Inhibitors of synaptogyrin-3 expression

Abstract

The present invention relates to the identification of regions within the synaptogyrin-3 RNA sequence that are targetable by oligonucleotide inhibitors, such as siRNA molecules. The synaptogyrin-3 inhibitors disclosed herein are provided for pharmaceutical use generally, and specifically for treating or inhibiting the progression of tauopathy or the symptoms of tauopathy.

Description

[Technical Field]

[0001] The present invention relates to regions within the synaptogyrin-3 RNA sequence that are targetable by oligonucleotide inhibitors, such as siRNA molecules. The synaptogyrin-3 inhibitors disclosed herein are provided for pharmaceutical use generally, and specifically for treating or inhibiting the progression of tauopathy or the symptoms of tauopathy. [Background technology]

[0002] Tau pathology is associated with more than 20 neurodegenerative diseases, including Alzheimer's disease (Wang & Mandelkow 2016 Nat Rev Neurosci 17:5-21). Hyperphosphorylation or mutation of the microtubule-associated protein tau is common to all of these diseases, collectively referred to as tauopathies, and filamentous inclusions of hyperphosphorylated tau are the hallmark pathology of Alzheimer's disease and other tauopathies (Ballatore et al 2007 Nature Reviews Neuroscience 8:663-672). Tau pathology is not simply a by-product of other pathological pathways, but is itself a key mediator of neurotoxicity (Roberson et al. 2007 Science 316:750-754; Hutton et al. 1998 Nature 393:702-705; Caffrey & Wade-Martins 2007 Neurobiol Dis 27:1-10; Le Guennec et al. 2016 Molecular Psychiatry 1-7). Under physiological conditions, tau is expressed in neurons and bound to axonal microtubules. However, under pathological conditions, tau mutations (e.g., in frontotemporal dementia with parkinsonism (FTDP)-17) or abnormal phosphorylation of tau (e.g., in sporadic Alzheimer's disease) reduce its microtubule-binding affinity (Hong et al., 1998 Science 282:1914-1917; Wang & Mandelkow, 2016 Nat Rev Neurosci, 17:5-21), leading to its dissociation from axonal microtubules and mislocalization to postsynaptic sites (Spires-Jones & Hyman, 2014 Neuron, 82:756-771; Tai et al., 2012 Am J Pathol, 181:1426-1435; Tai et al., 2014 Acta Neuropathol Commun, 2:146). This mislocalization of soluble tau plays a key role in disrupting synaptic function in early disease stages, which may contribute to subsequent synapse loss and neurodegeneration.

[0003] In addition to the reported postsynaptic localization of pathological tau (Hoover et al., 2010 Neuron 68:1067-1081; Ittner et al., 2010 Cell 142:387-397; Zhao et al., 2016 Nat Med 22:1268-1276), it has previously been shown that hyperphosphorylated tau species accumulate on presynaptic vesicles isolated from Alzheimer's disease brains. This suggests that presynaptic pathways also contribute to synaptic dysfunction in tau-related human neurodegenerative diseases. Using unbiased proteomic and genetic approaches, it was found that the transmembrane synaptic vesicle protein synaptogyrin-3 mediates tau association with synaptic vesicles in vitro and in vivo (WO2019 / 016123). Reduction of Drosophila synaptogyrin or murine synaptogyrin-3 levels in neurons from fly and mouse models of tauopathy reduced tau binding to synaptic vesicles and subsequently rescued tau-induced defects in vesicle mobility and neurotransmitter release. These findings identified synaptogyrin-3 as a novel tau interactor mediating tau-associated synaptic dysfunction (WO 2019 / 016123). Therefore, it would be advantageous to develop specific synaptogyrin-3 inhibitors for use in treating various tauopathies, including Alzheimer's disease, for which there remains a high unmet need for treatment. Because neurodegeneration is thought to begin with the loss of presynaptic terminals and proceed retrogradely in a dying-back process, impacting tau-mediated pathways at the presynapse is highly plausible (Yoshiyama et al., 2007, Neuron 53:337-351). Summary of the Invention

[0004] The present inventors have found that some subsequences within the synaptogyrin-3 mRNA transcript are significantly more accessible to oligonucleotides, such as RNAi molecules, and are therefore preferred target regions for designing oligonucleotides suitable for or capable of reducing the expression and / or activity of synaptogyrin-3. The boundaries of these identified target regions were determined by transcript walking.

[0005] Thus, the present application provides oligonucleotides 10 to 70 nucleotides in length comprising a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length, which contiguous nucleotide sequence is at least 90% complementary to an equal length portion of a target region within the synaptogyrin-3 transcript set forth in SEQ ID NO:1, wherein the target region is comprised between nucleobases 205 and 265, 255 and 348, 338 and 387, 369 and 433, 422 and 531, 603 and 656, 641 and 714, 717 and 768, 1150 and 1600, 1743 and 1868, or between nucleobases 1865 and 2026 of SEQ ID NO:1, wherein the endpoints are inclusive. In one embodiment, the oligonucleotide is capable of binding to the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1. In another embodiment, said binding of the oligonucleotide to said synaptogyrin-3 mRNA transcript may reduce the expression and / or activity of synaptogyrin-3.

[0006] In one embodiment, oligonucleotide is double-stranded nucleic acid molecule, more particularly RNAi molecule or RNA duplex, and more particularly RNAi molecule is siRNA, bivalent siRNA or shRNA.In another embodiment, oligonucleotide is single-stranded nucleic acid molecule, more particularly the antisense part of RNAi molecule.

[0007] In another embodiment, the sense and / or antisense strands of the oligonucleotides of the present application comprise between 15 and 25 nucleotides in length, more particularly, the antisense strand is 21 nucleotides in length. In another embodiment, the oligonucleotides of the present application comprise at least one or at least two single-stranded nucleotide overhangs.

[0008] In specific embodiments, the oligonucleotides of the present application are at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or fully complementary (100% complementary) to an equal length portion of a target region selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 70-81, and 83-92.

[0009] In the most specific embodiment, the oligonucleotide of the present application comprises a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length that exhibits at least 90% sequence identity to any of SEQ ID NOs: 172-249.

[0010] In one embodiment, the oligonucleotide of the present application comprises one or more internucleoside linkages and / or one or more 2'-sugar-modified nucleosides, more specifically, the internucleoside linkages are phosphorothioate internucleoside linkages and / or the 2'-sugar-modified nucleosides are selected from the group consisting of 2'-O-methyl-, 2'-O-methoxyethyl-, 2'-O-alkyl-, 2'-alkoxy, 2'-amino-, 2'-fluoro-, and LNA nucleosides. Even more specifically, all of the oligonucleosides are modified with phosphorothioate internucleoside linkages or with 2'-O-methyl groups.

[0011] Also provided are antisense oligonucleotides or RNAi molecules that can reduce the levels of synaptogyrin-3 mRNA, synaptogyrin-3 protein, synaptogyrin-3 activity, or a combination thereof, in a cell by at least 15% compared to a control situation in the absence of the antisense or RNAi molecule, wherein the antisense oligonucleotide or RNAi molecule nucleic acid sequence targets a subsequence of mRNA encoding synaptogyrin-3 selected from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93.

[0012] The oligonucleotides of the present application, including the antisense oligonucleotides and RNAi molecules disclosed herein, are provided as therapeutic agents for treating or reducing the symptoms of tauopathy.Therefore, pharmaceutical compositions comprising the oligonucleotides of the present application and methods for treating tauopathy in subjects in need thereof are provided, wherein the method comprises administering any of the antisense oligonucleotides and RNAi molecules provided herein.Also provided are the oligonucleotides of the present application for use as medicines, more particularly for treating or inhibiting the progression of tauopathy disorders, or for treating or inhibiting the symptoms of tauopathy disorders. [Brief explanation of the drawings]

[0013]

Figure 1

Figure 2-1

Figure 2-2

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3-4

Figure 4

[0014] In one aspect, the present invention relates to oligonucleotides ("oligonucleotides of the present disclosure") that specifically bind to synaptogyrin-3 RNA and reduce synaptogyrin-3 expression, e.g., through antisense or RNAi technology. In some aspects, the oligonucleotides of the present disclosure reduce synaptogyrin-3 expression levels, synaptogyrin-3 activity (e.g., dopamine transporter activity), synaptogyrin-3-mediated exocytosis, or a combination thereof. In some aspects, the oligonucleotides of the present disclosure are 10-50, 10-40, or 10-30 nucleotides in length and comprise a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length that is at least 90% complementary to an equal portion of the target region within the synaptogyrin-3 transcript set forth in SEQ ID NO:1. In some aspects, the target region within SEQ ID NO:1 is between nucleobases 205 and 265, between nucleobases 255 and 348, between nucleobases 338 and 387, between nucleobases 369 and 433, between nucleobases 422 and 531, between nucleobases 603 and 656, between nucleobases 641 and 714, between nucleobases 717 and 768, between nucleobases 1150 and 1600, between nucleobases 1743 and 1868, or between nucleobases 1865 and 2026 of SEQ ID NO:1, where the endpoints are inclusive.

[0015] In some aspects, oligonucleotides of the present disclosure are 10-50, 10-40, or 10-30 nucleotides in length and comprise a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length that is at least 90% complementary to a portion of equal length of a target region within human synaptogyrin-3, wherein the target region is selected from the list consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 82, and 93.

[0016] In some aspects, oligonucleotides of the present disclosure are complementary (fully or partially complementary) to a target region of synaptogyrin-3 selected from the group consisting of SEQ ID NOs: 2-4, SEQ ID NOs: 6-15, SEQ ID NOs: 17-18, SEQ ID NOs: 20-21, SEQ ID NOs: 23-25, SEQ ID NOs: 27-29, SEQ ID NOs: 31-41, SEQ ID NOs: 43-45, SEQ ID NOs: 47-49, SEQ ID NOs: 51-57, SEQ ID NOs: 70-81, and SEQ ID NOs: 83-92.

[0017] In some aspects, the oligonucleotides herein comprise or consist of 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In other aspects, the oligonucleotides herein comprise or consist of 19, 20, 21, or more nucleotides in length and comprise or consist of a sequence selected from the list consisting of SEQ ID NOs: 94-249, more particularly SEQ ID NOs: 172-249.

[0018] The present disclosure also provides a method of treatment comprising administering the oligonucleotides of the present disclosure or combinations thereof to a subject in need thereof. Pharmaceutical compositions, pharmaceutical formulations, and kits and articles comprising the oligonucleotides of the present disclosure are also provided. Methods of manufacturing the oligonucleotides of the present disclosure are also provided. definition

[0019] In order that this specification may be more readily understood, certain terms are first defined. Additional definitions are provided in the Detailed Description. The present invention will be described with respect to specific embodiments and with reference to certain drawings; however, the present invention is not limited thereto but only by the claims. Any reference signs in the claims should not be construed as limiting the scope. The drawings described are schematic only and are not limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn to scale for illustrative purposes.

[0020] It should be noted that the term "a" or "an" entity refers to one or more of that entity; for example, a "nucleotide sequence" is understood to refer to one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0021] Furthermore, "and / or," as used herein, should be taken as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" used herein in phrases such as "A and / or B" is intended to encompass "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0022] Where an indefinite or definite article is used when referring to a singular noun, e.g., "a," "an," or "the," this includes the plural of that noun unless something specifically stated otherwise. Furthermore, the terms first, second, third, and the like in this specification and claims are used to distinguish between similar elements and not necessarily to describe an organizational or chronological order. It is to be understood that terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in arrangements other than those described or illustrated herein.

[0023] Wherever an aspect is described herein by the phrase "comprising," it is understood that otherwise similar aspects described with the terms "consisting of" and / or "consisting essentially of" are also provided. Where the term "comprising" is used in the specification and claims, it does not exclude other elements or steps. Unless specifically defined herein, all terms used herein have the same meaning as they would have to one skilled in the art of the invention.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this disclosure pertains.For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press provide those skilled in the art with a general dictionary of many of the terms used in this disclosure. For definitions and terms of the art, practitioners are specifically directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012). The definitions provided herein should not be construed to have a scope less than that understood by a person skilled in the art.

[0025] Units, prefixes, and symbols are denoted in their International System of Units (SI) accepted form. Numerical ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of this disclosure that may be had by reference to the specification in its entirety. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0026] The term "about" is used herein to mean approximately, roughly, around, or within a range of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. Generally, the term "about" can modify a numerical value above and below the stated value, for example, by a variance of 10 percent upward or downward (higher or lower). For example, if it is stated that an oligonucleotide of the present disclosure reduces Syngr-3 transcript expression in cells by at least about 60% after administration of the oligonucleotide of the present disclosure, it implies that Syngr-3 expression levels are reduced by a range of 50% to 70%.

[0027] As used herein, the terms "reverse complement," "reverse complementary," and "reverse complementarity" are interchangeable with the terms "complement," "complementary," and "complementarity."

[0028] The term "identical" or percent "identity" in the context of two or more nucleic acids refers to two or more sequences that, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, are the same or have a specified percentage of nucleotide or amino acid residues that are the same. Any conservative amino acid substitutions are not considered part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to align amino acid or nucleotide sequences are known in the art.

[0029] The term "percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matched positions shared by the sequences in the comparison window. It takes into account the addition or deletion (i.e., gap) that must be introduced for optimal alignment of the two sequences. A matched position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since gaps are not nucleotides or amino acids, gaps present in the target sequence are not counted. Similarly, gaps present in the reference sequence are not counted, since target sequence nucleotides or amino acids are counted, not nucleotides or amino acids from the reference sequence.

[0030] One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain aspects, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California), or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain aspects, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative aspects, the GAP program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)), can be used to determine percent identity between two amino acid sequences (e.g., using either a BLOSUM 62 matrix or a PAM250 matrix and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5).Alternatively, in certain aspects, percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, percent identity can be determined using the ALIGN program (version 2.0) using PAM120 as the residue table, a gap length penalty of 12, and a gap penalty of 4. One of skill in the art can determine appropriate parameters for maximal alignment with particular alignment software. In certain aspects, the default parameters of the alignment software are used.

[0031] Those skilled in the art will understand that the generation of sequence alignments for calculating percent sequence identity is not limited to binary sequence-sequence comparisons driven solely by primary sequence data. Sequence alignments can also be derived from multiple sequence alignments. One suitable program for generating multiple sequence alignments is ClustalW2, available from www.clustal.org. Another suitable program is MUSCLE, available from www.drive5.com / muscle / . ClustalW2 and MUSCLE are alternatively available, for example, from EBI (European Bioinformatics Institute).

[0032] In certain aspects, the percentage identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues scored as identical matches on an alignment of the first and second sequences (aligned by visual inspection or by a specific sequence alignment program) and Z is the total number of residues on the second sequence. If the length of the first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0033] Different regions in a single polynucleotide target sequence that aligns with a polynucleotide reference sequence can each have their own percent sequence identity.It should be noted that percent sequence identity values ​​are rounded to one decimal place.For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, and 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2.It should also be noted that length values ​​will always be integers.

[0034] As used in this disclosure, the terms "nucleic acid molecule of the invention" and "oligonucleotide of the disclosure" and grammatical variations thereof are used interchangeably.

[0035] As used herein, the term "defined by SEQ ID NO: X" refers to a biological sequence consisting of the sequence of nucleotides given in SEQ ID NO: X. SEQ ID NO: X is interchangeable with SEQ ID NO: X. When the present application refers to "the group consisting of SEQ ID NOs: 2 to 4," this is the same as the group consisting of SEQ ID NOs: 2, 3, and 4.

[0036] The target nucleic acid of the present invention is a nucleic acid, e.g., mRNA, encoding synaptogyrin-3, more specifically, human synaptogyrin-3. The terms "synaptogyrin-3," "synaptogyrin-3," "synaptogyrin-3," "syngr-3," "Syngr-3," "SYNGR-3," or "SYNGR-3" are used interchangeably and, unless otherwise specified, refer to synaptogyrin-3 transcripts herein. The human nucleic acid sequence of synaptogyrin-3 (hSyngr-3) is set forth in SEQ ID NO: 1; however, mRNA encoding nucleic acid sequence variants of synaptogyrin-3, such as synaptogyrin-3 allelic variants, that may exist due to allelic variation, are also within the scope of the present invention. Such variations are defined herein as "allelic variants of SEQ ID NO: 1." The term "allelic variant" refers to one of several alternative forms of a gene occupying a given locus on an organism's chromosome (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985)). These allelic variants can differ at either the polynucleotide and / or polypeptide level and are encompassed by the present disclosure. Alternatively, non-naturally occurring variants can be produced by mutagenesis techniques or by direct synthesis. In some aspects, the synaptogyrin-3 variant is a splice variant. In some aspects, the synaptogyrin-3 variant is a post-translationally modified variant. In some aspects, the synaptogyrin-3 variant is a mutant synaptogyrin-3, e.g., a mutant containing at least one nucleotide point mutation, deletion, or insertion. In some aspects, the mutation is silent. In some aspects, the synaptogyrin-3 variant is a mutant protein containing at least one amino acid substitution, deletion, or insertion. In some aspects, the synaptogyrin-3 variant is a loss-of-function variant. In some aspects, the synaptogyrin-3 variant is a gain-of-function variant.

[0037] As used herein, "specific for synaptogyrin-3" refers to the fact that the nucleic acid molecule or oligonucleotide of the present invention acts at the level of synaptogyrin-3, but not at the level of another transcript. Specificity can be confirmed, for example, by determining the expression level of a closely related RNA sequence.

[0038] The term "statistically significantly" different is well known to those skilled in the art. Statistical significance plays a central role in statistical hypothesis testing. It is used to determine whether the null hypothesis should be rejected or retained. The null hypothesis is the default assumption that nothing has happened or changed, and therefore, for example, there is no difference in the synaptogyrin-3 transcript level in the presence of antisense or RNAi molecules compared to the synaptogyrin-3 transcript level in the absence of antisense or RNAi molecules. To reject the null hypothesis, the observed result must be statistically significant. That is, the observed p-value is less than the pre-specified significance level α. The resulting p-value, p, is the probability of obtaining a result that is at least as extreme if the null hypothesis is true. In one embodiment, α is 0.05. In a more specific embodiment, α is 0.01. In an even more specific embodiment, α is 0.001. Nucleic acid molecules that inhibit the expression of synaptogyrin-3

[0039] In a first aspect, the present application discloses nucleic acid molecules, more particularly oligonucleotides, comprising a sequence complementary (fully or partially) to a region of an mRNA encoding human synaptogyrin-3, such as the mature mRNA set forth in SEQ ID NO: 1, or an allelic variant or isoform thereof (e.g., any of the variants and isoforms disclosed in UniProtKB / Swiss-Prot entry O43761).

[0040] SEQ ID NO: 1 represents the mature mRNA sequence of the human synaptogyrin-3 gene (Gene ID: 9143; SEQ ID NO: NM_004209.6). The mRNA is 2026 bp long, contains four exons, and encodes the human synaptogyrin-3 protein (UniProtKB / Swiss-Prot: O43761). In some aspects, the target mRNA is a pre-mRNA or a splice variant of the pre-mRNA. In some aspects, the target sequence comprises an exon, an intron, or a combination thereof.

[0041] The synaptogyrin-3 coding sequence is underlined in the sequence below. "|" indicates the location of the exon junction. SEQ ID NO: 1 (synaptogyrin-3 mRNA) GAGGCGGCAGCGGCTGCAGCGTTGGTAGCATCAGCATCAGCATCAGCGGCAGCGGCAGCGGCCTCGGGCGGGGCCGGCCGGACGGACAGGCGGACAGAAGGCGCCAGGGCGCGCGTCCCGCCCGGGCCGGCC ATGGAGGGCGCCTCCTTCGGCGCGGGCCGCGCAGGGGCCGCCCTGGACCCCGTGAGCTTTGCGCGGCGGCCCCAGACCCTGCTCCGGGTCGCGTCCTGG|GTGTTCTCCATCGCCGTCTTCGGGCCCATCGTCAACGAGGGCTACGTGAACACCGACAGCGGCCCCGAGCTGCGCTGCGTGTTCAACGGGAACGCGGGCGCCTGCCGCTTCGGCGTCGCGCTGGGCCTCGGAGCCTTCCTCGCCTGCGCCGCCTTCCTGCTGCTCGATGTGCGCTTCCAGCAAATCAGCAGCGTCCGCGACCGCCGGCGCGCGGTGTTGCTGGACCTGGGCTTCTCAG|GACTCTGGTCCTTCCTGTGGTTCGTGGGCTTCTGCTTCCTCACCAATCAGTGGCAGCGCACGGCGCCAGGGCCGGCCACGACGCAGGCGGGGGACGCGGCGCGGGCCGCCATCGCCTTCAGCTTCTTCTCCATCCTCAGCTGG|GTGGCGCTCACCGTGAAGGCCCTGCAGCGGTTCCGCCTGGGCACCGACATGTCACTCTTCGCCACCGAACAGCTGAGCACCGGGGCGAGCCAGGCCTACCCCGGCTATCCGGTGGGCAGCGGCGTGGAGGGCACCGAGACCTACCAGAGCCCGCCCTTCACCGAGACCCTGGACACCAGCCCCAAAGGGTACCAGGTGCCCGCCTACTAG

[0042] In some aspects, the nucleic acid molecules or oligonucleotides (e.g., ASO, siRNA, shRNA) of the present disclosure include oligonucleotides between 10 and 50 nucleotides in length.

