hairpin, thereby releasing an approximately 21-nucleotide RNA duplex. Thus, in one embodiment of the present invention, isolated polynucleotides of about 80, 70, 60, 50, 40, 30, 25, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, or 6 nucleotides in length are also contemplated.

[0086] As used herein, the term "sufficiently identical" refers to a first amino acid or nucleotide sequence that contains a sufficient or minimum number of identical or equivalent amino acid residues or nucleotides (e.g., amino acid residues with similar side chains) with a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have a common structural domain and / or a common functional activity. For example, amino acid or nucleotide sequences that contain a common structural domain with about 65% identity, preferably 75% identity, and more preferably 85%, 95%, or 98% identity are defined herein as sufficiently identical.

[0087] The term "sample" refers to cells, populations of cells, biological samples, and subjects, such as mammalian subjects. The term "biological sample" refers to tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject.

[0088] As used herein, "subject" refers to an organism having a central nervous system. In particular, subjects can include, but are not limited to, human subjects or patients and companion animals. Exemplary companion animals can include domesticated mammals (e.g., dogs, cats, horses), mammals of high commercial value (e.g., dairy cattle, beef cattle, sport animals), mammals of high scientific value (e.g., captive or free specimens of endangered species), or mammals of other value. Suitable subjects can also include mice, rats, dogs, cats, ungulates such as cattle, pigs, sheep, horses, and goats, lagomorphs such as rabbits and hares, other rodents, and primates such as monkeys, chimpanzees, and apes. In some embodiments, the subject can be diagnosed with or at risk for autosomal dominant polycystic kidney disease. The subject can be of any age, including neonate, adolescent, adult, middle-aged, or elderly.

[0089] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a therapeutic agent of the present invention and a pharmaceutically acceptable carrier. As used herein, a "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to an amount of an agent effective to produce an intended pharmacological, therapeutic, or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 15% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of an agent for treating that disorder or disease is the amount necessary to produce at least a 15% reduction in that parameter.

[0090] The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. This term specifically excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable additives such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, and cornstarch and alginic acid are suitable disintegrants. Binders can include starch and gelatin, and lubricants, if present, can generally be magnesium stearate, stearic acid, or talc. If desired, tablets can be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract.

[0091] As used herein, "complementarity percentage" refers to the percentage of nucleotides in a modified oligonucleotide that are complementary to a microRNA. Complementarity percentage can be calculated by dividing the number of nucleotides in a modified oligonucleotide that are complementary to the nucleotides at corresponding positions in a microRNA by the total length of the modified oligonucleotide.

[0092] As used herein, "oligonucleotide" means a polymer of linked nucleosides, each of which may be modified or unmodified, independently of one another.

[0093] As used herein, "anti-miR" means an oligonucleotide having a nucleotide sequence complementary to a microRNA. In certain embodiments, the anti-miR is a modified oligonucleotide.

[0094] As used herein, "internucleoside linkage" means a covalent bond between adjacent nucleosides.

[0095] As used herein, "linked nucleosides" means nucleosides that are joined together by a covalent bond.

[0096] As used herein, "nucleobase" means a heterocyclic moiety capable of non-covalent pairing with another nucleobase.

[0097] As used herein, "nucleoside" means a nucleobase linked to a sugar.

[0098] As used herein, "nucleotide" means a nucleoside having a phosphate group or other internucleoside linkage-forming group covalently linked to the sugar portion of the nucleoside.

[0099] As used herein, "modified oligonucleotide" means an oligonucleotide having one or more modifications to the naturally occurring termini, sugars, nucleobases, and / or internucleoside linkages.

[0100] As used herein, "modified internucleoside linkage" means any variation from a naturally occurring internucleoside linkage.

[0101] As used herein, a "phosphorothioate internucleoside linkage" means a linkage between nucleosides in which one of the non-bridging atoms is a sulfur atom.

[0102] As used herein, "modified sugar" refers to a substitution and / or any change from a natural sugar.

[0103] As used herein, "modified nucleobase" means any substitution and / or variation from a naturally occurring nucleobase.

[0104] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to the 5' position.

[0105] As used herein, "2' fluoro sugar" means a sugar having a fluorine modification at the 2' position.

[0106] As used herein, "2'-O-methyl sugar" or "2'-OMe sugar" means a sugar having an O-methyl modification at the 2' position.

[0107] As used herein, "2'-O-methoxyethyl sugar" or "2'-MOE sugar" means a sugar having an O-methoxyethyl modification at the 2' position.

[0108] As used herein, "2'-O-fluoro" or "2'-F" refers to a sugar having a fluoro modification at the 2' position.

[0109] As used herein, "bicyclic sugar moiety" means a sugar modified by bridging two non-geminal ring atoms.

[0110] As used herein, "locked nucleic acid (LNA)" means a nucleic acid comprising one or more nucleosides having a substituted sugar moiety with a (CH2)-O bridge between the 4' and 2' furanose ring atoms.

[0111] In practicing the present invention, many conventional techniques in molecular biology, microbiology, and recombinant DNA may be used. These techniques are well known and are described, for example, in Current Protocols in Molecular Biology, Volumes I, II, and III, 1997 (FMA Usubel ed.); Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; DNA Cloning: A Practical Approach, Volumes I and II, 1985 (DNGlover ed.); Oligonucleotide Synthesis, 1984 (MLGait ed.); Nucleic Acid Hybridization, 1985, (Hames and Higgins eds.); Transcription and Translation, 1984 (Hames and Higgins eds.); Animal Cell Culture, 1986 (RI Freshney ed.); Immobilized Cells and Enzymes, 1986 (IRL Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the series, Methods in Enzymology (Academic Press, Inc.); Gene Transfer Vectors for Mammalian cells, 1987 (JH Miller and MPCalos eds., Cold Spring Harbor Laboratory); and Methods in Enzymology, Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds., respectively).

[0112] II. Composition Various embodiments of the present disclosure relate to antisense oligonucleotides (ASOs) that specifically target regulatory elements on the mRNA expressed from the PKD1 gene (hereinafter referred to as PKD1 mRNA). A further embodiment of the present disclosure relates to antisense oligonucleotides (ASOs) that specifically target regulatory elements on the mRNA expressed from the PKD2 gene (hereinafter referred to as PKD2 mRNA). These ASOs interfere with the binding of microRNA elements to the 3'UTR region of the mRNA, thus extending the lifespan of the mRNA. These ASOs can restore expression of polycystin 1 (PKD1) and / or polycystin 2 (PKD2) in cells or subjects that do not normally express sufficient levels of either or both proteins, thereby providing a means of treating autosomal dominant polycystic kidney disease (ADPKD).

[0113] Therefore, in various embodiments, antisense oligonucleotides are provided that selectively hybridize (for example, under stringent conditions) to the 3'UTR regulatory region on PKD1 mRNA and / or PKD2 mRNA.By binding to this region, ASOs interfere with the microRNA (for example, microRNA-17) that hybridizes to the same region, thus stabilizing mRNA.As used herein, the term "stabilizing" refers to extending the lifespan of mRNA and / or preventing its degradation.As used herein, "stabilized" mRNA can be translated more frequently, thus resulting in a higher titer of the encoded protein.

[0114] As mentioned, the ASOs provided herein selectively hybridize to the 3'UTR regulatory region of PKD1 mRNA or PKD2 mRNA (e.g., human or mouse PKD1 or PKD2 mRNA). Exemplary regions of the 3'UTR of Pkd1 and Pkd2 in both human and mouse mRNA are shown in Table 1 below. The antisense oligonucleotides of the present disclosure typically comprise a region of nucleotide sequence that hybridizes, under stringent conditions, to at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more consecutive nucleotides of the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA or PKD2 mRNA as set forth in Table 1 below. [Table 1]

[0115] In some embodiments, the ASO selectively hybridizes to the 3'UTR regulatory region of PKD1 mRNA. The 3'UTR regulatory region of PKD1 mRNA can comprise any one of SEQ ID NOS: 4-7. In some embodiments, the ASO of the present disclosure hybridizes under stringent conditions to at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more consecutive nucleotides of the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NOS: 5 or 7. For example, in some embodiments, an ASO of the disclosure hybridizes under stringent conditions to at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more contiguous nucleotides of the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NO: 4 or 6. By way of further example, in some embodiments, an ASO of the disclosure hybridizes under stringent conditions to the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NO: 4 or 6.

[0116] In some embodiments, the ASO selectively hybridizes to the 3'UTR regulatory region of PKD2 mRNA. The 3'UTR regulatory region of PKD2 mRNA can comprise any one of SEQ ID NOS: 8-13. In some embodiments, the ASO of the present disclosure hybridizes under stringent conditions to at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more consecutive nucleotides of the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NOS: 9, 11, or 13. For example, in some embodiments, an ASO of the disclosure hybridizes under stringent conditions to at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more contiguous nucleotides of the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NO: 8, 10, or 12. By way of further example, in some embodiments, an ASO of the disclosure hybridizes under stringent conditions to the sense or antisense sequence of the 3'UTR sequence of PKD1 mRNA provided as SEQ ID NO: 8, 10, or 12.

[0117] In certain embodiments, an ASO may comprise at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides. In certain embodiments, an ASO may comprise at least 9 nucleotides. In some embodiments, the ASO is 9 to 25 nucleotides, 9 to 24 nucleotides, 9 to 23 nucleotides, 9 to 22 nucleotides, 9 to 21 nucleotides, 9 to 20 nucleotides, 9 to 19 nucleotides, 9 to 18 nucleotides, 9 to 17 nucleotides, 9 to 16 nucleotides, 9 to 25 nucleotides, 9 to 24 nucleotides, 9 to 23 nucleotides, 9 to 22 nucleotides, 9 to 21 nucleotides, 10 to 20 nucleotides, 10 to 19 nucleotides, 10 to 18 nucleotides, 10 to 17 nucleotides, 10 to 16 nucleotides, 11 to 25 nucleotides, 11 to 24 nucleotides, 11 to 23 nucleotides, 11 to 22 nucleotides. The amino acid sequence may comprise 11 to 21 nucleotides, 11 to 20 nucleotides, 11 to 19 nucleotides, 11 to 18 nucleotides, 11 to 17 nucleotides, 11 to 17 nucleotides, 12 to 25 nucleotides, 12 to 24 nucleotides, 12 to 23 nucleotides, 12 to 22 nucleotides, 12 to 21 nucleotides, 12 to 20 nucleotides, 12 to 19 nucleotides, 12 to 18 nucleotides, 13 to 25 nucleotides, 13 to 24 nucleotides, 13 to 23 nucleotides, 13 to 22 nucleotides, 13 to 21 nucleotides, 13 to 20 nucleotides, 13 to 19 nucleotides, 13 to 18 nucleotides, or 13 to 17 nucleotides. In some embodiments, the ASO comprises or consists of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In particular embodiments, the ASO comprises or consists of 15 or 16 nucleotides.

[0118] In certain aspects, the ASO may further comprise one or more modifications to the nucleobase, sugar, and / or internucleoside linkage, and thus is a modified oligonucleotide. Modified nucleobases, sugars, or internucleoside linkages may be selected over unmodified forms for desirable properties, such as enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets, and increased stability in the presence of nucleases. In certain embodiments, the modified nucleoside is a sugar-modified nucleoside. In certain such embodiments, the sugar-modified nucleoside may further comprise a natural or modified heterocyclic base moiety or a natural or modified internucleoside linkage, and may include additional modifications unrelated to the sugar modification. In certain embodiments, the sugar-modified nucleoside is a 2'-modified nucleoside, in which the sugar ring is modified at the 2' carbon from natural ribose or 2'-deoxy-ribose. In certain embodiments, a 2'-modified nucleoside comprises a 2'-substituent selected from F, O-CH3, and OCH2CH2OCH3. In certain embodiments, a 2'-modified nucleoside has a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridging group between the 2' and 4' carbon atoms.

[0119] In certain embodiments, the modified oligonucleotide comprises one or more internucleoside modifications. In certain such embodiments, each internucleoside linkage of the oligonucleotide is a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage comprises a phosphorus atom.

[0120] In certain embodiments, the modified oligonucleotide comprises at least one phosphorothioate internucleoside linkage. In preferred embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0121] In certain embodiments, the modified oligonucleotide comprises one or more modified nucleobases. In certain embodiments, the modified oligonucleotide comprises one or more 5-methylcytosines. In certain embodiments, each cytosine in the modified oligonucleotide comprises a 5-methylcytosine.

[0122] In certain embodiments, the modified nucleobase is selected from 5-hydroxymethylcytosine, 7-deazaguanine, and 7-deazaadenine. In certain embodiments, the modified nucleobase is selected from 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.

[0123] In some embodiments, the antisense oligonucleotide of the present disclosure can be modified in the base moiety, sugar moiety or phosphate backbone, for example, to improve the stability, hybridization or solubility of the molecule.As another example, the deoxyribose phosphate backbone of nucleic acid can be modified to create peptide nucleic acid (see Hyrup et al. (1996) Bioorganic & Medicinal Chemistry 4(1):5-23).As used herein, the term "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic, such as a DNA mimic, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only four natural nucleic acid bases are retained.The neutral backbone of PNA has been shown to enable specific hybridization to DNA and RNA under conditions of low ionic strength. Synthesis of PNA oligomers can be carried out using standard solid phase peptide synthesis protocols such as those described in Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93:14670-675.

[0124] In other embodiments, the oligonucleotides of the invention may contain other additional groups, such as peptides (e.g., for targeting host cell receptors in vivo) or agents that facilitate transport across cell membranes (e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652; PKDT Publication No. WO 88 / 09810) or the blood-brain barrier (see, e.g., PKDT Publication No. WO 89 / 10134). In addition, oligonucleotides may be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al. (1988) Bio / Techniques 6:958-976) or intercalating agents (see, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, eg, a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

[0125] In certain embodiments, the antisense oligonucleotides of the invention are synthesized with an entirely phosphorothioate backbone with alternating blocks of 2'-MOE and 2' fluoro sugar modified nucleosides.

[0126] In certain embodiments, the ASO may comprise at least one locked nucleic acid (LNA). In some embodiments, the ASO may not comprise any locked nucleic acids.

[0127] In accordance with the above, exemplary ASOs are provided herein. In certain embodiments, the ASOs of the present disclosure may comprise a nucleic acid sequence having at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the ASOs of the present disclosure comprise or consist of SEQ ID NO: 1. In some embodiments, the ASOs of the present disclosure comprise or consist of SEQ ID NO: 2. In some embodiments, the ASOs of the present disclosure comprise or consist of SEQ ID NO: 3. For ease of reference, exemplary ASOs are set forth in Table 2 below. [Table 2]

[0128] The antisense oligonucleotide of the present invention can be synthesized by chemical synthesis and enzyme ligation reaction using procedures known in the art.For example, oligonucleotide (such as antisense oligonucleotide) can be chemically synthesized using naturally occurring ribonucleotide, deoxyribonucleotide, various modified nucleotides designed to increase the biological stability of molecules, or to increase the physical stability of the duplex formed between antisense nucleic acid and sense nucleic acid, or their combinations.For example, phosphorothioate derivatives and acridine-substituted nucleotides can be used. Other examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyluracil, and the like. Examples of uracil-5-oxyacetic acid methyl esters include 5-aminomethyl-2-thiouracil, β-D-mannosylqueosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxosin, pseudouracil, queosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.Alternatively, the oligonucleotide may be produced biologically using an expression vector into which the nucleic acid has been subcloned in an antisense orientation. Suitable expression vectors are further described below.

