RNA preparations for pharmaceutical use
RNA formulations with miRNA-binding sequences address the challenge of selective expression by recruiting miRNAs to inhibit translation in non-target cells, ensuring high expression in target cells and reducing toxicity.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-01-17
- Publication Date
- 2026-03-13
AI Technical Summary
Existing RNA-based therapeutics face challenges in achieving high expression levels in target cells while avoiding expression in non-target cells, which can lead to undesirable effects.
Incorporating miRNA-binding sequences specific to non-target cells into RNA formulations to recruit miRNAs that inhibit or destabilize translation in these cells, while allowing efficient expression in target cells.
Enables cell-type-specific or tissue-specific gene regulation, ensuring high expression of pharmaceutically active peptides or polypeptides in target cells while minimizing toxic effects in non-target cells.
Smart Images

Figure 2026508822000058 
Figure 2026508822000059 
Figure 2026508822000060
Abstract
Description
[Technical Field]
[0001] This disclosure relates to RNA comprising one or more miRNA-binding sequences, wherein the one or more miRNA-binding sequences bind to miRNAs present in cells where RNA expression is not desired. Delivery of the RNA to cells after administration, particularly after intramuscular or intravenous administration, enables the expression of RNA-encoded polypeptides in specific cells, while suppressing expression in other cells. In some embodiments, such cells include endothelial cells. The RNA compositions described herein enable RNA-mediated expression of pharmaceutically active peptides or polypeptides in a subject while reducing or avoiding the risk of undesirable effects resulting from the expression of pharmaceutically active peptides or polypeptides in specific cells or tissues. The disclosure also relates to methods for delivering RNA to cells of interest, or for treating or preventing a disease or disorder of interest, comprising administering the compositions of this disclosure to a subject. The RNA compositions, in some embodiments, include single-stranded RNA such as mRNA encoding a peptide or polypeptide of interest, such as a pharmaceutically active peptide or polypeptide. The RNA may be taken up by the treated cells of interest and translated into the encoded peptide or polypeptide to exhibit its physiological activity. Accordingly, the Disclosure also relates to a method for delivering a pharmaceutically active peptide or polypeptide to a target, or for treating or preventing a target disease or disorder, comprising administering the RNA composition of the Disclosure to a target, wherein the RNA encodes a pharmaceutically active peptide or polypeptide. [Background technology]
[0002] The use of RNA offers an attractive alternative to DNA to avoid the potential safety risks associated with the pharmaceutical use of DNA. In vitro transcription RNA (IVT-RNA) is particularly interesting in therapeutic approaches. Advantages of the pharmaceutical use of RNA include transient expression and non-transformation properties. RNA does not need to enter the nucleus to be expressed and cannot be integrated into the host genome, thereby eliminating the risk of carcinogenesis. When used for vaccination, RNA injections can induce both cellular and humoral immune responses in vivo.
[0003] The essential requirements for the effectiveness of RNA-based therapeutics are high RNA stability and translation efficiency. RNA molecules are inherently unstable, and their intracellular dynamics depend on the untranslated region (UTR) surrounding the coding sequence, particularly the 3'UTR element.
[0004] In previous studies, the inventors demonstrated that RNA having a 3'UTR containing a segment derived from split amino-terminal enhancer (AES) mRNA (also referred to herein as the "F element"; SEQ ID NO: 1) and mitochondrial-encoded 12S ribosomal RNA (mtRNR1) (also referred to herein as the "I element"; SEQ ID NO: 2) conferred RNA stability and high total protein expression. The AES-mtRNR1 3'UTR was significantly superior to other 3'UTRs (Orlandini von Niessen, AGet al. (2019) Molecular therapy: the journal of the American Society of Gene Therapy, 27(4), 824-836; International Publication No. 2017 / 060314).
[0005] While high stability and expression of RNA in target cells and tissues are generally desirable, it may also be desirable that RNA is not expressed in certain cells and tissues. For example, the expression product may be harmful to certain cells and tissues.
[0006] In principle, RNA expression in specific cells and tissues can be prevented by incorporating one or more miRNA-binding sequences, which are specific to miRNAs expressed in those cells and tissues where RNA expression should be suppressed, into the RNA. The one or more miRNA-binding sequences function to recruit one or more miRNA molecules, for example, selectively expressed, that are expressed in one or more cell or tissue types where RNA expression is undesirable. The one or more miRNA molecules target the RNA, thereby inhibiting the translation of the target RNA or destabilizing it. [Prior art documents] [Patent Documents]
[0007] [Patent Document 1] International Publication No. 2017 / 060314 [Non-patent literature]
[0008] [Non-Patent Document 1] Orlandini von Niessen, AGet al. (2019) Molecular therapy: the journal of the American Society of Gene Therapy, 27(4), 824-836 [Overview of the Initiative] [Problems that the invention aims to solve]
[0009] There is a need to provide a formulation for delivering pharmaceutically active RNA to target cells or tissues in which the delivered RNA is efficiently translated into the peptide or polypeptide it encodes, without inducing the expression of pharmaceutically active RNA in cells or tissues where RNA expression is not desired (non-target cells or tissues).
[0010] The object of the present invention was to provide RNA that can be used to achieve high levels of expression in target cells and tissues while suppressing expression in non-target cells and tissues, for example, to prevent toxic effects. In particular, this study investigated whether inhibition of expression by incorporating a miRNA binding site is effective even in RNA molecules that have been artificially modified to achieve significantly increased stability and expression compared to naturally occurring RNA, for example, by incorporating AES-mtRNR1 3'UTR.
[0011] This disclosure acknowledges that the suppression of the expression of proteins encoded by RNA containing AES-mtRNR1 3'UTR in non-target cells or tissues can be achieved by incorporating one or more miRNA target sites (miRNA binding sequences) specific to miRNAs exclusively expressed in non-target cells or tissues into the RNA. The RNA containing one or more miRNA binding sequences described herein functions to recruit one or more miRNA molecules in one or more cell types or tissue types where RNA expression is not desired, and the one or more miRNA molecules target the RNA, thereby modulating (e.g., inhibiting) or destabilizing the translation of the target RNA. In contrast, in one or more cell types or tissue types where RNA expression is desired and one or more miRNA molecules are absent or present in small amounts, the RNA is efficiently expressed. Thus, in some embodiments, one or more selected endogenous miRNAs can modulate (e.g., silence) the gene expression of target RNA having one or more binding sites to these miRNAs. In some embodiments, selected endogenous miRNAs are expressed, or selectively expressed, in one or more cell or tissue types where RNA expression is not desired. The disclosed RNAs enable cell-type-specific or tissue-specific gene regulation (e.g., silencing) by recruiting one or more cell-type-specific or tissue-specific miRNAs (e.g., miR-126 specific to endothelial cells). [Means for solving the problem]
[0012] This disclosure describes RNA formulations useful for in vivo RNA delivery, such as for pharmaceutical applications, and methods including the administration of RNA to a target.
