Cyclin-dependent kinase 2 / 4 / 9 inhibitors for the treatment of neutropenia

Abstract

The present invention relates to novel agents for the prevention and / or treatment of neutropenia, pharmaceutical compositions containing said agents, and methods for the preventive and / or therapeutic treatment of neutropenia.

Description

[Technical Field]

[0001] The present invention relates to novel agents for the prevention and / or treatment of neutropenia, pharmaceutical compositions containing said agents, and methods for the preventive and / or therapeutic treatment of neutropenia. [Background technology]

[0002] Neutropenia is a disease characterized by abnormally low levels of neutrophils in the blood and bone marrow. Neutrophils make up the majority of circulating white blood cells and serve as the primary defense against infection by destroying bacteria, their fragments, and viruses bound to immunoglobulins in the blood. Patients with neutropenia are susceptible to bacterial infections, which, if not promptly treated, can become life-threatening (neutropenic sepsis). Neutropenia can be acute (transient) or chronic (long-term). The term "neutropenia" is sometimes used interchangeably with "leukopenia" ("decreased white blood cell count").

[0003] Neutropenia can be divided into acquired and congenital forms. There are two main types of congenital neutropenia: severe congenital neutropenia (CN or SCN) and cyclic neutropenia (CyN).

[0004] Cyclic neutropenia is characterized by neutrophil counts ranging from normal to zero, whereas severe congenital neutropenia is characterized by a significantly reduced absolute neutrophil count (ANC) at birth (<500 cells / ml), arrest of myelopoiesis maturation in the bone marrow at the promyelocyte / myelocyte stage, and early onset of bacterial infections.

[0005] Severe congenital neutropenia (CN) is associated with mutations in various genes, including ELANE, HAX1, JAGN1, and SBDS. Severe congenital neutropenia may be diagnosed by measuring very low absolute neutrophil counts in the blood and by demonstrating arrested myeloid cell maturation on bone marrow aspirate.

[0006] Severe congenital neutropenia is usually diagnosed shortly after birth, whereas cyclic neutropenia generally presents at various ages and is characterized by recurrent acute oral disease. Bone marrow examination is often required to rule out malignant hematopoietic transformation, measure cellularity, assess bone marrow maturation, and detect signs of the precise etiology. Currently, cytogenetic bone marrow examination is crucial when severe congenital neutropenia (CN / SCN) is suspected. Antineutrophil antibody assays, immunoglobulin assays (Ig GAM), lymphocyte immunophenotyping, pancreatic markers (serum trypsinogen and fecal elastase), and fat-soluble vitamin levels (vitamin A, vitamin E, and vitamin D) are also important when evaluating severe congenital neutropenia (CN / SCN) and cyclic neutropenia (CyN).

[0007] Daily subcutaneous administration of recombinant human granulocyte colony-stimulating factor (rhG-CSF) is the preferred treatment, resulting in significant increases in absolute cell counts, reduced infections, and dramatically improved quality of life. While the majority of patients respond to daily rhG-CSF treatment, approximately 15% do not respond to the maximum dose of rhG-CSF of 50 μg / kg / day, and approximately 20% develop myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML). Bone marrow transplantation is the only curative treatment for severe congenital neutropenia, but due to the risk of severe adverse events such as graft-versus-host disease and graft failure, alternative treatments for patients with severe congenital neutropenia are urgently needed.

[0008] Against this background, the present invention aims to provide novel therapeutic and pharmacological interventions for the treatment and prevention of neutropenia, more specifically, to make available active agents or compounds that can alleviate, and preferably avoid, the problems of current neutropenia treatment options.

[0009] The present invention fulfills these and other needs. Summary of the Invention [Means for solving the problem]

[0010] The present invention provides cyclin-dependent kinase 2 / 4 / 9 (CDK2 / 4 / 9) inhibitors, as well as salts, solvates and solvates of the salts thereof, for use in the prevention and / or treatment of neutropenia. DETAILED DESCRIPTION OF THE INVENTION

[0011] Cyclin-dependent kinases (CDKs) are members of the CDK family. CDK family members share high similarity with the gene products of cdc28 in S. cerevisiae and cdc2 in S. pombe, and are known to be important cell cycle regulators. CDKs were first discovered as factors responsible for regulating the cell cycle. Furthermore, CDKs are involved in the regulation of transcription, mRNA processing, and neuronal differentiation. CDKs are present in all known eukaryotic organisms, and their regulatory function in the cell cycle is evolutionarily conserved.

[0012] Cyclin-dependent kinase 2 (CDK2) associates with and is regulated by regulatory subunits of complexes containing cyclin E or cyclin A. Cyclin E binds to Cdk2 in G1, and this binding is required for the transition from G1 to S phase, whereas binding to cyclin A is required for progression through S phase. CDK2 activity is also regulated by phosphorylation. Multiple alternative splice variants and multiple transcription start sites for the CDK2 gene have also been reported.

[0013] Cyclin-dependent kinase 4, or CDK4, is regulated by its regulatory subunit, the D-type cyclin. CDK4 has been shown to be responsible for phosphorylating the retinoblastoma gene product (Rb). The cyclin D-CDK4 complex is a key integrator of various mitogenic and cytostatic signals.

[0014] Cyclin-dependent kinase 9, or CDK9, is a cyclin-dependent kinase associated with P-TEFb. This kinase has been found to be a component of the multiprotein complex TAK / P-TEFb, which is an elongation factor for RNA polymerase II transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. CDK9 forms a complex with and is regulated by the regulatory subunits cyclin T or cyclin K.

[0015] A CDK2 / 4 / 9 inhibitor is a molecule that specifically inhibits the activity of CDK2 / 4 / 9. In one embodiment, it specifically inhibits the activity of CDK2 / 4 / 9 without forming a complex with the corresponding regulatory subunit, and in another embodiment, it specifically inhibits the activity of CDK2 / 4 / 9 by forming a complex with the corresponding regulatory subunit. According to the present invention, in one embodiment, a CDK2 / 4 / 9 inhibitor is a compound that inhibits CDK2, CDK4, or CDK9, i.e., it is understood to mean three different inhibitors, such as a CDK2 inhibitor, a CDK4 inhibitor, and a CDK9 inhibitor. On the other hand, in another embodiment, a CDK2 / 4 / 9 inhibitor is a compound that inhibits all of CDK2, CDK4, and CDK9, but not necessarily to the same extent, i.e., it is understood to mean one inhibitor. Furthermore, if necessary, the CDK-specific inhibitory effect may be concentration-dependent. That is, in one embodiment, a compound may inhibit only one or two of CDK2, CDK4, and CDK9 at low levels, while in another embodiment, the compound may inhibit all three CDKs at high levels, if desired.