[0129] vector In some embodiments, the present disclosure also encompasses vectors that facilitate the transfer of nucleic acids encoding antisense oligonucleotides into cells, including, but not limited to, plasmids, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, etc. The vector may also be a chemical vector, such as a lipid complex or naked DNA. In some embodiments, the vector may be a viral vector. The viral vector may comprise the expression construct described herein.

[0130] Viral vectors or gene therapy vectors are suitable vectors for gene therapy. Suitable vectors for gene therapy include those described in Anderson 1998, Nature 392:25-30; Walther and Stein, 2000, Drugs 60:249-71; Kay et al., 2001, Nat. Med. 7:33-40; Russell, 2000, J. Gen. Virol. 81:2573-604; Amado and Chen, 1999, Science 285:674-6; Federico, 1999, Curr. Opin. Biotechnol. 10:448-53; Vigna and Naldini, 2000, J. Gene Med. 2:308-16; Marin et al., 1997, Mol. Med. Today 3:396-403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10:454-7; Sommerfelt, 1999, J. Gen. Virol. 80:3049-64; Reiser, 2000, Gene Ther. 7:910-3; and references cited therein.

[0131] The viral and / or gene therapy vectors can be adenoviral vectors, adeno-associated viral vectors or retroviral vectors.

[0132] Particularly suitable vectors include adenovirus and adeno-associated virus (AAV) vectors. These vectors infect many dividing and non-dividing cell types, including synovial cells and hepatocytes. The episomal nature of adenovirus and AAV vectors after cell entry makes these vectors suitable for therapeutic applications. As mentioned above (Russell, 2000, J. Gen. Virol. 81: 2573-2604; Goncalves, 2005, Virol J. 2(1): 43). AAV vectors are even more preferred because they are known to provide very stable, long-term expression of transgenes (up to 9 years in dogs (Niemeyer et al., Blood. 2009 January 22;113(4):797-806) and approximately 2 years in humans (Nathwani et al., N Engl J Med. 2011 December 22;365(25):2357-65; Simonelli et al., Mol Ther. 2010 March;18(3):643-50. Epub 2009 December 1.)). Preferred adenoviral vectors are modified to reduce the host response, as reviewed by Russell (2000, supra). Methods for gene therapy using AAV vectors are described in Wang et al., 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al., 2004, Curr Opin Mol Ther. 6(5):482-90, and Martin et al., 2004, Eye 18(11):1049-55, Nathwani et al., N Engl J Med. 2011 Dec 22;365(25):2357-65, Apparailly et al., Hum Gene Ther. 2005 Apr;16(4):426-34.

[0133] Another suitable vector includes retroviral vector.The preferred retroviral vector for application in the present invention is lentivirus-based viral vector.Lentivirus vector has the ability to infect and stably integrate into the genome of dividing and non-dividing cells (Amado and Chen, 1999 Science 285:674-6).The method for constructing and using lentivirus-based expression constructs is described in U.S. Patent Nos. 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031, and Federico (1999, Curr Opin Biotechnol 10:448-53) and Vigna et al. (2000, J Gene Med 2000;2:308-16).

[0134] In one embodiment, vector is lentivirus vector.In another embodiment, single bicistronic virus vector is used.As a non-limiting example, single bicistronic lentivirus vector with 2A self-cleaving peptide sequence is used, as in the experimental section of Xu Y., et al. (2019), (Cancer Immunology, Immunotherapy, 68:1979-1993) and Pincha M., et al. (2011), (Gene Therapy, 18:750-764).

[0135] Other suitable viral and / or gene therapy vectors include herpes virus vectors, polyoma virus vectors or vaccinia virus vectors.

[0136] Viral vectors and / or gene therapy vectors contain nucleotides encoding antisense oligonucleotides, whereby each of the aforementioned nucleotide sequences is operably linked to an appropriate regulatory sequence. Such regulatory sequences will include at least a promoter sequence. Suitable promoters for expressing such nucleotide sequences from gene therapy vectors include, for example, the cytomegalovirus (CMV) immediate early promoter, viral long terminal repeat promoters (LTRs) such as those derived from murine Moloney leukemia virus (MMLV), Rous sarcoma virus, or HTLV-1, the simian virus 40 (SV40) early promoter, the MSCV promoter, and the herpes simplex virus thymidine kinase promoter. Transposons or other non-viral delivery systems can also be used in this context. All systems can be used in vitro or in vivo.

[0137] The viral and / or gene therapy vectors may optionally contain additional nucleotide sequences encoding additional polypeptides. The additional polypeptide may be a (selectable) marker polypeptide that allows for identification, selection, and / or screening of cells containing the expression construct. Marker proteins suitable for this purpose include, for example, the fluorescent protein GFP, and the selectable marker genes HSV thymidine kinase (for selection in HAT medium), bacterial hygromycin B phosphotransferase (for selection with hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection with G418), and dihydrofolate reductase (DHFR) (for selection with methotrexate), CD20, and the low-affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for their use are provided in Sambrook and Green (supra).

[0138] Pharmaceutical Composition As used herein, "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein (including any gene therapy vectors) with other chemical components, such as physiologically suitable carriers and additives. The purpose of a pharmaceutical composition is to facilitate administration of the gene therapy vector to an organism.

[0139] As used herein, the term "active ingredient" refers to an antisense oligonucleotide that is administered to increase the expression of PKD1 and / or PKD2 in a subject and can exert a biological effect. As used herein, the term "active ingredient" can also include a gene therapy vector encoding the antisense oligonucleotide.

[0140] Pharmaceutically acceptable carriers and excipients A further aspect of the present disclosure relates to a pharmaceutical composition comprising at least one antisense oligonucleotide as described above. In various aspects, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient.

[0141] Hereinafter, the terms "physiologically acceptable carrier" and "pharmaceutically acceptable carrier," which may be used interchangeably, refer to a carrier or diluent that does not cause significant irritation to an organism and does not abolish the biological activity and properties of the administered compound. These terms also include adjuvants.

[0142] In various embodiments, the compositions disclosed herein may further comprise one or more pharmaceutically acceptable diluents, additives, or carriers. As used herein, a pharmaceutically acceptable diluent, additive, or carrier refers to a material suitable for administration to a subject without causing undesired biological effects or adversely interacting with any of the components of the composition in which it is contained. Pharmaceutically acceptable diluents, carriers, and additives include, but are not limited to, saline, Ringer's solution, phosphate solution or buffer, buffered saline, and other carriers known in the art. Pharmaceutical compositions may also include stabilizers, antioxidants, colorants, other medicinal or pharmaceutical agents, carriers, adjuvants, preservatives, stabilizers, wetting agents, emulsifiers, solubility enhancers, salts, solubilizers, antifoaming agents, antioxidants, dispersing agents, surfactants, and combinations thereof. As used herein, the term "additive" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the active ingredient. Examples of additives include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and starch types, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.Technologies for drug formulation and administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pennsylvania, the latest edition, which is incorporated herein by reference.

[0143] In various embodiments, the pharmaceutical compositions described herein can be formulated in a conventional manner using one or more physiologically acceptable carriers, including additives and adjuvants, to facilitate the processing of genetically modified endothelial progenitor cells into pharmaceutically usable preparations. In other embodiments, any of the well-known techniques, carriers, and additives can be used as appropriate and understood in the art.

[0144] In various embodiments, the pharmaceutical compositions described herein may be aqueous suspensions containing one or more polymers as suspending agents. In some aspects, the polymers that may comprise the pharmaceutical compositions described herein include water-soluble polymers, such as cellulose-based polymers, for example, hydroxypropylmethylcellulose; water-insoluble polymers, such as cross-linked carboxyl-containing polymers; mucoadhesive polymers selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methyl methacrylate), polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate, and dextran; or combinations thereof. In other aspects, the compositions disclosed herein may contain at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total amount of polymers as suspending agents by weight of the total composition.

[0145] In various embodiments, the pharmaceutical compositions disclosed herein may contain viscous formulations. In some aspects, the viscosity of the composition may be increased by the addition of one or more gelling or thickening agents. In other aspects, the compositions disclosed herein may contain one or more gelling or thickening agents in an amount that provides the formulation with sufficient viscosity to remain on the treated tissue. In still other aspects, the compositions disclosed herein may contain at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total amount of gelling or thickening agent by total weight of the composition. In still other aspects, suitable thickening agents may be hydroxypropylmethylcellulose, hydroxyethylcellulose, polyvinylpyrrolidone, carboxymethylcellulose, polyvinyl alcohol, sodium chondroitin sulfate, or sodium hyaluronate.In other embodiments, the viscosity enhancing agent is selected from the group consisting of acacia (gum arabic), agar, magnesium aluminum silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, carbopol, xanthan, cellulose, microcrystalline cellulose (MCC), ceratonia, chitin, carboxymethylated chitosan, chondrus, dextrose, furcellaran, gelatin, ghatti gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, corn starch, wheat starch, rice starch, potato starch, gelatin, karaya gum, xanthum gum), tragacanth gum, ethyl cellulose, ethylhydroxyethyl cellulose, ethylmethyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethyl methyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate), oxypolygelatin, pectin, polygeline, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropyl methylcellulose (HPMC), sodium carboxymethylcellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), Splenda® (dextrose, maltodextrin, and sucralose), or combinations thereof. In some embodiments, a suitable thickening agent may be carboxymethyl cellulose.

[0146] In various embodiments, the pharmaceutical compositions disclosed herein may contain additional agents or additives selected from the group including surfactants, detergents, solvents, acidifying agents, alkalinizing agents, buffering agents, tonicity adjusting agents, ionic additives effective to increase the ionic strength of the solution, antibacterial agents, antibiotics, antifungals, antioxidants, preservatives, electrolytes, antifoaming agents, oils, stabilizers, enhancers, and the like. In some aspects, the pharmaceutical compositions disclosed herein may contain one or more agents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by total weight of the composition. In other aspects, one or more of these agents may be added to improve the performance, efficacy, safety, shelf life, and / or other properties of the muscarinic antagonist compositions of the present disclosure. In aspects, the additives are biocompatible and not harsh, abrasive, or allergenic.

[0147] In various embodiments, the pharmaceutical compositions disclosed herein may contain one or more acidifying agents. As used herein, "acidifying agent" refers to a compound used to provide an acidic medium. Examples of such compounds include, but are not limited to, acetic acid, amino acids, citric acid, fumaric acid, and other alphahydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid, as well as others known to those skilled in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In other aspects, the compositions disclosed herein may contain one or more acidifying agents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by weight of the total composition.

[0148] In various embodiments, the pharmaceutical compositions disclosed herein may contain one or more alkalizing agents. As used herein, an "alkalinizing agent" refers to a compound used to provide an alkaline medium. Examples of such compounds include, but are not limited to, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine, as well as others known to those skilled in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base can be used. In other aspects, the compositions disclosed herein may contain one or more alkalizing agents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by weight of the total composition.

[0149] In various embodiments, the pharmaceutical compositions disclosed herein may contain one or more antioxidants. As used herein, an "antioxidant" is an agent that inhibits oxidation and can therefore be used to prevent the deterioration of preparations due to the oxidative process. Examples of such compounds include, but are not limited to, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophophorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, and sodium metabisulfite, as well as other materials known to those skilled in the art. In some aspects, the compositions disclosed herein may contain one or more antioxidants in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by weight of the composition.

[0150] In other embodiments, the pharmaceutical compositions disclosed herein may include a buffer system. As used herein, a "buffer system" refers to a composition composed of one or more buffering agents, and a "buffering agent" refers to a compound used to resist changes in pH upon dilution or addition of acid or alkali. Examples of buffering agents include, but are not limited to, potassium metaphosphate, potassium phosphate, monobasic sodium acetate, and sodium citrate anhydrous and dihydrate, as well as other materials known to those of skill in the art. In some embodiments, any pharmaceutically acceptable organic or inorganic buffer can be used. In other embodiments, the compositions disclosed herein may include one or more buffering agents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%, based on the total weight of the composition. In other embodiments, the amount of one or more buffering agents may depend on the desired pH level of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In other embodiments, the pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6. In preferred embodiments, the compositions disclosed herein may have a pH greater than about 6.8.

[0151] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more preservatives. As used herein, "preservative" refers to an agent or combination of agents that inhibit, reduce, or eliminate bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include nipagin, nipazole, isopropyl alcohol, and combinations thereof. In some aspects, any pharmaceutically acceptable preservative can be used. In other aspects, the pharmaceutical compositions disclosed herein may include one or more preservatives in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by total weight of the composition.

[0152] In other embodiments, the pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents. In some aspects, the surface-acting reagents or detergents may be synthetic, natural, or semi-synthetic. In other aspects, the compositions disclosed herein may comprise an anionic detergent, a cationic detergent, a zwitterionic detergent, an ampholyte detergent, an amphoteric detergent, a non-ionic detergent with a steroid backbone, or a combination thereof. In still other aspects, the pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by total weight of the composition.

[0153] In various embodiments, the pharmaceutical compositions disclosed herein may contain one or more stabilizers. As used herein, "stabilizer" refers to a compound used to stabilize an active agent against physical, chemical, or biochemical processes that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, by way of example and not limitation, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, niacinamide, sodium acetyltryptophanate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycol, sodium caprylate, and sodium saccharin, as well as others known to those skilled in the art. In some aspects, the pharmaceutical compositions disclosed herein may contain one or more stabilizers in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% by weight of the composition.

[0154] In other embodiments, the pharmaceutical compositions disclosed herein may contain one or more tonicity agents. As used herein, "tonicity agent" refers to a compound that can be used to adjust the tonicity of a liquid formulation. Suitable tonicity agents include, but are not limited to, glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose, and others known to those skilled in the art. The osmolality in a composition can be expressed in milliosmoles per liter (mOsm / L). Osmolality can be measured using methods commonly known in the art. In a preferred embodiment, the osmolality of the compositions disclosed herein is calculated using the vapor pressure depression method. In some embodiments, the amount of one or more tonicity agents comprising a pharmaceutical composition disclosed herein may result in a composition osmolality of about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L, or about 250 mOsm / L to about 320 mOsm / L. In other embodiments, the compositions herein may have an osmolality ranging from about 100 mOsm / kg to about 1000 mOsm / kg, from about 200 mOsm / kg to about 800 mOsm / kg, from about 250 mOsm / kg to about 500 mOsm / kg, or from about 250 mOsm / kg to about 320 mOsm / kg, or from about 250 mOsm / kg to about 350 mOsm / kg, or from about 280 mOsm / kg to about 320 mOsm / kg. In some embodiments, the pharmaceutical compositions described herein have an osmolality of about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L.In still other embodiments, the pharmaceutical compositions disclosed herein may comprise one or more tonicity adjusting agents in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, by total weight of the composition.