[0013] The RNA described herein comprises one or more miRNA-binding sequences that bind to miRNAs present in cells where RNA expression is not desired. In some embodiments, such cells include endothelial cells. The RNA described herein enables RNA-mediated expression of pharmaceutically active peptides or polypeptides in a target while reducing or avoiding the risk of undesirable effects resulting from the expression of pharmaceutically active peptides or polypeptides in specific cells or tissues.
[0014] In one embodiment, the present disclosure provides a composition or pharmaceutical formulation comprising RNA, RNA is (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence This includes, where 3'UTR is, (i) A 3'UTR sequence comprising a first sequence containing the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 1, and a second sequence containing the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 2, (ii) One or more miRNA binding sequences and Includes.
[0015] In some embodiments, the RNA includes at least one of one or more miRNA-binding sequences upstream of the first and second sequences, downstream of the first and second sequences, or downstream of the first sequence and upstream of the second sequence.
[0016] In some embodiments, the first array is located upstream of the second array.
[0017] In some embodiments, the 3'UTR sequence includes the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3.
[0018] In some embodiments, the RNA includes at least one of one or more miRNA-binding sequences downstream of the coding sequence encoding the polypeptide and upstream of the 3'UTR sequence.
[0019] In some embodiments, the RNA includes one or more miRNA-binding sequences downstream of the polypeptide coding sequence and upstream of the 3'UTR sequence.
[0020] In some embodiments, the RNA includes a nucleotide sequence that ligates a miRNA-binding sequence(s) to a 3'UTR sequence.
[0021] In some embodiments, the nucleotide sequence linking the miRNA-binding sequence(s) to the 3'UTR sequence includes the sequence (X1)nCGAX2, where X1 is any nucleotide, n is 0 to 10, and X2 is G or U. In some embodiments, n is 1 to 6, for example, 2 or 5.
[0022] In some embodiments, the nucleotide sequence that ligates the miRNA-binding sequence(s) to the 3'UTR sequence includes the sequence CUCGAG or the sequence GGAUCCGAU.
[0023] In some embodiments, at least one of the one or more miRNA-binding sequences binds to miRNA present in cells where polypeptide expression is not desired.
[0024] In some embodiments, each of one or more miRNA-binding sequences binds to miRNA present in cells where polypeptide expression is not desired.
[0025] In some embodiments, the RNA includes three or more miRNA-binding sequences, and these three or more miRNA-binding sequences bind to the same or different miRNAs.
[0026] In some embodiments, the RNA includes two or more miRNA-binding sequences, and these two or more miRNA-binding sequences bind to the same or different miRNAs.
[0027] In some embodiments, the RNA contains one miRNA-binding sequence.
[0028] In some embodiments, one or more miRNA-binding sequences include nucleotide sequences that are the exact Watson-Crick complement of the miRNA.
[0029] In some embodiments, the RNA comprises a nucleotide sequence that ligates a 3'UTR sequence with a poly-A sequence containing the sequence gagaccugguccagagucgcuagccgcgucgcu or CUXGAGCUAGC, where X is G, C, A, or U.
[0030] In some embodiments, the RNA comprises a nucleotide sequence that ligates a 3'UTR sequence with a poly-A sequence containing the sequence CUXGAGCUAGC, where X is C, A, or U.
[0031] In some embodiments, the nucleotide sequence linking the 3'UTR sequence and the poly(A) sequence includes the sequence CUCGAGCUAGC.
[0032] In some embodiments, the RNA comprises, in the 5' to 3' direction, a 5'UTR, a coding sequence encoding a polypeptide, a miRNA-binding sequence(s), optionally a nucleotide sequence linking a miRNA-binding sequence(s) to a 3'UTR sequence, a 3'UTR sequence, optionally a nucleotide sequence linking a 3'UTR sequence to a poly(A) sequence, and a poly(A) sequence.
[0033] In some embodiments, the RNA includes a 3'UTR containing the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9.
[0034] In some embodiments, the RNA includes a 3'UTR containing the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10.
[0035] In some embodiments, the RNA includes a 3'UTR containing the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11.
[0036] In some embodiments, the RNA includes a 3'UTR comprising the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12.
[0037] In some embodiments, the polyA sequence is a suspended sequence of A nucleotides.
[0038] In some embodiments, the polyA sequence contains at least 100 nucleotides.
[0039] In some embodiments, the polyA sequence comprises or consists of the nucleotide sequence Ax-L-Ay, where Ax is a sequence of at least 20 A nucleotides, Ay is a sequence of at least 60 A nucleotides, and L is a linker of 1 to 20 nucleotides, which may contain nucleotides other than A.
[0040] In some embodiments, the polyA sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 4.
[0041] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7.
[0042] In some embodiments, the RNA includes a 5'UTR that has at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence that is preceded by a sequence containing the nucleotide sequence AGX1X2X3X4AACUAGU (where X1 is any nucleotide, preferably A or C; X2 is any nucleotide, preferably A or C; X3 is any nucleotide, preferably C, U, or G; and X4 is A or missing).
[0043] In some embodiments, the RNA includes a 5'UTR that contains the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence that has at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGACGAACUAGU.
[0044] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6.
[0045] In some embodiments, the RNA includes a 5'UTR comprising a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, preceded by a sequence comprising the nucleotide sequence AGX1AX3AAACUAGU (where X1 is any nucleotide, preferably A or C, and X3 is any nucleotide, preferably C or U).
[0046] In some embodiments, the RNA includes a 5'UTR that contains the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence that has at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGAAUAAACUAGU.
[0047] In some embodiments, the RNA includes a 5'UTR that contains the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, or a nucleotide sequence that has at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGCACAAACUAGU.
[0048] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7.
[0049] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7.
[0050] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8.