[0016] While CDK2 / 4 / 9 inhibitors are often, but not limited to, small molecules, CDK2 / 4 / 9 inhibitors also include inhibitory proteins named with a lowercase "p" followed by their molecular weight in kilodaltons, such as p15, p16, p18, p19, p21, p27, p57, etc.

[0017] The CDK2 / 4 / 9 inhibitors of the present invention may exist as stereoisomers (enantiomers or diastereomers). Therefore, the present invention further includes enantiomers or diastereomers and mixtures thereof. Stereoisomerically homogeneous components can be isolated from mixtures of enantiomers and / or diastereomers by known methods. When the CDK2 / 4 / 9 inhibitors of the present invention may exist as tautomers, the present invention includes all tautomers.

[0018] Preferred salts for the purposes of the present invention are physiologically or pharmaceutically acceptable salts of the CDK2 / 4 / 9 inhibitors of the present invention. However, salts which are not suitable for pharmaceutical applications but which can be used, for example, to isolate or purify the CDK2 / 4 / 9 inhibitors of the present invention are also encompassed by the present invention.

[0019] Examples of pharmaceutically acceptable salts of the CDK2 / 4 / 9 inhibitors of the present invention include salts of inorganic bases, such as ammonium salts, alkali metal salts (particularly, sodium salts or potassium salts), alkaline earth metal salts (particularly, magnesium salts or calcium salts); salts of organic bases (particularly, salts derived from the organic bases cyclohexylamine, benzylamine, octylamine, ethanolamine, diethanolamine, diethylamine, triethylamine, ethylenediamine, procaine, morpholine, pyrroline, piperidine, N-ethylpiperidine, N-methylmorpholine, or piperazine); and salts with basic amino acids (particularly, salts with lysine, arginine, ornithine, or histidine).

[0020] Further examples of pharmaceutically acceptable salts of the CDK2 / 4 / 9 inhibitors of the present invention include salts of inorganic acids, such as hydrochlorides, hydrobromides, sulfates, phosphates or phosphonates; salts of organic acids, specifically acetates, formates, propionates, lactates, citrates, fumarates, maleates, benzoates, tartrates, malates, methanesulfonates, ethanesulfonates, toluenesulfonates or benzenesulfonates; and salts with acidic amino acids, specifically aspartates or glutamates.

[0021] Further examples of pharmaceutically acceptable salts of the CDK2 / 4 / 9 inhibitors of the present invention include salts of inorganic acids, such as hydrochlorides, hydrobromides, sulfates, phosphates or phosphonates; salts of organic acids, specifically acetates, formates, propionates, lactates, citrates, fumarates, maleates, benzoates, tartrates, malates, methanesulfonates, ethanesulfonates, toluenesulfonates or benzenesulfonates; and salts with acidic amino acids, specifically aspartates or glutamates.

[0022] For the purposes of the present invention, a solvate refers to a form in which the CDK2 / 4 / 9 inhibitor of the present invention in the solid or liquid state is complexed by coordination with solvent molecules. A hydrate is a specific form of solvate in which water is coordinated.

[0023] CDK9 and its inhibitors are described in the review article by Anshabo et al. (2021), CDK9: A Comprehensive Review of Its Biology, and Its Role as a Potential Target for Anti-Cancer Agents, Front. Oncol. 11:678559. doi: 10.3389 / fonc.2021.678559. In particular, CDK9 inhibitors suitable for practicing the present invention are listed in Table 1 in the supplemental material.

[0024] According to the present invention, "prevention" and "treatment" of neutropenia are understood to mean measures that at least reduce the onset or prevalence of neutropenia and / or its symptoms in an organism, as well as measures that prevent the onset or prevalence of neutropenia and / or its symptoms in an organism. More specifically, "prevention" and "treatment" of neutropenia are understood to include preventing or reversing a decrease in neutrophilic granulocytes or neutrophils in the blood of an organism.

[0025] As used herein, the terms "organism" and "subject" can be used interchangeably. The terms "organism" and "subject" refer to any type of living organism, including vertebrates and mammals such as mice, rats, cows, pigs, goats, chickens, dogs, monkeys, horses, and humans. Preferably, the organism is a human. The subject may be a subject (patient) suffering from neutropenia, but may also be a healthy subject.

[0026] The inventors' finding that CDK2 / 4 / 9 inhibitors can be used to prevent and treat neutropenia was surprising and unexpected.To date, most CDK2 / 4 / 9 inhibitors, especially CDK9 inhibitors, have only been reported to be used in the treatment of solid malignancies and hematological malignancies.See Anshabo et al. (supra).

[0027] In fact, the prior art has reported the treatment of endometrial cancer with a compound called flavopiridol (alvocidib), which has previously been called a CDK9 inhibitor, but it has been reported that neutropenia may occur as a side effect (see Grendys et al. (2005), A phase II evaluation of flavopiridol as second-line chemotherapy of endometrial carcinoma: a Gynecologic Oncology Group study, Gynecol. Oncol. 98(2), pages 249-53). Therefore, a person skilled in the art would be correctly concerned about the onset or worsening of such clinical symptoms and would not consider using a CDK2 / 4 / 9 inhibitor, much less a CDK9 inhibitor, to prevent or treat neutropenia. In contrast, the present inventors have not been able to confirm the speculation by Grendys et al.

[0028] The present inventors have found that in well-known and established in vitro and in vivo animal models of neutropenia, as well as in hematopoietic stem and progenitor cells obtained from patients with severe congenital neutropenia, treatment with or administration of a CDK2 / 4 / 9 inhibitor results in significant and striking improvements in granulocyte production and patient clinical outcomes.

[0029] The starting point of our research was the discovery that flavopiridol (also known as alvocidib) can inhibit not only CDK9 but also CDK2 and CDK4, as previously speculated. Specifically, in an exemplary experimental setup, we were able to demonstrate that administration of flavopiridol can induce the maturation of primary hematopoietic stem and progenitor cells and induced pluripotent stem cells from patients with severe congenital neutropenia into neutrophils. Furthermore, flavopiridol increased the maturation of primary hematopoietic stem and progenitor cells from healthy controls into neutrophils.