[0155] Dosage Formulation In various embodiments, the pharmaceutical compositions herein are formulated for systemic administration.Suitable administration routes can include, for example, intramuscular, subcutaneous and intramedullary injection, and parenteral delivery, including intravenous or intraperitoneal injection.In various embodiments, the pharmaceutical compositions are formulated for intravenous, intraperitoneal or subcutaneous administration.

[0156] For example, the pharmaceutical composition can be administered locally or systemically by directly injecting the pharmaceutical composition into a tissue region of a patient. In some embodiments, the pharmaceutical composition disclosed herein can be administered parenterally, for example, by intravenous injection, renal injection, subcutaneous injection, or a combination thereof. In some embodiments, the pharmaceutical composition disclosed herein can be administered orally. In some embodiments, the pharmaceutical composition disclosed herein can be administered to a human patient via at least two administration routes. In some examples, the combination of administration routes is via renal injection and intravenous injection; intraperitoneal and intravenous injection; subcutaneous injection and intravenous injection; oral and renal injection; oral and intraperitoneal injection; oral and subcutaneous injection; and oral and intravenous injection.

[0157] The pharmaceutical compositions of the present disclosure may be manufactured by methods well known in the art, for example, by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.

[0158] Thus, pharmaceutical compositions for use in accordance with the present disclosure can be formulated in a conventional manner using one or more physiologically acceptable carriers containing additives and auxiliaries that facilitate the processing of the active ingredient into a pharmaceutically usable preparation. The appropriate formulation depends on the selected route of administration.

[0159] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.

[0160] The pharmaceutical compositions described herein can be formulated for parenteral administration, for example, by bolus injection or continuous infusion.The preparations for injection can be provided in unit dosage form, for example, in ampoules or in multi-dose containers, optionally containing preservatives.The compositions can be suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending agents, stabilizers and / or dispersants.

[0161] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form.In addition, suspensions of active ingredients can be prepared as suitable oily or water-based injection suspensions.Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate, triglycerides, or liposomes.Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran.If necessary, the suspension can also contain suitable stabilizers or agents that increase the solubility of the compound, allowing the preparation of highly concentrated solutions.

[0162] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water-based solution, before use.

[0163] Pharmaceutical compositions suitable for use in the context of the present disclosure include compositions in which the active ingredients are contained in an amount effective to achieve its intended purpose. In some embodiments, a therapeutically effective amount means an amount of active ingredient (i.e., as disclosed herein) effective to prevent, delay, alleviate, or reverse symptoms of a disorder, or to prolong the survival of the subject being treated.

[0164] Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0165] For any preparation used in the methods of the present disclosure, the therapeutically effective amount or dose can be initially estimated from the in vitro and cell culture assays and / or screening platforms disclosed herein.For example, the dose can be formulated in animal models to achieve a desired concentration or titer.This information can be used to more accurately determine the useful dose in humans.

[0166] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures, or in experimental animals. Data obtained from these in vitro and cell culture assays and animal studies are used to formulate a range of dosages for use in humans. Dosages may vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration, and dosage can be chosen by the individual physician in consideration of the patient's condition. (See, for example, Fingl et al., 1975, "The Pharmacological Basis of Therapeutics," Ch. 1, p. 1.)

[0167] Dosage and intervals can be individually adjusted to ensure that brain or blood levels of the active ingredient are sufficient to induce or suppress the biological effect (minimum effective concentration, MEC). The MEC varies for each preparation but can be estimated from in vitro data. The dosage required to achieve the MEC depends on individual characteristics and the route of administration. Plasma concentrations can be determined using detection assays.

[0168] Depending on the severity and responsiveness of the condition to be treated, dosage may be single or multiple administrations, with the course of treatment lasting from several days to several weeks, or until a cure is effected or a diminution of the disease state is achieved.

[0169] The amount of composition administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. Effective doses may be extrapolated from dose-response curves derived from in vitro or in vivo test systems.

[0170] III.How to use Further aspects of the present disclosure relate to methods of using the above antisense oligonucleotides. For example, in some aspects, a method for increasing the expression of polycystin 1 (PKD1) in cells is provided. Other methods include a method for treating autosomal dominant polycystic kidney disease (ADPKD) in a subject in need thereof.

[0171] Methods for increasing expression of polycystin 1 (PKD1) or polycystin 2 (PKD2) In various embodiments, methods for increasing expression of polycystin 1 and / or polycystin 2 in cells are provided, comprising delivering an ASO described herein to the cell. In various embodiments, the ASO selectively hybridizes to the 3'UTR regulatory region (e.g., cis-inhibitory motif) of PKD1 mRNA and / or PKD2 mRNA, thereby preventing binding of miR-17 to said region. This stabilizes the mRNA and increases translation and ultimately expression of the encoded protein (polycystin 1 or polycystin 2).

[0172] In various embodiments, the cells may have a mutation in at least one allele of the PKD1 and / or PKD2 gene. In various embodiments, the cells may be heterozygous for mutant PKD1 and / or PKD2 alleles. In various embodiments, the mutant PKD1 or PKD2 allele may be a loss-of-function allele that does not express a functional protein. In some embodiments, the cells may have a mutant (LOF) allele and a second allele that is WT. Alternatively, the cells may have a mutant (LOF) allele and a second allele that contains a different mutation that further reduces (but does not eliminate) the expression of polycystin 1 and / or polycystin 2. For example, the second allele may contain a missense mutation that destabilizes the mRNA transcribed from it, reducing protein expression. Generally, the cells have, or have been genetically engineered to have, reduced expression of polycystin 1 (PKD1) and / or polycystin 2 (PKD2) compared to normal WT cells (i.e., cells containing two normal alleles of PKD1 or PKD2). In various embodiments, the cells express polycystin 1 to a level that is less than 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the level expressed by WT cells. In various embodiments, the cells express polycystin 2 to a level that is less than 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the level expressed by WT cells.

[0173] In various embodiments, the method comprises increasing the expression of PKD1 in a cell by at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% compared to baseline, where baseline is defined as the level of expression in a cell under normal conditions. For example, in certain embodiments, the method comprises increasing the expression of PKD1 by at least 25% compared to baseline.

[0174] In various embodiments, the cells can be epithelial cells, endothelial cells (e.g., vascular endothelium), immune cells, or interstitial cells. In some embodiments, the cells can be kidney cells or kidney cell lines (e.g., renal epithelial cells, inner medullary collecting duct (IMCD) cells, HK-2 cells, renal cortical epithelial cells, renal medullary epithelial cells, renal mixed epithelial cells, or renal proximal tubule epithelial cells). For example, the cells can be renal epithelial cells or mIMCD3 cells. In certain embodiments, the cells can be obtained from a patient with autosomal dominant polycystic kidney disease. The cells can be human or murine.

[0175] In various embodiments, the method of increasing PKD1 expression is carried out in vitro. For example, certain embodiments of the present disclosure are directed to increasing the expression of PKD1 and / or PKD2 in a cell line in vitro. The cell line can be an immortalized cell line generated from a human tissue sample (e.g., from a patient with ADPKD). Alternatively, the cell line can be an immortalized cell line generated from a genetically engineered mouse model (i.e., Pkd1 RC / - Pkd1 can be produced from a variety of cell lines. RC / - The cell lines are described in more detail in the Examples herein below.

[0176] In various embodiments, the method of increasing expression of PKD1 and / or PKD2 is performed in vivo. For example, the cell can be in vivo (i.e., in a patient with autosomal dominant polycystic kidney disease).

[0177] In various embodiments, delivering an antisense oligonucleotide (ASO) can include delivering an expression vector encoding the ASO to the cell. Suitable viral vectors that can be used for this purpose are described above.

[0178] Methods for treating autosomal dominant polycystic kidney disease In yet a further aspect, a method of treating autosomal dominant polycystic kidney disease is provided, comprising administering an antisense oligonucleotide (ASO) to a subject in need thereof, and may further comprise increasing endogenous expression of polycystin 1 and / or polycystin 2 in at least one cell of the subject.

[0179] In various aspects, the ASO is administered as part of a pharmaceutical composition, such as any of those described herein. In some aspects, the ASO is administered systemically (i.e., intravenously, subcutaneously, or intraperitoneally). In each of these embodiments, the ASO can be prepared as a pharmaceutical formulation tailored to each administration route.

[0180] In various embodiments, administering the ASO may include administering an expression construct or vector (e.g., a viral vector) that encodes the ASO and enables expression of the ASO in the cells of the subject.

[0181] In various embodiments, treating a subject with ADPKD results in at least 25%, at least 30%, at least 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% increase in polycystin 1 (PKD1) and / or polycystin 2 (PKD2) expression in at least one cell of the subject compared to baseline PKD1 expression and / or PKD2 expression in patients with ADPKD.

[0182] Suitable subjects include humans, livestock animals, companion animals, laboratory animals, or zoological animals. In one embodiment, the subject may be a rodent, such as a mouse, rat, or guinea pig. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas, and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, "zoological animal" refers to animals that may be found in zoos. Such animals may include non-human primates, big cats, wolves, and bears. In certain embodiments, the animal is a laboratory animal. Non-limiting examples of laboratory animals may include rodents, dogs, cats, and non-human primates. In certain embodiments, the animal is a rodent. Non-limiting examples of rodents include mice, rats, guinea pigs, etc. In a preferred embodiment, the subject is a human. [Example]

[0183] Example 1 - Introduction to the Example An estimated 12.5 million people worldwide suffer from autosomal dominant polycystic kidney disease (ADPKD), making it one of the most common monogenetic conditions known in humans. The clinical hallmark of ADPKD is the relentless growth of numerous fluid-filled cysts in the kidneys, which replace normal parenchyma and, over several decades, cause significant bilateral renal enlargement and renal failure. ADPKD results from heterozygous loss-of-function mutations in PKD1 (approximately 78% of cases) or PKD2 (approximately 15% of cases). The classical hypothesis for cyst initiation is that a germline inactivating mutation in one allele of the PKD gene, plus somatic inactivation (referred to as a second hit) in the other allele, causes a complete loss of polycystin expression in cells. However, in recent years, several lines of evidence have supported a gene dosage threshold as the mechanism responsible for cystogenesis. This hypothesis speculates that complete PKD1 loss is not necessary; rather, cyst formation occurs if functional PKD1 dosage falls below a critical threshold. Supporting the gene dosage model, inactivating second-hit mutations are not a universal feature, especially in smaller ADPKD cysts. Importantly, many individuals with ADPKD harbor missense (rather than inactivating) germline PKD1 mutations and therefore continue to have residual PKD1 expression. As proof of principle, reducing PKD1 dosage is sufficient to cause PKD in mice, pigs, and monkeys. Therefore, if dosage reduction causes ADPKD, increasing expression of the normal PKD1 allele could halt the disorder. However, despite this novel possibility, the factors governing PKD1 dosage in ADPKD are largely unknown, and currently, no mechanism for activating the normal PKD1 allele exists.

[0184] The 3'-untranslated region (3'-UTR), the portion of an mRNA immediately downstream of its translation stop codon, protects the mRNA from degradation and promotes translation via its poly(A) tail. Paradoxically, the 3'-UTR can also mediate mRNA translational repression or deadenylation through interactions with microRNAs (miRNAs). Most mRNA 3'-UTRs possess evolutionarily conserved miRNA-binding elements (MBEs), suggesting that cis-inhibition of translation is a widespread mode of gene output regulation. However, this intriguing aspect of 3'-UTR function remains poorly understood. Given that miRNAs primarily act as rheostats, modestly repressing mRNA targets, the prediction is that individual MBEs will have only a modest effect on host mRNA function. Contrary to this general logic, we reasoned that under certain circumstances, such as when gene dosage is already reduced due to haploinsufficiency, MBE-mediated cis-inhibition of the remaining allele may have a disease-modifying effect by governing final protein output.

[0185] In the following examples, the goal was to determine whether monoallelic PKD1 derepression is possible and how it affects preclinical ADPKD progression. PKD1 contains a miR-17 binding motif in its 3'-UTR, and miR-17 expression and activity are higher in ADPKD models. Therefore, we tested whether PKD1 mRNA is cis-inhibited by its 3'-UTR miR-17 motif, with the idea that blocking this inhibition would reverse PKD1 decline. Using CRISPR / Cas9 editing, we deleted the miR-17 motif from the PKD1 gene in a monoallelic ADPKD model. We found that eliminating the miR-17 motif was sufficient to improve Pkd1 mRNA stability, increase polycystin-1 (PKD1) expression, and reverse cyst growth in cellular, ex vivo, and mouse PKD models. The other ADPKD gene, PKD2, also contains a 3'-UTR miR-17 binding motif; notably, deletion of this miR-17 motif increases polycystin-2 (PKD2) levels and attenuates cyst growth in Pkd1 mutant models. Furthermore, acute pharmacological blockade of Pkd1 / 2 cis-inhibition prevents cyst development and stabilizes established PKD in mice. Finally, derepression of PKD1 or PKD2 has been shown to reverse cyst pathogenic events in primary renal cyst epithelium derived from individuals with ADPKD.

[0186] Example 2 - Pkd1 is cis-repressed via its 3'-UTR miR-17 binding motif. In this example, data are presented showing that cis-repression via the 3'-UTR miR-17 binding motif on Pkd1 mRNA can govern Pkd1 dosage. In initial experiments, we tested the effect of deleting this MBE in normal mouse kidneys. We designed an sgRNA that binds to Pkd1 exon-46, adjacent to the DNA segment encoding the miR-17 motif, and used CRISPR / Cas9 editing to transfect a Pkd1 allele lacking the miR-17 binding site (Pkd1 Δ17) were generated (Figure 1A). The motif deletion was verified by DNA PKDR and subsequent direct Sanger sequencing (Figure 1B-1C). 6-week-old and 18-week-old Pkd1 mice were analyzed. Δ17 / Δ17 This editing approach did not unintentionally inactivate Pkd1, as normal kidney histology and function were observed in the mice (Figures 1D-F and 7A-D). PKD1 levels were assessed using Western blot analysis using the 7E12 PKD1 antibody, which detects the full-length protein and the N-terminal fragment (see Methods for details). The 7E12 antibody was used to detect both wild-type and Pkd1. - / - As expected, PKD1 signaling was not observed in Pkd1-null cells (Figures 8A-8B). Despite the loss of miR-17 binding sites, PKD1 expression was significantly elevated in Pkd1-null cells at 6 or 18 weeks of age. Δ17 / Δ17 Pkd1 in mouse kidneys and their respective age-matched controls + / + The Pkd1 expression levels were similar between the normal adult mouse kidneys (Fig. 7D), implying that there was no Pkd1 cis-inhibition in the normal adult mouse kidneys.