[0051] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0052] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0053] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 11.
[0054] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8, and downstream of a coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0055] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8, and a sequence downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 11.
[0056] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0057] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0058] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 11 downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences.
[0059] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, and a polyA sequence.
[0060] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, and a sequence containing the nucleotide sequence of SEQ ID NO: 11 downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences.
[0061] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, and a polyA sequence.
[0062] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, and a polyA sequence.
[0063] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences comprising the nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 12.
[0064] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, and a polyA sequence.
[0065] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, and a polyA sequence.
[0066] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 12 downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences.
[0067] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, and a polyA sequence.
[0068] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, and a polyA sequence.
[0069] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences comprising the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 10.
[0070] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 7-53 of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, and a polyA sequence.
[0071] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, and a polyA sequence.
[0072] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 10 downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences.
[0073] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of nucleotides 6-52 of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 6-52 of SEQ ID NO: 6, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, and a polyA sequence.
[0074] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, and a polyA sequence.
[0075] In some embodiments, the RNA includes a 5'UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6, and a sequence downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences comprising the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 9.
[0076] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of nucleotides 6-52 of SEQ ID NO: 6, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, and a polyA sequence.
[0077] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, and downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences, a sequence containing the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, and a polyA sequence.
[0078] In some embodiments, the RNA includes a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, and a sequence containing the nucleotide sequence of SEQ ID NO: 9 downstream of a coding sequence encoding a polypeptide and one or more miRNA-binding sequences.
[0079] In some embodiments, at least 90% means at least 95%, 96%, 97%, 98%, or 99%.
[0080] In some embodiments, the RNA includes two or more coding sequences that encode two or more polypeptides.
[0081] In some embodiments, the polypeptide is a pharmaceutically active polypeptide.
[0082] In some embodiments, the RNA contains a modified nucleoside instead of uridine.
[0083] In some embodiments, the RNA contains modified nucleosides instead of each uridine.
[0084] In some embodiments, the modified nucleoside is pseudouridine (ψ) and / or N1-methyl-pseudridine (m1ψ).
[0085] In some embodiments, the modified nucleoside is N1-methyl-pseuduridine (m1ψ).
[0086] In some embodiments, the RNA includes a 5' cap.
[0087] In some embodiments, the RNA includes a cap-1 structure.
[0088] In some embodiments, RNA has a 5' cap m2 7,3’-O Gppp(m1 2’-O ) Includes ApG.
[0089] In some embodiments, the RNA is single-stranded RNA.
[0090] In some embodiments, RNA is mRNA.
[0091] In some embodiments, RNA is formulated into a delivery vehicle.
[0092] In some embodiments, RNA is formulated into lipid nanoparticles (LNPs).
[0093] In some embodiments, the lipids forming the lipid nanoparticles include cationic lipids, polymer-conjugated lipids, neutral lipids, and steroids.
[0094] In some embodiments, the cationic lipid includes cationic ionizable lipids.
[0095] In some embodiments, the polymer-conjugated lipid includes a PEG-conjugated lipid.
[0096] In some embodiments, the neutral lipids include phospholipids.
[0097] In some embodiments, the steroid includes cholesterol.
[0098] In some embodiments, a. Cationic lipids make up approximately 35-65 mol% of total lipids; b. Polymer-conjugated lipids are present at approximately 1-5 mol% of the total lipids; c. Neutral lipids make up about 5-15 mol% of total lipids; and d. Steroids are present in the form of approximately 30-50 mol% of total lipids.
[0099] In some embodiments, the lipid nanoparticles have an average size of about 50–150 nm.
[0100] In some embodiments, the composition is a pharmaceutical composition.
[0101] In some embodiments, the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and / or excipients.
[0102] In some embodiments, the pharmaceutical formulation is a kit.
[0103] In some embodiments, the RNA and optionally the particle-forming components are contained in separate vials.
[0104] In some embodiments, the composition or pharmaceutical formulation is for parenteral administration. In some embodiments, the composition or pharmaceutical formulation is for intramuscular administration. In some embodiments, the composition or pharmaceutical formulation is for intravenous administration.
[0105] In some embodiments, at least one of one or more miRNA-binding sequences, each optionally, binds to a miRNA present in the endothelial cell. In some embodiments, the miRNA is miR-126, and optionally, miR-126-5p or miR-126-3p. In some embodiments, at least one of the miRNA-binding sequences, each optionally, comprises or consists of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p).
[0106] In some embodiments, at least one of one or more miRNA-binding sequences, each optionally, binds to a miRNA present in hematopoietic cells, such as immune cells. In some embodiments, immune cells include dendritic cells and / or macrophages, such as Kupffer cells. In some embodiments, the miRNA is miR-142, and optionally miR-142-3p. In some embodiments, at least one of the miRNA-binding sequences, each optionally, comprises or consists of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p).
[0107] In some embodiments, at least one of one or more miRNA-binding sequences, each optionally, binds to a miRNA present in hepatocytes. In some embodiments, the miRNA is miR-122. In some embodiments, at least one of the miRNA-binding sequences, each optionally, contains or consists of ACAAACACCAUUGUCACACUCCA (which binds to miR-122).
[0108] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0109] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0110] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0111] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0112] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0113] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0114] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0115] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0116] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0117] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0118] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0119] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0120] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0121] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0122] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0123] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0124] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0125] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0126] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0127] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) One or more, for example, two, three or more, preferably one, two or three miRNA binding sequences, comprising or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of one or more miRNA binding sequences, a nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0128] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising or consisting of three miRNA-binding sequences, each containing cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0129] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising or consisting of three miRNA-binding sequences, each containing cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0130] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising or consisting of three miRNA-binding sequences, each containing cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0131] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising or consisting of three miRNA-binding sequences, each containing cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0132] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising or consisting of three miRNA-binding sequences, each containing cgcguaccaaaaguaauaaug (which binds to miR-126-5p) or cgcauuauuacucacgguacga (which binds to miR-126-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0133] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) Three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), and a miRNA binding sequence, (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 and comprises.
[0134] In some embodiments, the RNA described herein is, in the 5' to 3' direction: (a) 5'UTR, (b) A coding sequence encoding a polypeptide, (c) 3'UTR, and (d) A polyA sequence, wherein the 3'UTR is (i) Three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), and a miRNA binding sequence, (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 and comprises.