[0030] The present inventors have demonstrated that not only the therapeutic effect of CDK2 / 4 / 9 inhibitors, but also the preventive effect of CDK2 / 4 / 9 inhibitors in preventing neutropenia is particularly advantageous. Thus, surprisingly, the present inventors have found that administering CDK2 / 4 / 9 inhibitors to healthy individuals also promotes neutrophil maturation. The fact that the granulocyte differentiation of hematopoietic stem cells from healthy donors into neutrophils is also promoted further supports the advantages of applying CDK2 / 4 / 9 inhibitors to the treatment of acquired neutropenia.

[0031] Surprisingly, the beneficial effects of CDK2 / 4 / 9 inhibitors observed by the inventors can be obtained regardless of neutropenia-causing mutations, such as those in ELANE, HAX1, JAGN1, and SRP54, which are mutated genes found in congenital neutropenia. Thus, the novel agents of the present invention are characterized by a particularly broad range of applications and a particularly large set of addressable targets.

[0032] While prior art CDK inhibitors are typically used at very high concentrations for known applications, it has been found that the effects of the CDK2 / 4 / 9 inhibitors observed in the present invention are clearly demonstrated even at low concentrations. In prior art clinical trials, a steady plasma concentration of approximately 350 nM of flavopiridol was used to inhibit CDK and induce apoptosis in leukemia cells (Gerson et al. (2018), Flavopiridol - Pharmacology and molecular mechanisms of antineoplastic agents for hematologic malignancies, in 'Hematology', 7 th Edition). On the other hand, the present inventors have already achieved favorable effects on neutropenia at a partial plasma concentration, for example, at a dose of about 1 / 9 of the dose described in the above academic paper. By using the compound of the present invention at a low concentration, therapeutic safety can be achieved while minimizing the risk of side effects.

[0033] These findings by the present inventors are therefore particularly beneficial because, for the first time, it is now possible to treat neutropenic patients who do not respond to administration of rhG-CSF or who are at risk of developing myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML) without the need for bone marrow transplantation.

[0034] In one embodiment of the invention, the CDK2 / 4 / 9 inhibitor is selected from the group consisting of flavopiridol (alvocidib), rohitukin, TP-1287, seliciclib (roscovitine / CYC202), dinaciclib (SCH 727965), SNS 032, P276-00, AT7519, voruciclib, CDKI-73, TG02, BAY1143572 (atuveciclib), BAY1251152, AZD4573, i-CDK9, and NVP-2.

[0035] This approach has the advantage of being able to use a wide range of CDK9 inhibitors that have already been tested in clinical trials or at least preclinical trials, so that many details about their efficacy profile, pharmacodynamics, and pharmacokinetics, and possibly also their side effect profile, are already known, allowing for rapid translation into workable therapeutics.

[0036] For example, flavopiridol, also known as alvocidib, is a flavonoid alkaloid CDK9 kinase inhibitor currently in clinical development for the treatment of acute myeloid leukemia. Flavopiridol is also being investigated for the treatment of arthritis [Sekine et al. (2008), Successful treatment of animal models of rheumatoid arthritis with small-molecule cyclin-dependent kinase inhibitors, J. Immunol. 180 (3), pp. 1954-61] and plaque formation in atherosclerosis [Ruel et al. (1999), Flavopiridol inhibits smooth muscle cell proliferation in vitro and neointimal formation in vivo after carotid injury in the rat, Circulation. 100 (6), pp. 659-65]. The target of alvocidib is positive transcription elongation factor (P-TEFβ). Treatment of cells with alvocidib has been reported to inhibit P-TEFb and reduce mRNA production. Alvocidib was granted orphan drug designation by the FDA in 2014 for the treatment of patients with acute myeloid leukemia.

[0037] In another embodiment of the present invention, the neutropenia is selected from the group consisting of congenital neutropenia and acquired neutropenia, wherein congenital neutropenia and acquired neutropenia include severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN), chronic neutropenia including idiopathic neutropenia, drug-induced neutropenia, immune-mediated neutropenia, and acute neutropenia caused by chemotherapy or radiation.

[0038] This approach has the advantage that the present invention can be used to treat neutropenia, a common condition for a significant proportion of affected patients for which there are currently no satisfactory treatment options.

[0039] In one preferred embodiment of the present invention, the CDK2 / 4 / 9 inhibitor of the present invention is flavopiridol (alvocidib) and the neutropenia is severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN).

[0040] In this embodiment, the findings obtained by the present inventors in the exemplary experiments are advantageously implemented. Thus, by using flavopiridol as an example and an established CN / SCN experimental model, the present inventors have found that CDK2 / 4 / 9 inhibitors can successfully and effectively treat or prevent neutropenia.

[0041] In yet another embodiment of the present invention, the CDK2 / 4 / 9 inhibitor is used at a dose such that the plasma concentration after administration to an organism is in the range of about 10 to about 300 nM, preferably about 20 to about 200 nM, more preferably about 30 to about 100 nM, and most preferably about 40 nM.

[0042] This approach has the advantage that by providing a sufficiently high concentration of a CDK2 / 4 / 9 inhibitor, the therapeutic and preventive effects against neutropenia described in the present invention can be achieved. However, according to the prior art, such high concentrations cannot be used due to the induction of side effects. For example, very high concentrations of CDK inhibitors are used in antitumor treatments (see Gerson et al., supra), but these can be accompanied by significant side effects. See Grendys et al. (supra).

[0043] In another embodiment of the present invention, the CDK2 / 4 / 9 inhibitor of the present invention is used in the prophylaxis and / or treatment of neutropenic patients who do not respond to treatment with granulocyte colony-stimulating factor (G-CSF) or who do not respond adequately to treatment with G-CSF, wherein the G-CSF is preferably recombinant human G-CSF (rhG-CSF).

[0044] This approach has the advantage of being able to help the large number of patients who do not respond or respond adequately to current standard treatments and who would otherwise have to undergo potentially risky bone marrow treatments without the use of CDK2 / 4 / 9 inhibitors. Thus, the present invention can provide an effective treatment.

[0045] On the other hand, the CDK2 / 4 / 9 inhibitor of the present invention can be used as an independent agent or the sole active agent. Thus, in yet another embodiment of the present invention, the CDK9 inhibitor of the present invention is used in combination with G-CSF, preferably in combination with recombinant human G-CSF (rhG-CSF).

[0046] This embodiment of the present invention provides an enhanced or synergistic effect that significantly improves the current standard of care in G-CSF-sensitive patients, and has the advantage of allowing for a lower dose of G-CSF, if necessary, which further significantly reduces the risk of developing side effects such as MDS and AML.