[0043] In some aspects, the nucleic acid molecule or oligonucleotide of the present disclosure comprises or consists of one oligonucleotide (for example, ASO oligomer or shRNA).In some aspects, the nucleic acid molecule or oligonucleotide of the present disclosure comprises or consists of two oligonucleotides (for example, siRNA).In some aspects, the two oligonucleotides are a sense oligonucleotide and an antisense oligonucleotide.In some aspects, the sense oligonucleotide and the antisense oligonucleotide are connected by a loop.

[0044] In some aspects, a nucleic acid molecule of the present disclosure comprises or consists of a sequence of about 8 to about 70 contiguous nucleotides in length as disclosed herein, a sequence of about 10 to about 60 contiguous nucleotides in length as disclosed herein, a sequence of about 12 to about 50 contiguous nucleotides in length as disclosed herein, a sequence of about 8 to about 40 nucleotides in length, a sequence of about 10 to about 35 contiguous nucleotides in length as disclosed herein, a sequence of about 12 to about 30 contiguous nucleotides in length as disclosed herein, a sequence of about 14 to about 28 contiguous nucleotides in length as disclosed herein, a sequence of about 16 to about 25 nucleotides in length as disclosed herein, a sequence of about 17 to about 24 nucleotides in length as disclosed herein, or a sequence of about 18 to about 23 contiguous nucleotides in length as disclosed herein. In some aspects, nucleic acid molecules of the invention are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length. In one embodiment, "a length of nucleotides" refers to "a length of consecutive nucleotides."

[0045] As used herein, "nucleotide" refers to the building block of oligonucleotides and polynucleotides, and for the purposes of the present invention, includes both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (which are absent in nucleosides). A nucleotide without a phosphate group is called a "nucleoside," and is therefore a compound containing a nucleobase moiety and a sugar moiety. As used herein, "nucleobase" refers to a group of atoms that can be linked to a sugar moiety to create a nucleoside that can be incorporated into an oligonucleotide, where the group of atoms can bind to a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Naturally occurring nucleobases in RNA or DNA include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0046] As used herein, the term "contiguous nucleotides" or "contiguous nucleotide sequence" refers to an uninterrupted region of an oligonucleotide that is complementary to a target nucleic acid. As used herein, "contiguous" means adjacent or together in sequence. Thus, contiguous nucleotides are linked nucleotides (i.e., there is no additional nucleoside between the linked nucleotides). The target nucleic acid of the present invention is synaptogyrin-3, more specifically human synaptogyrin-3.

[0047] In the context of this disclosure, the terms "oligomer" or "oligonucleotide" are used interchangeably and refer to a molecule formed by the covalent linkage of two or more nucleotides. Herein, a single nucleotide (unit) may also be referred to as a monomer or unit.

[0048] In some aspects, the present disclosure provides the derivative of the oligonucleotide of the present disclosure, which is conjugate, for example, GalNAc conjugate.The term " derivative " used herein refers to the chemical compound that is structurally related to the compound disclosed herein (for example, the oligonucleotide of the present disclosure).For example, it has the same carbon skeleton, but is chemically modified at one or more positions, for example, by introducing side chain or group, and wherein the biological activity of the entity or molecule that it is derivative of is substantially similar (for example, the ability to reduce Syngr3 expression).

[0049] The term "complementary" means that two sequences are complementary, such that one sequence can bind to the other in an antiparallel sense, with the 3' end of each sequence binding to the 5' end of the other, and each A, T(U), G, and C of one sequence aligning with the T(U), A, C, and G, respectively, of the other sequence. Normally, complementary sequences of oligonucleotides have at least 90%, preferably 95%, and most preferably 100% complementarity to a given sequence.

[0050] In determining the degree of "complementarity" between an oligonucleotide (or region thereof) of the present disclosure and a target region, such as those disclosed herein, the degree of "complementarity" (also, "homology" or "identity") is expressed as the percentage identity (or percentage homology) between the sequence of the oligonucleotide (or region thereof) and the sequence of the target region (or reverse complement of the target region) with which it best aligns. The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, dividing by the total number of contiguous monomers (e.g., nucleotides) on the oligomer (e.g., oligonucleotide), and multiplying by 100. In such a comparison, if gaps exist, it is preferred that such gaps are simply mismatches rather than areas where the number of monomers within the gap differs between the oligomer of the present disclosure and the target region.

[0051] In some embodiments, the above-described nucleic acid molecule or contiguous nucleotide sequence thereof is less than 60 nucleotides, less than 59 nucleotides, less than 58 nucleotides, less than 57 nucleotides, less than 56 nucleotides, less than 55 nucleotides, less than 54 nucleotides, less than 53 nucleotides, less than 52 nucleotides, less than 51 nucleotides, less than 50 nucleotides, less than 49 nucleotides, less than 48 nucleotides, less than 47 nucleotides, less than 46 nucleotides, less than 45 nucleotides, less than 44 nucleotides, less than 43 nucleotides, less than 42 nucleotides, less than 41 nucleotides, less than 40 nucleotides, less than 39 nucleotides, less than 38 nucleotides, less than 37 nucleotides. less than 36 nucleotides, less than 35 nucleotides, less than 34 nucleotides, less than 33 nucleotides, less than 32 nucleotides, less than 31 nucleotides, less than 30 nucleotides, less than 29 nucleotides, less than 28 nucleotides, less than 27 nucleotides, less than 26 nucleotides, less than 25 nucleotides, less than 24 nucleotides, less than 23 nucleotides, less than 22 nucleotides, less than 21 nucleotides, less than 20 nucleotides, less than 19 nucleotides, less than 18 nucleotides, less than 17 nucleotides, less than 16 nucleotides, less than 15 nucleotides, less than 14 nucleotides, less than 13 nucleotides, or less than 12 nucleotides.

[0052] Any range given herein should be understood to include the endpoints of the range, thus, when a nucleic acid molecule is said to include between 10 and 30 nucleotides, both 10 and 30 nucleotides are included.

[0053] In some embodiments, the contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. In some aspects, nucleic acid molecules of the invention are 14 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 15 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 16 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 17 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 18 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 19 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 20 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 21 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 22 nucleotides in length. In some aspects, nucleic acid molecules of the invention are 24 nucleotides in length.

[0054] The nucleic acid molecule(s) are typically for regulating the expression of synaptogyrin-3 as a target nucleic acid in mammals.In some embodiments, the nucleic acid molecule(s) such as siRNA, shRNA or antisense oligonucleotide are typically for inhibiting the expression of target nucleic acid.More specifically, the oligonucleotide of the present application is provided as being able to reduce the level of synaptogyrin-3 mRNA transcript (and therefore indirectly SYNGR3 protein) in cells, wherein reduction is determined by comparison with the level of synaptogyrin-3 mRNA transcript in the same cells or the same cell type grown under the same conditions but in the absence of the oligonucleotide of the present application.

[0055] The oligonucleotides described herein are partially or completely complementary to equal-length portions of target regions within synaptogyrin-3 as set forth in SEQ ID NO: 1 or its allelic variants. Specific target regions are described in detail below. In another embodiment, the oligonucleotides of the present invention comprise a contiguous nucleotide sequence complementary to one of the specific target regions, and in some embodiments, may further comprise one or more additional nucleotides, e.g., 1 to 30, e.g., 1 to 20, e.g., 1 to 10, e.g., 1, 2, 3, 4, or 5, in addition to the contiguous nucleotide sequence. In some embodiments, the additional nucleotides are complementary to the contiguous nucleotide sequence and can form a stem-loop (hairpin) structure by hybridizing to the contiguous nucleotide sequence. In some embodiments, the additional nucleotides are 1 to 5 phosphodiester-linked nucleotides. In some embodiments, all nucleotides of the oligonucleotide form a contiguous nucleotide sequence.

[0056] In yet another embodiment, the oligonucleotide of the present invention can be or comprise an antisense oligonucleotide (ASO), or can be another oligomeric nucleic acid molecule, such as CRISPR RNA, siRNA, shRNA, aptamer, or ribozyme.In a specific embodiment, the oligonucleotide of the present invention is an RNAi molecule or RNAi agent, more specifically siRNA, di-siRNA, shRNA, or miRNA.

[0057] The term "RNAi agent" or "RNA interference (RNAi) molecule" refers to any molecule that inhibits RNA expression or translation through the RNA reduction silencing complex (RISC) in the cytoplasm of a cell, where the RNAi molecule interacts with the catalytic RISC component Argonaute. Small interfering RNA (siRNA) is typically a double-stranded RNA complex containing a passenger (sense) and a guide (antisense) oligonucleotide (strand), which, when administered to a cell, results in the incorporation of the guide (antisense) strand into the RISC complex (siRISC), leading to the RISC-associated inhibition of translation or degradation of the complementary RNA target nucleic acid in the cell. The sense strand is also referred to as the passenger strand, and the antisense strand is also referred to as the guide strand. Short hairpin RNA (shRNA) is a single nucleic acid molecule that forms a stem-loop (hairpin) structure that can degrade mRNA through RISC. RNAi nucleic acid molecules can be synthesized chemically (typically in siRNA complexes) or by in vitro transcription, or can be expressed from a vector.

[0058] shRNA molecules are generally between 40 and 70 nucleotides in length, e.g., between 45 and 65 nucleotides in length, e.g., between 50 and 60 nucleotides in length, and interact with an endonuclease known as Dicer. This appears to process dsRNA into 19-23 base pair short interfering RNAs with characteristic 2-nucleotide 3' overhangs. These are then incorporated into the RNA-induced silencing complex (RISC). Typically, the guide (antisense) strand of an siRNA (or the antisense region of an shRNA) is 17-25 nucleotides in length, e.g., 19-23 nucleotides in length, and is complementary to the target nucleic acid or target sequence. In the siRNA complex, the guide (antisense) strand and passenger (sense) strand form a double-stranded duplex, which may contain, for example, a 1-3 nucleotide 3' overhang (similar to the product produced by Dicer) or may be blunt-ended (no overhangs on one or both ends of the duplex). It will be appreciated that RNAi can be mediated by longer dsRNA substrates, such as miRNAs, that are processed into siRNAs within the cell, a process thought to involve the dsRNA endonuclease DICER.

[0059] In another specific embodiment, the nucleic acid molecule of the invention or the oligonucleotide of this disclosure is an antisense oligonucleotide (ASO), e.g., a single-stranded antisense oligonucleotide, e.g., a high-affinity modified antisense oligonucleotide that interacts with RNase H.

[0060] The term " antisense oligonucleotide " or " ASO " used herein is defined as an oligonucleotide that can regulate the expression of target gene by hybridizing to target nucleic acid, specifically to the continuous sequence on target nucleic acid.Antisense oligonucleotide is not essentially double-stranded, and therefore is not siRNA or shRNA.Preferably, the antisense oligonucleotide of the present invention is single-stranded.It is understood that the single-stranded oligonucleotide of the present invention can form hairpin or intermolecular duplex structure (duplex between two molecules of the same oligonucleotide), as long as the degree of complementarity within or between itself is less than 50% over the entire length of oligonucleotide.

[0061] In another specific embodiment, the single-stranded antisense oligonucleotide of the present invention does not contain RNA nucleoside, because this would reduce nuclease resistance.More specifically, the antisense oligonucleotide of the present invention comprises one or more modified nucleosides or nucleotides, such as 2' sugar-modified nucleosides.Moreover, it is advantageous that unmodified nucleosides are DNA nucleosides.

[0062] In one embodiment, the oligonucleotide of the present invention, such as a therapeutic antisense oligonucleotide, shRNA, or siRNA, comprises one or more internucleoside linkages modified from natural phosphodiester, for example, one or more modified internucleoside linkages that are more resistant to nuclease attack.The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently couples two nucleosides together, as generally understood by those skilled in the art.The increased resistance of oligonucleotides to nuclease compared to phosphodiester linkages is particularly advantageous for therapeutic oligonucleotides.Nuclease resistance can be determined by incubating oligonucleotides in serum or by using nuclease resistance assays (e.g., snake venom phosphodiesterase (SVPD)).Both are well known in the art.An internucleoside linkage that can enhance the nuclease resistance of oligonucleotides is called a nuclease-resistant internucleoside linkage. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide or its consecutive nucleotide sequence are modified.For example, at least 60%, for example at least 70%, for example at least 80%, or for example at least 90% of the internucleoside linkages in the oligonucleotide or its consecutive nucleotide sequence are nuclease-resistant internucleoside linkages.In some embodiments, all of the internucleoside linkages in the oligonucleotide or its consecutive nucleotide sequence are nuclease-resistant internucleoside linkages.It will be appreciated that in some embodiments, the nucleoside that connects the oligonucleotide of the present invention to a non-nucleotide functional group such as a conjugate can be phosphodiester.In a specific embodiment, the modified internucleoside linkage is phosphorothioate.

[0063] Phosphorothioate internucleoside linkages are particularly useful due to their nuclease resistance, favorable pharmacokinetics, and ease of manufacture.In some embodiments, at least 50% of the internucleoside linkages in oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.For example, at least 60%, for example at least 70%, for example at least 80%, or for example at least 90% of the internucleoside linkages in oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.In some embodiments, all of the internucleoside linkages in oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.The use of fully phosphorothioate modified oligonucleotide or consecutive nucleotide sequence is often used in antisense oligonucleotide, but in siRNA, partial phosphorothioate modification may be preferred.This is because it has been reported that fully phosphorothioate modification limits RNAi activity, especially when used in guide (antisense) strand. Phosphorothioate modifications can be incorporated into the 5' and 3' ends of the antisense strand of the siRNA without unduly limiting RNAi activity.

[0064] Nuclease-resistant linkages, such as phosphorothioate linkages, are particularly useful in regions of an oligonucleotide that can recruit nucleases when forming a duplex with a target nucleic acid, such as region G of a gapmer. However, phosphorothioate linkages can also be useful in regions that do not recruit nucleases and / or affinity-enhancing regions, such as regions F and F' of a gapmer. In some embodiments, a gapmer oligonucleotide can contain one or more phosphodiester linkages in regions F or F', or in both regions F and F', and the internucleoside linkages in region G can be entirely phosphorothioate. In specific embodiments, all internucleoside linkages along the contiguous nucleotide sequence of an antisense oligonucleotide are phosphorothioate linkages.

[0065] In other embodiments, the antisense oligonucleotides may contain other internucleoside linkages (other than phosphodiester and phosphorothioate), such as alkylphosphonate / methylphosphonate internucleoside linkages.

[0066] In some embodiments, the RNAi molecule of the present invention comprises one or more phosphorothioate internucleoside linkages. In RNAi molecules, phosphorothioate internucleoside linkages can reduce nuclease cleavage in RISC. Therefore, it is advantageous that not all internucleoside linkages are modified. Phosphorothioate internucleoside linkages can be advantageously located on the 3' and / or 5' end of the RNAi molecule, particularly on the part of the molecule that is not complementary to the target nucleic acid (e.g., the sense strand or passenger strand on an siRNA molecule). However, the region of the RNAi molecule that is complementary to the target nucleic acid (e.g., the antisense or guide strand on an siRNA molecule) can also have the first two to three internucleoside linkages at the 3' and / or 5' end modified.

[0067] In other embodiments, the oligonucleotide of the present invention can be chemically modified by incorporating high affinity nucleosides, such as 2' sugar-modified nucleosides, for example, 2'-4' bicyclic ribose-modified nucleosides, including LNA and cET, or 2'-substituted modifications such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA.For example, see WO 2002 / 044321, which discloses 2'-O-methyl-modified siRNA; WO2004083430, which discloses the use of LNA nucleosides in siRNA complexes known as siLNA; and WO2007107162, which discloses the use of discontinuous passenger strands in siRNA, such as siLNA complexes.

[0068] In specific embodiments, the oligonucleotides of the invention comprise a 2' sugar modified nucleoside selected from the list consisting of 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), and 2'-fluoro (2'-F).

[0069] In other embodiments, oligonucleotides of the present invention may contain one or more of the chemically modified sugar nucleosides described above and may contain one or more of the phosphorothioate internucleoside linkages described above.

[0070] Those skilled in the art know how to design the oligonucleotides disclosed herein. siRNA and shRNA design programs are publicly available. Non-limiting examples include siDESIGN from ThermoScientific, siDirect (Naito et al.), BLOCK-IT RNAi Designer from Invitrogen, siRNA Wizard from InvivoGen, shRNA design tool from Gene Link, and shRNA design tool from transomic. Manufacturers of RNAi products also provide guidelines for designing siRNA / shRNA molecules. siRNA sequences between 19 and 29 nucleotides (nt) are generally most effective. Sequences longer than 30 nt may result in nonspecific silencing. The ideal targeting site encompasses the AA dinucleotide and its 3' 19 nt on the target mRNA sequence. Typically, siRNAs with 3' dUdU or dTdT dinucleotide overhangs are more effective. GG overhangs should be avoided, although other dinucleotide overhangs may maintain activity. siRNA designs containing 4-6 poly(T) tracts (which act as termination signals for RNA pol III) should also be avoided, and a G / C content between 35-55% is recommended. shRNAs should contain sense and antisense sequences separated by a loop structure (recommended lengths of 19-21 nt each) and a 3' AAAA overhang. It is suggested that an effective loop structure be 3-9 nt in length. It is suggested that shRNA cassettes be designed following the sense-loop-antisense order and that 5' overhangs be avoided on shRNA constructs. Finally, several companies offer premade siRNAs and shRNAs commercially.

[0071] In some aspects, any of the oligonucleotides of the present disclosure is provided, wherein the oligonucleotide is an RNAi molecule, such as an siRNA, shRNA, or di-siRNA, comprising at least one nucleotide variant (e.g., an LNA unit). In some aspects, the oligonucleotide of the present disclosure further comprises at least one non-nucleotide or non-polynucleotide moiety (e.g., a GalNac moiety) covalently attached to the oligonucleotide, either directly or via a linker located between the contiguous nucleotide sequence and the non-nucleotide or non-polynucleotide moiety.

[0072] In some aspects, the present disclosure provides an oligonucleotide of the present disclosure comprising a 16-22 contiguous oligonucleotide in length comprising a 16-nucleotide contiguous sequence that is 100% complementary to a human synaptogyrin-3 target sequence selected from the group consisting of SEQ ID NOs: 2-93, wherein the oligonucleotide is an RNAi molecule such as an siRNA, shRNA, or di-siRNA that comprises at least one nucleotide variant (e.g., an LNA unit), and wherein the RNAi molecule targets the synaptogyrin-3 transcript set forth in SEQ ID NO: 1.

[0073] In some aspects, the oligonucleotides of the present disclosure comprise, consist of, or consist essentially of an RNAi molecule that binds to the human synaptogyrin-3 transcript set forth in SEQ ID NO: 1, wherein the RNAi molecule comprises one or more sequences selected from the group consisting of SEQ ID NOs: 94-249, more particularly SEQ ID NOs: 172-249.

[0074] In some aspects, oligonucleotides of the present disclosure include RNAi molecules comprising one or more sequences selected from the group consisting of SEQ ID NOs: 94-249, except for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleobase substitutions. In some aspects, oligonucleotides of the present disclosure include RNAi molecules comprising a sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 94-249. In some aspects, oligonucleotides of the present disclosure include RNAi molecules comprising a sequence that is about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 172-249. In some aspects, oligonucleotides of the present disclosure comprise a sequence that overlaps with a 9, 10, 11, 12, 13, 14, 15, or 16 nucleobase subsequence from a sequence selected from the group consisting of SEQ ID NOs: 172-249.