[0135] In some embodiments, the RNA described herein is, in the 5' to 3' direction: (a) 5'UTR, (b) A coding sequence encoding a polypeptide, (c) 3'UTR, and (d) A polyA sequence, wherein the 3'UTR is (i) Three miRNA binding sequences, comprising or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), and a miRNA binding sequence, (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 10 Includes.
[0136] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising three miRNA-binding sequences, including or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-298 of SEQ ID NO: 11 Includes.
[0137] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising three miRNA-binding sequences, including or consisting of UCCAUAAAGUAGGAAACACUACA (which binds to miR-142-3p), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0138] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising three miRNA-binding sequences, including or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 Includes.
[0139] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) Poly-A sequence, This includes, where 3'UTR is, (i) A miRNA-binding sequence comprising three miRNA-binding sequences, including or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-317 of SEQ ID NO: 9 Includes.
[0140] In some embodiments, the RNA described herein is arranged in the 5' to 3' direction: (a) 5'UTR, (b) Code sequence that codes for polypeptides, (c) 3'UTR, and (d) a polyA sequence, and includes, where the 3’UTR (i) three miRNA binding sequences, including or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 and includes.
[0141] In some embodiments, the RNA described herein is, in the 5’ to 3’ direction: (a) a 5’UTR, (b) a coding sequence encoding a polypeptide, (c) a 3’UTR, and (d) a polyA sequence, and includes, where the 3’UTR (i) three miRNA binding sequences, including or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 and includes.
[0142] In some embodiments, the RNA described herein is, in the 5’ to 3’ direction: (a) a 5’UTR, (b) a coding sequence encoding a polypeptide, (c) a 3’UTR, and (d) a polyA sequence, and includes, where the 3’UTR (i) A miRNA-binding sequence comprising three miRNA-binding sequences, including or consisting of ACAAACACCAUUGUCACACUCCA (which binds to miR-122), (ii) Downstream of the miRNA binding sequence, the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1-295 of SEQ ID NO: 12 Includes.
[0143] In one embodiment, the Disclosure provides a method for controlling polypeptide expression in a subject in a cell-type and / or tissue-specific manner, comprising administering a composition described herein to the subject, wherein one or more miRNA-binding sequences bind to miRNAs present in one or more cells or tissues of the subject in which polypeptide expression is not desired.
[0144] In some embodiments, the miRNA is either absent from one or more cells or tissues other than those in which polypeptide expression is not desired, or is present in lower amounts in one or more cells or tissues other than those in which polypeptide expression is not desired, compared to those in those cells or tissues.
[0145] In one embodiment, the present disclosure provides a method for treating a subject, comprising administering a composition described herein to a subject to express a polypeptide in selected cells of the subject while avoiding polypeptide expression in those cells, wherein one or more miRNA-binding sequences bind to miRNAs present in the selected cells.
[0146] In some embodiments, miRNAs are either absent from cells other than the selected cells, or present in lower amounts in cells other than the selected cells compared to the selected cells.
[0147] In some embodiments, administration is by parenteral administration. In some embodiments, administration is by intramuscular administration. In some embodiments, administration is by intravenous administration. [Brief explanation of the drawing]
[0148] [Figure 1] Expression of miR-126-BS mRNA in HEK293 cells. mRNA containing miR-126-5p and miR-126-3p binding sites was transfected into HEK293 cells along with the corresponding miRNA mimetics or nonspecific miRNAs. Expression of the encoded protein was analyzed by FACS 18 hours after transfection: percentage of protein-positive cells (left panel) and their mean fluorescence intensity (right panel). [Figure 2] Expression of miR-126-BS mRNA in HUVEC cells. 126-5p-BS and 126-3p-BS mRNA were transfected into HUVEC cells along with miRNA mimes, and protein expression was analyzed using FACS 18 hours after transfection: percentage of protein-positive cells (left panel) and their mean fluorescence intensity (right panel). [Figure 3] Expression of miR-BS mRNA, including miR-208b, miR-216a, and miR-217 binding sites, in HEK293 cells. HEK293 cells were transfected with miRNA mimes, and protein expression was analyzed using FACS 18 hours after transfection: percentage of protein-positive cells (left panel) and their mean fluorescence intensity (right panel). [Figure 4] Expression of miR-BS mRNA, including miR-208b, miR-216a, and miR-217 binding sites, in HUVEC cells. HUVEC cells were transfected with miRNA mimes, and protein expression was analyzed using FACS 18 hours after transfection: percentage of protein-positive cells (left panel) and their mean fluorescence intensity (right panel). [Figure 5] Expression of miR-BS mRNA containing 1–3 miR-126-5P binding sites at different locations in HEK293 cells. HEK293 cells were transfected with miRNA mimetics using 1–9 miR-126-5p-BS mRNA (see Table in Example 1 for reference), and protein expression was analyzed using FACS 18 hours after transfection: percentage of protein-positive cells (upper panel) and their mean fluorescence intensity (lower panel). [Figure 6] Expression of miR-BS mRNA containing 1–3 miR-126-5P binding sites at different locations in HUVEC cells. HUVEC cells were transfected with miR-BS mRNA, and protein expression was analyzed using FACS 18 hours after transfection: percentage of protein-positive cells (left panel) and their mean fluorescence intensity (right panel). [Figure 7]Luciferase activity in CHO cells 24 hours after transfection (by TransIT or lipofectamine) with luciferase-coding mRNA either with or without a 4×miRT-142-3p sequence insertion in the 3'UTR ("luc-miRT-142-3p") or without the insertion ("luc"). EPO levels (pg / ml) were measured in the supernatant of human primary cells (hepatocytes (hHEP), dendritic cells (hDC), or Kupffer cells (hKupffer)) 24 hours after cell transfection with LNP-formulated EPO mRNA containing either four tandem repeats of miRT-142-3p in the 3'UTR (miRT142-3p) or four tandem repeats of a scrambled version of the miRT142-3p sequence (miRT-142-3p mix) (B). EPO levels (pg / ml) were measured in the supernatants of different cell cultures (HEK293, CHO, Huh7, hHEP, hDC, or hKupffer) 24 hours after cell transfection with LNP-formulated EPO mRNA (skeleton B) containing either 4× miRT-142-3p (miRT-142-3p) or a 4× scrambled version of the miRT-142-3p sequence (miRT-142-3p mix) during