Recombinant AAV for gene therapy of Wilson disease

The rAAV-based gene therapy delivers a functional ATP7b gene to treat Wilson disease, addressing the limitations of current treatments by providing sustained expression and reducing copper accumulation in the liver.

JP2026508707APending Publication Date: 2026-03-11SKYLINE THERAPEUTICS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-21
Publication Date
2026-03-11

AI Technical Summary

Technical Problem

Current treatments for Wilson disease, such as chelating agents and drug therapies, have severe side effects and do not provide sustained expression of functional ATP7b, leading to impaired quality of life and progression of neurological or hepatic disease.

Method used

A gene therapy approach using recombinant adeno-associated viruses (rAAV) to deliver a functional ATP7b gene, including a mini-ATP7b polypeptide with an additional Cu-binding site, for sustained expression in target cells.

Benefits of technology

The rAAV-mediated delivery of ATP7b results in significant reduction of liver copper levels and increased serum ceruloplasmin activity, effectively treating Wilson disease with minimal side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026508707000010
    Figure 2026508707000010
  • Figure 2026508707000011
    Figure 2026508707000011
  • Figure 2026508707000012
    Figure 2026508707000012
Patent Text Reader

Abstract

The present invention provides polynucleotides encoding functional copper-transporting ATPases and recombinant AAVs. The present invention also provides methods for treating Wilson's disease, comprising administering the recombinant AAV to a subject in need thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to gene therapy, and in particular to recombinant adeno-associated viruses (AAV) for gene therapy of Wilson's disease. [Background technology]

[0002] Wilson disease (WD) is an autosomal recessive disorder of copper metabolism caused by pathogenic variants in the atp7b gene, which encodes a P-type copper-transporting ATPase. WD results in copper accumulation in many organs, including the liver, central nervous system (CNS), cornea, kidneys, joints, and myocardium, impairing the physiological function of affected organs.

[0003] WD can present with a variety of clinical manifestations, the most common of which are liver disease and neuropsychiatric disorders. WD typically begins with a presymptomatic period during which copper accumulation in the liver causes asymptomatic hepatitis, progressing to cirrhosis and the onset of neuropsychiatric symptoms in the teens or early twenties.

[0004] Currently, WD is generally treated by either i) promoting copper removal using chelating agents such as penicillamine, sodium dimercaptopropionate, triethylene-hydroxyltetramethylamine, and dimethylcaptosuccinic acid, or ii) blocking intestinal copper absorption using, for example, tetrathiomolybdate. However, all of these treatments have serious side effects that lead to treatment discontinuation. For example, up to 31% of patients experience severe side effects with the widely used D-penicillamine (Merle et al. Clinical presentation, diagnosis and long-term outcome of Wilson's disease: a cohort study, Gut., 2007, 56(1):115-120); 10-30% of patients experience a paradoxical worsening of neurological symptoms upon initiating chelator therapy (Ala et al., Wilson's disease, The Lancet, 2007, 369(9559):397-408); up to 45% of patients do not show neurological improvement (Weiss et al., Efficacy and safety of oral chelators in treatment of patients with Wilson disease, Clin Gastroenterol Hepatol, 2013, 11(8):1028-35.e1-2); up to 24% of patients have progression of neurological or hepatic disease despite treatment (Merle et al. al, supra); and up to 13% of patients have had to opt for liver transplantation (Beinhardt et al., Long-term outcomes of patients with Wilson disease in a large Austrian cohort, Clin Gastroenterol Hepatol, 2014, 12(4):683-9). Patients require a lifelong low-copper diet, and drug treatment severely impairs their quality of life.

[0005] Gene therapies are being developed for WD, for example, Ultragenyx is developing an AAV9-based gene therapy for IV injection, and Vivet and Pfizer are developing an AAV3b-based gene therapy for IV injection, both of which are in clinical trials. Summary of the Invention [Problem to be solved by the invention]

[0006] Therefore, new therapies for WD, such as gene therapies, that can provide sustained expression of functional ATP7b at desired levels are needed. [Means for solving the problem]

[0007] To meet this need, the present inventors have developed a gene therapy for WD that provides sustained and endogenous production of ATP7b after transferring a functional ATP7b gene into the patient.

[0008] In a first aspect, the present invention provides a polynucleotide comprising a first segment comprising residues 169 to 3126 of SEQ ID NO: 2, 3, 4, 5 or 6.

[0009] In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5, or 6. In some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO: 8 or residues 169-393 of SEQ ID NO: 10, preferably between the first and second segments. In some embodiments, the polynucleotide further comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, 8, or 10.

[0010] In a second aspect, the present invention provides an expression construct comprising a polynucleotide of the invention operably linked to a promoter, preferably comprising the nucleotide sequence of SEQ ID NO: 13 or 14.

[0011] In some embodiments, the construct further comprises an enhancer, preferably comprising the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the construct further comprises a polyA signal sequence, preferably comprising the nucleotide sequence of SEQ ID NO: 17 or 18. In some embodiments, the construct further comprises an intron, preferably comprising the nucleotide sequence of SEQ ID NO: 15 or 16.

[0012] In a third aspect, the present invention provides a recombinant adeno-associated virus (rAAV) comprising a genome that includes an expression construct of the present invention.

[0013] In some embodiments, the rAAV is hAAV6. In some embodiments, the genome comprises a 5'ITR and a 3'ITR, preferably comprising SEQ ID NOs: 19 and 20, respectively.

[0014] In some embodiments, rAAV is prepared by transforming a host cell with a system containing a transgene plasmid comprising the genome of the rAAV, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid. Accordingly, the present invention further provides a vector comprising the expression construct of the present invention.

[0015] In a fourth aspect, the present invention provides a pharmaceutical composition comprising an rAAV of the present invention.

[0016] In a fifth aspect, the present invention provides a host cell comprising a polynucleotide, expression construct, vector or rAAV of the invention.

[0017] In a sixth aspect, the present invention provides a method for treating a disease associated with defective copper transport, comprising administering to a subject in need thereof an rAAV or pharmaceutical composition of the present invention.

[0018] The invention also provides the use of a polynucleotide, expression construct, vector, rAAV, pharmaceutical composition and / or host cell of the invention in the preparation of a medicament for treating a disease associated with defective copper transport in a subject in need thereof.