[0075] In some aspects, the oligonucleotides of the present disclosure contain at least one non-cleavable internucleoside linkage, e.g., a phosphorothioate linkage. In some aspects, all internucleoside linkages on the oligonucleotides of the present disclosure are non-cleavable, e.g., phosphorothioate linkages. In some aspects, non-cleavable internucleoside linkages, e.g., phosphorothioate linkages, are present only in the wing portions of a gapmer, e.g., the 5'-end or the last 1, 2, or 3 linkages in the oligonucleotide and the 5'-end or the last 1, 2, or 3 linkages in the oligonucleotide. In some aspects, the oligonucleotides of the present disclosure contain nucleotide analogs. In some aspects, the oligonucleotides of the present disclosure contain affinity-enhancing nucleotide analogs. In some aspects, the nucleotide analogs are sugar-modified nucleotides, e.g., sugar-modified nucleotides independently or dependently selected from the group consisting of 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, and 2'-fluoro-DNA units.

[0076] In some aspects, the oligonucleotides of the present disclosure are siRNAs, di-siRNAs, shRNAs, RNA duplexes, or antisense strands from RNA duplexes. In some aspects, the oligonucleotides of the present disclosure comprise one or more locked nucleic acids (LNAs). In some aspects, the LNA oligonucleotides comprise wings of two to four nucleotide analogs, preferably LNA analogs, on each side (5' and 3'). In some aspects, the oligonucleotides of the present disclosure may optionally comprise an additional 1 to 6 nucleotides (e.g., 1, 2, 3, 4, 5, or 6 nucleotides), which may form or comprise a biologically cleavable nucleotide region, such as a phosphate nucleotide linker. In some aspects, the biologically cleavable nucleotide region is formed from a short stretch (e.g., 1, 2, 3, 4, 5, or 6 nucleotides) of physiologically unstable nucleotides. This can be achieved by using phosphodiester linkages in DNA / RNA nucleosides, or other nucleosides can be used if physiological stability can be maintained.

[0077] In some aspects, the LNA is oxy-LNA, thio-LNA, amino-5 LNA, 5'-methyl-LNA, ENA, cET, cMOE, or a combination thereof. In some aspects, the LNA is a stereoisomer of the beta-D or alpha-L configuration. In some aspects, the oligonucleotide of the present application comprises at least one cET unit. In some aspects, the oligonucleotide comprises 2, 3, 4, 5, 6, or 7 LNA units. In some aspects, every LNA unit on the oligonucleotide is a stereoisomer of the same configuration. In some aspects, every LNA unit on the oligonucleotide is a beta-D-oxyLNA unit, or every LNA unit on the oligonucleotide is an alpha-L-oxy-LNA unit. In some aspects, the sequence of the oligonucleotide comprises at least one phosphorothioate, phosphorodithioate, or boranophosphate internucleoside linkage. In some aspects, one or more of the internucleoside linkages contain a chiral center in the R and / or S conformation. In some aspects, an oligonucleotide comprising an LNA can form a duplex with a human synaptogyrin-3 target sequence selected from the group consisting of SEQ ID NOs: 2-93 with increased thermal stability relative to a corresponding duplex comprising the corresponding oligonucleotide without the LNA.

[0078] In some aspects, the oligonucleotides of the present disclosure are RNAi molecule conjugates comprising an RNAi molecule covalently attached to a non-nucleotide or non-polynucleotide moiety, which may be attached to the 5' end, the 3' end, or both. In some aspects, the non-nucleotide or non-polynucleotide moiety is a targeting moiety attached to the 5' end or the 3' end of the RNAi molecule. In some aspects, the targeting moiety is linked to the RNAi molecule via a linker. In some aspects, the targeting moiety comprises a carbohydrate conjugate moiety comprising a carbohydrate selected from the group consisting of galactose, lactose, N-acetylgalactosamine (GalNAc), mannose, mannose-6-phosphate, and combinations thereof. In some aspects, the carbohydrate conjugate moiety is not a linear carbohydrate polymer. In some aspects, the carbohydrate conjugate moiety is a carbohydrate group comprising one, two, three, or four carbohydrate moieties. In some aspects, the carbohydrate moieties are identical or non-identical. In some aspects, the carbohydrate conjugate moiety comprises at least one asialoglycoprotein receptor targeting conjugate moiety. In some aspects, the asialoglycoprotein receptor-targeting conjugate moiety comprises a monovalent, divalent, trivalent, or tetravalent GalNAc cluster. In some aspects, each GalNAc in the GalNAc cluster is attached to a branch point group via a spacer. In some aspects, the branch point group comprises a dilysine. In some aspects, the spacer comprises a PEG spacer. In some aspects, the linker comprises a C6-C12 aminoalkyl group or a biologically cleavable phosphate nucleotide linker comprising between 1 and 6 nucleotides. In some aspects, the targeting moiety targets the oligonucleotides of the present disclosure to the central nervous system (CNS). In some aspects, the targeting moiety allows the oligonucleotides of the present disclosure to penetrate the blood-brain barrier (BBB).

[0079] In some aspects, the oligonucleotides of the present disclosure, more particularly the RNAi molecules of the present disclosure, are double-stranded nucleic acids. In some aspects, the RNAi molecules are siRNAs. In some aspects, the RNAi molecules of the present disclosure are di-siRNAs. In some aspects, the RNAi molecules of the present disclosure are shRNAs. In some aspects, the antisense oligomer portion of the oligonucleotides of the present disclosure is an antisense oligonucleotide (ASO). In some aspects, the antisense oligomer portion of the oligonucleotides of the present disclosure is a multimer. In some aspects, the antisense oligomer portion of the oligonucleotides of the present disclosure is a multimeric ASO. For example, it may comprise several concatenated antisense oligomers of the present disclosure. In some aspects, the antisense oligomer portion of the oligonucleotides of the present disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 concatenated antisense oligomers. In some aspects, the concatenated oligomers are connected via cleavable linkers inserted between each ASO unit on the ASO multimer.

[0080] In some aspects, the antisense oligomer portion of the oligonucleotides of the present disclosure may target a target region on synaptogyrin-3 mRNA selected from the group consisting of SEQ ID NOs: 2-93.

[0081] In some aspects, the antisense oligomer portion of the oligonucleotide of the present disclosure comprises a complementary region that is complementary to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides of a target region on synaptogyrin-3 mRNA selected from the group consisting of SEQ ID NOs: 2-93.

[0082] The oligonucleotides of the present disclosure can regulate the expression of the synaptogyrin-3 gene by specifically targeting a target region on synaptogyrin-3 RNA, e.g., mRNA. In some aspects, the oligonucleotides of the present disclosure can down-regulate the expression of the synaptogyrin-3 gene by binding to such a target region. Therefore, in some aspects, the oligonucleotides of the present disclosure can affect (reduce or inhibit) the expression of synaptogyrin-3 in a mammalian subject, e.g., a human, by binding to a specific target region on synaptogyrin-3 RNA, e.g., mRNA. In some aspects, the oligonucleotides of the present disclosure can affect the expression of synaptogyrin-3 in human cells by binding to a specific target region on synaptogyrin-3 RNA, e.g., mRNA. In some aspects, the RNA is mRNA, e.g., pre-mRNA. In some aspects, the RNA is mature mRNA. The oligonucleotides according to the present disclosure are preferably capable of hybridizing to a target nucleic acid.

[0083] In some aspects, the target sequence may extend 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides beyond the 5' end of the synaptorgyrin-3 target region comprising or consisting of a sequence set forth in SEQ ID NOs: 2-93. In some aspects, the target sequence may extend 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides beyond the 3' end of the synaptorgyrin-3 target region comprising or consisting of a sequence set forth in SEQ ID NOs: 2-93. In some aspects, the target sequence may extend 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides beyond the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides beyond the 3' end of the synaptorgyrin-3 target region comprising or consisting of a sequence set forth in SEQ ID NOs: 2-93. In some aspects, the extended target region overlaps 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides of a synaptogyrin-3 target region comprising or consisting of a sequence set forth in SEQ ID NOs: 2-93.

[0084] In some aspects, nucleotides extending beyond the 5' and / or 3' ends of the sequences set forth in SEQ ID NOs: 2-93 are complementary (partially or fully complementary) to corresponding sequences on the mRNA transcript of SEQ ID NO: 1. The present disclosure also provides antisense oligonucleotides that are complementary, e.g., fully complementary, to these target sequences.

[0085] In some aspects, the present disclosure provides target sequences comprising a 21-mer sequence selected from SEQ ID NOs: 2-4, 6-15, 17, 18, 20, 21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and 83-92, or a 12, 13, 14, 15, 16, 17, 18, 19, or 20-mer subsequence thereof. Furthermore, the present disclosure provides target sequences comprising (i) a sequence selected from the group consisting of SEQ ID NOs:2-4, 6-15, 17, 18, 20, 21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and 83-92, and 12-mer, 13-mer, 14-mer, 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, or 20-mer subsequences thereof, plus (ii) 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional 5' nucleotides and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional 3' nucleotides. In some aspects, the additional 5' and / or 3' nucleotides are complementary (partially or fully complementary) to the corresponding sequence on the mRNA transcript of SEQ ID NO:1. The present disclosure also provides antisense oligonucleotides that are complementary, eg, perfectly complementary, to these target sequences.

[0086] In some aspects, the target region comprises or consists of a corresponding target sequence region derived from the sequence of a mutant or allelic variant of the human synaptogyrin-3 gene encoding the mRNA transcript of SEQ ID NO: 1. In other aspects, the target region can be a subsequence present on another synaptogyrin-3 mRNA transcript variant encoding human synaptogyrin-3. In some aspects, the target region comprises or consists of a corresponding target sequence region derived from the sequence of a paralog or ortholog of the human synaptogyrin-3 gene encoding the mRNA of SEQ ID NO: 1.

[0087] In some aspects, the target region is within an exon, hi some aspects, the target region comprises a junction between an intron and an exon.

[0088] In some aspects, the oligonucleotides of the disclosure bind to a subsequence of a target nucleic acid (e.g., an mRNA transcript, wherein the subsequence is selected from the group consisting of SEQ ID NOs: 2-93), and the effect on synaptogyrin-3 expression and / or activity levels is at least about a 10% to about a 20% reduction in synaptogyrin-3 expression and / or activity levels compared to normal or control synaptogyrin-3 expression levels (e.g., synaptogyrin-3 expression levels in saline-treated cells, animals, or humans) and / or normal or control synaptogyrin-3 activity levels (e.g., expression levels in saline-treated cells, animals, or humans). In some aspects, the reduction in synaptogyrin-3 expression and / or activity is at least about 10%, at least about 15%, at least about 20%, at least about a 10% to about a 20% reduction in synaptogyrin-3 expression and / or activity levels compared to normal or control expression and / or activity levels. at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100%. In some aspects, the reduction in synaptogyrin-3 expression and / or activity is about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% compared to normal or control synaptogyrin-3 expression and / or activity levels.

[0089] In some aspects, the synaptogyrin-3 expression level and / or protein level and / or activity level after administration of an oligonucleotide of the present disclosure is less than about 2%, less than about 5%, less than about 10%, less than about 15%, less than about 20%, less than about 25%, less than about 30%, less than about 35%, less than about 40%, less than about 45%, less than about 50%, less than about 55%, less than about 60%, less than about 65%, less than about 70%, less than about 75%, or less than about 80% of the synaptogyrin-3 expression level and / or protein level and / or activity level prior to administration of the oligonucleotide of the present disclosure.

[0090] In some aspects, the synaptogyrin-3 expression level and / or protein level and / or activity level after administration of an oligonucleotide of the present disclosure is about 2% to about 5%, about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, or about 75% to about 80% of the synaptogyrin-3 expression level and / or protein level and / or activity level prior to administration of the oligonucleotide of the present disclosure.

[0091] Thus, the present disclosure provides an in vitro or in vivo method for downregulating or inhibiting expression of synaptogyrin-3 protein and / or mRNA transcripts in a cell expressing synaptogyrin-3 protein and / or mRNA, the method comprising administering to the cell an oligonucleotide of the present disclosure, e.g., as a pharmaceutical composition of the present disclosure, to downregulate or inhibit expression of synaptogyrin-3 protein and / or mRNA in the cell. Preferably, the cell is a mammalian cell, such as a human cell.

[0092] It should be understood that in some aspects, the oligonucleotides of the present disclosure may be multimers comprising, for example, 2, 3, 4, 5, 6, or more chains of the oligonucleotides disclosed herein, which may optionally be connected by spacers or linkers comprising nucleotide or non-nucleotide units interposed between each oligonucleotide on the multimer. Thus, in some aspects, oligonucleotides of the present disclosure can comprise or consist of a contiguous nucleotide sequence totaling at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides in length.

[0093] In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 172 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 173 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 174 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 175 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 176 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 177 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 178 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 179 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 180 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 181 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 182 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 183 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 184 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 185 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 186 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 187 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 188 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 189 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 190 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 191 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 192 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 193 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 194 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 195 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 196 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 197 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 198 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 199 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 200 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 201 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 202 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 203 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 204 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 205 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 206 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 207 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 208 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 209 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 210 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 211 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 212 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 213 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 214 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 215 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 216 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 217 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 218 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 219 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 220 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 221 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 222 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 223 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 224 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 225 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 226 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, the oligonucleotide of the present disclosure has an antisense sequence set forth in SEQ ID NO: 227 or 12 to 21 contiguous sequences thereof. In some aspects, the oligonucleotide of the present disclosure includes a single-stranded oligomer, e.g., a 16-mer, comprising the antisense sequence set forth in SEQ ID NO: 228 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, the oligonucleotide of the present disclosure includes a single-stranded oligomer, e.g., a 16-mer, comprising the antisense sequence set forth in SEQ ID NO: 229 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, the oligonucleotide of the present disclosure includes a single-stranded oligomer, e.g., a 16-mer, comprising the antisense sequence set forth in SEQ ID NO: 230 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, the oligonucleotide of the present disclosure includes a single-stranded oligomer, e.g., a 16-mer, comprising the antisense sequence set forth in SEQ ID NO: 231 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 232 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 233 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 234 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 235 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 236 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 237 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 238 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 239 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 240 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 241 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 242 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 243 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 244 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 245 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 246 or a 12-21 contiguous nucleotide subsequence thereof.In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 247 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 248 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects, oligonucleotides of the present disclosure include single-stranded oligomers, e.g., 16-mers, comprising the antisense sequence set forth in SEQ ID NO: 249 or a 12-21 contiguous nucleotide subsequence thereof. In some aspects of the antisense sequences disclosed above, all odd-numbered positions on the antisense sequence include 2' O-methyl modifications and all even-numbered positions on the antisense sequence include 2' fluoro modifications. In some aspects of the antisense sequences disclosed above, the first two 5' and last two 3' internucleoside linkages are phosphorothioate.

[0094] In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 94 and 172, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 95 and 173, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 96 and 174, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 97 and 175, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 98 and 176, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 99 and 177, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 100 and 178, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 101 and 179, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 102 and 180, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 103 and 181, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 104 and 182, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 105 and 183, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 106 and 184, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 107 and 185, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 108 and 186, respectively.In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 109 and 187, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 110 and 188, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 111 and 189, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 112 and 190, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 113 and 191, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 114 and 192, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 115 and 193, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 116 and 194, respectively.In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 117 and 195, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 118 and 196, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 119 and 197, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 120 and 198, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 121 and 199, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 122 and 200, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 123 and 201, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 124 and 202, respectively.In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 125 and 203, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 126 and 204, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 127 and 205, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 128 and 206, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 129 and 207, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 130 and 208, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 131 and 209, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 132 and 210, respectively.In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 133 and 211, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 134 and 212, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 135 and 213, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 136 and 214, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 137 and 215, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 138 and 216, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 139 and 217, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 140 and 218, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 141 and 219, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 142 and 220, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 143 and 221, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 144 and 222, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 145 and 223, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 146 and 224, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 147 and 225, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 148 and 226, respectively.In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 149 and 227, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 150 and 228, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 151 and 229, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 152 and 230, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 153 and 231, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 154 and 232, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 155 and 233, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 156 and 234, respectively.In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 157 and 235, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 158 and 236, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 159 and 237, respectively. In some aspects, the nucleic acid of the present disclosure is a duplex (e.g., siRNA or shRNA) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 160 and 238, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 161 and 239, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 162 and 240, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 163 and 241, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 164 and 242, respectively.In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 165 and 243, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 166 and 244, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 167 and 245, respectively. In some aspects, nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising sense and antisense strands that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 168 and 246, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 169 and 247, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 170 and 248, respectively. In some aspects, the nucleic acids of the present disclosure are duplexes (e.g., siRNAs or shRNAs) comprising a sense strand and an antisense strand that comprise or consist of the sense and antisense sequences set forth in SEQ ID NOs: 171 and 249, respectively. In some aspects of the nucleic acid duplex sequences disclosed above, the 3' end of the sense strand and the 5' end of the antisense strand are connected by a loop. In some aspects of the nucleic acid duplex sequences disclosed above, all odd-numbered positions on the antisense strand sequence comprise 2'-O-methyl modifications, and all even-numbered positions on the antisense sequence comprise 2'-fluoro modifications.In some aspects of the nucleic acid duplex sequences disclosed above, all even-numbered positions on the sense strand sequence contain a 2'-O-methyl modification, and all off-positions on the sense strand sequence contain a 2'-fluoro modification, with the exception of the first 5'-terminal nucleotide (position 1), which contains a 2'-O-methyl modification. In some aspects of the nucleic acid duplex sequences disclosed above, the first two 5' and last two 3' internucleoside linkages of the sense strand are phosphorothioate. In some aspects of the nucleic acid duplex sequences disclosed above, the first two 5' and last two 3' internucleoside linkages of the antisense strand are phosphorothioate. The target region within the synaptogyrin-3 mRNA of the present application

[0095] Surprisingly, it was found that some regions within the synaptogyrin-3 mRNA transcript are significantly more accessible to oligonucleotides, such as RNAi molecules, and are therefore preferred target regions for designing oligonucleotides suitable for or capable of reducing the expression and / or activity of synaptogyrin-3. The boundaries of the identified regions were determined by transcript walking (Table 1).

[0096] Syngr-3 mRNA levels were determined in SH-SY5Y cells using 20 nM and 2 nM doses of siRNA containing a 21-mer antisense sequence and a 19-mer sense sequence. Dose-response curves (DRCs) were determined for siRNAs that could significantly reduce Syngr-3 mRNA transcript levels.

[0097] Table 1. Summary of siRNA molecules developed and tested by the inventors of this application. Listed from 5' to 3' based on their binding position on the synaptogyrin-3 transcript. The symbol " / / " represents some siRNA molecules that do not reduce synaptogyrin-3 transcript levels and are not shown due to space limitations. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0098] The threshold for the region suitable for antisense design was set at a level where the siRNA tested in at least one experiment (at a dose of 2 nM or 20 nM) would be able to reduce human Syngr-3 transcripts by at least 15% relative to a reference system (e.g., the baseline level in an individual or population of individuals, or below a predetermined threshold value). Nevertheless, because the DRC results ultimately showed a stronger reduction in Syngr-3 transcript levels (Table 1), therapeutic effects may be obtained at levels of inhibition of human Syngr-3 mRNA transcript expression below 15%. The siRNA molecules selected from the primary screening were retested in two different cell lines (i.e., SH-SY5Y and SKBR3 cells) (Table 2).

[0099] As used herein, the term "reducing," e.g., reducing the level of hSYNGR3 mRNA transcripts, hSYNGR3 protein levels, or hSYNGR3 activity, or a combination thereof, refers to the ability of an oligonucleotide (e.g., ASO or siRNA) of the present disclosure to statistically significantly reduce (or decrease, inhibit, or lower) the level of hSYNGR3 gene transcripts (mRNA, e.g., pre-mRNA or mature mRNA) and / or hSYNGR3 protein levels and / or activity in a cell, tissue, or subject. In some aspects, the term "reducing" refers to complete reduction or inhibition (100% inhibition or undetectable levels) of hSYNGR3 mRNA transcripts and / or hSYNGR3 protein levels and / or activity. In other aspects, the term "reducing" refers to, for example, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least 90%, at least 95%, or at least 99% reduction or inhibition of the level of hSYNGR3 mRNA transcript and / or hSYNGR3 protein expression and / or activity in a cell, tissue, or subject.