[0187] Analysis of miRNA microarray datasets revealed that miR-17 levels decline with postnatal maturation (Figure 9). Therefore, the lack of Pkd1 cis-inhibition in the mature kidney may be due to low basal miR-17 activity. Therefore, embryonic (E) Pkd1 Δ17 / + and Pkd1 Δ17 / Δ17 The kidneys were analyzed. Specifically, ex vivo kidney organ cultures were analyzed to simultaneously evaluate Pkd1 expression and its effect on cyst formation. E13.5 littermates Pkd1 + / + , Pkd1 Δ17 / + and Pkd1 Δ17 / Δ17 Kidneys were cultured for 4 days in medium containing 100 μM 8-bromo-cAMP, 100 μM 8-bromo-cAMP + S-adenosylmethionine (SAM), or vehicle control (Figure 1G-H). cAMP significantly increased Pkd1 activity compared to vehicle treatment. + / +This increased renal cyst formation, and this effect was further enhanced by the addition of SAM. Interestingly, the pro-cystogenic effect of cAMP and SAM was also mediated by Pkd1. Δ17 / + and Pkd1 Δ17 / Δ17 Furthermore, immunoblot analysis revealed that Pkd1 + / + Compared with ex vivo cultured kidneys, Pkd1 Δ17 / + and Pkd1 Δ17 / Δ17 Higher PKD1 expression was observed in the cultured embryonic kidney (Fig. 1I). These data indicate that deletion of the miR-17 motif derepresses PKD1 and blocks the procystic effect of cAMP in the cultured embryonic kidney.

[0188] We next measured the relative abundance of wild-type and Δ17 transcripts within the total Pkd1 mRNA pool. Allele-specific primers were designed to take advantage of the unique mRNA sequence created by CRISPR / Cas9 editing of the Δ17 allele. qRT-PKDR was used to identify E15.5 heterozygous in vivo Pkd1 Δ17 / + In the kidney, the Δ17 allele was found to contribute nearly 50% more transcripts than its wild-type counterpart (Figure 1J). Similarly, the Δ17 allele increased ex vivo Pkd1 expression. Δ17 / + It was observed that miR-17 produced more Pkd1 mRNA than the wild-type allele in kidney cultures. This difference was even more pronounced in the presence of cAMP (Figures 10A-C). These observations further implicate the inhibition of wild-type Pkd1 mRNA by miR-17, but not the escape of repression and the subsequent suppression of Pkd1 in the embryonic kidney. Δ17 This means improved stability of the mRNA.

[0189] Example 3 - Endogenous monoallelic Pkd1 derepression alleviates polycystic kidney disease In this example, data are presented showing that Pkd1 is cis-repressed in ADPKD and that preventing this inhibition has disease-modifying effects. This is important because renal cyst formation occurs when PKD1 dosage falls below a critical threshold and no approach exists to reverse the decline in PKD1. First, Pkd1 RC / - We investigated a cellular ADPKD model, a mouse cell line derived from the collecting duct, that harbors a missense RC mutation in one Pkd1 allele, while the other is inactivated (Lakhia, R. et al., "Enhancer and super-enhancer landscape in polycystic kidney disease," BioRxv, 2021, biorxiv.org / content / 10.1101 / 2021.11.19.469306v1.full.pdf, incorporated herein by reference in its entirety). The mutation results in an arginine-to-cystine substitution of the two amino acids preceding the second transmembrane domain, resulting in reduced levels of mature (functional) PKD1 protein. The RC mutation maps to Pkd1 exon-30, significantly upstream of the miR-17 motif encoded by Pkd1 exon-46. This allows CRISPR / Cas9 editing to remove the 3'-UTR miR-17 motif from the RC allele (Pkd1 RCΔ17 / - ) (Figures 11A and 11B). Next, two independent Pkd1 RCΔ17 / - Clonal cell lines were generated and transfected with the unedited parent Pkd1 RC / - and Pkd1 RC / + The expression of PKD1 was characterized in Pkd1 cells. RC / + Compared with cells, Pkd1 RC / - It has been previously reported that PKD1 expression was reduced in cells. Notably, Western blot analysis using the 7E12 antibody revealed that elimination of the miR-17 motif reduced PKD1 expression. RCΔ17 / -We then used several independent assays to demonstrate that this degree of PKD1 derepression was sufficient to reverse several well-known pathogenic events associated with cyst growth. First, Pkd1 RC / - Cells express Pkd1 RC / + cells have a higher proliferation rate and 3D cyst size than Pkd1 cells, and this discrepancy is due to the RCΔ17 / - Second, cAMP, glucose, and SAM were normalized after derepression of PKD1 in cells (Figures 2B-C). RC / - increased cell proliferation, but Pkd1 RCΔ17 / - The cells were observed to be resistant to these growth-promoting stimuli (Figure 2D and Table 3 below). [Table 3] Raw percentage reduction values ​​are shown for each biological replicate. Results of one-way ANOVA followed by Tukey's post hoc multiple comparison test are listed.

[0190] Third, we used MitoTracker to assess mitochondrial membrane potential as a surrogate for oxidative phosphorylation and anti-PKDreb1 antibody immunofluorescence as a readout for c-AMP signaling. RC / + Compared with cells, we found that Pkd1 RC / - We observed a decreased MitoTracker signal and higher PKDreb1 expression in cells. RCΔ17 / - This was true for cells, which showed restored MitoTracker signal and reduced PKDreb1 expression (Figures 2E and 12B). Finally, immunoblot analysis revealed that Pkd1 RC / + Compared with cells, Pkd1 RC / - Elevated Yap1, PKDreb1, and c-Myc expression was revealed in Pkd1 cells. RCΔ17 / - The cells returned to baseline (Fig. 12C).

[0191] Based on these promising results, we then modeled the 3'-UTR Δ17 deletion in vivo. re+ ;Pkd1 RC / RC Fertilized eggs were prepared to eliminate the miR-17 motif from the Pkd1RC allele. These eggs were then implanted into pseudopregnant surrogate female mice, ultimately generating three germline-transmitted heterozygous KsPKD mice. re+ ;PKD1 RCΔ17 / RC Founder mice were generated. Using DNA, PKDR, and Sanger sequencing, it was determined that the miR-17 motif was indeed deleted from one RC allele in all three founder mice, while the other RC allele still contained the wild-type 3'-UTR (Figure 14). Mice with heterozygous Δ17 deletions were chosen because they were Pkd1 F / F By crossing mice with the following four related genotypes from the same mating pair: Pkd1 RC / F (Pkd1 RC / + ), Pkd1 RCΔ17 / F (Pkd1 RCΔ17 / + ), KsPKD re+ ;Pkd1 RC / F (Pkd1 RC / - ), and KsPKD re+ ;Pkd1 RCΔ17 / F (Pkd1 RCΔ17 / - Data from 18-day-old offspring of all three founders are shown in Figures 2F-2H. First, Pkd1 RCΔ17 / + It was noted that the mice maintained normal kidney histology and function, again indicating that deletion of the miR-17 motif does not disrupt Pkd1 and produce PKD (Figure 2F). For each founder offspring, decreased PKD1 expression, severe cystic kidney disease, increased kidney weight-to-body weight (KW / BW) ratio, and higher serum BUN levels were observed in Pkd1-deficient mice. RC / + Pkd1 than mice RC / - This was observed in mice (Figures 2F-J). Similar to cell lines, deletion of the miR-17 motif resulted in Pkd1 downregulation, as assessed using the 7E12 antibody. RC / - Pkd1 compared with kidney RCΔ17 / -This resulted in derepression of PKD1 in the kidney (Figure 2G). PKD1 derepression in cell lines and mice was verified using a second independent antibody generated by the University of Maryland PKD Center (see Example 8 for details) that detects the c-terminus of PKD1 (Figures 13A-13B). Furthermore, using paired-end RNA-seq, Pkd1 RC / - Pkd1 than kidney RCΔ17 / Higher RC allele usage was observed in the kidney, further indicating Pkd1 derepression (Figure 2J). Strikingly, cystic disease was almost completely alleviated, and KW / BW and serum BUN were significantly elevated in the kidney compared with Pkd1. RC / - Pkd1 compared to mice RCΔ17 / - The Pkd1 expression level was nearly normalized in the Pkd1 mice (Figure 2F-I). To examine the long-term effects, the offspring of founders #2 and #3 were prospectively followed for 8 and 18 weeks, respectively. The offspring of founder #2 displayed an aggressive cystic disease phenotype, and Pkd1 expression was significantly elevated in the Pkd1 mice. RC / - 76.4% (13 / 17) of the mice died of renal failure before 8 weeks of age (Figures 15A-15B). RC / - Mice showed severe PKD and near-fatal kidney failure. RCΔ17 / - Only 27.2% (6 / 22) of the mice died by 8 weeks, and surviving mice had fewer cysts and relatively preserved kidney function (Figures 15C-15E). RC / - The offspring survived to 18 weeks of age. However, these founders developed progressive renal failure as evidenced by mean blood urea nitrogen (BUN) of over 100 mg / dL and serum creatinine of over 0.4 mg / dL (Figure 3B). Founder #3 Pkd1 RCΔ17 / - Mice showed minimal disease progression, with mean BUN <30 mg / dl and serum creatinine <0.2 mg / dl (Figures 3A-B).

[0192] Large-scale transcriptome dysregulation, tubular proliferation and activation of oncogenic signaling, and interstitial inflammation are some of the key pathological features of ADPKD. Therefore, we next addressed whether these changes were blunted by PKD1 derepression. RNA-seq analysis was performed on 18-day-old Pkd1 mice. RC / + Mouse, Pkd1 RCΔ17 / + Mouse, Pkd1 RC / - Mice and Pkd1 RCΔ17 / - Using mouse kidney samples, we found that dysregulation of a broad network of gene transcripts was observed in non-cystic Pkd1 RC / + Compared with control kidneys, cystic Pkd1 RC / - Upregulation of Pkd1 mRNA was observed in 4157 and downregulation of Pkd1 mRNA in 2067 (Fig. 3C). RCΔ17 / + Pkd1 RC / + The gene expression pattern was almost identical to that of the kidney. RC / - >95% of dysregulated mRNA in the kidney is Pkd1 RCΔ17 / - Consistent with the RNA-seq data, immunoblot analysis showed improved (or normalized) expression of Pkd1 in the kidney (Figure 3C). RC / - Compared with 18-day-old Pkd1 mice, RCΔ17 / - A decrease in c-Myc and Yap1 was evident in the kidneys of mice (Figure 15F). Finally, immunofluorescence analysis revealed fewer anti-phospho-histone-H3 positive cells, indicating lower proliferation, and decreased anti-PKDreb1 and anti-MRC1 signals, suggesting Pkd1. RC / - Compared with 18-day- and 18-week-old Pkd1 mice RCΔ17 / - These findings suggest that c-AMP signaling and cyst-associated inflammation were attenuated in the mouse kidneys (Fig. 3D).

[0193] Example 4 - Prevention of Pkd2 cis-inhibition attenuates cyst growth in a Pkd1 mutant model. In this example, we investigated whether Pkd2 is cis-inhibited and whether preventing this autoinhibition could positively impact disease progression in a Pkd1 mutant model. This is important because there has been a long-standing question as to whether increased PKD2 can compensate for low PKD1. Interestingly, PKD2, like PKD1, has an evolutionarily conserved 3'-UTR miR-17 motif. Data from previous examples have shown increased miR-17 suppression activity in Pkd1 mutant ADPKD models. Therefore, to address these questions, we investigated Pkd1 RC / - Starting with a cellular model, we used CRISPR / Cas9 to delete the miR-17 motif from the 3'-UTR of Pkd2 (Pkd1 RC / - ;Pkd2 Δ17 / Δ17 ), while leaving the Pkd1 miR-17 motif intact (Figures 16A-B). Consistent with 3'-UTR cis-inhibition, using qRT-PKDR and immunoblot analysis, the unedited parental Pkd1 RC / - Compared with cells, two Pkd1 RC / - ;Pkd2 Δ17 / Δ17 Higher Pkd2 and PKD2 expression was observed in the clonal cell lines (Figure 4A). PKD1 expression remained unchanged between edited and unedited cells, demonstrating the specificity of the miR-17 motif deletion from the 3'-UTR of Pkd2 (Figure 17B). Surprisingly, Pkd1 RC / - Compared with cells, Pkd1 RC / - ;Pkd2 Δ17 / Δ17 In cells, we observed that derepression of PKD2 was associated with reduced 3D cyst growth, restoration of MitoTracker signal, and downregulation of PKDreb1, Yap1, Mettl3, and c-Myc expression (Figures 4B-D and S17B-C). As with the Pkd1 3'-UTR deletion, cAMP, glucose, and SAM downregulated Pkd1. RC / - It promoted cell proliferation, and this stimulatory effect was mediated by Pkd1 RC / - ;Pkd2 Δ17 / Δ17 It was found to be lost in cells (Fig. 4E, Table 4 below). [Table 4] The raw percentage reduction values ​​are shown for each biological replicate. The results of one-way ANOVA followed by Tukey's post hoc multiple comparison test are listed.

[0194] Pkd1 RC / - Our observations in cells suggest that preventing Pkd2 cis-inhibition and improving PKD2 expression can counteract and delay disease progression in Pkd1 mutant models, suggesting that the Pkd2 3'-UTR miR-17 motif mediates Pkd1 expression. RC / - Pkd2 is deleted in mice Δ17 / Δ17 Briefly, CRISPR / Cas9-edited KsPKD was tested in vivo by re ;Pkd1 RC / RC KsPKD using mice re ;Pkd1 RC / RC ;Pkd2 Δ17 / + These mice were then transfected with Pkd1 F / F By crossing with mice, the following four genotypes were finally generated: (i) Pkd1 RC / F ;Pkd2 + / + , (ii) Pkd1 RC / F ;Pkd2 Δ17 / Δ17 , (iii) KsPKD re ;Pkd1 RC / F ;Pkd2 + / + , and (iv) KsPKD re ;Pkd1 RC / F ;Pkd2 Δ17 / Δ17 Characterization of these mice revealed that deletion of the Pkd2 miR-17 motif in a non-cystic setting did not result in PKD2 upregulation and reduced Pkd1 RC / F ;Pkd2 + / + Mice and Pkd1 RC / F ;Pkd2 Δ17 / Δ17 Both mice exhibited normal kidney histology and function (Figures 4F and 4G). In contrast, cystic Pkd1 RC / -Pkd2 miR-17 motif deletion in mice was associated with higher PKD2 expression. RC / - ;Pkd2 + / + Compared with mice, Pkd1 RC / - ;Pkd2 Δ17 / Δ17 In mice, KW / BW and serum creatinine levels were reduced by 34.8% and 25%, respectively (Figures 4H-I). Consistently, Pkd1 RC / - ;Pkd2 + / + Compared with the kidney, Pkd1 RC / - ;Pkd2 Δ17 / Δ17 The kidneys were observed to exhibit reduced c-Myc and Yap1 expression (Figure 4G), as well as reduced cyst proliferation and interstitial inflammation (Figure 4J). As additional phenotypic characterization, RNA-seq analysis was performed to compare the kidney transcriptome profiles in the four groups of mice (Figure 4K). The mRNA expression patterns were significantly different between the four groups: Pkd1 and Pkd2. RC / F ;Pkd2 + / + and Pkd1 RC / F ;Pkd2 Δ17 / Δ17 The miR-17 motifs in Pkd2 are nearly identical in cystic kidneys, further suggesting that elimination of the Pkd2 miR-17 motif has minimal impact in non-cystic kidneys. RC / - ;Pkd2 + / + The kidneys are characterized by non-cystic Pkd1 RC / + ;Pkd2 + / + Pkd2 miR-17 motif deletion showed extensive mRNA dysregulation compared with control kidneys. RC / - ;Pkd2 Δ17 / Δ17 This was found to be associated with improved expression of nearly 50% of these dysregulated mRNAs in the IL-16 / ...