[0047] Another subject of the present invention is a pharmaceutical composition for use in the prevention and / or treatment of neutropenia, comprising a CDK2 / 4 / 9 inhibitor according to the invention, or a salt thereof, a solvate thereof or a solvate of a salt thereof, and a pharmaceutically acceptable carrier.

[0048] The features, properties, advantages and embodiments disclosed above and below for the CDK2 / 4 / 9 inhibitors of the present invention apply equally and mutatis mutandis to the pharmaceutical compositions of the present invention.

[0049] The term "pharmaceutically acceptable carrier" is well known to those skilled in the art. Pharmaceutically acceptable carriers allow the CDK2 / 4 / 9 inhibitors of the present invention to be appropriately formulated, and, if applicable, allow the CDK2 / 4 / 9 inhibitors of the present invention to be appropriately formulated with additional active agents such as G-CSF, thereby improving the selectivity, efficacy, and / or safety of drug administration. Pharmaceutically acceptable carriers include, but are not limited to, solvents, excipients, binders, lubricants, stabilizers, surfactants, suspending agents, thickeners, emulsifiers, preservatives, liposomes, micelles, microspheres, nanoparticles, and the like, suitable for a particular dosage form. Unless a conventional carrier medium is incompatible with the active ingredient, for example, unless undesirable biological effects or other adverse interactions occur with other ingredients in the pharmaceutical composition, the use of such compositions is within the scope of the present invention. Pharmaceutically acceptable carriers include, but are not limited to, monosaccharides, oligosaccharides, and derivatives thereof; malt, gelatin, talc, excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline, Ringer's solution, ethyl alcohol, and phosphate buffer. Furthermore, the compositions of the present invention may contain other nontoxic, compatible lubricants, colorants, release agents, film-forming agents, sweeteners, flavoring agents, preservatives, or antioxidants, such as sodium lauryl sulfate and magnesium stearate.

[0050] "Pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response or other problem or complication, commensurate with a reasonable benefit / risk ratio. Suitable pharmaceutical carriers or excipients and pharmaceutical additives for use in pharmaceutical formulations are described in detail in Remington - The Science and Practice of Pharmacy, 23, a well-known reference text in the art. rd edition, 2020, and the United States Pharmacopeia and the National Formulary (USP / NF). Other sources of information are available to those skilled in the art.

[0051] The pharmaceutical compositions of the present invention may contain an "effective amount" of the CDK2 / 4 / 9 inhibitor of the present invention and, if applicable, an additional active agent such as G-CSF. An "effective amount" (or "therapeutically effective amount") is an amount sufficient to achieve a beneficial or desired clinical result upon treatment. An effective amount can be administered to a subject or organism in one or more administrations. A therapeutically effective amount is an amount sufficient to alleviate, alleviate, stabilize, reverse, or delay the progression of a disease, or to reduce the pathological consequences of the disease. The effective amount is determined by a physician on a case-by-case basis and is within the skill of a person skilled in the art. Typically, several factors are taken into consideration when determining an appropriate dose to achieve an effective amount. Such factors include the age, sex, and weight of the subject, the condition being treated, and the severity of the condition.

[0052] A further subject of the present invention is a method for the prophylactic and / or therapeutic treatment of neutropenia in an organism, which comprises administering to the organism an effective amount of a CDK2 / 4 / 9 inhibitor of the present invention, or a salt thereof, a solvate thereof or a solvate of a salt thereof, or a pharmaceutical composition of the present invention.

[0053] The features, properties, advantages and embodiments disclosed above and below for the CDK9 inhibitors and pharmaceutical compositions of the present invention apply equally and mutatis mutandis to the methods of the present invention.

[0054] The features mentioned above and the features to be described below can be used not only in the combinations shown in the respective embodiments, but also in other combinations or alone without departing from the scope of the present invention.

[0055] The present invention will be further described in detail by reference to the following embodiments, which describe additional features, characteristics, and advantages of the present invention. Furthermore, the following embodiments are for illustrative purposes only and are not intended to limit the spirit or scope of the present invention. Features described in specific embodiments are general features of the present invention and are not only applicable to specific embodiments, but also applicable alone and to all embodiments of the present invention. [Brief explanation of the drawings]

[0056] The present invention will be described and explained in more detail with reference to the following examples and figures, but the present invention is not limited to these examples and figures. [Figure 1] Generation of isogenic iPSC lines using CRISPR / Cas9 gene editing. A. Sanger sequencing traces of iPSCs derived from ELANE-CN patients harboring p.C151Y, p.A57V, or p.G214R mutations before and after CRISPR / Cas9-mediated correction. B. Flow cytometry analysis of suspension cells recovered from embryoid body cultures on day 28 of differentiation induction of ELANE-CN iPSC and ELANE-CN corr iPSC lines. Data represent the mean ± SD of two independent experiments, each performed in duplicate (*P<0.05, **P<0.01). [Figure 2]This shows that treatment with flavopiridol rescued granulocytic differentiation of ELANE-CN iPSCs. CD34+ cells recovered from embryoid body cultures of CN-iPSCs on day 14 of differentiation were treated with the 11 final selected small molecules for colony-forming unit (CFU) assays. Data represent the mean ± SD of two independent experiments (**P<0.01). This shows a CFU assay of CD34+ cells recovered from three CN-iPSC embryoid body cultures on day 14 of differentiation, treated with 40 nM flavopiridol. Data represent the mean ± SD of two independent experiments (**P<0.01). [Figure 3] Flavopiridol treatment enhanced the differentiation of primary bone marrow CD34+ HSPCs from healthy controls into granulocytes. A. Colony-forming unit (CFU) assay of CD34+ HSPC cells treated with 40 nM flavopiridol. Data represent the mean ± SD of two independent experiments (**P<0.01). B. The differentiation potential of flavopiridol-treated HD-CD34+ HSPC cells was assessed by examining the expression of neutrophil cell surface markers after 14 days of differentiation in liquid culture. Data represent the mean ± SD of duplicates (**P<0.01). C-D. Wright-Giemsa staining of differentiated cells on day 14 was performed to identify cell morphology. Representative images are shown. [Figure 4] Flavopiridol treatment restored granulocytic differentiation in primary bone marrow CD34+ HSPCs from ELANE-CN, HAX1-CN, JAGN1-CN, and SRP54-CN patients. A. Colony-forming unit (CFU) assay of CN CD34+ HSPC cells treated with 40 nM flavopiridol. Data represent the mean ± SD of two independent experiments (*P<0.05, **P<0.01). B. The differentiation potential of flavopiridol-treated CN-CD34+ HSPC cells was assessed by examining the expression of neutrophil cell surface markers after 14 days of differentiation in liquid culture. Data represent the mean ± SD of duplicates (**P<0.01, ***P<0.001). C-D. Wright-Giemsa staining of differentiated cells on day 14 was performed to identify cell morphology. Representative images are shown. [Figure 5] This figure shows that treatment of transgenic zebrafish mutant embryos with flavopiridol restored neutrophil numbers without affecting wild-type HSPCs. A. Flavopiridol treatment had no effect on HSPC (CD41:gfp+ cells) numbers compared to DMSO-treated controls. B. Jagn1b knockout embryos showed a decrease in neutrophils (mpo:gfp+ cells) compared to DMSO-treated wild-type controls. Two-day treatment of neutropenic Jagn1b knockout embryos with flavopiridol restored neutrophil (mpo:gfp+ cells) numbers to levels similar to those of wild-type controls. C. The number of neutrophils (mpo:gfp+ cells) in hax1 knockdown embryos was significantly reduced compared to DMSO-treated wild-type controls. After two days of flavopiridol treatment, the number of neutrophils (mpo:gfp+ cells) in hax1 knockdown embryos increased to levels similar to those of wild-type controls. Each dot represents an individual embryo. Data are means ± standard deviation. Statistical analysis was performed using an unpaired two-tailed Wilcoxon-Mann-Whitney test. ns: not significant; * p-value < 0.05; ** p-value < 0.01; *** p-value < 0.001; **** p-value < 0.0001. [Figure 6] Figure 1 shows the toxicity of flavopiridol on human healthy donor primary neutrophils after treatment with flavopiridol for (A) 3 hours, (B) 24 hours, or (C) 48 hours. [Figure 7] The effects of flavopiridol on hematopoietic stem progenitor cell (HSPC) apoptosis and viability (A, B, C, D) and the functional activity of in vitro formed neutrophils (E, F, G). [Example]