[0019] In some embodiments, the disease is Wilson's disease. [Brief explanation of the drawings]

[0020] [Figure 1] 1 shows the structure of the construct for testing codon optimization of miniATP7b. [Figure 2] Maps of the transgene plasmid (A), helper plasmid (B) and packaging plasmids (C and D) are shown. [Figure 3] Western blots for detecting rAAV-mediated mini-ATP7b expression in HepG2 cells are shown, with alpha-tubulin used as a reference. Lanes: NC, no treatment; G2, WT-AAV5; G3, Co1-AAV5; G4, Co2-AAV5; G5, Co3-AAV5; G6, Co4-AAV5; and G7, Co5-AAV5. [Figure 4] Western blot for detecting rAAV-mediated mini-ATP7b expression in the liver of WT mice. Lanes: G1, no treatment; G2, WT-AAV5; G3, Co1-AAV5; G4, Co2-AAV5; G5, Co3-AAV5; G6, Co4-AAV5; and G7, Co5-AAV5. The first and second lanes (from left to right) are a protein ladder and a positive control, respectively. [Figure 5] Expression of mini-ATP7b by rAAV Co3-AAV5 in the liver of ATP7b knockout (KO) mice (FIG. 5A: PC, positive control), and Western blot to detect viral genomes in cells (FIG. 5B) are shown. [Figure 6] Immunohistochemical staining of liver tissue from ATP7b KO mice treated with different doses of rAAV Co3-AAV5 is shown. [Figure 7]Shown is H&E staining of livers from ATP7b KO mice treated with different doses of rAAV Co3-AAV5. [Figure 8] Figure 1 shows the therapeutic efficacy of MBD5-6-AAV5 in 6-week-old male WD mice. Treatment with two different doses of MBD5-6-AAV5 (1E13 and 3E13 vg / kg) resulted in a significant reduction in liver copper levels (left panel) and an increase in serum ceruloplasmin activity (right panel) in a dose-dependent manner. [Figure 9] Western blot for detecting rAAV-mediated mini-ATP7b expression in HepG2 cells, with alpha-tubulin used as a reference. Lanes: 1, MBD3-5-6-AAV5; 2, MBD3T-5-6-AAV5; 3, MBD5-6-AAV5; 4, MBD3-5-6-AAV6; 5, MBD3T-5-6-AAV6; 6, MBD5-6-AAV6; 7, negative control; and C, positive control. [Figure 10] Western blot to detect the expression of mini-ATP7b in the liver of ATP7b KO mice treated with rAAV MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6 is shown. [Figure 11] Immunohistochemical staining of liver tissue from ATP7b KO mice treated with rAAV MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6 is shown. [Figure 12]The therapeutic efficacy of six different rAAVs in 6-week-old male WD mice is shown. After treatment (5E12 vg / kg) with the rAAVs MBD3-5-6-AAV5, MBD3T-5-6-AAV5, MBD5-6-AAV5, MBD3-5-6-AAV6, MBD3T-5-6-AAV6, and MBD5-6-AAV6, significant reductions in liver copper levels (left panel) and increases in serum ceruloplasmin activity (right panel) were observed in all groups at 4 weeks. The efficacy of these potential reductions is comparable to that of the positive control MBD5-6 in both the AAV5- and AAV6-treated groups. [Figure 13] Western blot analysis to detect rAAV-mediated mini-ATP7b expression in HepG2 cells. A, image of the Western blot; B, quantification of the Western blot. Lanes: 1, MBD3-5-6-1-AAV5; 2, MBD3T-5-6-1-AAV5; 3, MBD3T-5-6-2-AAV5; 4, MBD3-5-6-2-AAV5; 5, MBD3T-5-6-3-AAV5; 6, MBD3T-5-6-4-AAV5; 7, MBD3-5-6-3-AAV5; 8, MBD3T-5-6-5-AAV5; 9, MBD3-5-6-AAV5; 10, MBD3T-5-6-AAV5; 11, MBD5-6-AAV5; 12, negative control. [Figure 14] The structure of the copper-responsive reporter (A) and in vitro metallo-responsive element luciferase reporter assay (B) for copper transport activity are shown. Benchmark, MBD5-6-AAV6; #4, MBD3-5-6-2-AAV6; #6, MBD3T-5-6-4-AAV6; #7, MBD3-5-6-3-AAV6. [Figure 15] Shown are the distribution of rAAV in mouse liver (A), the expression of mini-ATP7b by rAAV in mouse liver (B and C), and the resulting reduction of Cu in mouse liver (D) and restoration of ceruloplasmin activity (E). [Figure 16] IHC staining of miniATP7b in livers from mice treated with rAAV (A) and quantification of miniATP7b-positive cells are shown. DETAILED DESCRIPTION OF THE INVENTION

[0021] 1.Definition Unless otherwise indicated, all terms used herein have the same meaning as they would have to one of ordinary skill in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology that are within the knowledge of those skilled in the art.

[0022] As used herein, "ATP7b" belongs to class 1B of the highly conserved P-type ATPase superfamily involved in the transport of copper and other heavy metals across cell membranes.

[0023] Adeno-associated virus (AAV) is a member of the parvovirus family. It is a simple single-stranded DNA virus that requires a helper virus (such as adenovirus) for replication. The wild-type AAV genome contains approximately 4.7 kilobases (kb) and is approximately 145 nucleotides long, with two inverted terminal repeat (ITR) sequences, cap and rep, between which there is an interrupted palindromic sequence that can fold into a hairpin structure that functions as a primer during the initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in AAV replication and integration. AAV can infect a variety of cells, and viral DNA can integrate into human chromosome 19 in the presence of the rep product.

[0024] As used herein, the term "inverted terminal repeat" or "ITR" refers to AAV viral cis elements designated by their symmetry. These elements are essential for efficient propagation of the AAV genome. In the present invention, the term "ITR" refers to ITRs of known natural AAV serotypes, as opposed to chimeric ITRs formed by the fusion of ITR elements from different serotypes and their functional variants.

[0025] The production of recombinant AAV particles can involve three plasmids: a transgene plasmid containing an expression construct for expressing an exogenous polynucleotide, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid.

[0026] As used herein, the term "expression construct" means a single- or double-stranded polynucleotide that is isolated from a naturally occurring gene or that has been modified to contain a non-naturally occurring nucleic acid segment. Expression constructs may contain the control sequences necessary to express a coding sequence of the present invention.

[0027] As used herein, the term "polynucleotide" generally refers to nucleic acid molecules (e.g., 100 bases and up to 30 kilobases in length) and sequences that are either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or untranscribed.

[0028] As used herein, the term "exogenous polynucleotide" refers to a nucleotide sequence that is not derived from the host in which it is placed. It may be identical to or heterologous to the host's DNA. An example is a sequence of interest inserted into a vector. Such foreign DNA sequences may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences encoding antisense oligonucleotides.

[0029] As used herein, the term "expression" includes any step involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0030] "Control sequences" include all elements necessary or advantageous for expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide, or native or foreign to each other. Such control sequences include, but are not limited to, a leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for ending transcription and translation.

[0031] For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by a host cell and directing expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences that mediate expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the host cell of choice, for example, the lac operon of E. coli. Promoters also include mutant, modified, and hybrid promoters and may be obtained from genes encoding extracellular or intracellular polypeptides, either homologous or heterologous to the host cell.

[0032] Optionally, introns can be included in the construct to improve expression of the coding sequence. A "modified" intron contains a modification such as a substitution, insertion or deletion of one or more nucleotides in the internal region of the initial intron.

[0033] As used herein, the term "operably linked" means that a control sequence is positioned in appropriate relation to the coding sequence of a polynucleotide sequence so that the control sequence directs expression of the polypeptide coding sequence.

[0034] A polynucleotide encoding an ATP7b protein can be subjected to various manipulations to improve expression of the polypeptide. Prior to inserting the polynucleotide into a vector, it may be desirable or necessary to manipulate the polynucleotide according to the expression vector or host, such as codon optimization.

[0035] As used herein, the term "recombinant" refers to a nucleic acid, vector, polypeptide, or protein that is produced using recombinant DNA (clonal) methods and is distinguishable from a native or wild-type nucleic acid, vector, polypeptide, or protein.

[0036] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acids, including full-length proteins and fragments thereof.