[0100] The terms "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly a human, for whom diagnosis, treatment, or therapy is desired. The compositions and methods described herein are applicable to both human therapy and veterinary applications. In some aspects, the subject is a mammal, and in other aspects, the subject is a human. As used herein, "mammalian subject" encompasses all mammals, including, without limitation, humans, domestic animals (e.g., dogs, cats, and the like), agricultural animals (e.g., cows, sheep, pigs, horses, and the like), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, and the like).

[0101] Therefore, the present application provides target regions within the human Syngr-3 gene or Syngr3 mRNA transcript for designing oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) that reduce hSYNGR3 expression by at least 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least 90%, at least 95%, or at least 99%, compared to a control situation, for example, in which no oligonucleotide (e.g., ASO, siRNA, or shRNA) was administered or a scrambled control molecule was used as a negative control. The target regions and corresponding sequences are shown in Figures 3 and 4.

[0102] Table 2. Confirmation of IC50 and maximum inhibition of selected siRNA molecules from Table 1 in SH-SY5Y and SKBR3 cells. [Table 2-1] [Table 2-2]

[0103] In one embodiment, the synaptogyrin-3 is selected from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93. mRNA transcript target sequences are provided for designing antisense or RNAi molecules (e.g., ASOs, siRNAs, or shRNAs) that can reduce the level of synaptogyrin-3 transcripts, the level of expressed synaptogyrin-3, the level of synaptogyrin-3 activity, or a combination thereof in cells by at least 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least 90%, at least 95%, or at least 99%, for example, compared to a control situation in which no oligonucleotide (e.g., ASO, siRNA, or shRNA) was administered or a scrambled control molecule was used as a negative control. In specific embodiments, the synaptogyrin-3 mRNA transcript target sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and SEQ ID NOs: 83-92.

[0104] In another embodiment, the oligonucleotides of the present application (described in detail above) comprise a contiguous nucleotide sequence at least 10 contiguous nucleotides in length that is partially or fully complementary to a target region of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1 or an allelic variant thereof. In specific embodiments, the contiguous nucleotide sequence at least 10 contiguous nucleotides in length is at least 80%, at least 81%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a target region on the synaptogyrin-3 mRNA transcript. In a specific embodiment, the contiguous nucleotide sequence of at least 10 consecutive nucleotides in length is about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% complementary to the target region on the synaptogyrin-3 mRNA transcript. In another specific embodiment, the contiguous nucleotide sequence of at least 10 consecutive nucleotides in length is complementary to an equal length portion of the target region on the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1 or a variant thereof, such as an allelic variant thereof.

[0105] The target region of the present disclosure is defined as a subsequence of SEQ ID NO: 1, where the subsequence is described by the 5'-end position and the 3'-end position. For example, the target region between the nucleobases at positions 2 and 10 of SEQ ID NO: 1 consists of consecutive nucleobases 2, 3, 4, 5, 6, 7, 8, 9, and 10 or AGGCGGCAG of SEQ ID NO: 1. Therefore, any range given in the present disclosure should be understood to encompass the endpoints of the range. Thus, if the target region is located between the nucleotides at positions 2 and 10 of SEQ ID NO: 1, both nucleotides 2 and 10 of SEQ ID NO: 1 are encompassed.

[0106] As used in this disclosure, the terms "target region of SEQ ID NO: 1" or "target region on a synaptogyrin-3 mRNA transcript" or generally "target region," and grammatical variations thereof, refer to a region or subsequence on a synaptogyrin-3 mRNA transcript targeted by an oligonucleotide of the present disclosure. In some aspects, the synaptogyrin-3 mRNA transcript containing the target region is the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. However, in other aspects, the synaptogyrin-3 mRNA transcript containing the target region may be a synaptogyrin-3 mRNA transcript variant, such as an allelic variant of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, an isoform thereof, or an ortholog thereof.

[0107] In specific aspects, the target region is a subsequence located between nucleobase positions 205 and 265 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within a nucleotide subsequence located between nucleobase positions 205 and 265 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. In some aspects, the target region is located between nucleobase positions 206 and 265, 207 and 265, 208 and 265, 209 and 265, 210 and 265, 211 and 265, 212 and 265, 213 and 265, 214 and 265, 215 and 265, 216 and 265, 217 and 265, 218 and 265, 219 and 265, 220 and 265, 221 and 265 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. , 222 and 265, 223 and 265, 224 and 265, 225 and 265, 226 and 265, 227 and 265, 228 and 265, 229 and 265, 205 and 258, 205 and 259, 205 and 260, 205 and 261, 205 and 262, 205 and 263, or 205 and 264. More specifically, the target region is located between nucleobase positions 224 and 263 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, more specifically between nucleobase positions 225 and 262, 226 and 261, 227 and 260, or 228 and 259, and even more specifically between nucleobase positions 229 and 258 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0108] In more specific embodiments, the target region is defined by SEQ ID NO: 5. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 2, 3, and / or 4. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 94, 95, 96, 172, 173, and / or SEQ ID NO: 174.

[0109] In another specific embodiment, the target region is located between or contained within the nucleotide subsequence defined by nucleobase positions 255 and 348 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Specifically, the target region is located between nucleobase positions 256 and 348, 257 and 348, 258 and 348, 259 and 348, 260 and 348, 261 and 348, 262 and 348, 263 and 348, 264 and 348, 265 and 348, 255 and 325, 255 and 326, 255 and 327, 255 and 328, 255 and 329, 255 and 330, 255 and 331 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. 331, 255 and 332, 255 and 333, 255 and 334, 255 and 335, 255 and 336, 255 and 337, 255 and 338, 255 and 339, 255 and 340, 255 and 341, 255 and 342, 255 and 343, 255 and 344, 255 and 345, 255 and 346, or 255 and 347. More specifically, between nucleobase positions 260 and 330 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, more specifically between nucleobase positions 261 and 329, 262 and 328, 263 and 327, or 264 and 326, and even more specifically between nucleobase positions 265 and 325 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0110] In more specific embodiments, the target region is defined by SEQ ID NO: 16. In even more specific embodiments, the target region is defined by (or comprises or consists of) a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 175, 176, 177, 178, 179, 180, 181, 182, 183, and / or SEQ ID NO: 184.

[0111] In another specific embodiment, the target region is located between nucleobase positions 338 and 387 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within the nucleotide subsequence defined by nucleobase positions 338 and 387. Specifically, the target region is located between nucleobase positions 339 and 387, 340 and 387, 341 and 387, 342 and 387, 343 and 387, 338 and 377, 338 and 378, 338 and 379, 338 and 380, 338 and 381, 338 and 382, ​​338 and 383, 338 and 384, 338 and 385, or 338 and 386 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. More specifically, between nucleobase positions 338 and 382 of the synaptogyrin-3 mRNA transcript defined by SEQ ID NO:1, more specifically between nucleobase positions 339 and 381, 340 and 380, 341 and 379, 342 and 378, and even more specifically between nucleobase positions 343 and 377 of the synaptogyrin-3 mRNA transcript defined by SEQ ID NO:1.

[0112] In more specific embodiments, the target region is defined by SEQ ID NO: 19. In even more specific embodiments, the target region is defined by (or comprises or consists of) a sequence selected from the group consisting of SEQ ID NOs: 17 and 18. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 107, 108, 185, and / or SEQ ID NO: 186.

[0113] In another specific embodiment, the target region is located between or contained within a nucleotide subsequence defined by nucleobase positions 369 and 433 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Specifically, the target region is located between nucleobase positions 370 and 433, 371 and 433, 372 and 433, 373 and 433, 374 and 433, 375 and 433, 376 and 433, 377 and 433, 378 and 433, 379 and 433, 380 and 433, 381 and 433, 382 and 433, 383 and 433, 384 and 433, 385 and 433, 386 and 433, 387 and 433, 388 and 433, 389 and 433, 390 and 433, 391 and 433, 392 and 433, 393 and 433, 394 and 433, 395 and 433, 396 and 433, 397 and 433, 398 and 433, 399 and 433, 440 and 433, 441 and 442, 443 and 444, 445 and 446, 447 and 448, 449 and 450, 451 and 452, 453 and 454, 455 and 456, 457 and 458, 459 and 459, 460 and 461, 462 and 463, 464 and 4 The target region is located between nucleobase positions 85 and 433, 386 and 433, 387 and 433, 388 and 433, 389 and 433, 390 and 433, 391 and 433, 392 and 433, 393 and 433, 369 and 427, 369 and 428, 369 and 429, 369 and 430, 369 and 431, or 369 and 432. More specifically, the target region is located between nucleobase positions 388 and 432 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, more specifically between nucleobase positions 389 and 431, 390 and 430, 391 and 429, 392 and 428, and even more specifically, the target region is located between nucleobase positions 393 and 427 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0114] In more specific embodiments, the target region is defined by SEQ ID NO: 22. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 20 and / or 21. In most specific embodiments, the oligonucleotide comprises or consists of SEQ ID NOs: 109, 110, 187, and / or SEQ ID NO: 188.

[0115] In another specific embodiment, the target region is located between nucleobase positions 422 and 531 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1, or is contained within a nucleotide subsequence defined by nucleobase positions 422 and 531. Specifically, the target region is located between nucleobase positions 423 and 531, 424 and 531, 425 and 531, 426 and 531, 427 and 531, 428 and 531, 429 and 531, 430 and 531, 431 and 531, 432 and 531, 433 and 531, 434 and 531, 422 and 526, 422 and 527, 422 and 528, 422 and 529, or 422 and 530 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1. More specifically, the target region is located between nucleobase positions 429 and 531 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1, more specifically between nucleobase positions 430 and 530, 431 and 529, 432 and 528, 433 and 527, and even more specifically, the target region is located between nucleobase positions 434 and 526 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1.

[0116] In more specific embodiments, the target region is defined by SEQ ID NO: 26. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 23, 24, and / or 25. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 111, 112, 113, 189, 190, and / or SEQ ID NO: 191.

[0117] In another specific embodiment, the target region is located between or contained within the nucleotide subsequence defined by nucleobase positions 603 and 656 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Specifically, the target region is located between nucleobase positions 604 and 656, 605 and 656, 606 and 656, 607 and 656, 608 and 656, 609 and 656, 610 and 656, 603 and 632, 603 and 633, 603 and 634, 603 and 635, 603 and 636, 603 and 637, 603 and 638, 603 and 639, 603 and 640, 603 and 641, 603 and 642, 603 and 643, 603 and 644, 603 and 645, 603 and 646, 603 and 647, 603 and 648, 603 and 649, 603 and 650, 603 and 649, 603 and 641, 603 and 642, 603 and 643, 603 and 644, 603 and 645, 603 and 646, 603 and 647, 603 and 648, 603 and 649, 603 and 649, 603 and 641, 603 and 642, 603 and 643, 603 and 644, 603 and 645, 603 and 646, 603 and 6 603 and 640, 603 and 641, 603 and 642, 603 and 643, 603 and 644, 603 and 645, 603 and 646, 603 and 647, 603 and 648, 603 and 649, 603 and 650, 603 and 651, 603 and 652, 603 and 653, 603 and 654, or 603 and 655. More specifically, the target region is located between nucleobase positions 605 and 637 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, more specifically between nucleobase positions 606 and 636, 607 and 635, 608 and 634, 609 and 633, and even more specifically, the target region is located between nucleobase positions 610 and 632 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0118] In more specific embodiments, the target region is defined by SEQ ID NO: 30. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 27, 28, and / or 29. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 114, 115, 116, 192, 193, and / or SEQ ID NO: 194.

[0119] In another specific embodiment, the target region is located between or contained within the nucleotide subsequence defined by nucleobase positions 641 and 714 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Specifically, the target region is located between nucleobase positions 642 and 714, 643 and 714, 644 and 714, 645 and 714, 646 and 714, 647 and 714, 648 and 714, 649 and 714, 650 and 714, 641 and 683, 641 and 684, 641 and 685, 641 and 686, 641 and 687, 641 and 688, 641 and 689, 641 and 690, 641 and 691, 641 and 692, 641 and 693, of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. It is positioned between 641 and 694, 641 and 695, 641 and 696, 641 and 697, 641 and 698, 641 and 699, 641 and 700, 641 and 701, 641 and 702, 641 and 703, 641 and 704, 641 and 705, 641 and 706, 641 and 707, 641 and 708, 641 and 709, 641 and 710, 641 and 711, 641 and 712, or 641 and 713. More specifically, the target region is located between nucleobase positions 645 and 688 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1, more specifically between nucleobase positions 646 and 687, 647 and 686, 648 and 685, 649 and 684, and even more specifically, the target region is located between nucleobase positions 650 and 683 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1.

[0120] In more specific embodiments, the target region is defined by SEQ ID NO: 42. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and / or 41. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, and / or SEQ ID NO: 205.

[0121] In another specific embodiment, the target region is located between or contained within the nucleotide subsequence defined by nucleobase positions 717 and 768 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1. Specifically, the target region is located between nucleobase positions 718 and 768, 719 and 768, 720 and 768, 721 and 768, 722 and 768, 723 and 768, 724 and 768, 725 and 768, 726 and 768, 727 and 768, 728 and 768, 729 and 768, 730 and 768, 731 and 768, 732 and 768, 733 and 768, 734 and 768, 735 and 768, 736 and 768, 737 and 768, 717 and 762, 717 and 763, 717 and 764, 717 and 765, 717 and 766, or 717 and 767 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1. More specifically, the target region is located between nucleobases 732 and 767 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1, more specifically between nucleobase positions 733 and 766, 734 and 765, 735 and 764, 736 and 763, and even more specifically, the target region is located between nucleobases 737 and 762 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1.

[0122] In more specific embodiments, the target region is defined by SEQ ID NO: 46. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 43, 44, and / or 45. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 128, 129, 130, 206, 207, and / or SEQ ID NO: 208.

[0123] In another specific embodiment, the target region is located between nucleobase positions 1150 and 1600 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within the nucleotide subsequence defined by nucleobase positions 1150 and 1600. Specifically, the target region is located between nucleobase positions 1150 and 1600 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Nucleobase positions of mRNA transcripts 1151 and 1600, 1152 and 1600, 1153 and 1600, 1154 and 1600, 1155 and 1600, 1156 and 1600, 1157 and 1600, 1158 and 1600, 1159 and 1600, 1160 and 1600, 1161 and 1600, 1162 and 1600, 1163 and 1600, 1164 and 1600, 1165 and 1600, 1166 and 1600, 1167 and 1600, 1168 and 1600, 1169 and 1600, 1170 and 1600 00, 1171 and 1600, 1172 and 1600, 1173 and 1600, 1174 and 1600, 1175 and 1600, 1176 and 1600, 1177 and 1600, 1178 and 1600, 1179 and 1600, 1180 and 1600, 1181 and 1600, 1182 and 1600, 1183 and 1600, 1183 and 1600, 1184 and 1600, 1185 and 1600, 1186 and 1600, 1187 and 1600, 1188 and 1600, 1189 and 1600, 1190 and 160 0, 1191 and 1600, 1192 and 1600, 1193 and 1600, 1194 and 1600, 1195 and 1600, 1196 and 1600, 1197 and 1600, 1198 and 1600, 1199 and 1600, 1200 and 1600, 1201 and 1600, 1202 and 1600, 1203 and 1600, 1204 and 1600, 1205 and 1600, 1206 and 1600, 1207 and 1600, 1208 and 1600, 1209 and 1600, 1210 and 1600, 1211 and 1600 , 1212 and 1600, 1213 and 1600, 1214 and 1600, 1215 and 1600, 1216 and 1600, 1217 and 1600, 1218 and 1600, 1219 and 1600, 1220 and 1600, 1221 and 1600, 1222 and 1600, 1223 and 1600, 1224 and 1600, 1225 and 1600, 1226 and 1600, 1227 and 1600, 1228 and 1600, 1229 and 1600, 1230 and 1600, 1231 and 1600, 1232 and 1600,1233 and 1600, 1234 and 1600, 1235 and 1600, 1236 and 1600, 1237 and 1600, 1238 and 1600, 1239 and 1600, 1240 and 1600, 1241 and 1600, 1242 and 1600, 1243 and 1600, 1244 and 1600, 12 45 and 1600, 1246 and 1600, 1247 and 1600, 1248 and 1600, 1249 and 1600, 1250 and 1600, 1251 and 1600, 1252 and 1600, 1253 and 1600, 1254 and 1600, 1255 and 1600, 1256 and 1600, 1257 and 1600, 1258 and 1600, 1259 and 1600, 1260 and 1600, 1261 and 1600, 1262 and 1600, 1263 and 1600, 1264 and 1600, 1265 and 1600, 1266 and 1600, 1267 and 1600, 1150 and 1535, 1150 and 15 36, 1150 and 1537, 1150 and 1538, 1150 and 1539, 1150 and 1540, 1150 and 1541, 1150 and 1542, 1150 and 1543, 1150 and 1544, 1150 and 1545, 1150 and 1546, 1150 and 1547, 1150 and 1548, 1150 and 1549, 1150 and 1550, 1150 and 1551, 1150 and 1552, 1150 and 1553, 1150 and 1554, 1150 and 1555, 1150 and 1556, 1150 and 1557, 1150 and 1558, 1150 and 1559, 1150 and 1560, 11 50 and 1561, 1150 and 1562, 1150 and 1563, 1150 and 1564, 1150 and 1565, 1150 and 1567, 1150 and 1568, 1150 and 1569, 1150 and 1570, 1150 and 1571, 1150 and 1572, 1150 and 1573, 1150 and 1574, 1150 and 1575, 1150 and 1576, 1150 and 1577, 1150 and 1578, 1150 and 1579, 1150 and 1580, 1150 and 1581, 1150 and 1582, 1150 and 1583, 1150 and 1584, 1150 and 1585, 1150 and 15 86, 1150 and 1587, 1150 and 1588, 1150 and 1589, 1150 and 1590, 1150 and 1591, 1150 and 1592, 1150 and 1593, 1150 and 1594, 1150 and 1595, 1150 and 1596, 1150 and 1597, 1150 and 1598,or between 1150 and 1599. More specifically, the target region is located between nucleobase positions 1262 and 1540 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO: 1, more specifically between nucleobase positions 1263 and 1539, 1264 and 1538, 1265 and 1537, or 1266 and 1536, and even more specifically, the target region is located between nucleobase positions 1267 and 1535 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO: 1.

[0124] In a more specific embodiment, the target region is defined by or is defined by SEQ ID NO:59.

[0125] In another specific embodiment, the target region is located between nucleobases 1262 and 1307 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within the nucleotide subsequence defined by nucleobase positions 1262 and 1307. Specifically, the target region is located between nucleobase positions 1263 and 1307, 1264 and 1307, 1265 and 1307, 1266 and 1307, 1267 and 1307, 1262 and 1302, 1262 and 1303, 1262 and 1304, 1262 and 1305, or 1262 and 1306 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. More specifically, the target region is located between nucleobase positions 1267 and 1302 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0126] In more specific embodiments, the target region is defined by or is defined by SEQ ID NO: 50. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 47, 48, and / or 49. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 131, 132, 133, 209, 210, and / or SEQ ID NO: 211.

[0127] In another specific embodiment, the target region is located between nucleobase positions 1384 and 1540 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within the nucleotide subsequence defined by nucleobase positions 1384 and 1540. Specifically, the target region is located between nucleobases 1385 and 1540, 1386 and 1540, 1387 and 1540, 1388 and 1540, 1389 and 1540, 1384 and 1535, 1384 and 1536, 1384 and 1537, 1384 and 1538, or 1384 and 1539 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. More specifically, the target region is located between nucleobase positions 1389 and 1535 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0128] In more specific embodiments, the target region is defined by SEQ ID NO: 58. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 51, 52, 53, 54, 55, 56, and / or 57. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 134, 135, 136, 137, 138, 139, 140, 212, 213, 214, 215, 216, 217, and / or SEQ ID NO: 218.