[0057] 1. Materials and Methods patient Bone marrow and peripheral blood samples were collected from patients undergoing annual follow-up as recommended by the Severe Chronic Neutropenia International Registry. Approval for this study was obtained from the ethical review board of the Faculty of Medicine, University of Tübingen. Written informed consent was obtained from study participants.

[0058] Reprogramming of peripheral blood mononuclear cells (PB MNC) The cells were cultured at a density of 1.5 × 10 in Stemline II medium (Sigma) supplemented with 10% FCS, 1% penicillin / streptomycin (Biochrom, #A2213), 1% glutamine (Biochrom, #K0283), and the cytokines 20 ng / μl IL-3 (PeproTech, #200-03), 20 ng / μl IL-6 (PeproTech, #200-06), 20 ng / μl TPO (R&D Systems, #288-TP-200), 50 ng / μl SCF (R&D Systems, #255-SC-200), and 50 ng / μl FLT-3L (BioLegend, #550604). 6 Peripheral blood mononuclear cells were cultured for 7 days. On day 7, the cells were transferred to RetroNectin (Clontech)-coated 12-well plates and infected with the supernatant of lentivirus (pRRL.PPT.SF.hOct34.hKlf4.hSox2.i2dTomato.pre.FRT) containing Oct3 / 4, Klf4, and Sox2 cDNAs at a multiplicity of infection (MOI) of 2. After 4 days, the cells were transferred onto SNL feeder cells and maintained in iPSC maintenance medium consisting of DMEM F12 (Sigma, #D6421-6x) supplemented with 20% Knockout serum replacement (Invitrogen, #10828028), 1% non-essential amino acid solution (Invitrogen, #11140-050), and 100 μM (2-mercaptoethanol and 2 mM L-glutamine), and CD34 medium supplemented with 2 mM valproic acid and 50 μg / ml vitamin C. +The cells were cultured in a 1:1 mixture of cell growth medium and iPSC medium alone. This medium was gradually replaced with iPSC medium alone. The first iPSC colonies appeared approximately 3 weeks after the start of reprogramming.

[0059] Design of ELANE-specific guide RNA (gRNA) gRNAs for the ELANE mutation p.A57V (cleavage site: chr19 [CTGCGCGGAGGCCACTTCTG (SEQ ID NO: 1), +852,969: -852,969], NM_001972.3 exon 2), the ELANE mutation p.C151Y (cleavage site: chr19 [GGGACGCCGCCTGGGCAACG (SEQ ID NO: 2), +855,637: -855,637], NM_001972.3 exon 4), and the ELANE mutation p.G214R (cleavage site: chr19 [TTAGCCCGTTGCAGACCAAG (SEQ ID NO: 3), +855,978: -855,978], NM_001972.3 exon 5) were designed using the CCTop web tool.

[0060] CRISPR / Cas9-based repair template Based on the human genome assembly GRCh37 (hg19), the ELANE mutation p. A57V (5'-CGGCCCCACGCGTGGCCCTTCATGGTGTCCCTGCAGCTGCGCGGAGGCCACTTCTGCGGCGCCACCCTGATTGCGCCCAACTTCGTCATGTCGGCCGCGCACTGCGTGGCGAATGTGTGAGTA-3' (SEQ ID NO: 4)), the ELANE mutation p. C151Y (5'-GCCAACGTGCAGGTGGCCCAGCTGCCGGCTCAGGGACGCCGCCTGGGCAACGGGGTGCAGTGCCTGGCCATGGGCTGGGGCCTTCTGGGCAGGAACCGTGGGATCGCCAGCGTCCTGCAGGAG-3' (SEQ ID NO: 5)), and the ELANE mutation p. A repair template for G214R (5'-CGGGGCAAAGGCATCGGGGTAGAGCCCTGAGGCGCAGCCTCCCCGGACGAAGGAGGCAATTCCGTGGATTAGCCCGTTGCAGACCAAGGGGCTGCCGGAGTCCCCCTGTGGAGGCAGACAAGG-3' (SEQ ID NO: 6)) was designed and synthesized as ssODN by Integrated DNA technologies (IDT).

[0061] Correction of ELANE mutation in CN-iPSCs using CRISPR / Cas9-gRNA RNP Electroporation was performed using the Amaxa Nucleofection System (P3 Primary Cell Kit, #V4XP-3024) according to the manufacturer's instructions. Assembled gRNA (8 μg) and HiFi Cas9 (15 μg) protein (Integrated DNA Technologies) were injected at 1 × 10 ng / ml with 1 μM of each repair template. 6 Human CN-iPSCs were electroporated.