[0037] As used herein, the term "host cell" refers to, for example, microorganisms, yeast cells, insect cells, and mammalian cells that can be or have been used as recipients of rAAV vectors. The term includes the progeny of the original cell that has been transduced. Thus, as used herein, the term "host cell" generally refers to a cell that has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parent cell may not necessarily be completely identical in morphology or genomic or total DNA complement to the original parent due to natural, accidental, or deliberate mutation.

[0038] As used herein, the term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not normally produce toxicity or allergic or similar side effects such as stomach upset, dizziness, etc. when administered to humans.

[0039] As used herein, the term "subject" includes, but is not limited to, non-human primates such as humans, chimpanzees, and other ape and monkey species; livestock such as cows, sheep, pigs, goats, and horses; domestic animals such as dogs and cats; and laboratory animals, including rodents such as mice, rats, and guinea pigs. The term does not denote a particular age or sex. Thus, it is intended to encompass adult and newborn subjects and fetuses, regardless of gender.

[0040] 2. Mini-ATP7b Polypeptide Gene therapy aims to correct the defective gene underlying the onset of disease, introduce an exogenous gene into the target cells of a subject, and express the product of the exogenous gene, which is useful for treating a specific disease, such as Wilson's disease. A common approach for this purpose involves delivering a functional gene, such as atp7b, to the nucleus. This gene can then be inserted into the genome of the target cell or remain episomal. Delivering a functional gene to the target cell of a subject can be carried out by many methods, including the use of viral vectors. Among the many available viral vectors (e.g., retroviruses, lentiviruses, adenoviruses, etc.), AAV has become increasingly popular as a multifunctional vector in gene therapy.

[0041] Vectors derived from AAV are particularly attractive for delivering genetic material because (i) they can infect (transduce) a variety of non-dividing and dividing cell types, including muscle fibers and neurons; (ii) they lack viral structural genes, thereby eliminating natural host cell responses to viral infection, such as interferon-mediated responses; (iii) wild-type viruses are not associated with any pathologies in humans; (iv) in contrast to wild-type AAV, which can integrate into host cell genomes, replication-deficient AAV vectors generally persist episomally, thus limiting the risk of insertional mutagenesis or activation of oncogenes; and (v) in contrast to other vector systems, AAV vectors do not trigger significant immune responses (see ii), thus conferring long-term expression of therapeutic transgenes (provided their gene products are not rejected). AAV vectors can be produced at high titers, and have been reported to enable gene transfer to critical muscle regions in rodents via a single intra-arterial, intravenous, or intraperitoneal injection. However, the small size of the AAV genome limits the length of the gene delivered by rAAV.

[0042] ATP7B is encoded by a large gene; for example, the human gene has 150 kb of genomic DNA, resulting in a cDNA of approximately 4.4 kb in length. Therefore, it is generally not possible to deliver a polynucleotide encoding full-length ATP7b with rAAV.

[0043] The 165-kD protein contains 1,465 amino acids organized from the N- to C-terminus into a phosphatase domain (PD), a phosphorylation domain, and eight transmembrane ion channels that span the phospholipid bilayer of the plasma membrane. The copper (Cu)-binding domain consists of six copper-binding sites (referred to as sites 1, 2, 3, 4, 5, and 6, respectively, numbered N- to C-terminus), which play a central role in receiving Cu from the copper transport protein ATOX1 via protein-protein interactions.

[0044] It has been found that ATP7b can also function when one or several copper-binding sites are removed, leaving sites 5 and 6, resulting in a smaller size that allows delivery by rAAV. Such modified ATP7b contains a distal N-terminus, a modified Cu-binding domain, a transmembrane ion channel, a phosphorylation domain, and a PD and is termed "mini-ATP7b," which can be more specifically named using the copper-binding sites contained therein.

[0045] For example, it has been reported that removal of sites 1 to 4 on mini-ATP7b derived from human ATP7 can affect copper transport. Such mini-ATP7b contains a Cu-binding domain (SEQ ID NO: 7) that includes only sites 5 and 6, and is referred to herein as MBD5-6.

[0046] We believe that the introduction of an additional Cu-binding site may improve the function of miniATP7b.

[0047] Thus, the present invention provides a mini-ATP7b polypeptide that comprises an additional Cu-binding site inserted at the N-terminus of the Cu-binding domain.

[0048] Mini-ATP7b may be derived from any animal species, including, but not limited to, non-human primates such as humans, chimpanzees and other ape and monkey species; livestock such as cows, sheep, pigs, goats and horses; domestic animals such as dogs and cats; and laboratory animals, including rodents such as mice, rats and guinea pigs.

[0049] In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b of the present invention comprises an additional Cu-binding site inserted between residues 56 and 57 of SEQ ID NO:7. In some embodiments, the additional Cu-binding site is site 3 of ATP7b (referred to as MBD3-5-6), e.g., having an amino acid sequence comprising residues 57-165 of SEQ ID NO:9. In some embodiments, the additional Cu-binding site is truncated site 3 of ATP7b (referred to as MBD3T-5-6), e.g., having an amino acid sequence comprising residues 57-131 of SEQ ID NO:11.

[0050] In some embodiments, mini-ATP7b comprises the amino acid sequence of SEQ ID NO:9 or 10 or an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:9 or 11, and comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9 or 11.

[0051] 3. Polynucleotides or constructs for expressing miniATP7b The present invention therefore contemplates providing a polynucleotide, an expression construct, or a vector comprising a polynucleotide or expression construct, for expressing ATP7b in a subject.

[0052] In some embodiments, the polynucleotide encoding ATP7b is codon-optimized to improve expression.

[0053] In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5, or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5, or 6.

[0054] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, 3, 4, 5 or 6.

[0055] In some embodiments, the polynucleotide comprises SEQ ID NO:2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes the polypeptide of SEQ ID NO:7.

[0056] In some embodiments, the polynucleotide comprises SEQ ID NO:3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes the polypeptide of SEQ ID NO:7.

[0057] In some embodiments, the polynucleotide comprises SEQ ID NO:4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes the polypeptide of SEQ ID NO:7.

[0058] In some embodiments, the polynucleotide comprises SEQ ID NO:5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes the polypeptide of SEQ ID NO:7.

[0059] In some embodiments, the polynucleotide comprises SEQ ID NO:6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes the polypeptide of SEQ ID NO:7.

[0060] Surprisingly, the present inventors have found that polynucleotides comprising SEQ ID NO: 2, 4 or 6 achieve higher miniATP7b expression in cells and mice than SEQ ID NO: 1.

[0061] The present inventors believe that the introduction of an additional Cu-binding site may improve the function of mini-ATP7b. Thus, in some embodiments, the polynucleotide further comprises a third segment comprising residues 169-495 of SEQ ID NO:8 or residues 169-393 of SEQ ID NO:10, preferably between the first and second segments.

[0062] In some embodiments, the polynucleotide comprises SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes the polypeptide of SEQ ID NO:9.

[0063] In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 11.

[0064] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2.

[0065] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6.

[0066] The present invention also provides an expression construct for expressing mini-ATP7b, comprising a polynucleotide encoding mini-ATP7b operably linked to a promoter. In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b comprises the amino acid sequence of SEQ ID NO: 7, 9, or 11.

[0067] In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5, or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5, or 6.