the 3'UTR (C). [Figure 8]Luciferase activity in three different cell lines 24 hours after TransIT transfection of luciferase-coding mRNA with or without a 4×miR-122T sequence insertion in the 3'UTR ("+miR-122T") or without the insertion ("-miR-122T") (A). EPO levels (pg / ml) were measured in the supernatant of human primary cells (hepatocytes (hHEP), dendritic cells (hDC), or Kupffer cells (hKupffer)) 24 hours after cell transfection with LNP-formulated EPO mRNA containing either four tandem repeats of miRT-122 in the 3'UTR (miRT-122) or four tandem repeats of a scrambled version of the miRT-122 sequence (miRT-122 mix) (B). EPO levels (pg / ml) were measured in the supernatants of different cell cultures (HEK293, CHO, Huh7, 1'Hep, hDC, or 1'Kupffer) 24 hours after cell transfection with LNP-formulated EPO mRNA (skeleton B) containing either 4× miRT-122 (miRT-122) or a 4× scrambled version of the miRT-122 sequence (miRT-122 mix) during the 3'UTR (C). [Figure 9] Luciferase-encoding IVT mRNA (unmodified (U) or modified (1mΨ)) containing or not containing 4×miRT-122 in the 3'-UTR was formulated into LNPs and administered to mice by intramuscular injection to deliver the indicated concentrations of mRNA. Luciferase expression levels (radiance (p / sec / cm3 / sr)) in mice were measured at two different exposure levels, 6 hours (6h) and 24 hours (24h) after administration. [Figure 10]EPO levels (pg / ml) were measured in the supernatant of human primary hepatocytes (hHEP) 24 hours after cell transfection with LNP-A formulated EPO-coded IVT mRNA containing 4×miRT-142-3p or the corresponding scrambled sequence (mix) in the 3'-UTR (A). EPO levels (pg / ml) were measured in the supernatant of primary human Kupffer (hKupffer) cells 24 hours after cell transfection with LNP-A formulated EPO-coded IVT mRNA containing 4×miRT-122 or the corresponding scrambled sequence (mix) in the 3'-UTR (B). [Figure 11A] This shows that EPO mRNA transcribed from skeleton C is superior to that from skeleton A in vivo, but inferior to that derived from the skeleton B / skeleton D cassette. [Figure 11B] This shows that EPO mRNA transcribed from skeleton C is superior to that from skeleton A in vivo, but inferior to that derived from the skeleton B / skeleton D cassette. [Figure 12A] This study compares mRNA translation from skeletons B, C, and D, which have different coding sequences, and demonstrates that the performance difference between skeleton C and skeletons B / D is independent of the coding sequence. Firefly luciferase mRNA from A, skeleton B (●), C (■), and D (▲) was electroporated twice into hiDC (solid and dashed lines). Bright-Glo assays were performed at the indicated times. [Figure 12B] This study compares mRNA translation from skeletons B, C, and D, which have different coding sequences, demonstrating that the performance difference between skeleton C and skeletons B / D is independent of the coding sequence. eGFP mRNA from skeletons B, C (■), and D (▲) was electroporated twice into hiDCs (solid and dashed lines). Cells were harvested and assayed for eGFP expression by FACS at the indicated times. [Figure 12C]This study compares mRNA translation derived from skeletons B, C, and D, which have different coding sequences, demonstrating that the performance difference between skeleton C and skeletons B / D is independent of the coding sequence. Primary human hepatocytes were lipofected with hIL-18 mRNA from skeletons B(●), C(■), and D(▲). The supernatant from the transfected cells was collected at the indicated time and assayed for the presence of hIL-18 by ELISA. [Figure 13A] This study demonstrates the translation of firefly luciferase mRNA derived from skeletons B and C, which contain different nucleotides at the -9 position upstream of polyA in hiDCs, and shows that the 3'UTR terminal sequence influences long-term translation in vitro. Firefly luciferase mRNA derived from skeletons B (panel A) and C (panel B), which have A(◆), G(■), T(▲), or C(●) at the -9 position upstream of the polyA sequence, were electroporated into hiDCs in two separate experiments, and luciferase expression was assayed at the indicated time points. [Figure 13B] This study demonstrates the translation of firefly luciferase mRNA derived from skeletons B and C, which contain different nucleotides at the -9 position upstream of polyA in hiDCs, and shows that the 3'UTR terminal sequence influences long-term translation in vitro. Firefly luciferase mRNA derived from skeletons B (panel A) and C (panel B), which have A(◆), G(■), T(▲), or C(●) at the -9 position upstream of the polyA sequence, were electroporated into hiDCs in two separate experiments, and luciferase expression was assayed at the indicated time points. [Figure 14A] Using skeleton B, we demonstrate that the 3'UTR terminal sequence significantly affects long-term translation in vivo. [Figure 14B] Using skeleton B, we demonstrate that the 3'UTR terminal sequence significantly affects long-term translation in vivo. [Figure 15A] Using skeleton D, we demonstrate that the 3'UTR terminal sequence significantly affects long-term translation in vivo. [Figure 15B] Using skeleton D, we demonstrate that the 3'UTR terminal sequence significantly affects long-term translation in vivo. [Figure 16]LUC activity (relative luminescence (RLU)) was measured in lysates of human primary skeletal muscle (HSkMC) (48 hours) and human dendritic cells (hDC) (24 hours) after cell transfection with TransIT formulation of Luc-coded IVT mRNA or Luc-coded IVT mRNA containing 4×miRT-206 in 3'-UTR. [Modes for carrying out the invention]
[0149] Array description The following table provides a list of specific sequences referenced herein.
[0150] [Table 1] TIFF2026508822000002.tif185158TIFF2026508822000003.tif185158
[0151] This disclosure will be described in more detail below, but it should be understood that this disclosure is not limited to the specific methods, protocols, and reagents described herein, and that these may change. Furthermore, it should be understood that the terms used herein are intended solely to describe specific embodiments and are not intended to limit the scope of this disclosure, and that the scope of this disclosure is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.
[0152] The elements of this disclosure are described in more detail below. These elements are listed together with specific embodiments, but it should be understood that they may be combined in any way and in any number to create further embodiments. The various examples and preferred embodiments described should not be construed as limiting this disclosure to only the expressly described embodiments. This description should be understood as supporting and encompassing embodiments that combine the expressly described embodiments with any number of disclosed and / or preferred elements. Furthermore, any rearrangement and combination of all elements described in this application should be considered disclosed by this description unless specifically indicated in the context.