[0062] Isolation of single-cell iPSC clones 8 × 10 cells were cultured in a 10-cm Geltrex-coated dish containing StemFlex medium (Thermo Fisher Scientific, #A3349401) supplemented with RevitaCell supplement (Thermo Fisher Scientific, #A2644501). 3 Human iPSCs were seeded onto the cells. The medium was changed every 24 hours with RevitaCell supplement-free medium. On day 7, single iPSC colonies were picked and transferred to Geltrex-coated 96-well plates (one clone per well).

[0063] Screening of single iPSC clones Genomic DNA was isolated from single iPSC clones using the QuickExtract DNA Extraction Kit (Lucigen, #QE09050). PCR was performed using the GoTaq Hot Start Polymerase Kit (Promega, #M5006) and ELANE-specific primers (Table 1). [Table 1]

[0064] Clones that did not show the correct restriction enzyme pattern were excluded by in vitro restriction enzyme (RE) digestion of the PCR products. The reaction mix was incubated at 37°C for 60 minutes and then run on a 1% agarose gel. PCR products from iPSC clones that showed the correct restriction enzyme pattern were purified using ExoSAP, a master mix consisting of 1 part 20 U / μl Exonuclease I (Thermo Fisher Scientific, #EN0581) and 2 parts 1 U / μl FastAP thermosensitive alkaline phosphatase (Thermo Fisher Scientific, #EF0651). Sanger sequencing of the purified PCR products was performed by Eurofins Genomics or Microsynth. CRISPR / Cas9-mediated genome editing was analyzed using the Tracking of Indels by Decomposition (TIDE) web tool or the Inference of CRISPR Edits (ICE) web tool.

[0065] Embryoid body-based hematopoietic differentiation of iPSCs iPSCs were cultured on SNL feeder cells for 24 hours and then dissociated into individual cells using PBS / EDTA (0.02%) for 5 minutes. 2 × 10 cells per embryoid body were cultured in a 96-well plate using APEL serum-free differentiation medium (Stemcell Technologies) supplemented with bFGF (20 ng / μl) and ROCK inhibitor (R&D). 4Embryoid bodies (EBs) were generated by centrifugation of 10 cells. On day 1, BMP4 (40 ng / μl) was added to the medium to induce mesodermal differentiation. On day 4, EBs were seeded (10 cells / well) onto Matrigel-coated 6-well plates in APEL medium supplemented with VEGF (40 ng / μl), SCF (50 ng / μl), and IL-3 (50 ng / μl). To induce neutrophil differentiation, the medium was replaced with fresh APEL medium supplemented with IL3 (50 ng / μl) and G-CSF (50 ng / μl) after 3 days. All cytokines were purchased from R&D Systems unless otherwise noted. The first floating hematopoietic cells appeared between days 10 and 14. The floating cells were harvested every 3–4 days, and analysis began between days 14 and 32. For flow cytometry analysis, cells were incubated in PBS / 1% BSA containing 0.05% sodium azide and stained with mouse monoclonal anti-human antibodies. Two multicolor flow cytometry antibody panels were used: the "early" hematopoietic differentiation panel, which included CD33 (BioLegend, #303416), CD34 (BD, #348811), CD309 (BioLegend, #359910), CD43 (BD, #560199), CD41a (BD, #557296), CD235a (BD, #559943), CD45 (BioLegend, #304036), and 7-AAD (BD, #559925). The "late" myeloid / hematopoietic differentiation panel included CD15 (BD, #555402), CD45 (BioLegend, #304012), CD33 (BioLegend, #303416), and 7-AAD (BD, #559925). For iPSC characterization, we used anti-human TRA1-60 (BD, #560380), anti-mouse TRA-1-85 / CD147 (R&D, #FAB3195A), and anti-human SSEA4 (BD, #560126). For compensation, we used anti-mouse Igκ / negative control compensation particles (BD Biosciences). Samples were analyzed using a FACSCanto II (BD) and FlowJo V10 (FlowJo LLC).

[0066] CD34 in liquid culture + Cell differentiation CD34 + 2 x 10 cells 5 Cells were seeded into 24-well plates at a density of 100 cells / ml. Cells were incubated for 7 days in RPMI 1640 GlutaMAX medium supplemented with 10% FBS, 1% penicillin / streptomycin, 5 ng / ml SCF, 5 ng / ml IL-3, 5 ng / ml GM-CSF, and 10 ng / ml G-CSF. The medium was changed every other day. On day 7, cells were seeded in RPMI 1640 GlutaMAX medium supplemented with 10% FBS, 1% penicillin / streptomycin, and 10 ng / ml G-CSF. On day 14, cells were analyzed by flow cytometry using mouse anti-human CD34 (BD, #348811), mouse anti-human CD33 (BioLegend, #303416), mouse anti-human CD45 (BioLegend, #304036), mouse anti-human CD11b (BD, #557754), mouse anti-human CD15 (BD, #555402), mouse anti-human CD66b (BioLegend, #305114), and mouse anti-human CD16 (BD, #561248).

[0067] Zebrafish care and breeding Transgenic and wild-type zebrafish were maintained according to standard protocols and handled in accordance with the European Union Animal Protection Directive 2010 / 63 / EU. Zebrafish were maintained under local regulatory approval (Tierschutzgesetz §11, Abs. 1, Nr. 1, Permit 35 / 9185.46 / Uni TU). All experiments were performed using 5-day-postfertilization zebrafish embryos. Two transgenic (tg) reporter lines were used in this study: tg(mpo:gfp), which expresses GFP in neutrophils, and tg(CD41:gfp), which expresses GFP in HSPCs. Both lines have been described in the art.

[0068] Microinjection and drug treatment To generate jagn1b and hax1 mutations, we used two approaches: CRISPR / Cas9-mediated knockout and morpholino-mediated knockdown, respectively. First, to disrupt jagn1b function, we injected jagn1b-targeting sgRNA and Cas9 protein RNP (Alt-R Sp Cas9 nuclease, v.3, IDT) into the blastomeres of one-cell tg(mpo:gfp) embryos, as previously described. Separately, to disrupt hax1 function, we injected 1 mM hax1-specific morpholino (GeneTool) into one-cell tg(mpo:gfp) embryos, as previously described. All mutant and uninjected control embryos were raised until the day after fertilization, and then the eggshells were removed using pronase (Roche, Catalog No. 10165921001). The exoskeletated embryos were then seeded at a density of 5 embryos per well in 24-well plates and treated with DMSO (control) or 5-10 μM flavopiridol in E3 zebrafish culture medium. After 2 days of treatment, mpo:gfp was visualized using a Nikon SMZ18 fluorescent stereomicroscope. + Number of cells or CD41:gfp + The number of cells was quantified.