[0068] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, 3, 4, 5 or 6.

[0069] In some embodiments, the polynucleotide comprises SEQ ID NO:2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes the polypeptide of SEQ ID NO:7.

[0070] In some embodiments, the polynucleotide comprises SEQ ID NO:3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes the polypeptide of SEQ ID NO:7.

[0071] In some embodiments, the polynucleotide comprises SEQ ID NO:4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes the polypeptide of SEQ ID NO:7.

[0072] In some embodiments, the polynucleotide comprises SEQ ID NO:5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes the polypeptide of SEQ ID NO:7.

[0073] In some embodiments, the polynucleotide comprises SEQ ID NO:6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes the polypeptide of SEQ ID NO:7.

[0074] Surprisingly, the present inventors have found that polynucleotides comprising SEQ ID NO: 2, 4 or 6 achieve higher miniATP7b expression in cells and mice than SEQ ID NO: 1.

[0075] In some embodiments, the polynucleotide further comprises a third segment comprising residues 169 to 495 of SEQ ID NO:8 or residues 169 to 393 of SEQ ID NO:10, preferably between the first and second segments.

[0076] In some embodiments, the polynucleotide comprises SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes the polypeptide of SEQ ID NO:9.

[0077] In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 11.

[0078] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2.

[0079] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6.

[0080] The constructs are generally transferred into mammalian cells (such as human cells) for expression. Such constructs often contain promoter-enhancers for high-level expression, such as the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter, and the Rous sarcoma virus (RSV) long terminal repeat. These promoter-enhancers are active in many cell types. Tissue and cell type promoter and enhancer regions can also be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those derived from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha-fetoprotein, alpha-1 antitrypsin, beta-globin, myelin basic protein, myosin light chain 2, and gonadotropin-releasing hormone genes.

[0081] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises SEQ ID NO: 13 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13. In some embodiments, the promoter comprises SEQ ID NO: 14 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14.

[0082] In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer comprises SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12.

[0083] It may also be desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding miniATP7b. In some embodiments, the intron is downstream of the promoter. In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 15 or 16.

[0084] The expression construct further comprises a polyadenylation signal for processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal sequence downstream of the nucleotide sequence encoding miniATP7b. In some embodiments, the polyadenylation signal sequence comprises SEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0085] In some embodiments, the expression construct comprises, in 5' to 3' order, an enhancer, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD5-6 of SEQ ID NO: 7), and a polyadenylation signal sequence.

[0086] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0087] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0088] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0089] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0090] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0091] Incorporation of additional Cu-binding sites would result in a larger size, which may make the construct less suitable for delivery by rAAV. The inventors surprisingly found that upon optimization of the regulatory sequences, it is possible to achieve the desired expression of larger mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6) even without one of the elements, such as enhancers or introns.

[0092] In some embodiments, the expression construct comprises, in 5' to 3' order, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NOs: 9 and 11, respectively), and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an enhancer.

[0093] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO:17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:17.

[0094] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO:18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:18.

[0095] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO:17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:17.

[0096] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO:18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:18.

[0097] In some embodiments, the expression construct comprises, in 5' to 3' order, an enhancer, a promoter, a polynucleotide of interest encoding miniATP7b (MBD3-5-6 and MBD3T-5-6 of SEQ ID NOs: 9 and 11, respectively), and a polyadenylation signal sequence. In some embodiments, the expression construct does not contain an intron.

[0098] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0099] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0100] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:17.

[0101] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:17.

[0102] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:18.

[0103] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:18.

[0104] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 18.

[0105] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 18.

[0106] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 18.

[0107] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 18.

[0108] 4. Recombinant AAV, Pharmaceutical Compositions and Host Cells The present invention further provides a recombinant AAV (rAAV) comprising a genome comprising an expression construct of the invention. In some embodiments, the expression construct is flanked by 5' and 3' inverted terminal repeats (ITRs) of an AAV.

[0109] In some embodiments, the rAAV of the present invention can be selected from human serotype 1 AAV (hAAV1), hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10, and hAAV11. In some embodiments, the rAAV is hAAV5. In some embodiments, the rAAV is hAAV6.

[0110] In some embodiments, the genome of the rAAV comprises an expression construct flanked by the 5' and 3' ITRs of AAV.

[0111] In some embodiments, the expression construct comprises a polynucleotide encoding mini-ATP7b operably linked to a promoter. In some embodiments, the mini-ATP7b is derived from human ATP7b. In some embodiments, the mini-ATP7b comprises the amino acid sequence of SEQ ID NO: 7, 9, or 11.

[0112] In some embodiments, the polynucleotide comprises a first segment comprising residues 169-3126 of SEQ ID NO: 2, 3, 4, 5, or 6. In some embodiments, the polynucleotide further comprises a second segment comprising residues 1-168 of SEQ ID NO: 2, 3, 4, 5, or 6.

[0113] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2, 3, 4, 5 or 6, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, 3, 4, 5 or 6.

[0114] In some embodiments, the polynucleotide comprises SEQ ID NO:2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 and encodes the polypeptide of SEQ ID NO:7.

[0115] In some embodiments, the polynucleotide comprises SEQ ID NO:3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and encodes the polypeptide of SEQ ID NO:7.

[0116] In some embodiments, the polynucleotide comprises SEQ ID NO:4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and encodes the polypeptide of SEQ ID NO:7.

[0117] In some embodiments, the polynucleotide comprises SEQ ID NO:5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and encodes the polypeptide of SEQ ID NO:7.

[0118] In some embodiments, the polynucleotide comprises SEQ ID NO:6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 and encodes the polypeptide of SEQ ID NO:7.

[0119] Surprisingly, the present inventors have found that polynucleotides comprising SEQ ID NO: 2, 4 or 6 achieve higher miniATP7b expression in cells and mice than SEQ ID NO: 1.

[0120] In some embodiments, the polynucleotide further comprises a third segment comprising residues 169 to 495 of SEQ ID NO:8 or residues 169 to 393 of SEQ ID NO:10, preferably between the first and second segments.

[0121] In some embodiments, the polynucleotide comprises SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 and encodes the polypeptide of SEQ ID NO:9.

[0122] In some embodiments, the polynucleotide comprises SEQ ID NO: 10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and encodes the polypeptide of SEQ ID NO: 11.

[0123] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:2, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:2.

[0124] In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6. In some embodiments, the polynucleotide comprises, from 5' to 3', residues 1-168 of SEQ ID NO:6, residues 169-495 of SEQ ID NO:8, and residues 169-3126 of SEQ ID NO:6.

[0125] The constructs are generally transferred into mammalian cells (such as human cells) for expression. Such constructs often contain promoter-enhancers for high-level expression, such as the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter, and the Rous sarcoma virus (RSV) long terminal repeat. These promoter-enhancers are active in many cell types. Tissue and cell type promoter and enhancer regions can also be used for expression. Exemplary promoter / enhancer regions include, but are not limited to, those derived from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha-fetoprotein, alpha-1 antitrypsin, beta-globin, myelin basic protein, myosin light chain 2, and gonadotropin-releasing hormone genes.

[0126] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter comprises SEQ ID NO: 13 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13. In some embodiments, the promoter comprises SEQ ID NO: 14 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14.