[0153] The implementation of this disclosure will use conventional chemical, biochemical, cell biology, immunological, and recombinant DNA technologies as described in the literature in this art, unless otherwise indicated.
[0154] Throughout this specification and the following claims, unless specifically required by context, the words “include” and variations such as “include” are understood to mean the inclusion of the feature, element, member, integer or process or group of features, elements, members, integers or processes described, but not the exclusion of any other feature, element, member, integer or process or group of features, elements, members, integers or processes. The term “essentially from” limits the scope of the claims or disclosure to such an extent that it does not substantially affect the specified feature, element, member, integer or process, or the fundamental and novel features of the claims or disclosure. The term “consisting of” limits the scope of the claims or disclosure to the specified feature, element, member, integer or process. The term “include” includes the term “essentially from,” which in turn includes the term “consisting of.” Thus, in each occurrence in this application, the term “include” may be replaced by the terms “essentially from” or “consisting of.” Similarly, in each occurrence in this application, the term “essentially from” may be replaced by the term “consisting of.”
[0155] In the context describing this disclosure (particularly in the context of the claims), the terms “a,” “an,” and “the,” and similar references, should be construed as encompassing both singular and plural unless otherwise specifically indicated herein or unless clearly inconsistent with the context.
[0156] All methods described herein may be carried out in any suitable order, unless otherwise specified herein or unless it is clearly inconsistent with the context.
[0157] The use of any examples or illustrative language provided herein (e.g., "etc.") is intended solely to better illustrate the disclosure and not to limit the scope of the claimed disclosure. No language in this specification should be construed as referring to any unclaimed elements essential to the practice of the disclosure.
[0158] As used herein, the terms “optional” or “optional” mean that the events, situations, or conditions described therein may or may not occur, and that such descriptions include cases in which the events, situations, or conditions occur and cases in which they do not occur.
[0159] Where used herein, “and / or” should be interpreted as a specific disclosure of each of the two designated features or components, whether they include the other or not. For example, “X and / or Y” should be interpreted as a specific disclosure of (i) X, (ii) Y, and (iii) X and Y, as if each were described herein separately.
[0160] In the context of this disclosure, the term “approximately” indicates an interval of precision that a person skilled in the art would understand to still guarantee the technical effect of the feature in question. Typically, this term refers to deviations of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, and, for example, ±0.01% from a given number. In some embodiments, “approximately” refers to a deviation of ±10% from a given number. In some embodiments, “approximately” refers to a deviation of ±5% from a given number. In some embodiments, “approximately” refers to a deviation of ±4% from a given number. In some embodiments, “approximately” refers to a deviation of ±3% from a given number. In some embodiments, “approximately” refers to a deviation of ±2% from a given number. In some embodiments, “approximately” refers to a deviation of ±1% from a given number. In some embodiments, "approximately" indicates a deviation of ±0.9% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.8% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.7% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.6% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.5% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.4% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.3% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.2% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.1% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.05% from the indicated value. In some embodiments, "approximately" indicates a deviation of ±0.01% from the indicated value. As will be understood by those skilled in the art, such specific deviations from the numerical value of a given technical effect depend on the nature of the technical effect. For example, natural or biological technological effects can generally have greater deviations than artificial or engineered technological effects.
[0161] The enumeration of value ranges in this specification is intended simply as a way of simplifying the reference of each distinct value that falls within that range individually. Unless otherwise indicated herein, each individual value is incorporated herein as if it were individually enumerated.
[0162] Throughout this specification, several sources are referenced. Each of the sources referenced herein (including all patents, patent applications, scientific publications, manufacturer specifications, instructions, etc.) is incorporated herein by reference in its entirety, whether above or below. Nothing in this specification should be construed as an acknowledgment that the present invention has no prior rights to such disclosure by prior art.
[0163] For clarity, whenever a sequence is referred to as a sequence between a nucleotide at position x and a nucleotide at position y, it should be noted that the resulting sequence will contain both the nucleotide at position x and the nucleotide at position y. Similarly, whenever a sequence is referred to as a sequence between an amino acid at position x and an amino acid at position y, the resulting sequence will contain both the amino acid at position x and the amino acid at position y. Furthermore, while the sequences described herein, in particular in the sequence listings, refer to DNA molecules, where it is stated in this specification or in the claims that RNA contains the nucleotide sequences described herein, in particular in the sequence listings, it is clear that the nucleotide sequences referred to are actually identical to the base sequences of the DNA molecules described herein, in particular in the sequence listings, for example, represented by the referenced sequence number, except that thymine is replaced by uracil.
[0164] Definitions and embodiments applicable to all aspects of this disclosure are provided below. Terms defined below have their defined meanings unless otherwise indicated. Terms not defined have their widely recognized meanings in their respective art.
[0165] As used herein, terms such as “reduce” or “inhibit” mean the ability to produce an overall reduction of, for example, a level of about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 40% or more, about 50% or more, or about 75% or more. The term “inhibit” or similar phrases include complete or essentially complete inhibition, i.e., a reduction to zero or essentially zero.
[0166] As used herein, terms such as “enhance” mean the ability to produce an overall increase or enhancement of, for example, at a level of at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 75%, or about 100% or more.
[0167] As used herein, “physiological pH” refers to a pH of approximately 7.4. In some embodiments, the physiological pH is 7.3 to 7.5. In some embodiments, the physiological pH is 7.35 to 7.45. In some embodiments, the physiological pH is 7.3, 7.35, 7.4, 7.45, or 7.5.
[0168] As used in this disclosure, "%w / v" refers to a weight-volume percentage, which is a unit of concentration that measures the amount of solute in grams (g) expressed as a percentage of the total volume of a solution in milliliters (mL).
[0169] As used in this disclosure, "weight percent" refers to weight percent, which is a unit of concentration that measures the amount of a substance in grams (g) expressed as a percentage of the total weight of the entire composition in grams (g).
[0170] As used in this disclosure, "mol%" is defined as the ratio of the number of moles of one component to the total number of moles of all components multiplied by 100.
[0171] As used in this disclosure, “mol% of total lipids” is defined as the ratio of the number of moles of one lipid component to the total number of moles of all lipids multiplied by 100. In this connection, in some embodiments, the term “total lipids” includes lipids and lipid-like substances.