[0069] 2.Results First, we established an efficient pipeline for correcting inherited genetic mutations associated with congenital neutropenia (CN) in induced pluripotent stem cells (iPSCs) derived from patients with congenital neutropenia (CN) using CRISPR / Cas9 genome editing (Dannenmann et al. (2020), CRISPR / Cas9 genome editing of human-induced pluripotent stem cells followed by granulocytic differentiation. RNA interference and CRISPR technologies: Technical advances and new therapeutic opportunities, pp. 471-483). Using this pipeline, we generated isogenic CN iPSCs with the same genetic background as the parent cell line (Figure 1A).

[0070] By correcting each individual mutation without altering surrounding factors such as genetic or epigenetic background, we generated genetically matched iPSC controls that were disease-free, allowing us to focus our study solely on the disease-causing mutation. The isogenic iPSCs were differentiated in vitro into neutrophils and characterized by flow cytometry analysis of cell surface markers.

[0071] Comparison of myeloid differentiation between various isogenic iPSC lines (ELANE-CN corr) and their corresponding parental iPSC lines (ELANE-CN) demonstrated that granulocyte production could be restored in iPSC lines expressing the corrected ELANE gene (Figure 1B).

[0072] These data clearly demonstrated the successful establishment of an iPSC-based isogenic CN model.

[0073] Next, we performed transcriptome profiling of isogenic hematopoietic stem and progenitor cells (HSPCs) to extract differentially expressed genes (DEGs) between CN and CN-corrected hematopoietic progenitors. The differentially expressed gene signatures were considered to represent differences between hematopoietic progenitors derived from CN iPSCs and their corrected isogenic counterparts. We submitted the differentially expressed gene signatures to the LINCS L1000 characteristic direction signatures search engine (L1000CDS), a publicly available database composed of over one million gene expression profiles from chemically perturbed human cell lines.

[0074] We then selected 11 small molecules that could potentially mimic the differentially expressed gene (DEG) signature between CN HSPCs and CN-corrected HSPCs and screened their effects on granulopoiesis using an isogenic CN iPSC model. The screening results showed that flavopiridol, a CDK2 / 4 / 9 inhibitor, significantly restored granulopoiesis in CN iPSCs.

[0075] Based on the screening results, we treated three independent ELANE-CN-derived iPSCs with flavopiridol during the differentiation process of granulocytes using colony-forming unit (CFU) assays. Interestingly, we observed a significant increase in granulocyte colony-forming units (CFU-G) and a significant decrease in macrophage CFU (CFU-Ms), indicating that granulocyte production in CN iPSCs was restored (Figure 2).

[0076] To investigate whether flavopiridol disrupts the granulopoiesis process in healthy individuals, primary bone marrow CD34 cells from healthy donors were cultured. +HSPCs were treated with 40 nM flavopiridol and subjected to CFU assays and in vitro granulocytic liquid culture differentiation (LCD) assays. The CFU assays showed that CFU-G levels in healthy donor 1 (HD1) were significantly increased compared to the DMSO control, but CFU-G levels in healthy donor 2 (HD2) were not significantly changed (Figure 3A).

[0077] After 14 days of differentiation in liquid culture, neutrophil cell surface marker analysis by flow cytometry revealed that flavopiridol-treated CD34 + The differentiation potential of HSPCs was evaluated. Both healthy CD34 cells treated with flavopiridol were + In HSPCs, granulocytes (CD45 + CD15 + CD11b + and CD45 + CD15 + CD66b + ) and mature neutrophils (CD45 + CD15 + CD16 + ) was observed, indicating a significant enhancement of granulocyte production (Figure 3B). Concurrently, morphological examination of cytospin preparations of mature granulocytes formed on day 14 of in vitro granulocyte differentiation in liquid culture (Figure 3C) revealed no change in neutrophil numbers in healthy donor 1 (HD1), but a significant increase in neutrophil numbers in healthy donor 2 (HD2) (Figure 3D).

[0078] These results suggest that flavopiridol inhibits the proliferation of primary bone marrow CD34 cells from healthy donors. + It was shown to enhance granulopoiesis rather than impede it in HSPCs.

[0079] Furthermore, to evaluate the clinical applicability of flavopiridol as a universal treatment option available for all CN patients, regardless of underlying genetic factors, primary bone marrow CD34 markers were obtained from two ELANE-CN patients, one HAX1-CN patient, one JAGN1-CN patient, and one SRP54-CN patient. +HSPCs were treated with 40 nM flavopiridol and subjected to CFU and LCD assays. The CFU assay showed that CFU-G levels were significantly increased in all CN groups (Figure 4A).

[0080] After 14 days of differentiation in liquid culture, the absolute number of neutrophil cell surface marker-expressing CD34 cells was analyzed by flow cytometry. + The differentiation potential of HSPCs was evaluated. All CN patient-derived CD34 cells treated with flavopiridol were + In HSPCs, granulocytes (CD45 + CD15 + CD11b + and CD45 + CD15 + CD66b + ) and mature neutrophils (CD45 + CD15 + CD16 + ) was recovered, indicating a significant recovery of granulocyte production (Fig. 4B).

[0081] Concurrently, morphological examination of cytospin preparations of mature granulocytes formed on day 14 of in vitro granulocyte differentiation in liquid culture (Fig. 4C) showed significant recovery or a tendency toward recovery of granulopoiesis in all CN patients (Fig. 4D).

[0082] From the above results obtained by the inventors' CN in vitro model, it was found that flavopiridol inhibits primary bone marrow CD34 in patients with ELANE-CN, HAX1-CN, JAGN1-CN, and SRP54-CN. + It was shown to restore granulocyte production in HSPCs.

[0083] To further validate the results obtained from our in vitro model, a series of experiments were designed to investigate the effects of flavopiridol in an in vivo model of zebrafish. Compared to DMSO-treated controls, treatment with flavopiridol up to a concentration of 10 μM significantly reduced the expression of HSPCs (CD41:gfp + No effect on the total number of cells was observed (Figure 5A).

[0084] As an in vivo model of JAGN1-CN, transgenic jagn1b knockout zebrafish mutant embryos were treated with flavopiridol for 2 days, resulting in increased neutrophil (mpo:gfp) expression to levels similar to those of wild-type controls. + Furthermore, treatment of hax1 knockdown zebrafish mutant embryos (hax1 MO), an in vivo model of hax1-CN, with flavopiridol for 2 days significantly restored the number of neutrophils (mpo:gfp) to levels comparable to those of wild-type controls. + The number of cells was significantly restored (Figure 5C).