[0127] In some embodiments, the expression construct further comprises an enhancer. In some embodiments, the enhancer is upstream of the promoter. In some embodiments, the enhancer comprises SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12.

[0128] It may also be desirable to include an intron (e.g., an intron derived from a eukaryotic organism or an artificial intron) in the construct to increase expression in eukaryotic cells. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is upstream of the nucleotide sequence encoding miniATP7b. In some embodiments, the intron is downstream of the promoter. In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 15 or 16.

[0129] The expression construct further comprises a polyadenylation signal for processing of the transcript. In some embodiments, the construct comprises a polyadenylation signal sequence downstream of the nucleotide sequence encoding miniATP7b. In some embodiments, the polyadenylation signal comprises SEQ ID NO: 17 or 18, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0130] In some embodiments, the expression construct comprises, in 5' to 3' order, an enhancer, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD5-6 of SEQ ID NO: 7), and a polyadenylation signal sequence.

[0131] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:2 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0132] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:3 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0133] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:4 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0134] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:5 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0135] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO: 15 or 16, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15 or 16; SEQ ID NO:6 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:7, and more preferably encoding SEQ ID NO:7); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0136] Incorporation of additional Cu-binding sites would result in a larger size, which may make the construct less suitable for delivery by rAAV. The inventors surprisingly found that upon optimization of the regulatory sequences, it is possible to achieve the desired expression of larger mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6) even without one of the elements, such as enhancers or introns.

[0137] In some embodiments, the expression construct comprises, in 5' to 3' order, a promoter, an intron, a polynucleotide of interest encoding mini-ATP7b (such as MBD3-5-6 and MBD3T-5-6 of SEQ ID NOs: 9 and 11, respectively), and a polyadenylation signal sequence. In some embodiments, the expression construct does not comprise an enhancer.

[0138] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO:17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:17.

[0139] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO:18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:18.

[0140] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO:17, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:17.

[0141] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14; SEQ ID NO: 15, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO:18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:18.

[0142] In some embodiments, the expression construct comprises, in 5' to 3' order, an enhancer, a promoter, a polynucleotide of interest encoding miniATP7b (MBD3-5-6 and MBD3T-5-6 of SEQ ID NOs: 9 and 11, respectively), and a polyadenylation signal sequence. In some embodiments, the expression construct does not contain an intron.

[0143] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO:12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO:8 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:8 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:9, and more preferably encoding SEQ ID NO:9); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0144] In some embodiments, the expression construct comprises, in 5' to 3' order: SEQ ID NO: 12 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 12; SEQ ID NO: 13 or 14, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13 or 14; SEQ ID NO:10 or a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10 (preferably encoding a functional mini-ATP7b polypeptide, such as a mini-ATP7b polypeptide having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more of the Cu transport capacity of the polypeptide of SEQ ID NO:11, and more preferably encoding SEQ ID NO:11); SEQ ID NO: 17 or 18, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17 or 18.

[0145] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:17.

[0146] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:17.

[0147] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:18.

[0148] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, and SEQ ID NO:18. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, and SEQ ID NO:18.

[0149] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, and SEQ ID NO: 18.

[0150] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, and SEQ ID NO: 18.

[0151] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, and SEQ ID NO: 18.

[0152] In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 17. In some embodiments, the expression construct comprises, in 5' to 3' order, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, and SEQ ID NO: 18.

[0153] The present invention also provides methods for preparing rAAV. In some embodiments, the rAAV is prepared using a system containing a transgene plasmid comprising the rAAV genome, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid, for example, a host cell such as a mammalian cell containing a transgene plasmid comprising the rAAV genome, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid. Accordingly, the present invention also provides vectors such as plasmids comprising the genome of the rAAV of the present invention.

[0154] In some embodiments, rAAV can be packaged as described in Crosson SM et al.

[12] .

[0155] The present invention further provides a vector comprising an rAAV genome, wherein the rAAV genome comprises an expression construct of the present invention flanked by 5' and 3' ITRs. In some embodiments, the vector is a transgene plasmid for packaging the rAAV. In some embodiments, the 5' ITR comprises SEQ ID NO: 19. In some embodiments, the 3' ITR comprises SEQ ID NO: 20.

[0156] In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, SEQ ID NO:17, and SEQ ID NO:20.

[0157] In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, SEQ ID NO:17, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, SEQ ID NO:17, and SEQ ID NO:20.

[0158] In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:2, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:3, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:4, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:5, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:6, SEQ ID NO:18, and SEQ ID NO:20.

[0159] In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:2, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:3, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:5, SEQ ID NO:18, and SEQ ID NO:20. In some embodiments, the genome of an rAAV comprises, in 5' to 3' order, SEQ ID NO:19, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:6, SEQ ID NO:18, and SEQ ID NO:20.

[0160] In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, SEQ ID NO: 17, and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 8, SEQ ID NO: 18, and SEQ ID NO: 20.

[0161] In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, SEQ ID NO: 17, and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 10, SEQ ID NO: 18, and SEQ ID NO: 20.

[0162] In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, SEQ ID NO: 17, and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 8, SEQ ID NO: 18, and SEQ ID NO: 20.

[0163] In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, SEQ ID NO: 17, and SEQ ID NO: 20. In some embodiments, the genome of the rAAV comprises, in 5' to 3' order, SEQ ID NO: 19, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 10, SEQ ID NO: 18, and SEQ ID NO: 20.

[0164] The present invention also provides pharmaceutical compositions comprising rAAV. Pharmaceutical compositions containing the AAV of the present invention can be formulated in any conventional manner by mixing a selected amount of rAAV with one or more pharmaceutically acceptable carriers or excipients.

[0165] The choice of carrier or excipient is within the skill of the administration specialist and can depend on a number of parameters, including, for example, the mode of administration (i.e., systemic, oral, local, topical, or any other mode) and the disease being treated. Pharmaceutical carriers or vehicles suitable for administration of the rAAV provided herein include any such carriers known to those of skill in the art to be suitable for the particular mode of administration.

[0166] In some embodiments, the pharmaceutical composition is formulated for parenteral administration, e.g., intravenous, intramuscular, or subcutaneous injection. In some embodiments, the pharmaceutical composition is formulated for topical administration.

[0167] The present inventors have discovered that the pharmaceutical composition of the present invention can achieve a desired safety profile when administered, for example, by intravenous injection.

[0168] The present invention further provides host cells comprising the polynucleotides, expression constructs and / or vectors of the invention. In some embodiments, the host cells are mammalian cells, such as human cells. In some embodiments, the host cells are 293-VPC cells.

[0169] 5. Treatment of diseases The present invention provides methods for treating a disease associated with ATP7b deficiency, comprising administering to a subject in need thereof an rAAV or pharmaceutical composition of the present invention. In some embodiments, the disease is Wilson's disease. In some embodiments, the rAAV or pharmaceutical composition is administered by intravenous injection.

[0170] The present invention further provides use of a polynucleotide, expression construct, rAAV, pharmaceutical composition, vector, or host cell of the present invention in the preparation of a medicament for treating a disease associated with ATP7b deficiency in a subject in need thereof. In some embodiments, the disease is Wilson's disease. In some embodiments, the medicament is administered by intravenous injection.

[0171] The rAAV and / or pharmaceutical composition of the present invention is provided for use in treating a disease associated with ATP7b deficiency in a subject in need thereof. In some embodiments, the disease is Wilson's disease. In some embodiments, the rAAV and / or pharmaceutical composition is administered by intravenous injection.