[0129] In another specific embodiment, the target region is located between nucleobase positions 1600 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1 or is contained within the nucleotide subsequence defined by nucleobase positions 1600 and 2026. Specifically, the target region is located between nucleobase positions 1600 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Nucleobase positions 1601 and 2026, 1602 and 2026, 1603 and 2026, 1604 and 2026, 1605 and 2026, 1606 and 2026, 1607 and 2026, 1608 and 2026, 1609 and 2026, 1610 and 2026, 1611 and 2026, 1612 and 2026, 1613 and 2026, 1614 and 2026, 1615 and 2026, 1616 and 2026, 1617 and 2026, 1618 and 2026, 1619 and 2026, 1620 and 2026 26, 1621 and 2026, 1622 and 2026, 1623 and 2026, 1624 and 2026, 1625 and 2026, 1626 and 2026, 1627 and 2026, 1628 and 2026, 1629 and 2026, 1630 and 2026, 1631 and 2026, 1632 and 2026, 1633 and 2026, 1634 and 2026, 1635 and 2026, 1636 and 2026, 1637 and 2026, 1638 and 2026, 1639 and 2026, 1640 and 2026, 1641 and 2026 6, 1642 and 2026, 1643 and 2026, 1644 and 2026, 1645 and 2026, 1646 and 2026, 1647 and 2026, 1648 and 2026, 1649 and 2026, 1650 and 2026, 1651 and 2026, 1652 and 2026, 1653 and 2026, 1654 and 2026, 1655 and 2026, 1656 and 2026, 1657 and 2026, 1658 and 2026, 1659 and 2026, 1660 and 2026, 1661 and 2026, 1662 and 2026 , 1663 and 2026, 1664 and 2026, 1665 and 2026, 1666 and 2026, 1667 and 2026, 1668 and 2026, 1669 and 2026, 1670 and 2026, 1671 and 2026, 1672 and 2026, 1673 and 2026, 1674 and 2026, 1675 and 2026, 1676 and 2026, 1677 and 2026, 1678 and 2026, 1679 and 2026, 1680 and 2026, 1681 and 2026, 1682 and 2026, 1683 and 2026,1684 and 2026, 1685 and 2026, 1686 and 2026, 1687 and 2026, 1688 and 2026, 1689 and 2026, 1690 and 2026, 1691 and 2026, 1692 and 2026, 1693 and 2026, 1694 and 2026, 1695 and 2026, 1696 and 2026, 1697 and 2026, 1698 and 2026, 1699 and 2026, 17 The target region is located between nucleobase positions 1700 and 2026, 1701 and 2026, 1702 and 2026, 1703 and 2026, 1704 and 2026, 1705 and 2026, 1706 and 2026, 1707 and 2026, 1708 and 2026, 1709 and 2026, 1710 and 2026, 1711 and 2026, 1712 and 2026, 1713 and 2026, or 1600 and 2025. More specifically, the target region is located between nucleobase positions 1708 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, and even more specifically, between nucleobase positions 1713 and 2025 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1.

[0130] In more specific embodiments, the target region is defined by SEQ ID NO: 69. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 60, 61, 62, 63, 64, 65, 66, 67, and / or 68. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 141, 142, 143, 144, 145, 146, 147, 148, 149, 219, 220, 221, 222, 223, 224, 225, 226, and / or SEQ ID NO: 227.

[0131] In another specific embodiment, the target region is located between or contained within the nucleotide subsequence defined by nucleobase positions 1743 and 1868 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Specifically, the target region is located between nucleobase positions 1744 and 1868, 1745 and 1868, 1746 and 1868, 1747 and 1868, 1748 and 1868, 1749 and 1868, 1750 and 1868, 1751 and 1868, 1752 and 1868, 1753 and 1868, 1754 and 1868, 1755 and 1868, 1756 and 1868, 1757 and 1868, 1758 and 1868 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. It can be positioned between 1868, 1759 and 1868, 1760 and 1868, 1761 and 1868, 1762 and 1868, 1763 and 1868, 1764 and 1868, 1765 and 1868, 1766 and 1868, 1767 and 1868, 1768 and 1868, 1769 and 1868, 1743 and 1865, 1743 and 1866, or 1743 and 1867. More specifically, the target region is located between nucleobase positions 1764 and 1868 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1, more specifically between nucleobase positions 1765 and 1868, 1766 and 1868, or 1767 and 1867, 1768 and 1866, and even more specifically, the target region is located between nucleobase positions 1769 and 1865 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1.

[0132] In more specific embodiments, the target region is defined by SEQ ID NO: 82. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, and / or 81. In most specific embodiments, the oligonucleotide (e.g., ASO, siRNA, shRNA) comprises or consists of SEQ ID NOs: 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, and / or SEQ ID NO: 239.

[0133] In another specific embodiment, the target region is located between nucleobase positions 1865 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, or is contained within the nucleotide subsequence defined by nucleobase positions 1865 and 2026. Specifically, the target region is located between nucleobase positions 1865 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1. Nucleobase positions 1866 and 2026, 1867 and 2026, 1868 and 2026, 1869 and 2026, 1870 and 2026, 1871 and 2026, 1872 and 2026, 1873 and 2026, 1874 and 2026, 1875 and 2026, 1876 and 2026, 1877 and 2026, 1878 and 2026, 1879 and 2026, 1880 and 2026, 1881 and 2026, 1882 and 2026, 1883 and 2026, 1884 and 2026, 1885 and 2026, 1886 and 2026, 1887 and 2026, 1888 and 2026, 1889 and 2026, 1890 and 2026, 1891 and 2026, 1892 and 2026, 1893 and 2026, 1894 and 2026, 1895 and 2026, 1896 and 2026, 1897 and 2026, 1898 and 2026, 1899 and 2026, 1899 and 2026, 1890 and 2026, 1891 and 2026, 1892 and 2026, 1893 and 2026, 1894 and 2026, 1895 and 2026, 1896 and 2026, 1 4 and 2026, 1885 and 2026, 1886 and 2026, 1887 and 2026, 1888 and 2026, 1889 and 2026, 1890 and 2026, 1891 and 2026, 1892 and 2026, 1893 and 2026, 1894 and 2026, 1895 and 2026, 1896 and 2026, 1897 and 2026, 1898 and 2026, 1899 and 2026, 1900 and 2026, 1901 and 2026, 1902 and 2026, 1903 and 2026, 1904 and 2026, 1905 and 2026, 1906 and 2026, 1907 and 2026, 1908 and 2026, 1909 and 2026, 1910 and 2026, 1911 and 2026, 1912 and 2026, 1913 and 2026, 1914 and 2026, 1915 and 2026, 1916 and 2026, 1917 and 2026, 1918 and 2026, 1919 and 2026, 1920 and 2026, 1921 and 2026, 1922 and 2026, 1923 and 2026 26, 1924 and 2026, 1925 and 2026, 1926 and 2026, 1927 and 2026, 1928 and 2026, 1929 and 2026, 1930 and 2026, 1931 and 2026, 1932 and 2026, 1933 and 2026, 1934 and 2026, 1935 and 2026, 1936 and 2026, 1937 and 2026, 1938 and 2026, 1939 and 2026, 1940 and 2026, or 1865 and 2025.More specifically, the target region is located between nucleobase positions 1935 and 2026 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1, more specifically between nucleobase positions 1936 and 2026, 1937 and 2026, 1938 and 2026, or 1939 and 2026, and even more specifically between nucleobase positions 1940 and 2025 of the synaptogyrin-3 mRNA transcript defined in SEQ ID NO:1.

[0134] In more specific embodiments, the target region is defined by SEQ ID NO: 93. In even more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 83, 84, 85, 86, 87, 88, 89, 90, 91, and / or 92. In most specific embodiments, the oligonucleotide (e.g., siRNA, ASO, shRNA) comprises or consists of SEQ ID NOs: 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 240, 241, 242, 243, 244, 245, 246, 247, 248, and / or SEQ ID NO: 249.

[0135] In another specific embodiment, the target region is located between nucleobase positions 1992 and 2026 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1, or is contained within a nucleotide subsequence defined by nucleobase positions 1992 and 2026. Specifically, the target region is located between nucleobase positions 1993 and 2026, 1994 and 2026, 1995 and 2026, 1996 and 2026, 1997 and 2026, or 1992 and 2025 of the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO:1.

[0136] In more specific embodiments, the target region is defined by (or comprises or consists of) SEQ ID NOs: 90, 91, and / or 92. In most specific embodiments, the oligonucleotide (e.g., siRNA, ASO, shRNA) comprises or consists of SEQ ID NOs: 169, 170, 171, 247, 248, and / or SEQ ID NO: 249.

[0137] In some aspects, the present disclosure provides target regions within the human Syngr-3 gene, specifically within the synaptogyrin-3 mRNA transcript set forth in SEQ ID NO: 1, that can be used to design oligonucleotides or RNAi molecules (e.g., ASOs, siRNAs, shRNAs) that can reduce the expression level of synaptogyrin-3 mRNA transcripts in cells, wherein the target region is any of the target regions described above.

[0138] Furthermore, any of the target regions described herein, for example, a target region defined by any of SEQ ID NOs: 2 to 93, a subsequence thereof, or a subsequence of the synaptogyrin-3 mRNA transcript defined by SEQ ID NO: 1 that includes or overlaps with a target region defined by any of SEQ ID NOs: 2 to 93, are provided for designing antisense or RNAi molecules, more specifically siRNA, di-siRNA, or shRNA duplexes, that can statistically significantly reduce the expression level of the synaptogyrin-3 mRNA transcript described by SEQ ID NO: 1, the synaptogyrin-3 protein level, the synaptogyrin-3 activity level, or any combination thereof in cells.

[0139] Antisense oligonucleotides (ASO): In some aspects, the oligonucleotides of the present disclosure are ASOs. Thus, in some aspects, the oligonucleotides of the present disclosure include antisense oligonucleotides (ASOs), such as unconjugated or conjugated ASOs. Antisense oligonucleotides or ASOs are small (generally between about 16 and about 30 nucleotides, or shorter, for example, between about 12 and about 20 nucleotides) synthetic single-stranded nucleic acid polymers of various chemistries, which can be used to regulate gene expression through various mechanisms. ASOs can be subdivided into two major categories: RNase H reactive and steric block ASOs. In some aspects, the oligonucleotides of the present disclosure are RNase H reactive. In some aspects, the oligonucleotides of the present disclosure are steric block ASOs. In some aspects, the oligonucleotides of the present disclosure are gapmers. Gapmer designs are disclosed, for example, in WO 2007 / 146511A2, the entire contents of which are incorporated herein by reference.

[0140] ASOs can also regulate gene expression through steric hindrance or occupancy alone. Steric block oligonucleotides are designed to bind to target transcripts with high affinity but lack RNase H reactivity and therefore do not induce target transcript degradation. Thus, such oligonucleotides contain either nucleotides that do not form RNase H substrates when paired with RNA, or a mixture of nucleotide chemistries that avoids stretches of consecutive DNA-like bases. Steric block oligonucleotides can mask specific sequences within target transcripts, thereby interfering with transcript RNA-RNA and / or RNA-protein interactions. The most widely used application of steric block ASOs is in modulating alternative splicing to selectively exclude or retain specific exon(s) to disrupt target gene translation. ASOs can also be designed to interfere with the maturation and stability of RNA transcripts or block their interaction with the translational apparatus.

[0141] In cases where ASOs can enter the nucleus, mRNA maturation can be regulated by inhibiting 5'-capping, inhibiting mRNA splicing, or activating RNase H (Chan et al 2006 Clin Exp Pharmacol Physiol 33:533-540; this reference also describes some of the software available to assist in ASO design).

[0142] In some aspects, the ASO comprises an antisense oligomer 16 to 22 contiguous nucleotides in length, wherein the sequence of the antisense oligomer comprises a contiguous sequence 16 to 22 (e.g., 16) nucleotides in length that is 100% complementary to a sequence or subsequence of a synaptogyrin-3 target sequence selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17, 18, 20, 21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and 83-92, or from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93, wherein the antisense oligomer targets an RNA encoding synaptogyrin-3.

[0143] In some aspects, the ASO comprises an antisense oligomer 10-16 contiguous nucleotides in length, wherein the sequence of the antisense oligomer comprises a contiguous sequence 10-25 nucleotides in length that is 100% complementary to a sequence or subsequence of a synaptogyrin-3 target sequence selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17, 18, 20, 21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and 83-92, or from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93, wherein the antisense oligomer targets an RNA encoding synaptogyrin-3.

[0144] In some aspects, the ASO is a gapmer. In some aspects, the ASO is conjugated to a targeting moiety, such as a GalNAc moiety.

[0145] RNAi using double-stranded silencers: In some aspects, the oligonucleotide of the present disclosure is an RNAi molecule, specifically an RNAi duplex or double-stranded RNAi oligonucleotide, more specifically the antisense portion or antisense strand of an RNAi duplex (double-stranded RNA). RNA interference (RNAi) is a mechanism by which double-stranded RNA induces the loss of homologous RNA molecules. Short interfering RNA (siRNA) molecules are effector molecules of RNAi, and are classically composed of an RNA duplex (or alternatively referred to as the duplex of an RNA molecule) with a length of 21 nucleotides, i.e., 19 complementary bases and two terminal 3' overhangs. One strand of the siRNA (the guide or antisense strand) is complementary to the target transcript, and the other strand is designated as the passenger or sense strand. siRNA acts as part of the RNA-induced silencing complex (RISC) to guide Argonaute 2 protein (AGO2) to the complementary target transcript. Perfect complementarity between the siRNA and the target transcript results in AGO2-catalyzed cleavage of the guide strand at the opposite position of the target, leading to gene silencing.

[0146] In siRNA, the sense strand fulfills the formal definition of a drug delivery device: it is non-covalently bound, enhances the stability of the antisense strand, and must be removed by the Ago2-loaded complex before the antisense strand of the pharmacophore becomes active.

[0147] Numerous variations of the prototypical siRNA designs have been developed with the aim of reduced passenger strand activity and / or improved potency, including Dicer substrate siRNAs, small internally segmented siRNAs, self-delivering siRNAs (asymmetric and hydrophobic), single-stranded siRNAs, and bivalent siRNAs.

[0148] In some aspects, the oligonucleotide of the present disclosure is the antisense part of shRNA.Short hairpin RNA (shRNA) is an artificial RNA molecule that is transcribed as single-stranded RNA, but forms a loop or hairpin-like structure due to internal complementarity.The hairpin is then processed into siRNA, and leads to the degradation of mRNA in a sequence-specific manner that depends on the complementary binding of target mRNA.shRNA is slightly larger than siRNA molecules, and unlike siRNA, it is produced in the nucleus within cells.

[0149] Other non-limiting examples of double-stranded silencers mediated by RNAi are miRNAs and di-siRNAs. MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that trigger RNAi and are involved in numerous physiological and pathophysiological processes. The miRNA hairpin embedded within a long primary miRNA transcript is sequentially processed by two RNase III family enzymes, DICER1 (Dicer) and DROSHA, which release the hairpin and cleave the loop sequence, respectively. The resulting double-stranded RNA, similar to siRNA, is then loaded onto an Argonaute protein (e.g., AGO2), and one strand is discarded to generate a mature single-stranded miRNA species. Like siRNAs, miRNAs guide RISC to target sequences where they initiate gene silencing. In contrast to siRNAs, miRNAs typically bind via partial complementarity and induce silencing via a Dicer-independent mechanism.

[0150] In some aspects, the oligonucleotide of the present disclosure is di-siRNA. Bivalent siRNA (di-siRNA) is a recently developed alternative to RNA silencing drugs, and has been shown to support high-potency and sustained gene silencing in the central nervous system of mice and non-human primates after a single injection into cerebrospinal fluid (Alterman et al. 2019 Nature Biotech 37, 884-894). Di-siRNA is composed of two fully chemically modified phosphorothioate-containing siRNAs connected by a linker.

[0151] In some aspects, the siRNA of the disclosure comprises an antisense strand of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length, wherein the sequence of the antisense strand is selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17, 18, 20, 21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, and 83-92. or a contiguous sequence of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length that is 100% complementary to a sequence or subsequence of a synaptogyrin-3 target sequence selected from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93, wherein the siRNA targets RNA encoding synaptogyrin-3.

[0152] In some aspects, the siRNA of the present disclosure is conjugated to a targeting moiety, eg, a GalNAc moiety.

[0153] CRISPR gRNA: Another recent genome editing technology is the CRISPR / Cas system, which can be used to achieve RNA-guided genome engineering. CRISPR interference is a genetic technique that allows sequence-specific control of gene expression in prokaryotic and eukaryotic cells. It is based on the CRISPR (clustered regularly interspaced palindromic repeats) pathway, derived from the bacterial immune system. Recently, it has been demonstrated that the CRISPR-Cas editing system can also be used to target RNA. It has been shown that the class 2 type VI-A CRISPR-Cas effector C2c2 can be programmed to cleave single-stranded RNA targets bearing a complementary protospacer (Abudayyeh et al., 2016, Science 353 / science.aaf5573). C2c2 is a single-effector endoRNase that mediates ssRNA cleavage once it is guided toward the target RNA by a single crRNA guide. Therefore, the invention disclosed herein can also be applied to develop gRNA that specifically reduces the expression of synaptogyrin-3 using CRISPR / Cas system.Therefore, the present application also provides that any of the oligonucleotides provided herein can be used as gRNA or CRISPR gRNA, more specifically, gRNA or CRISPR gRNA that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or about 100% complementarity to the same length of the target region of synaptogyrin-3 described in SEQ ID NO: 1, wherein the target region is selected from any of the target regions of the present application or their subsequences.

[0154] In some aspects, a gRNA or CRISPR gRNA provided herein has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementarity to an equivalent length of a target region of synaptogyrin-3 set forth in SEQ ID NO:1, wherein the target region is located between nucleobase positions 205 and 265, 255 and 348, 338 and 387, 369 and 433, 422 and 531, 603 and 656, 641 and 714, 717 and 768, 1150 and 1600, 1743 and 1868, or between nucleobase positions 1865 and 2026 of SEQ ID NO:1, or a subsequence thereof, wherein the endpoints are inclusive.

[0155] In some aspects, a gRNA or CRISPR gRNA provided herein has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementarity to an equivalent length of a target region of synaptogyrin-3 set forth in SEQ ID NO: 1, wherein the target region is selected from any of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, or 93; more specifically, the target region is selected from any of SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 70-81, and 83-92.

[0156] In some aspects, the gRNA comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 70-81, and 83-92. In some aspects, the gRNA comprises or consists of a sequence comprising a subsequence selected from the target regions defined in SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, and 93.

[0157] In specific embodiments, the gRNA is 10 to 50, 10 to 40, or 10 to 30 nucleotides in length, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0158] In another specific embodiment, the gRNA comprises a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length comprising a sequence selected from the group consisting of SEQ ID NOs: 172-249.

[0159] In yet another specific embodiment, a gRNA of the present disclosure comprises a sequence that overlaps with a 9, 10, 11, 12, 13, 14, 15, or 16 nucleobase subsequence from a sequence selected from the group consisting of SEQ ID NOs: 172-249. chemical modification

[0160] In some aspects, the oligonucleotides of the present disclosure comprise non-naturally occurring nucleotide analogs, such as nucleotides with modified sugar moieties, e.g., bicyclic nucleotides or 2'-modified nucleotides, e.g., 2'-substituted nucleotides. An essential step in the evolution of antisense technology has been the creation, innovation, and evaluation of oligonucleotide medicinal chemistry. The goals have been to enhance affinity for target sequences (thereby increasing potency), ensure effective distribution to peripheral tissues, enhance duration of action by increasing resistance to nuclease degradation, improve pharmacokinetic characteristics, reduce class-specific (chemically based) toxicity of chemical classes commonly used in therapeutic drugs, and create designs that support multiple post-binding mechanisms, thereby broadening the utility of the technology.

[0161] Within the field of antisense technology, extensive work has been initiated to modify essentially every position on a dinucleotide, with the exception of those required for Watson-Crick base pairing. Thousands of analogs have been synthesized and evaluated to date, and new analogs continue to be explored. Three major classes of modifications can be distinguished: modification of the internucleotide linkage, modulation of the ribose sugar, and bioconjugation, for example with GalNAc. phosphorothioate

[0162] In some aspects, the oligonucleotide of the present disclosure comprises one or more non-cleavable internucleotide linkages, for example, phosphorothioate linkages.The phosphodiester backbone of unmodified DNA and RNA oligonucleotides is highly susceptible to degradation by nuclease in vivo.Therefore, in order to develop the oligonucleotide for therapeutic drug application, it is necessary to identify the backbone modification that reduces their susceptibility to nuclease degradation, but does not too much damage other key characteristics, such as RNase H1 activation and RNA binding.