[0195] Example 5: Acute blockade of Pkd1 and Pkd2 cis-inhibition reverses PKD. This example provides data showing that acute blockade of cis-inhibition of Pkd1 and Pkd2 can reverse PKD. This is important because data presented in previous examples using CRISPR-edited clonal cells or mouse ADPKD models both result in chronic derepression of Pkd1 or Pkd2, and these data cannot explain whether acute derepression of Pkd1 / 2, as when cysts are forming, prevents disease onset or whether restoring Pkd1 / 2 can alleviate established PKD. To answer these questions, we used the anti-miR-17 oligonucleotide RGLS4326 as a tool to acutely block cis-inhibition of Pkd1 and Pkd2 (Lee, EC et al., Discovery and preclinical evaluation of anti-miR-17 oligonucleotide RGLS4326 for the treatment of polycystic kidney disease. Nat Commun 10, 4148, doi:10.1038 / s41467-019-11918-y (2019), incorporated herein by reference in its entirety). First, compared with vehicle (PBS) or a control oligonucleotide, RGLS4326 significantly inhibited Pkd1. RC / - RGLS4326 was confirmed to increase Pkd1 / 2 and PKD1 / 2 expression in IL-16 cells (Figures 5A-5B). The Pkd1 / 2-boosting effect of RGLS4326 was evident within 3 days of treatment. Importantly, RGLS4326 treatment increased Pkd1 and PKD1 / 2 expression in IL-16 cells (Figures 5A-5B). RCΔ17 / - and Pkd1 RC / - ;Pkd2 Δ17 / Δ17 RGLS4326 did not result in higher PKD1 and PKD2 levels in the cell lines, confirming that upregulation of polycystin by this oligonucleotide is dependent on the miR-17 motif in the Pkd1 / 2 3'-UTR (Figures 20B-C). RC / - Cells were incubated with PBS or control oligonucleotide-treated Pkd1 RC / -Compared to the RGLS4326 cells, they proliferated less, produced smaller cysts in 3D Matrigel culture, and showed lower Yap1, c-Myc, and PKDreb1 expression, as well as higher MitoTracker signals (Figures 19A-19E). The cyst-reducing effect of RGLS4326 was due to the Pkd1 RCΔ17 / - or Pkd1 RC / - ;Pkd2 Δ17 / Δ17 It is also present in cell lines but at a blunted level, and this compound inhibits Pkd1 RC / - These results suggest that the benefits of Pkd1 / 2 are primarily mediated through derepression of Pkd1 / 2 in cysts (Fig. 20D-G). RC / - The effects of acutely increasing Pkd1 / 2 in cells were examined. RC / - Cells were cultured in Matrigel for 4 days to allow cyst growth. These cysts were then treated with vehicle, control oligonucleotide, or RGLS4326 and monitored for an additional 3 days. Vehicle- and control oligonucleotide-treated cysts nearly tripled in size, whereas RGLS4326 treatment inhibited this growth (Figure 5C).

[0196] We then determined whether the observations in cells could be replicated in vivo. RC / - Mice were treated with vehicle (PBS), control oligonucleotide, or RGLS4326 starting at P10, the age at which cysts begin to form in this model. By P18, significant kidney enlargement was observed in PBS- and control oligonucleotide-treated mice compared with age-matched wild-type mice, with a >10-fold higher KW / BW ratio and elevated BUN and serum creatinine (Figures 5D-G). Surprisingly, PKD was virtually prevented, and renal function improved in P18 RGLS4326-treated Pkd1 mice. RC / - In a second study, Pkd1 RC / -Treatment began at P16, when mice had already developed cystic disease. By P26, one of 15 control oligonucleotide-treated mice had died, and surviving mice had developed progressive kidney enlargement and near-fatal renal failure. In contrast, RGLS4326-treated Pkd1 mice showed no significant changes in cystic disease. RC / - In Pkd1 / 2-KO mice, attenuation of PKD progression and stabilization of renal function were observed (Figures 5H-K). Finally, in a third study, the long-term effects of Pkd1 / 2 derepression were evaluated in mice that already had PKD. RC / - Mice were treated with vehicle, 20 mg / kg RGLS4326, or 20 mg / kg control oligonucleotide on P16 and P17. Mice then received the respective treatment regimen weekly until 18 weeks of age. RC / - A fourth group of mice received 20 mg / kg RGLS4326 treatment on P16 and P17, and every other week thereafter. RC / - 85.7% (12 of 14) of Pkd1-KO mice and control oligonucleotide-treated Pkd1 RC / - 100% (14 of 14) of Pkd1 -KO mice died of disease before 18 weeks of age. In contrast, Pkd1 -KO mice treated twice a month or weekly with RGLS4326 RC / - Seventy percent (7 of 10) and 50% (5 of 10) of mice survived to 18 weeks of age, respectively (Figure 5M). Furthermore, surviving mice in the RGLS4326 group had substantially preserved renal parenchyma (Figure 5L and Figures 21A-C) and reduced KW / BW (Figure 5N). Thus, acute pharmacological derepression of Pkd1 / 2 attenuates murine PKD, including after cyst development. Example 6: PKD1 Δ17 or PKD2 Δ17 Allele reduces cyst growth in patient-derived primary ADPKD cultures This example provides data demonstrating that PKD1 / 2 cis-inhibition is a hallmark of human ADPKD and that derepression of this motif in human cells reduces cyst growth in primary ADPKD cultures. In this example, cells derived from cysts of freshly discarded ADPKD nephrectomy samples from four affected individuals (three men aged 41, 48, and 52 years and one woman aged 57 years) were used. PKD1 and PKD2 mutation analysis was performed using DNA from cyst cells (Table 5 below). PKD1 and PKD2 mutation analysis was performed using genomic DNA from ADPKD donor cyst cells. DNA sequencing and mutation analysis were performed by Ambry Genetics. Details of the identified mutations in the four donor cell lines are shown. [Table 5]

[0197] Cell lines #1, #3, and #4 harbor heterozygous PKD1 mutations, whereas cell line #2 harbors a heterozygous truncating PKD2 mutation and a missense heterozygous PKD1 mutation. Due to technical issues, mutation analysis of cell line #4 was not possible. To assess the translational potential of our findings to mice, we used CRISPR / Cas9 editing to eliminate the PKD1 or PKD2 miR-17 motif in these primary ADPKD cultures (Figures 22A-D). Human-specific sgRNAs were designed to target the miR-17 motif in the 3'-UTR of PKD1 or PKD2. Primary ADPKD cultures from all four donors were then transfected with Cas9 and either the PKD1 or PKD2 3'-UTR sgRNA. Mock-transfected cells from each donor served as unedited parental controls. PKD1 Δ17 Higher PKD1 levels within 3 days of modeling the allele were observed in all four CRISPR-transfected cultures compared to their respective mock-transfected parental controls (Figure 6A). Δ17Modeling of the alleles resulted in higher PKD2 expression in CRISPR-transfected cultures than in their respective mock-transfected parental controls (Figure 6B). The functional significance of PKD1 or PKD2 derepression was assessed by performing Matrigel 3D cyst formation, Alamar Blue proliferation assays, live-cell MitoTracker labeling, and anti-PKDREB1 immunofluorescence. Δ17 or PKD2 Δ17 CRISPR-transfected cultures containing cells formed smaller cysts (Figures 6C-6F), exhibited lower proliferation rates (Figures 23A-B), higher MitoTracker signals, and lower PKDREB1 expression (Figures 6G-6H) compared to their respective mock-transfected unedited controls. These data suggest ongoing PKD1 / 2 cis-inhibition and the potential benefits of PKD1 / 2 derepression in human ADPKD cells.

[0198] Example 7 - Discussion of Examples 2 to 6 Examples 2-6 provide a viable framework for increasing endogenous PKD1 levels and show for the first time that monoallelic Pkd1 derepression is sufficient to alleviate preclinical PKD.

[0199] A unifying and concise explanation for the development of ADPKD is that cyst formation occurs when functional PKD1 dosage is reduced by 70% to 80%, below a critical threshold. Therefore, germline inactivation of only one PKD1 allele cannot explain this degree of dose reduction. Additional stochastic events that suppress the remaining allele are required and play a critical role in determining disease onset. In this regard, the data in the Examples herein demonstrate that miR-17-mediated inefficient translation of mRNA transcribed by the non-inactivated PKD1 allele represents a targetable somatically inhibited mechanism for ADPKD pathogenesis. As an attractive safety feature, miR-17-mediated inhibition of Pkd1 appears to be an ADPKD-specific phenomenon, as miR-17 levels are low in normal adult mouse kidneys and, therefore, were observed not to affect Pkd1 mRNA stability in the non-cystic setting. In contrast, the miR-17 miRNA family becomes activated in PKD models and appears to mediate Pkd1 suppression into adulthood, as evidenced by the attenuation of cyst growth with the anti-miR-17 drug RGLS4326, even when treatment is initiated at a late stage of the disease. It is important to note here that although RGLS4326 increases PKD1 levels, its benefit in later stages of the disease may stem from the simultaneous derepression of other miR-17 targets, including PKD2 and Ppara. This is because RGLS4326 acts on miR-17 itself, rather than on its mRNA target motif. While Examples 1-7 herein do not clarify whether directly targeting the miR-17 cis-inhibitory motif to Pkd1 mRNA would be beneficial, this data is presented in the subsequent Examples below. Another insight from this study is that potentially restoring hypomorphic Pkd1 mutants could be a beneficial therapeutic approach. Of note, elevating Pkd1 above wild-type levels, particularly for modalities using exogenous PKD1 replacement, results in cystic disease in mice.However, the methods used in these examples are unique in that they rely on preventing inhibition rather than transactivation, making it less likely that PKD1 will rise to the supratherapeutic range. As an indication that miR-17-mediated PKD1 inhibition may also be relevant in individuals with ADPKD, it was noted that deletion of the PKD1 miR-17 motif in primary human ADPKD cultures increased PKD1 and reduced 3D cyst growth and proliferation. Similarly, inhibition of miR-17 increased PKD1 levels and inhibited cyst growth and proliferation in primary human ADPKD cultures.

[0200] The previous examples also highlight the role of PKD1 in the continued expansion and growth of renal cysts. Following cyst initiation, PKD1 inhibition unleashes extensive transcriptomic and metabolic dysregulation, activating numerous oncogenic pathways, including cAMP and c-Myc / Yap. This downstream cyst pathogenic signaling is then thought to promote cyst expansion. Despite such widespread dysregulation, a recent elegant study reported that transgenic Pkd1 or Pkd2 reconstitution rapidly reversed established cystic disease in mice. Consistently, acute Pkd1 / 2 derepression was found to prevail in established cystic disease, rendering Pkd1 mutant cells resistant to pro-cystogenic stimuli, such as cAMP and SAM. Collectively, these observations point to PKD1 as a major, if not the only, factor governing cyst development and growth.

[0201] These examples also demonstrate the unexpected finding that Pkd2 influences the cystic phenotype of Pkd1 mutant models. PKD1 and PKD2 physically interact and are co-expressed at multiple intracellular locations, indicating that the two proteins function in the same physiological pathway. We add a new dimension by extending this relationship to pathological situations. Perhaps enhancing Pkd2 expression in Pkd1 mutant cells could improve PKD1 trafficking and / or allow more heteromeric PKD1-PKD2 protein complexes to form.

[0202] Finally, these examples provide new insights into miRNA biology. miRNAs are well known to simultaneously but subtly repress large mRNA networks. Our approach unravels and unifies this pleiotropy in the context of PKD. We designed a system in which miR-17 is prevented from binding to Pkd1 (or Pkd2), while its ability to interact with other mRNA targets remains intact. Surprisingly, eliminating just one 3'-UTR miR-17 motif significantly inhibits the repression of Pkd1. RC / - This study phenocopies the effects of inhibiting all of miR-17 in a model. Therefore, this study is one of the first to demonstrate that, in some circumstances, the majority of a miRNA's biological effects can be induced through the suppression of a handful of its targets. There are some similarities between this study and the miR-122-hepatitis C (HCV) infection axis in terms of targeting disease-central RNAs. However, the mechanism of miR-122 is unusual, as it targets the foreign HCV RNA genome, binds to the 5'-UTR, and supports HCV accumulation.

[0203] Most miRNAs are not essential for homeostatic tissue function and are relatively easily pharmacologically inhibited. Despite these favorable characteristics, miRNA-based drug development has stagnated compared to other forms of RNA therapeutics. This is, in part, because the pleiotropic molecular mechanisms of numerous downstream mRNA targets make it difficult to validate the biological effects of miRNAs or develop pharmacodynamic readouts for anti-miRNA drugs. These examples highlight the potential for a profitable drug development strategy to prioritize miRNAs that function as tonic inhibitors of a handful of disease-centric mRNAs. Importantly, these insights are transferable, and we can speculate that similar modes of therapeutically targetable cis-inhibitory regulation exist in other disorders, particularly haploinsufficient monogenic conditions.

[0204] Example 8 - Methods and materials of Examples 1-7. CRISPR / Cas9-mediated generation of 3'-UTR cell lines: The miR-17 binding site was deleted from the 3'-UTR of Pkd1 or Pkd2 using CRISPR / Cas9. sgRNAs were designed using www.benchling.com and ordered from IDT. The sgRNA pair targeted DNA sequences upstream and downstream of the miR-17 motif in the Pkd1 or Pkd2 gene. The sgRNAs were cloned into the CRISPR mammalian expression vector pSPKDas9(BB)-2A-GFP as described by Ran, FA et al. (Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308, doi:10.1038 / nprot.2013.143 (2013), incorporated herein by reference in its entirety). These plasmids encoding sgRNAs were used to express Pkd1. RCΔ17 / - Cell lines and Pkd1 RC / - ;Pkd2 Δ17 / Δ17 The cell lines were generated as follows: Pkd1 RCΔ17 / -To generate cell lines, 0.6 μg of SPKDas9-2A-GFP plasmid carrying the upstream or downstream sgRNA was transfected into Pkd1 cells using Lipofectamine 3000. RC / - Cells were transfected with the PKDR-1111 gene. After 72 hours, FACS was performed to select GFP-positive cells with the highest 5% intensity. These cells underwent clonal expansion in 96-well plates. Fully formed colonies were screened for the absence of miR-17 binding sites by DNA PKDR in the targeted Pkd1 genomic sequence. Clones with the expected deletion band were confirmed by Sanger sequencing. Two Pkd1 deletions were confirmed. RCΔ17 / - The clonal cell lines were further characterized and analyzed along with their parental control cell lines, as shown in Figures 2A-2J and 10A-10C. RC / - ;Pkd2 Δ17 / Δ17 The same strategy and experimental approach was used to generate cell lines (Figures 4A-4K and 14). The sgRNA sequences and genotyping primers are shown in Tables 6-7 below. [Table 6] [Table 7]

[0205] CRISPR / Cas9-mediated generation of 3'-UTR mice: The following mouse strains were used: (1) For the mouse model shown in Figure 1, wild-type C57BL / 6N female and male mice were used. (2) For the mouse models shown in Figures 2 and 4, KsPKD mice maintained on a C57BL / 6J background by our laboratory were used. re ;Pkd1 RC / RCMice were used. Prepubertal female mice were superovulated using a standard hormonal regimen. Epididymis samples were collected from male mice for sperm collection. After in vitro fertilization, one-cell zygotes were isolated. CRISPR reagent (IDT) was delivered into the cytoplasm by electroporation using a Nepa21 Super Electroporator (NEPAGENE, Ichikawa, Japan). Eggs surviving electroporation were washed and cultured in microdroplets in fresh M16 medium. Eggs were then surgically transferred into the oviducts of day-1 pseudopregnant ICR females. At 21 days of age, founder mice were screened for deletion of the miR-17 binding site by genotyping, and deletion confirmation was performed by Sanger sequencing.