[0172] In some embodiments, the treatment increases Cu transport in the subject. In some embodiments, the treatment increases Cu transport in the liver and / or central nervous system. In some embodiments, the treatment reduces neuronal death.

[0173] In some embodiments, the subject is a human.

[0174] In some embodiments, treatment cures, ameliorates, reduces, blocks or partially blocks the symptoms of Wilson's disease. [Example]

[0175] The following examples are provided for illustrative purposes only and are not intended to limit the present application in any way.

[0176] Example 1. Preparation of rAAV Six constructs containing rAAV genomes containing the codon-optimized coding sequence for miniATP7b were prepared by Gibson assembly of the ApoE enhancer (SEQ ID NO: 12), hAAT promoter (SEQ ID NO: 13), chimeric intron (SEQ ID NO: 15), coding sequence (one of the codon-optimized sequences of SEQ ID NOs: 2-6 or the non-optimized sequence of SEQ ID NO: 1), rabbit globin poly(A) signal sequence (SEQ ID NO: 17), and ITRs (SEQ ID NOs: 19 and 20) in the pGCB108 plasmid backbone. The structures of the constructs are shown in Figure 1. The transgene plasmids are designated WT, Co1, Co2, Co3, Co4, and Co5 (SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively), and maps of the transgene plasmids are shown in Figure 2A.

[0177] rAAV vectors were prepared in a similar manner to that described in Crosson SM et al. 2018. Briefly, 293VPC cells (Thermo, Catalog A35347) were transfected in triplicate at 3E6 cells / ml in serum-free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) using polyethyleneimine with the following helper plasmids, packaging plasmids encoding rep / cap, and transgene plasmids: - a helper plasmid ("pHelper" containing the Ad E2A, E4 and VA RNA helper genes as described in Crosson Sm et al., the map of which is shown in Figure 2B); - a packaging plasmid (a map of which is shown in Figure 2C) in which "AAV5 Cap" is a nucleotide sequence encoding the Cap polypeptide of AAV5 (SEQ ID NO: 21) and "AAV2 Rep" is a nucleotide sequence encoding the Rep polypeptide of AAV2 (SEQ ID NO: 22); -Transgene plasmid, constructed as above.

[0178] After 72 hours of incubation at 37°C, cells were harvested and viral particles were purified through an iodixanol gradient (see Crosson SM et al.).

[0179] The resulting rAAVs were designated with the transgene plasmid and serotype (i.e., WT-AAV5, Co1-AAV5, Co2-AAV5, Co3-AAV5, Co4-AAV5, and Co5-AAV5) and titered by ddPCR, all 10 13 The levels were viral genomes (vg) / mL. Specifically, ddPCR was performed using a Bio-Rad QXDx AutoDG ddPCR system and a QXDx Universal Kit for the AutoDG ddPCR system according to the manufacturer's instructions. The primers and probes for ddPCR were as follows:

[0180] [Table 1]

[0181] Example 2. Expression of mini-ATP7b by rAAV This example was carried out to verify the expression of ATP7b contained in the rAAV prepared in Example 1, and the results showed increased expression of mini-ATP7b in rAAV containing a codon-optimized coding sequence for mini-ATP7b of the present invention.

[0182] HepG2 cells were infected with the rAAV prepared in Example 1 at an MOI of 5E4 for 48 hours at 37°C.

[0183] Infected cells were lysed with M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Cat. No. 78501). Equal amounts of lysate (10 μg) were loaded onto SDS-PAGE gels and run at 200 V for 22 minutes. Proteins were transferred to PVDF membranes using an iBlot® 2 Gel Transfer Apparatus (Thermo Fisher Scientific) and an iBlot® 2 Transfer Stack (PVDF, regular size) according to the manufacturer's instructions. After incubation in blocking buffer (8% milk in 1x TBST) for 1 hour and three washes (1 min / wash), the membrane was probed with the primary rabbit ATP7B polyclonal antibody (1:1000, Invitrogen, catalog no. PA5-122222) in the same buffer at 4°C, followed by three washes (1 min / wash) and then incubation with IRDye® 800CW donkey anti-rabbit IgG (H+L) (Licor, P / N: 926-32213) for 2 hours at RT. α-Tubulin served as a housekeeping control to quantify the relative expression of ATP7b. The immunoreactivity was visualized using a Licor Odyssey® DLx imaging system. Image acquisition, organization, and analysis were performed on scanned images using Empiria Studio® software paired with the Odyssey DLx Imager. Images of the Western blots are shown in Figure 3.

[0184] The viral genomes in the samples were measured as described in Example 1, and the relative expression of miniATP7b to viral genomes per cell (Vg / cell, calculated using housekeeping genes according to cell normalization) is shown in Table 1.

[0185] [Table 2]

[0186] As shown in Figure 3 and Table 1, codon optimization indeed worked, and rAAVs containing the coding sequences of SEQ ID NO: 2, 4, or 6 (rAAVs Co1-AAV5, Co3-AAV5, and Co5-AAV5) showed higher relative expression than non-optimized coding sequences, and approximately 2- to 2.5-fold higher than rAAV containing SEQ ID NO: 1 (WT-AAV5).

[0187] Example 3. In vivo expression of mini-ATP7b by rAAV in WT mice This example was performed to evaluate the in vivo expression of mini-ATP7b by the rAAV prepared in Example 1.

[0188] rAAV in DPBS was injected into C57BL / 6 mice (6-8 weeks old) at a single IV dose of 1E13 vg / kg, while mice injected with DPBS served as controls (200 µL / mouse, n = 6, 3 males + 3 females). Livers of mice were collected 28 days after injection to assess mini-ATP7b protein levels.

[0189] Liver tissue was lysed with T-PER™ Tissue Protein Extraction Reagent (Thermo, Catalog No. 78510), and 100 μl of T-per containing proteinase inhibitor (Pierce™ Protease Inhibitor Minitablets, EDTA-free, Catalog No. A32955) was added to the frozen tissue, followed by following the instructions for Catalog No. 78510. 50 μg of tissue lysate was loaded for SDS-PAGE and subsequent Western blot analysis as described in Example 2. The results are shown in Figure 4 and Table 2.

[0190] [Table 3]

[0191] The viral genome (VG) in the tissue lysates was measured as described in Example 1, and the relative expression of miniATP7b to VG is shown in Table 3.

[0192] [Table 4]

[0193] It can be seen that rAAVs containing the coding sequence of SEQ ID NO: 2, 4 or 6 (rAAVs Co1-AAV5, Co3-AAV5 and Co5-AAV5) showed higher relative expression than the non-optimized coding sequence (rAAVs WT-AAV5), with Co3-AAV5 achieving higher expression both in vitro and in vivo.

[0194] Example 4. In vivo expression of mini-ATP7b by rAAV in a WD model This example was carried out to examine the expression level of mini-ATP7b by rAAV in ATP7b knockout (KO) mice (WD model, Atp7b − / − ).