[0163] In phosphorothioate (PS) linkages, the non-bridging oxygen on the phosphate group is replaced by sulfur. PS moieties provide significant protection from nucleases. Importantly, due to the greater size impact of sulfur compared to oxygen, the negative charge of PS moieties at physiological pH is more widely distributed than that of phosphodiester (PO) moieties. This increases the lipophilicity of oligonucleotides containing PS moieties, facilitating protein binding, thereby preventing rapid excretion of oligonucleotides by the kidney and facilitating their uptake into cells and tissues. PS moieties are the most widely used backbone modification in RNAi molecules such as ASOs and siRNAs. Ribose sugar modification

[0164] In some aspects, the oligonucleotides of the present disclosure include non-naturally occurring nucleotide analogs, such as nucleotides with modified sugar moieties, such as bicyclic nucleotides or 2'-modified nucleotides, e.g., 2'-substituted nucleotides. Oligonucleotides are frequently modified at the ribose sugar, primarily to improve properties such as affinity and / or nuclease resistance. Such modifications include those in which the ribose ring structure is modified (e.g., locked nucleic acids or LNAs), those in which the sugar moiety is replaced with a non-sugar moiety (e.g., peptide nucleic acids or PNAs), or those in which the substituents on the ribose ring are altered to groups other than hydrogen or the 2' and OH groups naturally found on DNA and RNA nucleosides.

[0165] Non-limiting examples of ring structure modifications include HNA (hexitol nucleic acid), in which the ribose ring is replaced by a hexose ring; UNA (unlocked nucleic acid), in which the unlinked ribose ring lacks a bond between the C2 and C3 carbons; or locked nucleic acid (LNA), in which the C2' and C4' of the ribose sugar ring are linked by a methylene bridge (also referred to as a "2'-4' bridge"), which restricts or locks the conformation of the ribose ring. Locking the ribose conformation (also referred to as bridged nucleic acid or BNA) is associated with enhanced hybridization affinity (duplex stabilization) when LNA is incorporated into the oligonucleotide of a complementary RNA or DNA molecule. Non-limiting examples of LNA nucleosides include beta-D-oxy-LNA, 6'-methyl-beta-D-oxy-LNA, such as (S)-6'-methyl-beta-D-oxy-LNA (ScET), and 2'-O,4'-C-ethylene bridged nucleic acids (ENA), or the nucleic acids described in WO 1999 / 014226, WO 2000 / 66604, WO 1998 / 039352, WO 2004 / 046160, WO 2000 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, and WO 2008 / 150729, all of which are incorporated herein by reference in their entirety.

[0166] Because BNA modifications enhance both nuclease stability and the affinity of oligonucleotides for target RNA, they have been incorporated into the flanking regions of gapmers to improve target binding. Thus, cET-flanked 3-10-3 gapmers are more potent than MOE 5-10-5 equivalents. Importantly, BNAs are excluded from DNA gap regions because they are not compatible with RNase H-mediated cleavage. LNA modifications have also been utilized in steric-blocking ASOs, such as miRNA inhibitors.

[0167] Non-limiting examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'-OMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA (2'-F), and 2'-F-ANA nucleosides. These modifications increase the nuclease resistance of oligonucleotides by replacing the nucleophilic 2'-hydroxyl group of unmodified RNA, leading to improved stability in plasma, increased tissue half-life, and ultimately prolonged drug efficacy. These modifications also enhance the binding affinity of oligonucleotides to complementary RNA, and some 2' modifications reduce pro-inflammatory effects. 2'-ribose modifications are not compatible with RNase H activity, meaning they are typically used in steric block oligonucleotides or in flanking sequences on gapmer ASOs. Although most work has been done in modifying the 2' position, substituents can also be introduced at the 3', 4', or 5' positions.

[0168] The present disclosure provides oligonucleotides comprising or consisting of a simple sequence of naturally occurring nucleotides, preferably 2'-deoxynucleotides (commonly referred to herein as "DNA"), but possibly also ribonucleotides (commonly referred to herein as "RNA"), or a combination of such naturally occurring nucleotides with one or more non-naturally occurring nucleotides, i.e., "nucleotide analogs," such as nucleotides having the ribose sugar modifications disclosed above.

[0169] In some aspects, an oligonucleotide (e.g., ASO, siRNA, or shRNA) of the present disclosure comprises at least two nucleotide analogs. In some aspects, an oligonucleotide of the present disclosure comprises 3, 4, 5, 6, 7, or 8 nucleotide analogs, for example, 6 or 7 nucleotide analogs. In some aspects, all nucleotide analogs are the same. In some aspects, some nucleotide analogs are different. In some aspects, all nucleotides on an oligonucleotide of the present disclosure are nucleotide analogs, i.e., an oligonucleotide (e.g., ASO, siRNA, or shRNA) of the present disclosure is fully modified. In some aspects, when all nucleotides on an oligonucleotide of the present disclosure are nucleotide analogs, all nucleotide analogs are the same. In some aspects, when all nucleotides on an oligonucleotide of the present disclosure are nucleotide analogs, some of the nucleotide analogs are different. In some aspects, all nucleotides on an oligonucleotide (e.g., ASO, siRNA, or shRNA) of the present disclosure are 2'-modified. In some aspects, all nucleotides on an oligonucleotide (e.g., ASO, siRNA, or shRNA) of the present disclosure are 2'-fluoride and 2'-O-methyl nucleotides. In some aspects, all nucleotides on the oligonucleotides (e.g., ASO, siRNA, or shRNA) of the present disclosure are 2'-fluoride and 2'-O-methyl nucleotides in an alternating pattern.In some aspects, all nucleotides on the double strands (e.g., siRNA or shRNA) of the present disclosure are 2'-fluoride and 2'-O-methyl nucleotides in an alternating pattern, wherein all or substantially all of the 2'-fluoride modified nucleotides on the sense strand are complementary to all or substantially all of the 2'-O-methyl modified nucleotides on the antisense strand.In some aspects, the double stranded oligonucleotides (e.g., siRNA or shRNA) of the present disclosure comprise nucleotide overhangs.In some aspects, the nucleotide overhangs are dinucleotide overhangs.In some aspects, the dinucleotide overhang is on the antisense strand. In some aspects, the dinucleotide overhang is at the 3' end of the antisense strand. In some aspects, the overhang sequence follows the modification pattern (e.g., an alternating pattern) of the rest of the strand. In some aspects, the overhang is complementary to the synaptogyrin-3 mRNA target sequence. In some aspects, the oligonucleotide of the present disclosure has the structure shown in Figure 1.

[0170] In some aspects, a nucleic acid or oligonucleotide (e.g., ASO, siRNA, or shRNA) of the disclosure comprises a modification motif defined in Figure 2A or 2B.

[0171] In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise modification motifs (e.g., patterns of distribution of nucleotide analogs, internucleoside linkages, conjugate moieties, etc. along the sense and antisense sequences) disclosed in U.S. Patent Nos. 8,110,674; 8,420,799; 8,809,516; 9,222,091; 9,708,615; 10,273,477; 9,290,760; 10,233,448; or 9,796,974; U.S. Application Publication Nos. 2018 and 0258427A1; or International Publication WO2018098328A1, all of which are incorporated by reference herein in their entireties.

[0172] In some aspects, nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one chiral internucleoside linkage. In some aspects, all internucleoside linkages are chiral internucleoside linkages. In some aspects, nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one 8-oxo-deoxyadenosine. In some aspects, nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one phosphoryl DMI amidate diester internucleoside linkage (PN). In some aspects, nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one 8-oxo-deoxyadenosine. In some aspects, nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one phosphoramidite internucleoside linkage. In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one phosphoramidate internucleoside linkage. In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one pseudouridine. In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one isouridine. See, e.g., WO2022 / 099159 and WO2021 / 071858, which are incorporated herein by reference in their entireties. In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise at least one glycol nucleic acid (GNA). In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise a loop. In some aspects, the nucleic acids or oligonucleotides (e.g., ASOs, siRNAs, or shRNAs) of the present disclosure comprise a cleavable loop. Conjugation

[0173] In some aspects, the oligonucleotides of the present disclosure are conjugated, for example, GalNAc conjugates. The delivery potential of RNAi molecules such as ASOs and siRNAs can be enhanced through direct covalent conjugation with various moieties that promote cellular uptake, target the drug to specific cells / tissues, or reduce clearance from the circulation. Non-limiting examples include lipids, peptides, aptamers, antibodies, and sugars. Bioconjugates constitute discrete, homogeneous, single-component molecular entities with precise stoichiometry, meaning that high-scale synthesis is relatively simple and their pharmacokinetic properties are well-defined. Furthermore, bioconjugates are typically small, meaning that they generally exhibit favorable biodistribution profiles. For example, conjugating ASOs or siRNAs with the sugar moiety GalNAc results in more efficient delivery to hepatocytes, without a significant shift in distribution to other tissues, resulting in a 15- to 30-fold increase in potency against RNA targets in these cells.

[0174] RNAi molecules such as ASOs and siRNAs can also be loaded into exosomes. Exosomes are heterogeneous lipid bilayer-enclosed vesicles approximately 100 nm in diameter that are generated as a result of the inward budding of multivesicular bodies. Exosomes are thought to be released by all cells into the extracellular space, where they facilitate intercellular communication through the transfer of their complex macromolecular cargo. Exosomes present several advantageous properties in terms of oligonucleotide drug delivery, making their ability to cross biological membranes, such as the blood-brain barrier (BBB), highly relevant for the treatment of CNS disorders. The method of the present application

[0175] In one embodiment, the oligonucleotide(s) of the present invention, such as the RNAi molecule(s) of the present invention, are artificial and / or chemically synthesized and / or typically purified or isolated.Therefore, the present disclosure provides the method for producing the nucleic acid molecule(s) of the present invention or the oligonucleotide(s), comprising chemically synthesizing the nucleic acid molecule(s) of the present invention or the oligonucleotide(s).In some aspects, the method comprises conjugating a delivery moiety, for example, a GalNAc moiety.

[0176] The present disclosure also provides methods for designing or manufacturing oligonucleotides (e.g., ASOs or siRNAs) of the present disclosure that can inhibit human synaptogyrin-3 (hSYNGR3) gene transcripts and / or hSYNGR3 protein expression and / or activity in a cell, tissue, or subject, wherein the oligonucleotides of the present disclosure are complementary (partially or fully complementary) to any of the target regions of the present application described above. In some aspects, the complementary sequence of the oligonucleotides of the present disclosure comprises or consists of a subsequence of the nucleotide sequence set forth in SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 69, 82, or 93, more specifically SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 60-68, 70-81, or 83-92. In some aspects, the complementary sequence of the oligonucleotides of the present disclosure partially overlaps with the nucleotide sequence set forth in SEQ ID NOs: 94-249, more specifically SEQ ID NOs: 172-249. In some aspects, the complementarity is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% complementary.

[0177] As used herein, the term "manufacturing" refers to chemically synthesizing the oligonucleotides of the present disclosure, for example, using solid-phase synthesis. In some aspects, manufacturing further includes chemically attaching or conjugating a moiety, such as a delivery moiety (e.g., a GalNAc moiety) and / or a targeting moiety.

[0178] The present disclosure also provides a method for producing the oligonucleotide of the present disclosure, the method comprising using continuous solid-phase oligonucleotide synthesis to chemically synthesize the oligonucleotide of the present disclosure.The present disclosure also provides a method for producing the oligonucleotide of the present disclosure that comprises a conjugate moiety, wherein the method comprises covalently attaching a conjugate moiety (for example, at least one non-nucleotide or non-polynucleotide moiety) to the oligonucleotide disclosed herein.In some aspects, the conjugate moiety (for example, a non-nucleotide or non-polynucleotide moiety, for example, a carbohydrate conjugate moiety such as a GalNAc moiety) is attached to the oligonucleotide disclosed herein directly or via a linker located between the oligonucleotide sequence and the conjugate moiety.

[0179] In some aspects, the non-nucleotide or non-polynucleotide moiety is a liver-targeting moiety attached to the 5' or 3' end of the oligonucleotide disclosed herein. In some aspects, the liver-targeting moiety is linked to the oligonucleotide via a linker. In some aspects, the liver-targeting moiety comprises a carbohydrate-conjugate moiety comprising a carbohydrate selected from the group consisting of galactose, lactose, N-acetylgalactosamine (GalNAc), mannose, mannose-6-phosphate, and combinations thereof. In some aspects, the carbohydrate-conjugate moiety is not a linear carbohydrate polymer. In some aspects, the carbohydrate-conjugate moiety is a carbohydrate group comprising 1, 2, 3, or 4 carbohydrate moieties. In some aspects, all carbohydrate moieties are identical. In some aspects, at least one carbohydrate moiety is different (non-identical) from the other carbohydrate moieties. In some aspects, the carbohydrate-conjugate moiety comprises at least one asialoglycoprotein receptor-targeting conjugate moiety. In some aspects, the asialoglycoprotein receptor-targeting conjugate moiety comprises a monovalent, divalent, trivalent, or tetravalent GalNAc cluster. In some aspects, each GalNAc in the GalNAc cluster is attached to the branch point group via a spacer. In some aspects, the branch point group comprises a dilysine. In some aspects, the spacer comprises a PEG spacer. In some aspects, the linker comprises a C6-C12 aminoalkyl group or a biologically cleavable phosphate nucleotide linker comprising between 1 and 6 nucleotides.

[0180] In some aspects, covalently attaching a conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety such as a GalNAc moiety) to an oligonucleotide comprises: (i) chemically synthesizing the oligonucleotide; and (ii) adding a conjugate moiety to the oligonucleotide by chemical synthesis or conjugation to produce an oligonucleotide conjugate. In some aspects, adding a conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) to an oligonucleotide by chemical synthesis or conjugation to produce an oligonucleotide conjugate includes: (i) incorporating at least one conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) into the oligonucleotide by chemical synthesis or conjugation; (ii) incorporating at least one linker into the oligonucleotide or conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) by chemical synthesis or conjugation; (iii) incorporating at least one branch point into the oligonucleotide or conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) by chemical synthesis or conjugation; (iv) incorporating at least one spacer into the oligonucleotide or conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) by chemical synthesis or conjugation; or (v) combinations thereof.In some aspects, (i) at least one linker is inserted between the oligonucleotide and the branch point; (ii) at least one branch point is inserted between the linker and the conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety); (iii) at least one, two, or three conjugate moieties (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) are attached to the branch point; (iv) at least one polymer spacer (e.g., a PEG spacer) is inserted between the conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) and the branch point; or (v) any combination thereof. Pharmaceutical salts

[0181] The oligonucleotides according to the present invention can exist in the form of their pharmaceutically acceptable salts.The term "pharmaceutically acceptable salts" refers to conventional acid addition salts or base addition salts formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases, which retain the biological effectiveness and properties of the nucleic acid molecules or oligonucleotides of the present invention.Acid addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, and the like.Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide.Chemical conversion of pharmaceutical compounds into salts is a well-known technique for medicinal chemists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of compounds. It is described, for example, by Bastin (2000 Organic Process Research & Development 4:427-435) or Ansel (1995 In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed., pp.196 and 1456-1457).For example, the pharmaceutically acceptable salt of the nucleic acid molecule or oligonucleotide provided herein can be sodium salt.Provided herein is the pharmaceutically acceptable salt of the nucleic acid molecule or oligonucleotide described herein.In one embodiment, the pharmaceutically acceptable salt is sodium or potassium salt. Pharmaceutical Composition

[0182] In another aspect, the present invention provides pharmaceutical compositions comprising any of the nucleic acid molecules or oligonucleotides or salts thereof described herein and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. In some embodiments, the nucleic acid molecules or oligonucleotides of the present application are used in a pharmaceutically acceptable diluent at a concentration of between about 2 and 100 nM, between about 5 and 500 nM, between about 20 and 750 nM, between about 0.05 and 10 μM, between about 1 and 500 μM, between about 2 and 750 μM, between about 0.01 and 1 mM, between about 0.5 and 10 mM, or between about 50 and 300 mM solution.

[0183] Suitable formulations for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, for example, Langer (1990 Science 249:1527-1533). Non-limiting examples of pharmaceutically acceptable diluents, carriers, adjuvants, suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are provided in WO2007 / 031091, the entire contents of which are incorporated herein by reference. The nucleic acid molecules or oligonucleotides of the present application or their salts can be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered. Pharmaceutical compositions containing the nucleic acid molecules or oligonucleotides of the present application or their salts can be sterilized by conventional sterilization techniques or can be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration.

[0184] The pH of the preparation will typically be between 3 and 11, more particularly between 5 and 9 or between 6 and 8, most particularly between 7 and 8, e.g., 7 to 7.5. The resulting solid form of the composition can be packaged in a sealed package of multiple single-dose units, each containing a fixed amount of the nucleic acid molecule or oligonucleotide of the present application or a salt thereof, for example, tablets or capsules. The solid form of the composition can also be packaged in flexible quantity containers. Tauopathy disorders

[0185] It has previously been shown that SYNGR-3 interacts with pathological tau at presynapses and that reducing SYNGR-3 levels rescues tau-induced deficits in vesicle mobility and neurotransmitter release (McInnes et al. 2018 Neuron 97:823-835). Accordingly, the present disclosure provides oligonucleotides capable of inhibiting the expression and / or activity of synaptogyrin-3 to reduce binding between synaptogyrin-3 and (the N-terminal sequence of) tau protein. Thus, in a further aspect, any of the nucleic acid molecules or oligonucleotides described herein are provided for use as pharmaceuticals, more specifically, for treating tauopathies. The present disclosure also provides methods for treating, preventing, or ameliorating symptoms or sequelae of the diseases or disorders disclosed herein, comprising administering to a subject in need thereof an effective amount of any of the nucleic acid molecules or oligonucleotides described herein, or a combination thereof.

[0186] Tauopathies are a diverse group of disorders that all share the common association of significant intracellular tau protein accumulation. Tau protein is abundantly expressed in the central nervous system. The group of tauopathies is growing with the recent addition of Huntington's disease (Fernandez and Nogales et al. 2014 Nat Med 20:881-885) and chronic traumatic encephalopathy (CTE; McKee et al. 2009 J Neuropathol Exp Neurol 68:709-735).

[0187] Different classifications of tauopathies exist. In one classification system, tauopathic disorders are divided into those with predominant tau pathology, those associated with amyloid deposition, and those associated with other pathologies (Williams et al. 2006 Intern Med J 36:652-660). Predominant tau pathologies include progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration, Pick's disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), postencephalitic parkinsonism, Guam Parkinson's disease complex, and Guadeloupe Parkinsonism. Tauopathic disorders associated with amyloid deposition include Alzheimer's disease, Down's syndrome, dementia pugilistica, familial British dementia, and familial Danish dementia. Tauopathy disorders associated with different pathologies include myotonic dystrophy, Hallervorden-Spatz disease, and Niemann-Pick type C.

[0188] Another classification is based on the isoform types found in the aggregates, although overlap may exist: 4R tauopathies include progressive supranuclear palsy (PSP), corticobasal degeneration, tangle-predominant dementia, and argyrophilic grain disease. 3R tauopathies include Pick's disease, and 3R+4R tauopathies include Alzheimer's disease (Dickson et al., 2011, J Mol Neurosci. 45:384-389; Murray et al., 2014, Alzheimer's Res. Ther. 6:1). Tau protein is discussed in more detail further below.

[0189] Additional tauopathies include tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-associated mental retardation, non-Guam motor neuron disease with neurofibrillary tangles, neurodegeneration with cerebral iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcifications, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis / Parkinsonism dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis (Murray et al. 2014 Alzheimer's Res Ther 6:1; Spillantini & Goedert 2013 Lancet Neurol 12:609-622).