[0206] ADPKD mouse model: KsPKD re , Pkd1 F / F , and Pkd1 RC / RC Mice were used in this study. All mice were maintained on a C57BL / 6J background. At pre-specified time points, mice were anesthetized using an approved protocol, and blood was obtained by cardiac puncture. The right kidney was weighed to obtain the KW / BW ratio and immediately snap-frozen for future molecular analysis. The left kidney was perfused with ice-cold 1x PBS and 4% (wt / vol) paraformaldehyde. The kidney was then paraffin-embedded. All studies used equal numbers of males and females. The UT Southwestern Institutional Animal Care and Use Committee approved all experiments involving animals.

[0207] Pkd1 RC / + and Pkd1 RC / - Cell line: Pkd1 RC / + and Pkd1 RC / - is an isogenic collecting duct-derived epithelial cell line. These cells were isolated from 14-day-old Pkd1 RC / floxThe tissue was prepared from the kidneys of male mice. Renal tissue was minced into 1 mm cubes and subsequently incubated in DMEM containing 5% collagenase (Sigma #C1639, USA) for 40 minutes at 37°C with intermittent agitation to prepare a single-cell suspension. The cells were then incubated with biotinylated Dolichos biflorus agglutinin (DBA, a collecting duct marker) (Vector Labs #B-1035) for 1 hour. DBA-positive cells were isolated using the CELLection Biotin binder kit (Invitrogen #11533D). The cells were then immortalized using the SV40 T Antigen Cell Immortalization Kit (Alstem #CILV01). One SV40-positive immortalized Pkd1 RC / Flox Clones were infected with an adenovirus expressing Cre recombinase (Vector Biolabs #1779) to delete the floxed allele, thereby deleting Pkd1 RC / - Cells were generated. Genotyping confirmed recombination of the floxed allele. Genotype Pkd1 RC / + An uninfected parental clone carrying the floxed allele (where "+" is the floxed allele) is used as a control. These cells are maintained at 37°C in epithelial cell culture medium (Dulbecco's modified Eagle's medium / Ham's F-12 medium) supplemented with 2% fetal bovine serum, insulin (8.3 × 10 m), prostaglandin E1 (7.1 × 10 m), selenium (6.8 × 10 m), transferrin (6.2 × 10 m), triiodothyronine (2 × 10 m), dexamethasone (5.09 × 10 m), and recombinant gamma-interferon (10 units / ml).

[0208] Pkd1 + / + and Pkd1 - / - Cell line generation: Pkd1 + / + and Pkd1 - / - The cells are an isogenic renal tubule-derived epithelial cell line. These cells were cultured at 12 days of age. F / FThe tissue was prepared from the kidneys of male pups. The kidneys were isolated and minced into 1 mm cubes. The tissue was incubated in DMEM containing 5% collagenase (Sigma #C1639, USA) at 37°C with intermittent agitation for 40 minutes to create a single-cell suspension. Cells were then strained using a 40-micron cell strainer and incubated with biotinylated Dolichos biflorus agglutinin (DBA) (Vector Labs #B-1035) for 1 hour. DBA-positive cells were isolated using the CELLection Biotin binder kit (Invitrogen #11533D). Cells were then immortalized using the SV40 T Antigen Cell Immortalization Kit (Alstem #CILV01) and cultured via clonal expansion. Clones were screened for the SV40 marker by genotyping, and one clone was selected for further culture. Adenovirus expressing Cre recombinase (Vector Biolabs #1779) was transfected into Pkd1 so that the floxed allele could be excised. F / F By infecting cells with Pkd1 - / - Infected cells were cultured by clonal expansion. Clones were genotyped to confirm successful recombination and deletion of both Pkd1 alleles. Parental Pkd1 F / F and Pkd1 - / - The cells were further characterized by qRT-PKDR and Western blot analysis (Figure 8A-B). These cells are grown and maintained in epithelial cell culture medium as described in the section above.

[0209] Histology: Tissue embedding in paraffin and subsequent sectioning were performed using standard protocols by the Histology Core at UT Southwestern Medical Center. Tissues were cut into 5 μm sections and stained with hematoxylin and eosin (H&E) for histological analysis. Stained sections were imaged using a slide scanner.

[0210] RNA: The Qiagen miRNEASY kit was used for total RNA extraction. cDNA was prepared using the Invitrogen First Strand Superscript III cDNA Synthesis Kit. Q-PKDR was performed using iQ SYBR Green Supermix (Bio-Rad). All samples were loaded in duplicate or triplicate onto the CFX Connect™ Real-Time PKDR Detection System. mRNA expression was normalized using 18s. Primer sequences are listed in Table 8. [Table 8]

[0211] PKD1 and other Western Blots: Total protein was isolated from kidneys or cells using a lysis buffer made by mixing T-PER Tissue Protein Extraction Reagent (Invitrogen, Cat. No. 78510) with protease phosphatase inhibitor tablets (Fisher, Cat. No. PIA32961) according to the manufacturer's instructions. Lysis buffer was prepared and stored in single-use aliquots at -80°C. Aliquots were thawed on ice immediately prior to protein isolation. Protein concentrations were measured using the Bradford Assay reagent. Protein samples were prepared in 4x NuPAGE LDS sample buffer containing 0.5% b-mercaptoethanol (Sigma, Cat. No. M6250) for all proteins except PKD1 and PKD2 and their loading control β-actin, which were prepared with 0.1 M DTT (Sigma, Cat. No. D0632). Samples were always prepared fresh before gel electrophoresis. BME samples were boiled at 98°C for 5 min before loading onto the gel. The DTT samples were incubated at 25°C for 10 min before loading onto the gel.

[0212] For full-length PKD1 detection, samples were run on NuPAGE™ 3-8% Tris-Acetate Protein Gels (Invitrogen, EA03785) at 160 V on ice for 1.5 hours. A high-molecular-weight protein ladder (Invitrogen, catalog no. LC5699) was used on each gel to track the 460 kDa protein. Electrophoretically separated proteins were transferred using the Invitrogen transfer system at 200 mAmps for 100 minutes on ice or at 4°C. Samples containing 10 μg of protein were run on mini-PROTEAN SDS-polyacrylamide precast gels to detect other proteins. A standard molecular weight ladder was used on each gel to track protein size. Gels were run at 150 V until the dye washed out. Proteins were transferred to nitrocellulose membranes using the Trans-Blot semi-dry transfer system with a mixed MW program.

[0213] After transfer was complete, the membrane was blocked with 5% nonfat milk and probed with primary antibodies overnight at 4°C. The membrane was washed three times with 1x TBS-Tween® the following morning before and after 1 hour of secondary antibody probing. Goat anti-rabbit or anti-mouse HRP-conjugated IgG was used as the secondary antibody. Total protein was measured using an HRP-conjugated actin antibody (Sigma, catalog no. a3854). Blots were developed using Pierce's chemiluminescent substrates SuperSignal West Dura, ECL, or Femto. Blots were developed using a Bio-Rad digital imager. Protein bands were quantified using Bio-Rad's Imagelab software. Each Western blot was repeated at least three times. Ten micrograms of protein from cells or kidneys was run on the gel to detect proteins smaller than 150 kDa. 40–60 μg of protein was run on the gel to detect the heavy (462 kDa) full-length PKD1 protein. All primary antibodies were used at a dilution of 1:1000, except for PKD1 (used at a dilution of 1:500). Secondary antibodies were used at a dilution of 1:5000. The following primary antibodies were used: PKD1 (7E12 Santa Cruz, catalog number sc-130554); PKD1 E8-8C3C10 (Baltimore PKD Core Center); PKD2 (gift from the Baltimore PKD Core); PKDREB (Cell Signaling, catalog number 9198); c-Myc (Abcam, catalog number ab185656); YAP1 (Cell Signaling, catalog number 4912); and Mettl3 (Invitrogen, catalog number MA5-27527).

[0214] Immunofluorescence in tissue samples: Paraffin sections of kidney tissue were used for immunofluorescence staining. Briefly, slides were first baked at 60°C for 1 hour and then deparaffinized by washing three times in Histo-clear (Fisher, HS-2001) for 5 minutes each. Next, slides were rewetted through 100%, 95%, and 70% ethanol washes before incubation in 1x PBS. Slides were then subjected to antigen retrieval with sodium citrate. Slides were treated with sodium borohydride to quench autofluorescence for 40 minutes. Slides were washed three times in 1x PBS and then blocked in 1x PBS + 10% goat serum + 0.1% BSA (antibody block) for at least 1-2 hours at room temperature. Sections were incubated overnight with primary antibodies. Primary antibodies were diluted in antibody block at a 1:500 dilution. Slides were washed three times with 1x PBS for 5 minutes each, treated with Alexa Fluor secondary antibody (diluted 1:500 using antibody block) for 1 hour, and then washed three times for 5 minutes each. Slides were mounted using Vecta Shield containing Dapi. Slides were imaged using a Zeiss Compound Light microscope or a Zeiss Axioscan Z1 slide scanner. The following antibodies were used: DBA (Vector Labs, catalog no. B-1035), THP (Biomedical Technologies, catalog no. BT-590), LTA (Vector Labs, catalog no. B-1325), MRC1 (Abcam, catalog no. ab64693), PKDREB1 (Cell Signaling, catalog no. 9198), and pHH3 (Sigma, catalog no. H0412). Slide processing, immunostaining, and imaging were performed simultaneously within each experiment.

[0215] Immunofluorescence in cells: Immunofluorescence staining was performed on cells grown on 8-chamber slides (Fisher, catalog no. 154534PK). Cells were fixed with 100% ice-cold methanol for 5 minutes at 4°C. Slides were washed three times for 5 minutes with 1x PBS. Cells were then blocked for at least 30 minutes at room temperature in 1x PBS + 10% goat serum + 0.1% BSA + 0.1 M glycine + 0.1% Tween 20 (antibody block). Primary antibodies were diluted at a 1:100 dilution using the antibody block and applied to the slides for 2 hours. Slides were washed three times for 5 minutes each with 1x PBS, treated with Alexa Fluor secondary antibodies (diluted at a 1:500 dilution using the antibody block) for 1 hour, and then washed three times for 5 minutes each. Slides were counterstained with DAPI (Fisher, catalog no. ICN15757410) diluted 1:10,000 in distilled water for 10 minutes before imaging on a Zeiss Compound Light microscope. For each experiment, control and treated or control and Δ17 cells were seeded simultaneously in different chambers of the same slide. Slides were also processed, immunostained, and imaged simultaneously.

[0216] MitoTracker analysis: Mitochondrial membrane potential was analyzed in live cells using MitoTracker Red CMXRos (Thermo Fisher, catalog number M7512). Lyophilized MitoTracker® products were dissolved in dimethyl sulfoxide (DMSO) to a final concentration of 1 mM and stored in small aliquots at -20°C. Cells grown to 40-70% confluency were washed with sterile PBS and then treated with regular DMEM serum-free medium containing 100 nM MitoTracker for 8 minutes. Immediately after, the medium was replaced with regular growth medium and imaged under a Zeiss Compound Light microscope. Images were taken with the same exposure time for samples from the same experiment. The intensity of fluorescence is directly proportional to the membrane potential.

[0217] 3D cyst formation assay: Twenty-five microliters of 100% Matrigel (Fisher, catalog no. 354234) was spread onto each well of an eight-chamber slide using a pre-chilled 200-microliter sterile pipette tip. The plate was then placed in a 37°C incubator for 30 minutes to allow the Matrigel to solidify. During this time, cells were trypsinized, washed once with PBS, and filtered through a 40-micrometer cell strainer to create a single-cell suspension and counted. Cells were seeded onto Matrigel-coated slides at a seeding density of 5,000 cells / well in 300 μl of growth medium containing 2% Matrigel. For each cell line or treatment condition, cells were seeded in triplicate and incubated at 37°C for 7 days to allow for the growth of 3D cysts in suspension. During this period, wells were replenished with growth medium 72 hours after initial placement in the Matrigel. On day 7, the chamber slides were imaged with a Leica DMI 3000B light microscope. Images were analyzed using ImageJ software, and cyst size measurements were obtained. Each assay was repeated at least three times. Measurements from each experiment were combined and analyzed for statistical significance.

[0218] In vitro organ culture: Latent Pkd1 + / + ;Pkd1 Δ / + , and Pkd1 Δ / Δ Female mice bearing embryos were dissected in PBS at embryonic day (E) 13.5 to collect the kidneys and tails. The tails of each embryo were used for DNA extraction and subsequent genotyping. 28Kidneys were placed for culture on Whatman membranes (Sigma, catalog no. WHA110409) at the air-medium interface as described in

[14] . Kidneys were cultured in basal DMEM (Thermo Fisher, catalog no. 12500) containing 10% fetal bovine serum (FBS), 2% PenStrep (Invitrogen, catalog no. 1514022), 5 μg / ml insulin, 5 μg / ml transferrin, 2.8 nM sodium selenite, 25 ng / ml prostaglandin E, and 32 pg / ml T3. One kidney was grown in the above medium, while the contralateral kidney was grown in medium supplemented with 100 μM 8-Br-cAMP (Sigma, catalog no. B7880). A second cohort of mice was used to grow one kidney in 100 μM 8-Br-c-AMP or 100 μM 8-Br-c-AMP + 250 μM SAM. For all cultures, medium was changed every 48 hours. Cultures were imaged live using a Zeiss Stereo Lumar microscope on day 4. Cysts were measured and analyzed using ImageJ software. At the end of the 6-day period, kidneys were snap-frozen and stored at -80°C until further use for RNA or protein extraction.

[0219] Alamar Blue Assay: Pkd1 RC / - and Pkd1 RCΔ17 / - Cells (density 3×10 3 ) were seeded into 96-well plates. The next morning, the medium was changed to contain 1x AlamarBlue reagent (Invitrogen, Cat. No. DAL1025) and vehicle, 100 μM 8-Br-cAMP, 100 μM SAM, or 17 mM glucose. Colorimetric readings were taken at 570 nm and 600 nm on a microplate reader after 12 hours. Cell proliferation was quantitatively assessed using the AlamarBlue redox reaction. N=8 for each condition. Values ​​were plotted as a scaled heatmap using the Python MatplotLib package. The same experimental approach was used for Pkd1. RCΔ / - ;Pkd2 Δ17 / Δ17 Pkd1 cells and control cells RC / -;Pkd2 + / + was used.