[0085] The results obtained in zebrafish models of hax1- or jagn1-associated congenital neutropenia allowed us to cross-validate the results obtained in our in vitro CN-iPSCs or CN HSPCs.

[0086] To investigate the dose-dependent toxic effects of flavopiridol on human primary neutrophils, we performed the RealTime-Glo MT Cell Viability Assay (Promega, #G9711). This assay measures the reduction potential of live cells in an ATP-independent manner, and provides sensitive and rapid response without cell lysis, allowing us to track cell viability over time using the same plate continuously.

[0087] Peripheral blood polymorphonuclear cells (PBPMN)1 from healthy donors were isolated using Ficoll-Paque density gradient medium (density: 1.077 g / mL). Primary human neutrophils from healthy donors were treated with a wide range of flavopiridol concentrations (10 nM to 10 μM). Cell viability was measured in these samples 3, 24, and 48 hours after treatment using a Glomax plate reader according to the manufacturer's protocol.

[0088] No significant differences were observed in the viability of healthy human primary neutrophils treated with 40 nM flavopiridol for 3 h (Figure 6A), 24 h (Figure 6B), or 48 h (Figure 6C) compared with neutrophils treated with 0.1% DMSO.

[0089] To evaluate the effects of flavopiridol on the apoptosis and viability of hematopoietic stem progenitor cells (HSPCs), CD34 cells from healthy donors were used. + HSPCs were treated with DMSO or 40 nM flavopiridol for 48 h and then subjected to Annexin V apoptosis assay and RealTime-Glo MT cell viability assay. + Flavopiridol treatment did not induce apoptosis in HSPCs (Figure 7A). + The survival rate of HSPCs was comparable to that of the DMSO-treated group (Figure 7B). + HSPCs were treated with flavopiridol or DMSO and subjected to in vitro granulocytic liquid culture differentiation (LCD). Annexin V apoptosis assays and RealTime-Glo MT cell viability assays were performed on day 13 of differentiation to compare the two groups. Flavopiridol-treated neutrophils formed in vitro were over 95% viable, with approximately 3% early apoptotic cells and less than 2% late apoptotic cells (similar to the DMSO group) (Figure 7C). RealTime-Glo MT cell viability assays demonstrated improved viability in flavopiridol-treated neutrophils (Figure 7D).

[0090] To examine the functional activity of neutrophils formed by in vitro differentiation in the presence of 40 nM flavopiridol, reactive oxygen species (ROS) assays, chemotaxis assays, and phagocytosis assays were performed. Treatment with flavopiridol did not affect neutrophil function (Figures 7E, 7F, and 7G).

[0091] These data suggest that 40 nM flavopiridol inhibits CD34 + It was shown to be non-toxic to HSPCs and to in vitro differentiated neutrophils.

[0092] Overall, these data define a new application area for CDK2 / 4 / 9 inhibitors (illustratively flavopiridol) in that they can be used to restore granulocyte production in a diverse genetic population of neutropenic patients.

[0093] 3. Conclusion In summary, our findings demonstrate that CDK2 / 4 / 9 inhibitors enhance granulopoiesis in healthy donors but restore granulopoiesis in patients with congenital neutropenia. Based on these results, a new treatment can be established not only for patients with congenital neutropenia but also for all neutropenic patients.

Claims

1. A cyclin-dependent kinase 2 / 4 / 9 (CDK2 / 4 / 9) inhibitor, or a salt thereof, a solvate thereof or a solvate of a salt thereof, for use in the prevention and / or treatment of neutropenia.

2. 2. The CDK2 / 4 / 9 inhibitor of claim 1, selected from the group consisting of flavopiridol (alvocidib), rohitukin, TP-1287, seliciclib (roscovitine / CYC202), dinaciclib (SCH 727965), SNS 032, P276-00, AT7519, voruciclib, CDKI-73, TG02, BAY1143572 (atuveciclib), BAY1251152, AZD4573, i-CDK9, and NVP-2.

3. The CDK2 / 4 / 9 inhibitor according to claim 1 or 2, wherein the neutropenia is selected from the group consisting of congenital neutropenia and / or acquired neutropenia, preferably selected from the group consisting of severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN), chronic neutropenia including idiopathic neutropenia, drug-induced neutropenia, immune-mediated neutropenia, and acute neutropenia induced by chemotherapy and / or radiation.

4. 10. The CDK2 / 4 / 9 inhibitor according to any one of the preceding claims, which is flavopiridol (alvocidib).

5. 10. The CDK2 / 4 / 9 inhibitor according to any one of the preceding claims, used at a dose that results in a plasma concentration after administration to an organism in the range of about 10 to about 300 nM, preferably about 20 to about 200 nM, more preferably about 30 to about 100 nM, and most preferably about 40 nM.

6. 2. The CDK2 / 4 / 9 inhibitor according to any one of the preceding claims, wherein said neutropenia is severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN).

7. 10. The CDK2 / 4 / 9 inhibitor according to any one of the preceding claims, wherein the use is in the prophylaxis and / or treatment of neutropenic patients who are unresponsive to treatment with granulocyte colony-stimulating factor (G-CSF) or who are insufficiently responsive to treatment with G-CSF.

8. The CDK2 / 4 / 9 inhibitor according to claim 7, wherein the G-CSF is recombinant human G-CSF (rhG-CSF).

9. 10. A CDK2 / 4 / 9 inhibitor according to any one of the preceding claims for use in combination with G-CSF.

10. The CDK2 / 4 / 9 inhibitor according to claim 9, wherein the G-CSF is rhG-CSF.

11. A pharmaceutical composition for use in the prevention and / or treatment of neutropenia, comprising the CDK2 / 4 / 9 inhibitor according to any one of claims 1 to 8, or a salt thereof, a solvate thereof, or a solvate of the salt thereof, and a pharmaceutically acceptable carrier.

12. The pharmaceutical composition of claim 11, further comprising G-CSF.

13. The pharmaceutical composition of claim 12, wherein the G-CSF is rhG-CSF.

14. A method for the prophylactic and / or therapeutic treatment of neutropenia in an organism, comprising the step of administering to the organism an effective amount of the CDK2 / 4 / 9 inhibitor according to any one of claims 1 to 8, or a salt thereof, a solvate thereof, or a solvate of the salt thereof, or the pharmaceutical composition according to any one of claims 11 to 13.

Images