[0172] The term "ionic strength" refers to the mathematical relationship between the number of different types of ions in a given solution and their respective charges. Therefore, ionic strength I is given by the formula:
[0173]
number
[0174] Mathematically expressed as Σ, where c is the molar concentration of a particular ion species and z is the absolute value of its charge. The sum Σ spans all different kinds of ions (i) in the solution.
[0175] According to this disclosure, the term “ionic strength” in some embodiments relates to the presence of monovalent ions. With respect to the presence of divalent ions, particularly divalent cations, their concentration or effective concentration (presence of free ions) is, in some embodiments, low enough to prevent nucleic acid degradation due to the presence of chelating agents. In some embodiments, the concentration or effective concentration of divalent ions is below the catalytic level for hydrolysis of phosphodiester bonds between nucleotides, such as RNA nucleotides. In some embodiments, the concentration of free divalent ions is 20 μM or less. In some embodiments, free divalent ions are absent or essentially absent.
[0176] "Osmolality by weight" refers to the concentration of a particular solute, expressed as the number of osmoles of solute per kilogram of solvent.
[0177] The terms “freeze-dry” or “freeze-drying” refer to the freeze-drying of a substance by freezing it and then reducing the ambient pressure (e.g., less than 15 Pa, e.g. less than 10 Pa, less than 5 Pa, or 1 Pa or less) to cause the freezing medium in the substance to sublimate directly from the solid phase to the gas phase. Therefore, the terms “freeze-dry” and “freeze-drying” are used interchangeably herein.
[0178] The term "spray drying" refers to the process of drying a substance by mixing a fluid that is atomized (sprayed) with a (heated) gas in a container (spray dryer), where the solvent evaporates from the formed droplets, resulting in a dry powder.
[0179] The term "reconstitute" refers to adding a solvent, such as water, to a dried product to return it to a liquid state, such as its original liquid state.
[0180] In the context of this disclosure, the term “recombinant” means “produced through genetic engineering.” In some embodiments, the “recombinant” in the context of this disclosure does not exist in nature.
[0181] As used herein, the term “naturally occurring” refers to the fact that an object can be found in nature. For example, peptides or nucleic acids that are present in living organisms (including viruses), can be isolated from natural sources, and have not been intentionally modified by humans in a laboratory are naturally occurring. The term “found in nature” means “naturally occurring” and includes known objects as well as objects that have not yet been discovered and / or isolated from nature but may be discovered and / or isolated from natural sources in the future.
[0182] As used herein, the terms “room temperature” and “ambient temperature” are used interchangeably herein and refer to temperatures of at least about 15°C, for example, about 15°C to about 35°C, about 15°C to about 30°C, about 15°C to about 25°C, or about 17°C to about 22°C. Such temperatures include 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, and 22°C.
[0183] The term "EDTA" refers to ethylenediaminetetraacetate disodium salt. All concentrations are given in relation to EDTA disodium salt.
[0184] The term "freeze-protecting agent" refers to a substance added to a formulation to protect the active ingredient during the freezing process.
[0185] The term "freeze-drying protective agent" refers to a substance added to a formulation to protect the active ingredient during the drying process.
[0186] According to this disclosure, the term “peptide” refers to a substance comprising a sequence of amino acids, up to approximately 2, 3, 4, 6, 8, 10, 13, 16, 20, and up to approximately 50, 100, or 150, linked together by peptide bonds. The term “polypeptide” refers to a larger peptide, particularly a peptide having at least approximately 151 amino acids. However, both “peptide” and “polypeptide” are protein molecules, and therefore the terms “peptide,” “protein,” and “polypeptide” are generally used interchangeably herein. In particular, the term “polypeptide,” as used herein, generally encompasses peptides and polypeptides of any length.
[0187] The term "biological activity" refers to the response of a biological system to a molecule. Such a biological system may be, for example, a cell or an organism. In some embodiments, such a response is therapeutically or pharmaceutically useful.
[0188] The term "part" refers to a fraction. In relation to an amino acid sequence or a specific structure such as a protein, the term "part" can refer to a continuous or discontinuous fraction of the structure.
[0189] The terms “part” and “fragment” are used interchangeably herein and refer to a contiguous element. For example, a part of an amino acid sequence or a structure such as a protein refers to a contiguous element of the structure. When used in relation to a composition, the term “part” means a portion of the composition. For example, a part of a composition may be any portion of the composition from 0.1% to 99.9% (e.g., 0.1%, 0.5%, 1%, 5%, 10%, 50%, 90%, or 99%).
[0190] With respect to an amino acid sequence (peptide or polypeptide), a “fragment” refers to a sequence representing a portion of the amino acid sequence, i.e., a truncated amino acid sequence at the N-terminus and / or C-terminus. A C-terminally truncated fragment (N-terminal fragment) can be obtained, for example, by translation of a truncated open reading frame lacking the 3' end of the open reading frame. An N-terminally truncated fragment (C-terminal fragment) can also be obtained, for example, by translation of a truncated open reading frame lacking the 5' end of the open reading frame, insofar as it contains a start codon that acts to initiate translation of the truncated open reading frame. An amino acid sequence fragment can include, for example, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the amino acid residues from the amino acid sequence. An amino acid sequence fragment can include, for example, at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from the amino acid sequence. A fragment of an amino acid sequence may, for example, contain up to eight, and more particularly, up to ten, twelve, fifteen, twenty, thirty, or fifty consecutive amino acid sequences.
[0191] As used herein with respect to amino acid sequences (peptides or polypeptides), “variant” means an amino acid sequence that differs from the parent amino acid sequence by at least one amino acid (e.g., a different amino acid, or a modification of the same amino acid). The parent amino acid sequence may be a natural or wild-type (WT) amino acid sequence, or a modified version of a wild-type amino acid sequence. In some embodiments, the variant amino acid sequence has at least one amino acid difference compared to the parent amino acid sequence, for example, 1 to about 20 amino acid differences compared to the parent, for example, 1 to about 10 or 1 to about 5 amino acid differences.
[0192] In this specification, “wild-type,” “WT,” or “natural” means an amino acid sequence found in nature, including allelic mutations. A wild-type amino acid sequence, peptide, or polypeptide has an amino acid sequence that has not been intentionally modified.