[0190] Symptoms of tauopathy disorders include clinical or pathological symptoms such as mild cognitive impairment, dementia, cognitive decline (e.g., apathy, impaired abstract thinking), motor decline (e.g., causing postural instability, tremor, or dystonia), and oculomotor and bulbar dysfunction. Criteria for diagnosing dementia are outlined, for example, in the Diagnostic and Statistical Manual of Mental Disorders (DSM) or the International Classification of Diseases (ICD) and are subject to periodic updates. The type of clinical manifestation depends on which brain regions are affected by the tauopathy, explaining why Alzheimer's disease is primarily a dementing disorder and why Parkinson's disease primarily affects movement. The stereotypical spatiotemporal propagation of tau inclusions creates consistent patterns of brain pathology in at least Alzheimer's disease and argyrophilic grain disease. Spreading may occur, in part, in a transsynaptic manner (Spillantini & Goedert 2013 Lancet Neurol 12:609-622; Liu et al 2012 PloS One 7:e31802). Molecular symptoms of tauopathy disorders include synaptic dysfunction (specifically presynaptic dysfunction), neurotoxicity, neurodegeneration, neuronal dysfunction, synaptic loss, and amyloid deposition.

[0191] Since the nucleic acid molecules or oligonucleotides described herein can target the mRNA encoding synaptogyrin-3 and reduce its expression, any of the nucleic acid molecules or oligonucleotides can therefore be used as medicines.In one embodiment thereof, any of the nucleic acid molecules or oligonucleotides described herein are provided for use in (methods for) treating or inhibiting the progression of tauopathy disorders, or for use in (methods for) treating or inhibiting the symptoms of tauopathy disorders.Specifically, the nucleic acid molecules or oligonucleotides of the present invention are inhibitors of human synaptogyrin-3 expression and / or human synaptogyrin-3 activity.The expression or function of synaptogyrin-3 is (partially) inhibited, for example, to restore presynaptic dysfunction induced by pathological tau. In methods for treating or inhibiting the progression of a tauopathy disorder or a symptom of a tauopathy disorder, any of the nucleic acid molecules or oligonucleotides described herein is administered to a subject in need thereof (a subject suffering from or exhibiting a tauopathy or a symptom thereof) in an effective amount, i.e., an amount sufficient to treat or inhibit the progression of a tauopathy disorder or a symptom of a tauopathy disorder.

[0192] For the purpose of treating, preventing, or inhibiting (the progression of) the intended disease or disorder, and in methods for treating, preventing, or inhibiting (the progression of) the intended disease or disorder, an effective amount of a therapeutic compound is administered to a subject in need thereof. An "effective amount" of an active agent in a composition is the amount of said agent required and sufficient to elicit a sufficient response in treating, preventing, or inhibiting (the progression of) the intended or targeted medical indication. It will be apparent to those skilled in the art that such a response may require continuous administration (over time) of the composition as part of an administration scheme. The effective amount may vary depending on the properties of the compound, the route of administration of the compound (passing the blood-brain barrier and cell membrane are potential barriers to be overcome by the oligonucleotides described herein), the health and physical condition of the individual to be treated, the age of the individual to be treated (e.g., dosages for infants may be lower than those for adults), the taxonomic group of the individual to be treated (e.g., humans, non-human primates, primates, etc.), the capacity of the individual's system to respond effectively, the desired degree of response, the formulation of the active substance, the evaluation of the attending physician, and other relevant factors.The effective amount may also vary depending on whether it is used in monotherapy or combination therapy.Determination of the effective amount of a compound usually comes from preclinical studies in representative animal or in vitro models (if available) and / or dose-finding studies in early clinical trials.

[0193] Any of the nucleic acid molecules or oligonucleotides described herein are provided for use in (a method for) treating or inhibiting progression of a tauopathy disorder, wherein the tauopathy disorder is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration, Pick's disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), postencephalitic parkinsonism, Parkinson's disease complex of Guam, Parkinson's disease of Guadeloupe, Huntington's disease, Down's syndrome, dementia pugilistica, familial British dementia, familial idiopathic dementia, and familial idiopathic dementia. The disease is selected from the group consisting of Danish dementia, myotonic dystrophy, Hallervorden-Spatz disease, Niemann-Pick type C, chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-associated mental retardation, non-Guam motor neuron disease with neurofibrillary tangles, neurodegeneration with cerebral iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcifications, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis / Parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

[0194] Therefore, any of the nucleic acid molecules or oligonucleotides described herein can be used in the treatment or inhibition of the progression of symptoms of tauopathy disorders selected from the group consisting of mild cognitive impairment, dementia, cognitive decline, motor function decline, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neurodegeneration, neuronal dysfunction, synaptic loss, and amyloid deposition. Specifically, with regard to synaptic dysfunction, it relates to presynaptic dysfunction.

[0195] Also provided is a method of treating a tauopathy disorder in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide of the present disclosure to the subject.The present disclosure also provides a method of treating or inhibiting the progression of a tauopathy disorder or treating or inhibiting a symptom of a tauopathy disorder in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide of the present disclosure to the subject.

[0196] "Treatment" refers to a reduction or delay in any rate of progression of a disease or disorder compared to the progression or expected progression of the disease or disorder if left untreated. More desirably, treatment results in no / zero progression of the disease or disorder (i.e., "inhibition" or "inhibition of progression"), or even regression of any rate of an already developed disease or disorder. Tauopathies are generally progressive disorders, and progression can imply the spread of pathological tau protein (Asai et al. 2015 Nat Neurosci 18:1584-1593; deCalignon et al. 2012 Neuron 73:685-697).

[0197] As used herein, "reduction" or "reducing" of disease progression refers to a statistically significant reduction. More specifically, compared to the control situation where no oligonucleotide is administered, the statistically significant reduction is achieved by administering the oligonucleotide of the present invention. In a specific embodiment, the statistically significant reduction is at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% reduction compared to the control situation.

[0198] The present disclosure provides an in vitro method for reducing the expression level and / or activity of synaptogyrin-3 in a cell, comprising administering to the cell an effective amount of an oligonucleotide of the present disclosure. Also provided is a method for reducing the expression level and / or activity of synaptogyrin-3 in a subject in need thereof, comprising administering to the subject an effective amount of an oligonucleotide of the present disclosure. Also provided is a method for reducing synaptogyrin-3 levels in a subject in need thereof, comprising administering to the subject an effective amount of an oligonucleotide of the present disclosure. Diagnosis of Tauopathy Disorders

[0199] The nucleic acid molecules or oligonucleotides of the present disclosure can also be used for diagnostic purposes.Magnetic resonance imaging (MRI) itself allows the radiological determination of brain atrophy.Signs of midbrain atrophy, such as hummingbird or penguin silhouette, are indicators of, for example, progressive supranuclear palsy (PSP).Determining the tau protein content in cerebrospinal fluid (CSF) can also be used as an indicator of tauopathy.For example, the ratio between 33kDa / 55kDa tau forms in CSF has been found to be reduced in patients with PSP (Borroni et al. 2008 Neurology 71:1796-1803).

[0200] Recently, in vivo imaging techniques for neurodegeneration have become available. Such techniques can clearly support the clinical diagnosis of neurodegenerative diseases in general, and tauopathies in particular. In vivo diagnosis of tauopathies benefits from the existence of tau imaging ligands detectable by positron emission tomography (PET), and can be visualized using the radioactive tracer 2-(1-(6-((2-[ 18 F]fluoroethyl)(methyl)amino)-2-naphthyl)ethylidene)malononitrile([ 18 F]FDDNP), 2-(4-aminophenyl)-6-(2-([ 18 F]fluoroethoxy))quinolone ([ 18 F]THK523), and [ 18 F]T807 and [ 18[F]T808 (Murray et al 2014 Alzheimer's Res Ther 6:1). In addition, MRI can be used to detect tauopathies, and fluorodeoxyglucose (FDG, 18 PET imaging with F drugs indicates synaptic activity (Murray et al., 2014 Alzheimer's Res Ther 6:1). For example, beta-amyloid, which can be detected in vivo by using florbetapir (or other amyloid markers) in combination with PET, has been found to be an accurate biomarker for at least Alzheimer's disease (Clark et al., 2011 J Am Med Assoc 305:275-283), and florbetapir-PET technology received FDA approval in 2012. The availability of in vivo tauopathy detection technology further supports the selection of subjects who may benefit from synaptogyrin-3 inhibition treatment as described herein.

[0201] Thus, the present disclosure provides nucleic acid molecules or oligonucleotides of the present disclosure conjugated to a detectable moiety, such as a radioactive tracer, a fluorescent moiety (e.g., a fluorescent protein), or any detectable moiety known in the art. Methods for the diagnosis or prognosis of a tauopathy disorder, for monitoring the efficacy of treatment, for selecting patients for treatment, or for selecting or excluding subjects for a clinical trial involving administering a nucleic acid molecule or oligonucleotide of the present disclosure are also provided. Inhibition of synaptogyrin-3

[0202] By using the oligonucleotide of the present disclosure, the inhibition of synaptogyrin-3 can be obtained at the expression level.In other words, the administration of the oligonucleotide of the present disclosure can reduce the mRNA level encoding synaptogyrin-3, which in turn will result in a lower protein expression level of synaptogyrin-3.In some aspects, such reduction in the expression level of synaptogyrin-3 can result in the reduction of synaptogyrin-3 activity.As previously demonstrated (see WO2019 / 016123 and US 20220403021A1, the entire contents of which are incorporated herein by reference), partial inhibition of synaptogyrin-3 activity is sufficient to restore the presynaptic dysfunction induced by pathological tau.Therefore, the inhibition of synaptogyrin-3 expression and / or activity implies several possible levels of inhibition. In some aspects, administration of an oligonucleotide of the present disclosure may result in a reduction in synaptogyrin-3 mRNA levels of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or even about 100% relative to control conditions (e.g., prior to administration of an oligonucleotide of the present disclosure). In some aspects, administration of an oligonucleotide of the present disclosure may result in a reduction in synaptogyrin-3 protein levels of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% relative to control conditions (e.g., prior to administration of an oligonucleotide of the present disclosure).In some aspects, administration of an oligonucleotide of the present disclosure may result in a reduction in synaptogyrin-3 activity levels of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% relative to control conditions (e.g., prior to administration of an oligonucleotide of the present disclosure).

[0203] Those skilled in the art are familiar with several ways to determine the level of synaptogyrin-3 in cells, and thus, to determine the reduction of Syngr-3 transcript levels compared to a control. A non-limiting example is quantitative reverse transcriptase (RT)-PCR. In this application, Syngr-3 levels were determined using TaqMan assay. Administering the Nucleic Acid Molecules of the Invention

[0204] The nucleic acid molecule or oligonucleotide of the present disclosure can be administered intravenously, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, intraventricularly, intraocularly or intrathecally.In some embodiments, administration is via intrathecal administration.As used herein, "administering" means to give a composition, including the composition disclosed herein, to a subject via a pharmaceutically acceptable route.

[0205] SYNGR-3 gene inactivation, i.e., inhibition of target gene expression, can also be achieved by creating a transgenic organism expressing one of the oligonucleotides of the present invention (e.g., siRNA) or by administering the inhibitor to a subject. The nature of the inhibitor (e.g., siRNA, shRNA, ASO, etc.) and whether the effect is achieved by incorporating the oligonucleotide into the subject's genome or by administering the oligonucleotide are not critical to the present invention, as long as the oligonucleotide reduces the level of Syngr-3 transcripts. The oligonucleotide construct can be delivered, for example, as an expression plasmid, which, when transcribed in a cell, produces an oligonucleotide complementary to at least a unique portion of the cell's Syngr-3 RNA. Alternatively, oligonucleotide inhibitors such as siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing these inhibitors targeting Syngr-3 from a plasmid include, for example, U6 or H1 RNA polymerase III promoter sequences and cytomegalovirus promoters. The selection of other suitable promoters is within the skill of those skilled in the art. Non-limiting examples are neuron-specific promoters, glial cell-specific promoters, the human synapsin 1 gene promoter, the Hb9 promoter, or the promoters disclosed in US Pat. No. 7,341,847B2.

[0206] Recombinant plasmids containing any of the nucleic acid molecules or oligonucleotides of the present invention may also contain inducible or regulatable promoters for expression of the nucleic acid molecule or oligonucleotide in a specific tissue or in a specific intracellular environment. The nucleic acid molecule or oligonucleotide expressed from the recombinant plasmid can either be isolated from a cultured cell expression system by standard techniques or expressed intracellularly, for example, in brain tissue or in neurons. The nucleic acid molecule or oligonucleotide can also be expressed intracellularly from a recombinant viral vector. The recombinant viral vector contains a sequence encoding the nucleic acid molecule or oligonucleotide of the present invention and any suitable promoter for their expression. The nucleic acid molecule or oligonucleotide will be administered in an "effective amount," which is an amount sufficient to cause a statistically significant reduction in Syngr-3 transcripts. Generally, an effective amount of a nucleic acid molecule or oligonucleotide targeting a Syngr-3 transcript comprises an intracellular concentration of about 0.2 nanomolar (nM) to about 100 nM, preferably about 1 nM to about 10 nM, more preferably about 2 nM to about 20 nM, more preferably about 2.5 nM to about 50 nM, and even more preferably about 5 nM to about 75 nM or about 10 nM to about 150 nM. It is contemplated that greater or lesser amounts of inhibitor may be administered.

[0207] For example, shRNAs can be introduced into the nucleus of target cells using vectors (e.g., bacterial or viral) that can be stably integrated into the genome. shRNAs are typically transcribed from vectors driven by, for example, the Pol III U6 or H1 promoter. Vectors allow inducible shRNA expression, relying, for example, on commercially available Tet-on and Tet-off inducible systems or on modified U6 promoters induced by the insect hormone ecdysone. The Cre-Lox recombination system has been used to achieve controlled expression in mice. Synthetic shRNAs can be chemically modified to affect their activity and stability. Plasmid DNA or dsRNA can be delivered to cells by transfection (lipid transfection, cationic polymer-based nanoparticles, lipid or cell-penetrating peptide conjugation) or electroporation. Viral vectors include lentivirus, retrovirus, adenovirus, and adeno-associated virus vectors. Drug administration through the blood-brain barrier

[0208] In some aspects, the oligonucleotides of the present disclosure are administered through the blood-brain barrier. The blood-brain barrier (BBB) ​​is a protective layer of tightly intertwined cells lining the blood vessels of the brain, which prevents the entry of harmful substances (e.g., toxins, infectious agents) and restricts the entry of (non-lipid) soluble molecules that are not recognized by specific transport carriers into the brain. This poses a challenge in the delivery of drugs, such as the synaptogyrin-3 inhibitors described herein, to the central nervous system / brain, in that drugs transported by blood will not necessarily pass through the blood-brain barrier. In many cases, the BBB is affected or destroyed to some degree in the case of tauopathy disorders, but candidate drugs for treating tauopathy disorders may need to rely on measures to enhance BBB penetration in order to enter affected brain cells. Therefore, in some aspects, the oligonucleotides of the present disclosure are formulated, conjugated, or carried by vectors, polymers, cells, or devices that allow oligonucleotides to cross the BBB, to name a few alternatives. Currently, several options are available for delivery of drugs across the BBB (Peschillo et al 2016 J Neurointervent Surg 8:1078-1082; Miller & O'Callaghan 2017 Metabolism 69:S3-S7; Drapeau & Fortin 2015 Current Cancer Drug Targets 15:752-768).

[0209] Drugs can be injected directly into the brain (invasive strategy) or can be introduced into the brain after BBB disruption with pharmacological agents (pharmacological strategy). In some aspects, oligonucleotides of the present disclosure can be injected directly into the brain, for example, using a needle or catheter. In some aspects, oligonucleotides of the present disclosure can be introduced into the brain by BBB disruption with pharmacological agents. Invasive means of BBB disruption are associated with the risk of bleeding, infection, or damage to diseased and normal brain tissue from the needle or catheter. Direct drug administration can be improved by convection-enhanced delivery techniques. Thus, in some aspects, oligonucleotides of the present disclosure can be administered via convection-enhanced delivery.

[0210] Longer-term delivery of therapeutic proteins (e.g., neurotrophic factors or nerve growth factors, or proteinaceous synaptogyrin-3 inhibitors described herein) can be achieved by implantation of genetically modified stem cells, by recombinant viral vectors, by means of osmotic pumps, or by incorporating the therapeutic agent into a polymer (sustained release; can be locally implanted). Thus, in some aspects, oligonucleotides of the present disclosure can be administered, for example, by implantation of genetically modified cells (e.g., stem cells), recombinant vectors (e.g., viral vectors), delivery devices (e.g., pumps such as osmotic pumps), or by incorporation into a polymer.

[0211] Pharmacological BBB disruption has the disadvantage of being non-selective and may be associated with unwanted effects on blood pressure and fluid balance. This can be avoided by targeted or selective administration of pharmacological BBB disruption drugs. For example, intra-arterial infusion of an antibody (bevacizumab) in brain tumors has been demonstrated after osmotic disruption of the BBB with mannitol (Boockvar et al. 2011, J Neurosurg 114:624-632); other drugs that can pharmacologically disrupt the BBB include bradykinin and leukotriene C4 (e.g., via intracarotid infusion; Nakano et al. 1996, Cancer Res 56:4027-4031). Therefore, in some aspects, the oligonucleotides of the present disclosure are formulated in combination with pharmacological BBB disruption drugs. In some aspects, the oligonucleotides of the present disclosure are administered in combination with pharmacological BBB disruption drugs. In some aspects, the pharmacological BBB disrupting agent is administered prior to the administration of the oligonucleotide of the present disclosure. In some aspects, the pharmacological BBB disrupting agent is administered simultaneously with the administration of the oligonucleotide of the present disclosure. In some aspects, the pharmacological BBB disrupting agent is administered after the administration of the oligonucleotide of the present disclosure. In some aspects, the pharmacological BBB disrupting agent comprises mannitol, bradykinin, leukotriene C4, or a combination thereof.

[0212] BBB transcytosis and efflux inhibition are other strategies for increasing the brain uptake of drugs delivered through blood.Using transferrin or transferrin receptor antibody as a drug carrier is an example of utilizing natural BBB transcytosis process (Friden et al. 1996, J Pharmacol Exp Ther 278:1491-1498).Using BBB transcytosis for drug delivery is also known as molecular Trojan horse strategy.In some aspects, the oligonucleotide of the present disclosure is conjugated with a carrier, for example, transferrin or transferrin receptor antibody.In some aspects, the oligonucleotide of the present disclosure is conjugated or formulated to cross the BBB via transcytosis. Another mechanism underlying the BBB, efflux pumps or ATP-binding cassette (ABC) transporters (e.g., breast cancer resistance protein (BCRP / ABCG2) and P-glycoprotein (Pgp / MDR1 / ABCB1)) can be blocked to increase compound uptake (e.g., Carcaboso et al. 2010, Cancer Res 70:4499-4508). In some aspects, the oligonucleotides of the present disclosure can be formulated in combination with compounds capable of blocking ABC transporters, compounds capable of blocking P-glycoprotein, or a combination thereof.

[0213] Kumar et al (2007 Nature 448:39-43) demonstrated brain uptake of siRNA after coupling to a 29 amino acid peptide derived from the rabies virus glycoprotein (RVG), which specifically binds to the acetylcholine receptor. In some aspects, the oligonucleotides of the present disclosure are conjugated to RVG.

[0214] Alternatively, therapeutic drugs can be loaded into liposomes to enhance their passage through the BBB, an approach also known as the liposomal Trojan horse strategy. Thus, in some aspects, the oligonucleotides of the present disclosure are formulated into liposomes, for example, liposomes for use in the liposomal Trojan horse strategy.

[0215] Intranasal drug delivery has been of considerable interest, particularly in the art of treating cognitive and neurodegenerative disorders (e.g., Muhs et al. 2007, Proc Natl Acad Sci USA 104:9810-9815; Kao et al. 2000, Pharm Res 17:978-984; Hanson & Frey 2008, BMC Neurosci 9 (Suppl3):55). This strategy is based on the trigeminal and olfactory nerves that innervate the nasal epithelium, representing a direct connection between the external environment and the brain. Therefore, in some aspects, the oligonucleotides of the present disclosure are formulated for intranasal delivery.