[0195] The Atp7b- / - mouse model used in this study was developed by Buiakova et al. Ten 129S6 / SvEv Atp7b- / - males were mated with C57BL / 6J wild-type females, followed by embryo transfer into recipient female mice. Atp7b+ / - heterozygous mice (maintained on a mixed 129S6 / SvEv × C57BL / 6J genetic background) were bred at the Shanghai Model Organisms Center, Inc. and used to generate Atp7b- / - and Atp7b+ / + mice. Atp7b- / - mice were generated by breeding and genotyping according to a protocol approved by the Ethics Committee of the Veterinary Authority of the Shanghai Ministry of Public Health.

[0196] Male ATP7b KO mice (7 weeks old) were injected with rAAV Co3-AAV5 at a single IV dose of 1E13 or 3E13 vg / kg in 200 μl of DPBS (n=10), and mice injected with 200 μl of DPBS served as controls (n=5).

[0197] Blood was collected on the day of injection and 28 days after injection. Liver tissue was collected from the injected mice 28 days after injection, and mini-ATP7b protein levels were evaluated by Western blot analysis similar to that described in Example 2, with mini-ATP7b overexpressed cell lysate as a positive control and GAPDH as a standard.

[0198] As shown in Figure 5, ATP7b KO mice injected with rAAV Co3-AAV5 showed dose-dependent ATP7b expression in the liver.

[0199] Liver samples were also stained for ATP7b by IHC and H&E stained to detect inflammation. Liver samples were also tested for copper accumulation. The copper content in the samples was determined by inductively coupled plasma (Agilent ICP-OES 730). Samples were prepared according to the manufacturer's instructions. Briefly, tissue pieces (e.g., liver) were weighed and digested in HNO3 and H2O2 at 180°C. The digested samples were diluted with deionized water and measured directly by ICP.

[0200] Immunohistochemical staining (IHC) was performed using the IHC Automatic Staining System (Leica Bond RX) with standard protocols for paraffin sections. Slides were dewaxed, followed by antigen inactivation with ER2 (AR9640, Leica) at 100°C for 20 minutes. Slides were rinsed and blocked with peroxide at room temperature for 5 minutes. The slides were then washed with wash buffer (Leica) for 30 seconds, which was repeated four times. Diluted primary antibody (anti-ATP7b, ab124973, Abcam) was added to each slide and then incubated for 40 minutes at room temperature. Slides were washed with wash buffer (Leica) and then incubated with polymer (Leica) for 8 minutes at room temperature. Slides were washed and incubated with DAB solution for 10 minutes at room temperature. Slides were rinsed with water and counterstained with hematoxylin for 10 minutes. Finally, the mounted slides were scanned with a slide scanner (Aperio GT450 DX, Leica).

[0201] H&E staining was performed using a Leica Automatic Staining System ST5010 according to standard protocols. Slides were mounted using the Leica Cover Slip System (Leica CV5030). Images were acquired using a slide scanner (Aperio GT450 DX, Leica).

[0202] Serum was separated from blood samples, and ceruloplasmin was detected in the serum. Briefly, serum proteins were precipitated by adding 100 μl of saturated ammonium sulfate solution (approximately 4.1 M) to 100 μl of serum. The supernatant was removed after centrifugation at 10,000 rpm for 5 minutes at room temperature. The pellet was resuspended in 160 μl of 0.1 M sodium acetate buffer (pH 5.0) and transferred to a non-binding transparent 96-well plate. 20 μl of the suspension was mixed with 80 μl of dimethoxybenzidine dihydrochloride (o-dianisidine; TCI) solution to a final o-dianisidine concentration of 2.5 mg / ml. The mixture was incubated for 90 minutes at 30°C, and then stopped by adding 50 μl of 9 M sulfuric acid. The absorbance at 540 nm was measured within 20 minutes of the end point.

[0203] As shown in Figure 6, AAV5 transduced hepatocytes in ATP7b KO mice, and human ATP7b protein was widely expressed in hepatocytes in a dose-dependent manner.

[0204] As shown in Figure 7, no inflammation was observed at either dose.

[0205] As shown in Figure 8, expression of mini-ATP7b in the liver alleviated hepatic copper accumulation and restored serum ceruloplasmin activity.

[0206] Example 5. Design and testing of new ATP7b variants This example was carried out to test new ATP7b variants in vitro and in vivo.

[0207] Transgene plasmids were constructed as described in Example 1 using modified coding sequences relative to SEQ ID NO:8 or 10 (referred to as MBD3-5-6 and MBD3T-5-6). rAAV was prepared using the above transgene plasmids as described in Example 1. In addition, transgene plasmids Co3 (also referred to hereafter as MBD5-6), MBD3-5-6, and MBD3T-5-6 were also used to prepare rAAV using a similar method in which the packaging plasmid encoded the AAV6 capsid (SEQ ID NO:23; see Figure 2D). The resulting rAAVs are shown in Table 4.

[0208] [Table 5]

[0209] As described in Example 2, HepG2 cells were infected with the rAAVs listed in Table 4 and tested for ATP7b expression.

[0210] As shown in Figure 9, AAV6 rAAV showed higher expression of ATP7b than AAV5 rAAV, and rAAV containing SEQ ID NO: 8 or 10 showed lower expression of ATP7b than those containing SEQ ID NO: 4.

[0211] rAAV was also injected into male ATP7b KO mice at a dose of 3E13vg / kg in 200µL of DPBS (n=10), and mice injected with 200µL of DPBS served as controls (n=5). ATP7b expression and copper accumulation in the liver were detected as described in Example 4. The results are shown in Figures 10-12 and Table 5.

[0212] [Table 6]

[0213] [Table 7]

[0214] As shown in Figure 10, the expression of ATP7b by rAAV in ATP7b KO mice was similar to that in HepG2 cells, i.e., rAAV of AAV6 showed higher expression of ATP7b than rAAV of AAV5, and rAAV containing sequence number 8 or 10 showed lower expression of ATP7b than that containing sequence number 4.

[0215] As shown in Table 5, higher rAAV expression of AAV6 was associated with higher levels of virus in liver tissue.

[0216] As shown in Figure 11, all treatment groups demonstrated good transduction efficacy as reflected by superior ATP7b expression in hepatocytes, while AAV6 demonstrated better transduction efficacy compared to AAV5.

[0217] As shown in Figure 12, overexpression of human truncated ATP7b (miniATP7b) in the liver of a WD model alleviated hepatic copper accumulation and restored serum ceruloplasmin activity.

[0218] Example 6. Optimization of the rAAV genome This example was performed to identify elements for reducing the size of the rAAV genome encoding ATP7b MBD3-5-6 and resulting in improved expression of ATP7b.

[0219] 6.1. Construction of modified transgene plasmids The modified transgene plasmid was constructed by replacing elements such as promoter, intron, and polyA signal in plasmid Co3 by Gibson assembly. The elements in plasmid 11 and the modified transgene plasmid are shown in Table 6.

[0220] [Table 8]

[0221] 6.2. rAAV Preparation rAAVs were prepared in a manner similar to that described in Example 1 using the modified transgene plasmids in Table 6, and the resulting rAAVs were designated by their plasmids and serotypes, i.e., MBD3-5-6-1-AAV5, MBD3T-5-6-1-AAV5, MBD3T-5-6-2-AAV5, MBD3-5-6-2-AAV5, MBD3T-5-6-3-AAV5, MBD3T-5-6-4-AAV5. AV5, MBD3-5-6-3-AAV5, MBD3T-5-6-5-AAV5, MBD3-5-6-1-AAV6, MBD3T-5-6-1-AAV6, MBD3T-5-6-2-AAV6, MBD3-5-6-2-AAV6, MBD3T-5-6-3-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6, and MBD3T-5-6-5-AAV6.