[0220] Serum electrolytes: Serum creatinine was measured by capillary electrophoresis at the UT Southwestern O'Brien Center, and BUN was measured by a Vitros250 Analyzer at the UT Southwestern Metabolic Phenotyping Core.

[0221] Microarray analysis of microRNAs: Total RNA was extracted from kidneys using the miRNeasy Mini Kit (Qiagen). Small RNA fractions (<300 nucleotides) were hybridized on μParaflo Microfluidic chips containing detection probes for all mouse microRNAs (miRNAs) in miRBase version-17 (miRBase, http: / / microrna.sanger.ac.uk / sequences). The hybridized microarray chips were labeled with fluorescent dyes and laser scanned to obtain fluorescent images. Signal values ​​for each sample were derived by background subtraction and normalization. Microarray chip hybridization, fluorescent labeling, laser scanning, and background subtraction and normalization were performed by LC Sciences. Signal values ​​for each of the five age groups (P2, P7, P14, and P35) were averaged, and P values ​​were calculated using one-way ANOVA. Differentially detected signals were defined as P<0.05.

[0222] RNA-seq preprocessing: Sequencing quality control was performed using FastQC v0.11.8. RNA-seq reads were trimmed and low-quality reads were removed using Trimgalore v0.6.3_dev (www.bioinformatics.babraham.ac.uk / projects / trim_galore / ) with the "pairs" parameter and a length of 150 bps. Trimmed fastq sequences were aligned to the mouse reference genome GRCm38 using STAR aligner v2.5.3a, and the generated bam files were sorted by coordinate using the option "--outSAMtype BAM SortedByCoordinate." Raw read gene counts were obtained using STAR aligner with the options "-quantMode GeneCounts" and "--sjdbGTFfile" with GTF-formatted gene models obtained from mouse EnsEMBL release 94. Alignment quality control and read mapping statistics were obtained from Picard tools v2.20.3 using the function “CollectMultipleMetrics” (broadinstitute.github.io / picard / ).

[0223] RNA-seq data analysis: Raw gene counts were used for quality control and differential expression analysis. Raw counts were normalized to the total number of reads by calculating log2CPM (counts per million). We carefully examined the relationship between the log2CPM distribution and its standard deviation and determined an appropriate cutoff (mean Log2CPM<-3) to eliminate low-expressing genes before differential gene expression analysis. TPM (transcripts per million) quantification was performed using RSEM v1.3.1, and differential gene expression analysis was performed using R. 58,59 This was done using limma-trend (version 3.40.6).

[0224] Transcript quantification: Quantification of individual Pkd1 transcripts was performed using Salmon v1.3.0 60This was done using [the RefSeq mm9 fasta reference transcriptome]. Five distinct transcript versions of Pkd1 were added to the RefSeq mm9 fasta reference transcriptome to construct a novel Salmon index. Fastq files were then directly mapped, read counts were generated, and TPM values ​​were quantified using standard processes.

[0225] In vitro RGLS4326 experiments: Pkd1 RC / - 2 x 10 cells in a 6-well plate 5 Cells were seeded at confluence. The next morning, cells were transfected with vehicle, control oligonucleotide, or RGLS4326 at a final concentration of 100 μM using Lipofectamine 3000. 48 hours after transfection, cells were harvested for RNA extraction. 72 hours after transfection, cells were harvested for protein or further seeded for Alamar Blue assay and 3D cyst formation assay. For the experiments shown in Figure 5C, the 3D cyst formation assay was performed using untreated Pkd1 cells as described in the 3D cyst formation assay methods section with the following changes: RC / - On day 4 of Matrigel culture, wells were imaged using a Leica DMI 3000B light microscope. Cultures were then transfected with vehicle, 100 μM control oligonucleotide, or 100 μM RGLS4326 and grown for an additional 3 days. On day 7, samples were imaged to assess cyst size.

[0226] RGLS4326 Mouse Experiments: KsPKD re ;Pkd1 F / RC The mouse strains used for the drug study were randomly assigned and administered 20 mg kg -1Mice were administered vehicle (PBS), control oligonucleotide, or RGLS4326. For the first cyst prevention study (Figure 5D-G), mice were injected on postnatal days (P) 10, P11, P12, and P16 and sacrificed on P18. Non-transgenic strain-matched mice were also sacrificed on the same days. For the second disease stabilization study (Figure 5H-K), mice were injected on P16 and P17 and sacrificed on P26. One mouse from the study succumbed to the disease and died before 26 days of age. For the third long-term study (Figure 5L-N), mice were injected on P16 and P17 and then weekly until 18 weeks of age. Another cohort of mice received the same dose of RGLS4326 treatment on P16 and P17, then every two weeks until 18 weeks of age. Mice were observed daily for 18 weeks and noted for mortality. At the end of the 18 weeks, surviving mice were sacrificed and tissues were harvested. Equal numbers of males and females were used in all study groups.

[0227] Human ADPKD cell experiments: Primary human ADPKD cyst cells were obtained from the PKD Research Biomarker and Biomaterial Core at the University of Kansas Medical Center (KUMC). The use of surgically discarded kidney tissue was approved by the University of Kansas Medical Center's Institutional Review Board in accordance with federal regulations. PKD1 and PKD2 mutation analysis of DNA from donor cyst cells was performed by Ambry Genetics (Aliso Viejo, CA). Each primary cell line was cultured in 10% FBS, 5 μg kg -1 Insulin, 5 μg mL -1 Transferrin and 5ng mL -1Cells were cultured in DMEM / F12++ (Gibco, catalog no. 10565-018) supplemented with sodium selenite and incubated at 37°C in an atmosphere of 95% air and 5% CO2 until 80% confluency was reached. At the second passage, cells from each human donor were reverse transfected using CRISPRMAX reagent (Invitrogen) containing Cas9 protein (IDT) and synthetic sgRNA (IDT) or transfected with vehicle (lacking Cas9). Cas9 / sgRNA-transfected cultures are a mixed population of edited and unedited cells. Clonal expansion was not possible because these are primary cells, allowing only a limited number of passages. Cas9-transfected or vehicle-transfected (control) cells were then seeded into 6-well plates and chamber slides. After 72 hours, cells were harvested for genotyping, Western blot analysis, and immunofluorescence / MitoTracker staining. Additionally, 72 hours after transfection, cells were trypsinized and plated at a density of 4000 cells / well in 130 μl of medium plus Matrigel (Corning, catalog no. 354234) in 96-well plates (Corning, catalog no. 353072). Medium was replenished 72 hours after initial plating in Matrigel. Cyst images were obtained on day 7 of Matrigel culture (day 10 after Cas9 / SgRNA or vehicle transfection). One hundred cyst images were obtained for Cas9- or vehicle-transfected cells from each donor. Similarly, 72 hours after transfection, cells were plated at a density of 2000 cells / well in 96-well plates for Alamar Blue proliferation assays. The next day, the medium was replaced with growth medium containing 1x Alamar Blue, and readings were taken 12 hours later.

[0228] Statistics and reproducibility: All experiments were performed with at least three biological replicates and demonstrated successful reproducibility. For in vivo experiments, N is the number of mice analyzed. For in vitro experiments, N refers to the number of biological replicates. A two-tailed Student's t-test was used for pairwise comparisons and analysis of variance (ANOVA), followed by Tukey's post-hoc test for multiple comparisons. The Mantel-Cox test was used to analyze mouse survival. All data were analyzed using Prism software (GraphPad Software). P<0.05 was considered statistically significant. Sample sizes and P values ​​are listed in the figure graphs, figure legends, or results section. For the RGLS4326 study, animals were randomly assigned to treatment arms. Investigators were not blinded to the animal treatments or genotypes.

[0229] Data availability: The RNA-seq dataset has been deposited in the NCBI Gene Expression Omnibus repository under accession number GSE196237 [www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE196237]. The microarray dataset has been deposited in the NCBI Gene Expression Omnibus repository under accession number GSE208429 [www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE208429].

[0230] Example 9 - Design and validation of Pkd1 stabilizing oligos in mouse kidney epithelial cell lines To test whether PKD1 dosage can be regulated by directly targeting miR-17 engagement with Pkd1 mRNA, PKD1-stabilizing oligos were designed that bind to the 3' untranslated region (UTR) of PKD1 mRNA. A schematic representation of the action of these oligos is shown in Figure 24A, and the alignment to the 3'UTR is shown in Figure 24B. As shown in Table 9 below, three oligos were generated that target mouse or human Pkd1 mRNA or mouse / human Pkd2 mRNA. The two ASOs targeting mouse or human Pkd1 mRNA are hereinafter referred to as "Oligo 1" and "Oligo 2," respectively. [Table 9]

[0231] mIMCD3 cells were transfected with the pls-PKD1-3'-UTR reporter plasmid, a microRNA mimic (sc or miR-17), and scrambled (ctl) or Pkd1 oligo (SEQ ID NO: 1). Luciferase levels were then measured 72 hours after transfection as a reporter of PKD1 expression (see Methods in Example 13). Figure 24C shows that cells treated with Pkd1 oligo (SEQ ID NO: 1) increased the signal and thus PKD1 expression. On the other hand, qRT-PKDR analysis of Pkd1 mRNA spanning exons 4-5 in scrambled and Pkd1 oligo-treated mouse kidney epithelial cells showed no change in Pkd1 transcripts (Figure 24D). Furthermore, Pkd1 oligo binding prevented cDNA synthesis at the Pkd1-3'-UTR binding site, as evidenced by the lack of Pkd1 3'-UTR transcript detection in Pkd1 oligo-treated cells (Figure 24E). The increase in PKD1 expression was confirmed using Western blots showing increased polycystin 1 (PKD1) in kidney epithelial cells treated with Pkd1 oligos (Figure 24F).

[0232] Example 10 - Pkd1-oligo stabilizes Pkd1 mRNA and slows cyst growth in Pkd1 mutant cell lines. In this example, data are presented showing that Pkd1 oligos can stabilize Pkd1 mRNA and slow cyst growth in model cell lines. RC / - Cells were transfected with Pls-PKD1-3'-UTR reporter plasmid along with Pkd1 (SEQ ID NO: 1) or scrambled oligos, and Pkd1-3'-UTR activity was monitored using luminescence. As shown in Figure 25A, luminescence activity measured after 72 hours indicated increased Pkd1-3'-UTR activity in Pkd1 oligo-treated cells. In a separate experiment, Pkd1 RC / - Cells were transfected with Pkd1 (SEQ ID NO: 1) or scrambled oligos and then analyzed by qRT-PKDR for transcripts spanning exons 4-5 and encompassing the Pkd1 3'-UTR. As shown in Figure 25B, in Pkd1 oligo-treated cells, the overall level of Pkd1 mRNA was unchanged, but the level of Pkd1 3'-UTR transcript was depleted. Thus, Pkd1 oligo binding prevents cDNA synthesis at the Pkd1-3'-UTR binding site.

[0233] In another experiment, Pkd1 transfected with scrambled oligos or Pkd1 oligos (SEQ ID NO: 1) RC / - Cells were treated with actinomycin to inhibit transcription 48 hours after transfection. Samples were taken at 0, 4, and 8 hours to measure mRNA transcript abundance. Pkd1 mRNA degradation is inhibited by Pkd1 oligos (Figure 25C). c-Myc transcripts are degraded equally in both scrambled and Pkd1 oligo-treated samples (Figure 25D).

[0234] In another experiment, Pkd1 RC / + and Pkd1 RC / - Cells were plated in 6-well plates (1 × 10 per well). 5Cells) were seeded onto 1000-well plates and transfected the next morning with the pDAC565 plasmid (Addgene #195242) also carrying a guide RNA targeting exon 4 of the Pkd1 gene (e.g., CAGCCACGCCAGACCACAGTTGCACTCAAATG (SEQ ID NO: 39)) using Lipofectamine 3000 (Invitrogen) to reach a final concentration of 40 nM. After 48 hours, cells were visualized under a 40x fluorescent microscope. Quantification of Pkd1 mRNA abundance was performed by counting the number of plasmid-transfected cells (indicated by background green fluorescence in the nuclei) that displayed punctate or cloud-like signals expressing GFP (indicating Pkd1 mRNA). 200 cells with GFP emission were counted per condition. Each experiment was completed in triplicate. Figure 25E shows a representative fluorescent image of the treated cells. Figure 25F shows a graphical plot of the percentage of cells with detected Pkd1 mRNA. Pkd1 RC / + Cells and Pkd1 RC / - We found that there was a 50% reduction in Pkd1 mRNA detection between the cells (Figures 25E-F).

[0235] To determine whether Pkd1 oligos could rescue the loss of Pkd1 mRNA levels after knockdown, we RC / - Cells were plated in 6-well plates (1.5 × 10 cells per well). 5Cells) were seeded onto the cells and transfected the following morning with scrambled or Pkd1 oligos (SEQ ID NO: 1) and the pDAC565 plasmid (containing a guide RNA targeting exon 4 of the Pkd1 gene) using Lipofectamine 3000 (Invitrogen) to reach a final concentration of 40 nM. After 48 hours, cells were visualized under a 40x fluorescence microscope. Quantification of Pkd1 mRNA abundance was performed by counting the number of plasmid-transfected cells (indicated by background green nuclear fluorescence) that displayed punctate or cloud-like signals expressing GFP (indicating Pkd1 mRNA). 200 cells with GFP emission were counted per condition. Each experiment was completed in triplicate. Figure 25G shows a representative fluorescence image of treated cells. Figure 25H shows a graphical plot of the percentage of cells with detected Pkd1 mRNA. In cells treated with Pkd1 oligos, Pkd1 mRNA detection is significantly increased compared to scrambled oligos (Figures 25G-H).

[0236] Pkd1 was then transfected with scrambled oligos or Pkd1 oligos (SEQ ID NO: 1). RC / - Cells were analyzed for PKD-1 expression, cyst size, and mitochondrial activity. As shown in Figure 25I, Pkd1 oligo-treated Pkd1RC / - cells (pink) showed increased polycystin-1 protein (PKD-1) expression compared to scramble-treated cells (purple). Similarly, Figure 25J shows that Pkd1 oligo-treated Pkd1RC / - cells (pink) showed reduced cyst size compared to scramble-treated cells (purple). Finally, Pkd1 oligo-treated cells showed enhanced mitochondrial activity (red) and reduced PKDREB expression (green) as measured by MitoTracker signal (Figure 25K).

[0237] Example 11 - Pkd1 oligos increase PKD1 expression in three immortalized human ADPKD kidney epithelial cell lines. This example demonstrates that Pkd1 oligos (SEQ ID NO: 1) can increase Pkd1 expression in human cell lines. Specifically, three immortalized human ADPKD kidney cell lines (each with one inactivated or mutant PKD1 allele) were treated with Pkd1 oligos (SEQ ID NO: 1) and then analyzed for PKD-1 protein expression, cyst size, mitochondrial activity, and global gene expression. Figure 26A shows an exemplary Western blot demonstrating increased PKD1 expression of the remaining PKD1 allele in all three cell lines. Figure 26B shows that the treated cells also had reduced cyst size, increased MitoTracker signal (red), and reduced PKDREB expression (green).