[0216] A more recent and promising approach to delivering therapeutic drugs to the brain consists of (transient) BBB disruption by ultrasound, more specifically focused ultrasound (FUS; Miller et al. 2017, Metabolism 69:S3-S7). In addition to being non-invasive, this technique has the advantage of precise targeting to diseased areas of the brain, often in combination with real-time imaging. Therapeutic drugs can be delivered, for example, in microbubbles stabilized by, for example, albumin or other proteins, lipids, or polymers. Alternatively, or together with the microbubbles, therapeutic drugs can be delivered by any other method, after which FUS can enhance the local uptake of any compounds present in the blood (e.g., Nance et al. 2014, J Control Release 189:123-132). Just one example is the FUS-assisted delivery of antibodies directed against toxic amyloid beta peptides, with evidence of reduced pathology in mice (Jordao et al. 2010, PloS One 5:e10549). Microbubbles loaded with therapeutic drugs can also be induced to burst in the vicinity of target cells by means of FUS (hyperthermia effect), and when driven by, for example, a heat shock protein gene promoter, localized transient expression of therapeutic proteins can be induced by ultrasound hyperthermia (e.g., Lee Titsworth et al. 2014, Anticancer Res 34:565-574). Alternatives to ultrasound for inducing hyperthermia effects are microwaves, laser-induced interstitial hyperthermia, and magnetic nanoparticles (e.g., Lee Titsworth et al. 2014, Anticancer Res 34:565-574).

[0217] Thus, in some aspects, the oligonucleotides of the present disclosure are formulated for FUS-mediated delivery. Intracellular drug administration

[0218] In some aspects, the oligonucleotide of the present disclosure is formulated for intracellular administration.In addition to the need to pass through BBB, the drug that targets the disorder of central nervous system, such as the synaptogyrin-3 inhibitor described herein, may also need to pass through cell barrier.Although most antisense oligonucleotides are easily taken up by neurons and glia after reaching nervous system, it may be advantageous to use the promoter of intracellular drug uptake.

[0219] One solution is the use of cell-penetrating proteins or peptides (CPPs). Such peptides allow the translocation of targeted drugs coupled to them across the plasma membrane. CPPs, alternatively called protein transduction domains (TPDs), typically contain 30 or fewer amino acids (e.g., 5-30 or 5-20), are usually rich in basic residues, and are derived from naturally occurring CPPs (usually longer than 20 amino acids) or are the result of modeling or design. Non-limiting choices of CPPs include the TAT peptide (derived from the HIV-1 Tat protein), penetratin (derived from Drosophila antennapedia-Antp), pVEC (derived from murine vascular endothelial cadherin), peptides based on signal sequences or membrane translocation sequences, model amphipathic peptides (MAPs), transportan, MPG, and polyarginine; more information about these peptides can be found in Torchilin 2008 (Adv Drug Deliv Rev 60:548-558) and the references cited therein. A commonly used CPP is the transduction domain of TAT, termed TATp. The TAT peptide has been used, for example, to shuffle tau fragments into neuronal cells (Zhou et al. 2017).

[0220] CPP can be coupled to carriers such as nanoparticles, liposomes, micelles, or generally any hydrophobic particles.Coupling can be by absorption or chemical bond between CPP and carrier, for example, via spacer.To increase target specificity, antibody that binds to target-specific antigen can be further coupled to carrier (Torchilin 2008, Adv Drug Deliv Rev 60:548-558).

[0221] CPPs have already been used to deliver diverse payloads into cells, such as plasmid DNA, oligonucleotides, siRNA, peptide nucleic acids (PNAs), proteins and peptides, small molecules, and nanoparticles (Stalmans et al. 2013, PloS One 8:e71752). Kits and manufactured products

[0222] Also provided herein are kits and articles of manufacture comprising one or more compositions described herein (e.g., oligonucleotides of the present disclosure or pharmaceutical compositions comprising oligonucleotides of the present disclosure). In some aspects, provided herein are pharmaceutical packs or kits comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions described herein.

[0223] In some aspects, the kit or article of manufacture includes a first container comprising a first pharmaceutical composition, e.g., comprising an oligonucleotide of the present disclosure, a second container containing a solvent, and optionally instructions for use.

[0224] In some aspects, the kit or article of manufacture comprises a container containing an oligonucleotide of the disclosure and, optionally, instructions for use.

[0225] In some aspects, the kit contains a pharmaceutical composition described herein and any prophylactic or therapeutic agent, such as those described herein. In some aspects, the kit further includes instructions for administering the disclosed composition according to any of the methods disclosed herein. In some aspects, the kit is for use in treating a medical indication disclosed herein. In some aspects, the kit is a diagnostic kit.

[0226] All of the references cited above, and all references cited herein, are incorporated herein by reference in their entirety.

[0227] The sequences of biomolecules (e.g., proteins, genes) disclosed herein and identified by either database accession number or gene name are incorporated by reference. Database accession numbers (e.g., Genbank accession numbers) disclosed herein refer to the database version effective February 1, 2023. The nucleic acid sequences of the genes identified by name, as well as their full names and alternative names, correspond to those in the Genbank database version effective February 1, 2023, and are incorporated herein by reference. The amino acid sequences of the proteins identified by name or the translation products of the genes identified by name, as well as their full names and alternative names, correspond to those in the UniProt database version effective February 1, 2023, and are incorporated herein by reference.

[0228] While the present invention has been described and illustrated in the foregoing exemplary embodiments, it will be understood that the present disclosure is by way of example only, and that numerous changes in the details of the implementation of the invention may be made without departing from the spirit and scope of the invention, which is limited only by the following claims. Features of the disclosed embodiments may be combined and permuted in various ways. Various embodiments may be combined with one or more other embodiments to form new embodiments.

[0229] The following examples are offered by way of illustration and not by way of limitation. example Example 1. Oligonucleotide design and synthesis

[0230] Bioinformatics analysis was performed to identify potential screening candidate siRNAs targeting human SYNGR3 mRNA (NCBI gene ID: 9143). The bioinformatics approach assumed a classical siRNA structure. Positions 2 and 18 (5'-3') of the sense and antisense strands were used to calculate specificity. Positions 1-19 (5'-3') of the antisense strand were used to evaluate cross-reactivity and human SNP analysis. The following parameters were evaluated:

[0231] (a) Species cross-reactivity to humans, cynomolgus monkeys, rhesus monkeys, and mice For each species, siRNAs were selected that targeted at least all protein-coding transcripts of the target gene. The analysis was based on classical siRNA design, using 19- and 17-mers (positions 1 and 19 not considered) for cross-reactivity. We considered 17-mer (positions 2-18) perfect matches and possible single mismatch hits with the target sequence in the secondary species.

[0232] (b) Specificity Target specificity in humans, rhesus monkeys, cynomolgus monkeys, and mice was performed to identify siRNAs with the lowest sequence complementarity to any non-target transcripts. Our analysis considered the likelihood of unintended downregulation of any other transcript due to full or partial complementarity of the siRNA strand (up to four mismatches within positions 2-18); it described the most likely off-target(s) predicted for the antisense and sense strands of each siRNA based on the number and location of mismatches. (c) MicroRNA-like off-target effects Because siRNAs can function in an miRNA-like manner through base pairing with complementary sequences within the 3'-UTR of mRNA molecules, the identity of the siRNA seed region to that of a known miRNA (microRNA) is an important feature. To avoid the possibility that siRNAs may act through functional miRNA binding sites, we avoided siRNA strands containing natural miRNA seed regions (positions 2-7).

[0233] (d) Single nucleotide polymorphism binding An analysis of the human SNP database (NCBI DB SNP) was performed to identify siRNAs targeting regions with known SNPs. When data was available, we also included the location and minor allele frequency of the SNP within the target sequence. All target sites with abundant SNPs were excluded.

[0234] (e) Sequence activity based on the current algorithm siRNA activity prediction was based on classical siRNA design.

[0235] (f) Identify molecules that can silence specific Syngr3 transcripts. Considering all parameters, we selected 192 siRNA sequences to be synthesized and tested in cell lines.

[0236] As shown in Figure 1, the siRNA molecules were fully modified with 2'-fluoride and 2'-O-methyl. Example 2. Dual-dose screening

[0237] We seeded SH-SY5Y cells (ATCC, CRL-2266) at a density of 20,000 cells / well onto collagen-coated 96-well tissue culture plates and subsequently transfected the cells using Dharmafect-4 (0.5 μl / well; Horizon Discovery). siRNA was added to the cells at final concentrations of 20 nM and 2 nM, and the assay plate was incubated for 24 h at 37°C / 5% CO2 in a humidified incubator. To monitor on-target mRNA expression levels, we used branched DNA (bDNA) technology. The bDNA assay provides a unique and powerful tool for reliable quantification of nucleic acid molecules. The bDNA assay directly measures nucleic acid molecules at physiological levels by boosting the reporter signal rather than replicating the target sequence as a detection method, thus avoiding the errors inherent in target sequence extraction and amplification.

[0238] Immediately following release of the target RNA, several oligonucleotide probes were incubated to allow binding to Syngr3 (and GAPDH as a control). The Syngr3 probe was custom made by ThermoFisher Scientific. Assay ID: DRAAACA). Addition of a fluorescent reporter generates a signal that is directly proportional to the amount of target RNA present in the sample.

[0239] Some of the tested siRNAs showed visible toxicity in the assay as a reduction in the average hsGAPDH mRNA expression level. The average on-target hsSYNGR3 / hsGAPDH ratio was artificially set to 100% and used to normalize all other samples. All data were generated in quadruplicate. The results of the dual-dose screen are shown in Table 1. As can be seen from Table 1, when we selected for at least 15% reduced synaptogyrin-3 expression levels at 2 nM or 20 nM concentrations, regions within synaptogyrin-3 emerged as target regions for designing antisense and / or RNAi molecules capable of reducing synaptogyrin-3 expression in cells, tissues, or subjects. The first target region is constructed by siRNA molecules R2000060, R2000061, and R2000064. The second target region is R2000072, R2000073, R2000075, R2000076, R2000077, R2000080, R2000081, R2000083, R2000084, and R2000085. The third target region is R2000095 and R2000097, the fourth target region is R2000099 and R2000100, the fifth target region is R2000104, R2000105, and R2000106. The sixth target region includes oligonucleotides R2000123, R2000124, and R2000125. The seventh target region is formed by R2000130, R2000132, R2000133, R2000134, R2000135, R2000136, R2000137, R2000138, R2000140, R2000141, and R2000142. The eight target regions are defined by R2000156, R2000157, and R2000158, and finally, by R2000175, R2000176, R2000177, R2000179, R2000180, R2000181, R2000182, R2000183, R2000187, and R2000190, with two larger target regions defined by R2000191 through R2000221.

[0240] From the siRNA molecules making up the target region, we further selected 48 siRNA molecules to be tested in dose-response curves. Selection was based on activity, target sequence binding, and cross-reactivity. Example 3. Dose-response curve

[0241] We seeded SH-SY5Y cells at a density of 20,000 cells / well on collagen-coated 96-well tissue culture plates and subsequently transfected the cells using Dharmafect-4 (0.5 μl / well). For transfection, the highest siRNA concentration tested was 100 nM. Using two-fold dilution steps and 10 data points, the lowest siRNA final concentration tested was 0.2 nM. Cells were incubated in a humidified incubator at 37°C / 5% CO2 for 48 h, followed by cell lysis and bDNA analysis to monitor on-target mRNA expression levels relative to hsGAPDH mRNA levels. All data were generated in quadruplicate. Dose-response curve (DRC) results are shown in Tables 1-2. Experimental procedures Measure Syngr3 levels

[0242] SH-SY5Y cells were incubated with the siRNA to be tested for 24 hours. The medium was removed, and SH-SY5Y cells (obtained from ATCC, CRL-2266) were lysed by adding 150 μl lysis mixture (1 volume lysis mixture, 2 volumes nuclease-free water) per 96-well plate and subsequent incubation at 53°C for at least 60 minutes. Immediately after release of the target RNA, several oligonucleotide probes were incubated to allow binding to Syngr3 (and GAPDH as a control). The Syngr3 probe was custom made by ThermoFisher Scientific (Assay ID: DRAAACA). During this incubation, the probes cooperatively hybridize to Syngr3. Then, 50 μl of working probe set hsSYNGR3 (gene target, synaptogyrin 3 from Homo sapiens) and 90 μl of working probe set hsGAPDH (endogenous control, glyceraldehyde-3-phosphate dehydrogenase from Homo sapiens), as well as 50 μl (for hsSYNGR3) and 10 μl (for hsGAPDH) of cell lysate, were added to the capture plates provided by the manufacturer. The capture plates were incubated at 53°C for approximately 16–20 hours. The following day, the capture plates were washed three times with at least 300 μl of 1× wash buffer (nuclease-free water, wash buffer component 1, and wash buffer component 2). 100 μl of pre-amplification working reagent was added to both the hsSYNGR3 and hsGAPDH capture plates, which were then sealed with clear adhesive foil and incubated at 53°C for 1 hour. After incubation, the wash step was repeated, and then 100 μl of amplification working reagent was added to both the hsSYNGR3 and hsGAPDH capture plates. After a 1-hour incubation at 53°C, the wash and dry step was repeated, and 100 μl of labeled probe per 96-well was added to all capture plates. The capture plates were incubated at 53°C for 1 hour.The plate was then washed with 1x wash buffer and dried, and 100 μl of substrate was then added to the capture plate, which was sealed with adhesive aluminum foil. After 30 min of incubation in the dark, luminescence was read using a 1420 luminescence counter (WALLAC VICTOR Light, Perkin Elmer, Rodgau-Juegesheim, Germany).

[0243] For each siRNA, four wells containing SH-SY5Y cells were transfected in parallel, and individual data points were collected from each well. For each well, hsSYNGR3 mRNA levels were normalized to hsGAPDH mRNA levels. The activity of a given hsSYNGR3-targeting siRNA was expressed as the percent hsSYNGR3 mRNA concentration (normalized to hsGAPDH mRNA) in treated cells relative to the average hsSYNGR3 mRNA concentration (normalized to hsGAPDH mRNA) among control wells.

Claims

1. An oligonucleotide 10 to 70 nucleotides in length comprising a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length, which contiguous nucleotide sequence is at least 90% complementary to an equal length portion of a target region within the synaptogyrin-3 transcript set forth in SEQ ID NO:1, wherein the target region is comprised between nucleobases 205 and 265, 255 and 348, 338 and 387, 369 and 433, 422 and 531, 603 and 656, 641 and 714, 717 and 768, 1150 and 1600, 1743 and 1868, or between nucleobases 1865 and 2026 of SEQ ID NO:1, wherein the endpoints are inclusive.

2. 2. The oligonucleotide of claim 1, wherein the oligonucleotide is capable of binding to the synaptogyrin-3 transcript set forth in SEQ ID NO:

1.

3. The oligonucleotide according to any one of claims 1 to 2, wherein the oligonucleotide is capable of statistically significantly reducing the level of synaptogyrin-3 transcript in a cell compared to a control condition in the absence of the oligonucleotide.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is a double-stranded nucleic acid molecule.

5. The oligonucleotide of claim 4, wherein the double-stranded oligonucleotide is an RNAi molecule or an RNA duplex.

6. The oligonucleotide of claim 5, wherein the RNAi molecule is an siRNA, a bivalent siRNA, or an shRNA.

7. The oligonucleotide of any one of claims 1 to 3, wherein the oligonucleotide is a single-stranded nucleic acid molecule.

8. The oligonucleotide of claim 7, wherein the single-stranded oligonucleotide is the antisense portion of an RNAi molecule.

9. The oligonucleotide according to any one of claims 4 to 8, wherein the sense and / or antisense strand comprises between 15 and 25 nucleotides in length.

10. The oligonucleotide of any one of claims 4 to 9, wherein the antisense strand is 21 nucleotides in length.

11. 11. The oligonucleotide of any one of claims 1 to 10, comprising at least one single-stranded nucleotide overhang.

12. 12. The oligonucleotide of any one of claims 1 to 11, wherein the target region is selected from SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 82, or 93.

13. 13. The oligonucleotide of any one of claims 1 to 12, wherein the target region is selected from the group consisting of SEQ ID NOs: 2-4, 6-15, 17-18, 20-21, 23-25, 27-29, 31-41, 43-45, 47-49, 51-57, 70-81, and 90-92.

14. 14. The oligonucleotide of any one of claims 1 to 13, wherein a contiguous nucleotide sequence of at least 10 contiguous nucleotides in length exhibits at least 90% sequence identity to any of SEQ ID NOs: 172-218, 228-239, or 247-249.

15. The oligonucleotide of any one of claims 1 to 14, wherein the oligonucleotide comprises one or more internucleoside linkages and / or one or more 2' sugar-modified nucleosides.

16. 16. The oligonucleotide of claim 15, wherein the internucleoside linkage is a phosphorothioate internucleoside linkage and / or the 2' sugar modified nucleoside is selected from the group consisting of 2'-O-methyl-, 2'-O-methoxyethyl-, 2'-O-alkyl-, 2'-alkoxy, 2'-amino-, 2'-fluoro-, and LNA nucleosides.

17. 16. The oligonucleotide of claim 15, wherein all oligonucleosides are modified by phosphorothioate internucleoside linkages or by 2'-O-methyl groups.

18. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1 to 17.

19. An oligonucleotide according to any one of claims 1 to 17 or a pharmaceutical composition according to claim 18 for use as a medicament.

20. 19. The oligonucleotide of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for use in treating or inhibiting the progression of a tauopathy disorder or for use in treating or inhibiting a symptom of a tauopathy disorder.

21. Tauopathy disorders include Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-Parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration, Pick's disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), postencephalitic parkinsonism, Guam Parkinson's disease complex, Guadeloupe Parkinson's disease, Huntington's disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallervorden-Spatz disease, Niemann-Pick type C, chronic traumatic encephalopathy, tangle-only dementia, and bulbar dementia.

20. The oligonucleotide of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for use according to claim 20, wherein the oligonucleotide is selected from the group consisting of leukotauopathy with glial inclusions, subacute sclerosing panencephalitis, SLC9A6-associated mental retardation, non-Guam motor neuron disease with neurofibrillary tangles, neurodegeneration with cerebral iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcifications, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis / Parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

22. 21. The oligonucleotide of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for use according to claim 20, wherein the symptoms of a tauopathy disorder are selected from the group consisting of mild cognitive impairment, dementia, cognitive decline, motor function decline, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neurodegeneration, neuronal dysfunction, synapse loss, and amyloid deposition.

23. The oligonucleotide of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for use according to claim 22, wherein the synaptic dysfunction is presynaptic dysfunction.

24. A nucleic acid sequence selected from SEQ ID NO: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 82, or 93 for designing an antisense or RNAi molecule capable of reducing the level of synaptogyrin-3 transcripts in a cell by at least 15% compared to the control situation in the absence of the antisense or RNAi molecule.

25. 19. A method for treating or inhibiting the progression of a tauopathy disorder or treating or inhibiting a symptom of a tauopathy disorder, comprising administering to a subject in need thereof an effective dose of the oligonucleotide of any of claims 1 and 17 or the pharmaceutical composition of claim 18.

26. Tauopathy disorders include Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-Parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration, Pick's disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), postencephalitic parkinsonism, Guam Parkinson's disease complex, Guadeloupe Parkinson's disease, Huntington's disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallervorden-Spatz disease, and Niemann-Pick C.

26. The method of claim 25, wherein the dementia is selected from the group consisting of: chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-associated mental retardation, non-Guam motor neuron disease with neurofibrillary tangles, neurodegeneration with cerebral iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcifications, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis / Parkinsonism dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

27. 26. The method of claim 25, wherein the symptoms of the tauopathy disorder are selected from the group consisting of mild cognitive impairment, dementia, cognitive decline, motor function decline, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neurodegeneration, neuronal dysfunction, synaptic loss, and amyloid deposition.

28. 28. The method of claim 27, wherein the synaptic dysfunction is presynaptic dysfunction.

29. An antisense oligonucleotide or RNAi molecule capable of reducing the levels of synaptogyrin-3 mRNA, synaptogyrin-3 protein, synaptogyrin-3 activity, or a combination thereof, in a cell by at least 15% compared to a control situation in the absence of the antisense or RNAi molecule, wherein the nucleic acid sequence of the antisense oligonucleotide or RNAi molecule targets a subsequence of mRNA encoding synaptogyrin-3 selected from the group consisting of SEQ ID NOs: 5, 16, 19, 22, 26, 30, 42, 46, 50, 58, 59, 82, and 93.

Images