[0222] 6.3. Expression of ATP7b in cells HepG2 cells were infected with the rAAV prepared in Example 6.2, as well as MBD5-6-AAV5, MBD3-5-6-AAV5, and MBD3T-5-6-AAV5, and ATP7b expression was detected as described in Example 2.

[0223] As shown in Figure 13, rAAV MBD3-5-6-2-AAV5, MBD3T-5-6-3-AAV5, and MBD3-5-6-3-AAV5 showed higher expression of ATP7b, indicating that the promoter of sequence number 14 and / or the polyA signal sequence of sequence number 18 contribute to increased expression even though the introns were removed.

[0224] 6.4. In Vitro Metal-Responsive Element Luciferase Reporter Assay for Copper Transport Activity Copper transport activity was used to determine whether the three truncated ATP7b transgenes altered protein functionality. Four rAAV vectors, MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6, and MBD5-6-AAV6 (control), were added to human HepG2 cells at an MOI of 3E6 and cotransfected with a reporter plasmid expressing luciferase under the control of a metal-inducible promoter (pGL4.40[luc2P / MRE / Hygro], Promega, E4131) and a normalizing plasmid expressing Renilla luciferase (pGL4.75[hRluc / CMV], Promega, E6931).

[0225] As shown in Figure 14, all of the rAAVs MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6, MBD3-5-6-3-AAV6, and MBD5-6-AAV6 showed no increase in luciferase signal in response to copper, in contrast to cells without AAV infection. These results indicate that all four versions of mini-ATP7b functioned as copper transporters with similar abilities to remove excess copper.

[0226] 6.5. In vivo expression of mini-ATP7b by rAAV rAAVs were also prepared using the transgene plasmids MBD3-5-6-2, MBD3T-5-6-4, and MBD3-5-6-3, respectively, and packaging plasmids encoding AAV6 capsids as described in Example 1 (MBD3-5-6-2-AAV6, MBD3T-5-6-4-AAV6, and MBD3-5-6-3-AAV6).

[0227] rAAVs (MBD5-6-AAV5(G2), MBD3-5-6-2-AAV5(G3), MBD3T-5-6-4-AAV5(G4), MBD3-5-6-3-AAV5(G5), MBD5-6-AAV6(G6), MBD3-5-6-2-AAV6(G7), MBD3T-5-6-4-AAV6(G8), and MBD3-5-6-3-AAV6(G9)) were injected intravenously into male ATP7b KO mice (6 weeks old) at a dose of 5E12 vg / kg in 200 μL of DPBS (n=7). ATP7b KO mice (G1) and WT mice injected with 200 μL of DPBS served as controls (n=5 each).

[0228] At 28 days post-injection, plasma and liver were collected and examined as described in Example 4.

[0229] In addition, mRNA transcribed from the transgene was detected by qPCR. Briefly, RNA was isolated using the RNeasy Mini Kit (QIAGEN 74106), QIAzol Lysis Reagent (QIAGEN 79306), and Buffer RWT (QIAGEN 1067933) according to the manufacturer's instructions, and reverse transcribed using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme R333-01). qPCR was performed using TaqMan™ Gene Expression Master Mix (Thermo 4369016), UltraPure™ distilled water (Invitrogen 10977-015), and the following primers and probe: GAPDH was used as a housekeeping reference. ApoE-F AGCAGCAAACAGCAAACAC (SEQ ID NO: 24) ApoE-R CCTCTCCACCGAAATTCCAA (SEQ ID NO: 25) ApoE-Probe 5'-6-FAM-ATGCCACCT / ZEN / CCAACATCCACTCG-Iowa Black FQ-3' (SEQ ID NO: 26) M_GAPDH-F CCACTCACGGCAAATTCAAC (SEQ ID NO: 27) M_GAPDH-R ACCAGTAGACTCCACGACATA (SEQ ID NO: 28) M_GAPDH-P 5'-VIC-TTGTCATCAACGGGAAGCCCATCA -MGB-3' (SEQ ID NO: 29)

[0230] As shown in Figure 15, the average AAV distribution (vg / cell) in the liver was similar between AAV5 and AAV6. Indeed, the benchmark (MBD5-6) had slightly higher vg / cell, ATP7b mRNA, and ATP7b protein. AAV6 had higher ATP7b mRNA and ATP7b protein than AAV5, indicating that AAV6 is more potent than AAV5 in reducing copper and increasing ceruloplasmin activity. Copper levels in the liver from G6 to G9 were comparable and lower than those from G1 to G5 (see Table 7 below).

[0231] [Table 9]

[0232] As shown in Figure 16, the percentage of positive cells (counted with the Mutiplex IHC module of the Halo program) in tissues from mice injected with AAV6 was higher than that of AAV5, and the percentage of positive cells in tissues from G9 was comparable to that of G6.

Claims

1. A polynucleotide comprising a first segment comprising residues 169 to 3126 of SEQ ID NO: 2, 3, 4, 5 or 6.

2. 2. The polynucleotide of claim 1, further comprising a second segment comprising residues 1 to 168 of SEQ ID NO: 2, 3, 4, 5 or 6.

3. 3. The polynucleotide of claim 1 or 2, further comprising a third segment, preferably between the first and second segments, comprising residues 169 to 495 of SEQ ID NO:8 or residues 169 to 393 of SEQ ID NO:

10.

4. The polynucleotide of any one of claims 1 to 3, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, 8 or 10.

5. An expression construct comprising the polynucleotide of any one of claims 1 to 4 operably linked to a promoter, and preferably comprising the nucleotide sequence of SEQ ID NO: 13 or 14.

6. 6. The expression construct of claim 5, further comprising an enhancer, preferably comprising the nucleotide sequence of SEQ ID NO:

12.

7. 7. An expression construct according to claim 5 or 6, further comprising a polyA signal sequence, preferably comprising the nucleotide sequence of SEQ ID NO: 17 or 18.

8. 8. The expression construct of any one of claims 5 to 7, further comprising an intron, preferably comprising the nucleotide sequence of SEQ ID NO: 15 or 16.

9. A vector comprising the polynucleotide of any one of claims 1 to 4 or the expression construct of any one of claims 5 to 8.

10. A recombinant adeno-associated virus (rAAV) comprising a genome comprising an expression construct according to any one of claims 5 to 8.

11. The rAAV of claim 10, wherein the rAAV is hAAV6.

12. 12. The rAAV of claim 10 or 11, wherein the genome comprises 5' and 3' ITRs, preferably comprising SEQ ID NOs: 19 and 20, respectively.

13. A host cell comprising a polynucleotide according to any one of claims 1 to 4, an expression construct according to any one of claims 5 to 8, a vector according to claim 9 or an rAAV according to any one of claims 10 to 12.

14. A pharmaceutical composition comprising the rAAV of any one of claims 10 to 12.

15. A method for treating a disease associated with a defect in copper transport, the method comprising administering an rAAV according to any one of claims 7 to 9 or a pharmaceutical composition according to claim 14.

16. 16. The method of claim 15, wherein the disease is Wilson's disease.