[0238] Example 12 - Side-by-side testing of Pkd1 oligos 1 and 2 in mouse and human ADPKD kidney cell lines In this example, two Pkd1 oligos are tested in human and mouse ADPKD cell lines and systems. In the first experiment, mouse Pkd1 RC / - Cells were treated with scrambled oligos, Pkd1 oligo #1 (SEQ ID NO: 1), or Pkd1 oligo #2 (SEQ ID NO: 2) and analyzed for levels of Pkd1 mRNA transcripts or Pkd1 3'-UTR transcripts (containing the binding site for each oligo). Polycystin-1 protein expression in treated cells was also measured using Western blot. Figure 27A shows that binding of each Pkd1 oligo increases total Pkd1 mRNA transcripts (leftmost plot) but prevents cDNA synthesis at the Pkd1 3'-UTR binding site, as evidenced by decreased Pkd1 3'-UTR transcript detection in Pkd1 oligo #1 or #2-treated cells (middle plot). Increased transcripts correlate with increased protein expression, as evidenced by increased polycystin levels measured by Western blot (rightmost image).

[0239] In a second experiment, human ADPKD cells from three donors (donor 3, donor 4, and WT9-7) were treated in the same manner with scrambled oligos, Pkd1 oligo #1 (SEQ ID NO: 1), or Pkd1 oligo #2 (SEQ ID NO: 2). After treatment with each Pkd1 oligo in each cell line, we observed increased levels of Pkd1 mRNA transcript (intact), decreased levels of Pkd1 3'-UTR transcript, and increased protein expression of polycystin-1 (by Western blot) (Figures 27B-27D). Thus, both Pkd1 oligos (SEQ ID NO: 1 and SEQ ID NO: 2) are effective in increasing PKD1 dosage in both human and mouse cell lines.

[0240] Example 13 - Pkd2 oligos increase PKD2 expression in mIMCD3 cells mIMCD3 cells were transfected with the pls-PKD2-3'-UTR reporter plasmid, microRNA mimic (sc or miR-17), and scrambled (sc) or Pkd2 oligo (SEQ ID NO: 3). Cells were also transfected with 0.04 μg of pGL3-control plasmid (Promega Corp) encoding Photinus luciferase to serve as a control for differences in transfection efficiency. Luciferase levels were measured 72 hours after transfection as a reporter for PKD2 expression (see Methods in Example 14). Figure 28 shows that cells treated with PKD2 oligo in the presence of microRNA (miR-17) had an increased signal, and therefore, increased PKD2 expression, compared to cells treated with microRNA alone.

[0241] Example 14 - Materials and methods used in Examples 9-13 Luciferase assay Culture mIMCD3 cells in a 6-well dish (2 × 10 cells per well). 5Cells were seeded onto 96-well plates and transfected with 0.4 μg of pLS-Pkd1-3'-UTR plasmid, 10 nM of miR-17 or scrambled mimic (Dharmacon), and 40 nM of scrambled oligo, Pkd1 oligo, or Pkd2 oligo (Qiagen). Cells were also transfected with 0.04 μg of pGL3-control plasmid (Promega Corp) encoding Photinus luciferase to serve as a control for differences in transfection efficiency. Lipofectamine 2000 (Invitrogen) was used as the transfection reagent. After 48 h, cells were lysed with 250 μl of passive lysis buffer (Promega Corp), and 40 μl of cell lysate was added to a 96-well plate. Photinus and Renilla luciferase activities were measured by using the Dual-Luciferase Reporter Assay System (Promega Corp) according to the manufacturer's instructions.

[0242] qRT-PKDR Total RNA was extracted using the Qiagen miRNEASY Mini Kit. One microgram of RNA was treated with DNase I (Invitrogen), and cDNA was generated using the Invitrogen First Strand Superscript III cDNA Synthesis Kit. Q-PKDR was performed using iQ SYBR Green Supermix (Bio-Rad). All samples were loaded in duplicate or triplicate for analysis on the CFX Connect™ Real-time PKDR. 18s rRNA was used to normalize mRNA expression.

[0243] Western blot Cells were scraped from 6-well plates in 1x PBS with a cell scraper and then centrifuged for 5 minutes to isolate the pellet. Total protein was extracted from the cell pellet using Tissue Protein Extraction Reagent (Invitrogen, Cat. No. 78510) containing protease phosphatase inhibitor tablets (Fisher, Cat. No. PIA32961). 20-50µg of protein was loaded onto NuPAGE™ 3-8% Tris-Acetate Protein Gel (Invitrogen, EA03785) along with a high molecular weight ladder (Invitrogen, Cat. No. LC5699) at 160V for 1.5 hours on ice. Proteins were transferred to nitrocellulose membranes using an Invitrogen Wet Tank Transfer System at 200mAmps for 100 minutes on ice or at 4°C. Membranes were blocked with 5% milk in 1x TBS-Tween for 45 minutes and then probed with PKD1 antibody (Santa Cruz 7E12) at a 1:500 dilution overnight or Actin-HRP (Sigma) at a 1:40,000 dilution for 1 hour. The following morning, membranes were washed three times with 1x TBS-Tween, and then goat anti-mouse conjugated HRP was applied as the secondary antibody at a 1:5000 dilution for 1 hour. Blots were developed using Pierce chemiluminescent substrate (Super-signal West Femto or ECL) reagent and visualized on a Bio-Rad Digital Imager.

[0244] mRNA stability assay Pkd1 RC / - Cells were plated in 6-well plates (1.5 × 10 cells per well). 5 Cells were seeded onto 1000-well plates and transfected the following morning with scrambled or Pkd1 oligos to a final concentration of 40 nM using Lipofectamine 3000 (Invitrogen). Forty-eight hours after transfection, the culture medium was replaced with medium containing 5 μg actinomycin per ml of medium. Cells were harvested 0, 4, and 8 hours after actinomycin treatment for analysis.

[0245] cell line Pkd1RC / - Cells, kidney epithelial cells, and mIMCD3 cells were used in these experiments. mIMCD3 cells were obtained from ATCC. Kidney epithelial cells and Pkd1 RC / - The cells are immortalized tubule-derived renal epithelial cells derived in our laboratory from 12-day-old male mouse kidneys.

[0246] 3D cyst formation assay Eight-well chamber slides and 200 μl sterile pipette tips were pre-cooled at -20°C for a minimum of 6 hours. The floor of each well of an eight-well chamber slide was carefully coated with 25 μl of 100% Matrigel (Fisher, catalog no. 354234) using a 200 μl sterile pipette tip. The plate was then placed in a 37°C incubator for 30 minutes to allow the Matrigel to solidify. During this time, cells were washed with 1x PBS, trypsinized, and filtered through a 40 μm cell strainer to create a single-cell suspension. Cells were counted using a hemocytometer and diluted to a final concentration of 5,000 cells per 150 μl. 150 μl of the cell suspension was combined 1:1 with 4% Matrigel and added to each well. Each treatment condition was seeded in triplicate and incubated at 37°C for 7 days. After 72 hours, each well was replenished with 100 μl of epithelial medium. On day 7, cysts were imaged using a Leica DMI 3000B light microscope. Images were analyzed using ImageJ software, and cyst size was measured. Each assay was repeated three times.

[0247] Immunofluorescence staining Cells were fixed with ice-cold 100% methanol at 4°C for 5 minutes and then washed three times with 1x phosphate-buffered saline. Cells were then blocked for a minimum of 30 minutes at room temperature in 1x PBS + 10% goat serum + 0.1% BSA + 0.1 M glycine + 0.1% Tween 20 (blocking solution). Cells were probed overnight at 4°C with PKDREB antibody (Cell Signaling) at a 1:400 dilution in blocking solution. Secondary antibodies were applied at a 1:400 dilution for 1 hour at room temperature. Cells were counterstained with DAPI at a 1:100.00 dilution in 1x PBS and visualized using a Carl Zeiss Compound Light Microscope. All conditions for each experiment were processed and imaged simultaneously.

[0248] MitoTracker staining Cells were washed with 1x PBS and then incubated in 100 nM MitoTracker Red CMXRos (Thermo Fisher Scientific) in serum-free DMEM medium for 8 minutes. The serum-free medium was then replaced with normal epithelial medium, and cells were immediately imaged using a Carl Zeiss Compound Light microscope. All images were taken at the same exposure to compare the intensity of MitoTracker fluorescence, which is directly proportional to membrane potential.

[0249] RNA sensor experiments Pkd1 RC / - Cells were seeded into 6-well plates (1 × 10 per well). 5The next morning, cells were transfected with scrambled or Pkd1 oligos and the pDAC565 plasmid (Addgene #195242), which also carries a guide RNA targeting exon 4 of the Pkd1 gene (CAGCCACGCCAGACCACAGTTGCACTCAAATG; SEQ ID NO: 39), using Lipofectamine 3000 (Invitrogen) to reach a final concentration of 40 nM. After 48 hours, cells were visualized under a 40x fluorescence microscope. Quantification of Pkd1 mRNA abundance was determined by counting the number of cells transfected with the plasmid (indicated by background green fluorescence in the nuclei) that displayed punctate or cloud-like signals expressing GFP (indicating Pkd1 mRNA). 200 cells with GFP emission were counted per condition. Each experiment was completed in triplicate.

Claims

1. A method for selectively increasing the expression of polycystin-1 and / or polycystin-2 in a cell, comprising delivering to the cell an antisense oligonucleotide (ASO) that hybridizes to the 3'UTR regulatory region on the mRNA encoding polycystin-1 or polycystin-2 (PKD1 mRNA or PKD2 mRNA).

2. The method of claim 1 , wherein the ASO interferes with a microRNA that hybridizes to the 3′UTR regulatory region.

3. The method of claim 2, wherein the microRNA is microRNA-17.

4. The method of claim 1 , wherein the 3′UTR regulatory region comprises a cis-inhibitory motif.

5. The method of claim 1 , wherein the ASO stabilizes the PKD1 mRNA and / or the PKD2 mRNA.

6. The method of claim 1, wherein the ASO comprises at least 9 nucleotides.

7. The method of claim 6, wherein the ASO comprises 9 to 24 nucleotides.

8. The method of claim 7, wherein the ASO consists of 15 or 16 nucleotides.

9. 9. The method of any one of claims 1 to 8, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA).

10. The method according to claim 9, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 4 to 7.

11. 11. The method of claim 10, wherein the ASO comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:1 or SEQ ID NO:

2.

12. 12. The method of claim 11, wherein the ASO comprises a nucleic acid sequence comprising or consisting of SEQ ID NO:1 or SEQ ID NO:

2.

13. 9. The method of any one of claims 1 to 8, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 2 (PKD2 mRNA).

14. The method according to claim 13, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD2 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 8 to 13.

15. 15. The method of claim 14, wherein the ASO comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:

3.

16. 16. The method of claim 15, wherein the ASO comprises a nucleic acid sequence comprising or consisting of SEQ ID NO:

3.

17. 17. The method of any one of claims 1 to 16, wherein the cells carry a mutation in at least one allele of the PKD1 gene and / or the PKD2 gene and have reduced baseline expression of polycystin 1 and / or polycystin 2 compared to cells not carrying the mutation.

18. 18. The method of claim 17, wherein expression of polycystin 1 and / or polycystin 2 is increased by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% over baseline.

19. The method of any one of claims 1 to 18, wherein the cell is in vitro.

20. The method of any one of claims 1 to 19, wherein the cell is in vivo.

21. The method of any one of claims 1 to 20, wherein the cells are human or mouse.

22. A method for treating autosomal dominant polycystic kidney disease (ADPKD) in a subject in need of such treatment, comprising administering to the subject a pharmaceutically effective amount of an antisense oligonucleotide (ASO) that hybridizes to a 3'UTR regulatory region on mRNA encoding polycystin 1 or polycystin 2 (PKD1 mRNA or PKD2 mRNA).

23. 23. The method of claim 22, wherein the ASO interferes with a microRNA that hybridizes to the 3'UTR regulatory region.

24. 24. The method of claim 23, wherein the microRNA is microRNA-17.

25. The method of claim 22, wherein the 3'UTR regulatory region comprises a cis-inhibitory motif.

26. The method of claim 22, wherein the ASO stabilizes the PKD1 mRNA and / or the PKD2 mRNA.

27. 23. The method of claim 22, wherein the ASO comprises at least 9 nucleotides.

28. 28. The method of claim 27, wherein the ASO comprises 9 to 24 nucleotides.

29. 29. The method of claim 28, wherein the ASO consists of 15 or 16 nucleotides.

30. 30. The method of any one of claims 22 to 29, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA).

31. The method of claim 30, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 4 to 7.

32. 32. The method of claim 31 , wherein the ASO comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:1 or SEQ ID NO:

2.

33. 33. The method of claim 32, wherein the ASO comprises a nucleic acid sequence comprising or consisting of SEQ ID NO:1 or SEQ ID NO:

2.

34. 30. The method of any one of claims 22 to 29, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 2 (PKD2 mRNA).

35. The method of claim 34, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD2 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 8 to 13.

36. 36. The method of claim 35, wherein the ASO comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:

3.

37. 37. The method of claim 36, wherein the ASO comprises a nucleic acid sequence comprising or consisting of SEQ ID NO:

3.

38. The method of any one of claims 22 to 37, wherein the ASO is administered systemically.

39. 39. The method of claim 38, wherein the ASO is administered orally, intravenously, subcutaneously, or intraperitoneally.

40. The method of any one of claims 22 to 39, wherein the ASO is administered as a pharmaceutical composition.

41. The method of any one of claims 22 to 40, wherein the subject is a human.

42. An antisense oligonucleotide (ASO) that hybridizes to the 3'UTR regulatory region on the mRNA encoding polycystin 1 or polycystin 2 (PKD1 mRNA or PKD2 mRNA).

43. The ASO of claim 42, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA).

44. The ASO of claim 43, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD1 mRNA) comprises any one of the nucleic acid sequences of SEQ ID NOs: 4 to 7.

45. The ASO of claim 44, wherein the ASO comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:1 or SEQ ID NO:

2.

46. 46. ​​The ASO of claim 45, comprising a nucleic acid sequence comprising or consisting of SEQ ID NO: 1 or SEQ ID NO:

2.

47. The ASO of claim 42, wherein the ASO hybridizes to at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the 3'UTR regulatory region on the mRNA encoding polycystin 2 (PKD2 mRNA).

48. The ASO of claim 47, wherein the 3'UTR regulatory region on the mRNA encoding polycystin 1 (PKD2 mRNA) has the nucleic acid sequence of any one of SEQ ID NOs: 8 to 13.

49. The ASO of claim 48, comprising a nucleic acid sequence having at least 50%, at least 60%, at least 70%, or at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:

3.

50. 50. The ASO of claim 49, comprising a nucleic acid sequence comprising or consisting of SEQ ID NO:

3.

51. The ASO of any one of claims 42 to 50, further comprising at least one locked nucleic acid.

52. 52. A pharmaceutical composition comprising the ASO of claim 51 and at least one carrier or excipient.

53. 53. A kit comprising the pharmaceutical composition of claim 52.