[0193] For the purposes of this disclosure, “variants” of an amino acid sequence (peptide or polypeptide) may include amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. The term “variant” includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allele variants, species variants, and species homologs, in particular those occurring in nature. The term “variant” also includes, in particular, fragments of an amino acid sequence.
[0194] Amino acid insertion mutants involve the insertion of one or more amino acids in a specific amino acid sequence. In the case of amino acid sequence mutants with insertions, one or more amino acid residues are inserted at a specific site in the amino acid sequence, although random insertions are also possible with appropriate screening of the resulting product. Amino acid addition mutants involve the amino-terminus and / or carboxyl-terminus fusion of one or more amino acids, e.g., 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion mutants are characterized by the removal of one or more amino acids from a sequence, e.g., 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletion can be at any position in the protein. Amino acid deletion mutants, which have a deletion at the N-terminus and / or C-terminus of the protein, are also called N-terminal and / or C-terminal cleavage mutants. Amino acid substitution mutants are characterized by the removal of at least one residue in a sequence and the insertion of another residue in its place. Modifications are preferred at positions within the amino acid sequence that are not conserved between homologous peptides or peptides, and / or by replacing amino acids with other amino acids having similar properties. In some embodiments, amino acid changes in peptide and polypeptide variants are conserved amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. Conservative amino acid changes involve the substitution of one of the families of amino acids whose side chains are related. Naturally occurring amino acids are generally divided into four families: acidic (aspartic acid, glutamic acid), basic (lysine, arginine, histidine), nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified together as aromatic amino acids.
[0195] In some embodiments, the degree of similarity, such as identity, between a given amino acid sequence and an amino acid sequence that is a variant of the given amino acid sequence is at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the degree of similarity or identity is given for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is given, for example, for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, in some embodiments for consecutive amino acids. In some embodiments, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. Alignment for determining sequence similarity, such as sequence identity, can be performed using tools known in the art, for example, using the best sequence alignment, for example, using Align, with standard settings, preferably EMBOSS::needle, matrix:Blosum62, gap start 10.0, gap extension 0.5.
[0196] "Sequence similarity" indicates the percentage of amino acids that are identical or represent a conserved amino acid substitution. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.
[0197] The terms "% identical" and "identity%" or similar terms are intended to refer specifically to the percentage of nucleotides or amino acids that are identical in the optimal alignment between the sequences being compared. The percentage is purely statistical, and the difference between the two sequences may, but not necessarily, be randomly distributed across the entire length of the sequences being compared. Comparison of two sequences is typically performed by comparing the sequences with respect to a segment or "comparison window" after optimal alignment to identify local regions of the corresponding sequences. Optimal alignment for comparison can be performed manually, or using local homology algorithms by Smith and Waterman, 1981, Ads App.Math.2, 482, by Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443, by similarity search algorithms by Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 88, 2444, or by using computer programs that employ these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA from the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.). In some embodiments, the percentage of identity between two sequences is determined using the BLASTN or BLASTP algorithm, which is available on the United States National Center for Biotechnology Information (NCBI) website (e.g., blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq).In some embodiments, the algorithm parameters used for the BLASTN algorithm on the NCBI website include: (i) an expected threshold set to 10; (ii) a word size set to 28; (iii) a maximum match within the query range set to 0; (iv) a match / mismatch score set to 1, -2; (v) a gap cost set to linear; and (vi) a filter for low complexity regions used. In some embodiments, the algorithm parameters used for the BLASTP algorithm on the NCBI website include: (i) an expected threshold set to 10; (ii) a word size set to 3; (iii) a maximum match within the query range set to 0; (iv) a matrix set to BLOSUM62; (v) a gap cost set to exist: 11, extended: 1; and (vi) a conditional composition score matrix adjustment.
[0198] The identity percentage is obtained by determining the number of identical positions in the sequences being compared, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying the result by 100.
[0199] In some embodiments, the degree of similarity or identity is given for regions that are at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, in some embodiments for consecutive nucleotides. In some embodiments, the degree of similarity or identity is given for the total length of the reference sequence.
[0200] Homologous amino acid sequences, according to this disclosure, exhibit identity of at least 40%, particularly at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, for example, at least 95%, at least 98%, or at least 99% of the amino acid residues.
[0201] The amino acid sequence variants described herein can be readily prepared by those skilled in the art, for example, by recombinant DNA manipulation. Manipulation of DNA sequences for preparing peptides or polypeptides having substitutions, additions, insertions, or deletions is described, for example, in Molecular Cloning: A Laboratory Manual, 4. th This is described in detail in Edition, MR. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012. Furthermore, the peptides, polypeptides and amino acid variants described herein can be readily prepared using known peptide synthesis techniques, such as solid-phase synthesis and similar methods.
[0202] In some embodiments, a fragment or variant of an amino acid sequence (peptide or polypeptide) is a “functional fragment” or “functional variant.” The term “functional fragment” or “functional variant” of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, i.e., functionally equivalent. With respect to an antigen or antigen sequence, one particular function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. As used herein, the term “functional fragment” or “functional variant” refers in particular to a variant molecule or sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and that still performs one or more functions of the parent molecule or sequence, for example, that can induce an immune response. In some embodiments, the modification of the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the characteristics of the molecule or sequence. In different embodiments, the function of a functional fragment or functional variant may be reduced but still significantly present; for example, the function of a functional fragment or functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of that of the parent molecule or sequence. However, in other embodiments, the function of a functional fragment or functional variant may be enhanced compared to the parent molecule or sequence.
[0203] The amino acid sequence (peptide or polypeptide) "derived from" a specified amino acid sequence (peptide or polypeptide) refers to the origin of the original amino acid sequence. In some embodiments, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to that particular sequence or fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant or fragment of that particular sequence. For example, it will be understood by those skilled in the art that antigens suitable for use herein may be modified to have a sequence different from the naturally occurring sequence from which they are derived, while retaining the desired activity of the natural sequence.
[0204] In some embodiments, “isolated” means taken out (e.g., purified) from its natural state or from an artificial composition such as a composition from a manufacturing process. For example, nucleic acids, peptides, or polypeptides that are naturally present in living animals are not “isolated,” but the same nucleic acids, peptides, or polypeptides that have been partially or completely separated from their naturally occurring coexisting substances are “isolated.” Isolated nucleic acids, peptides, or polypeptides may exist in a substantially purified form or in a non-natural environment such as a host cell.
[0205] The term “transfection” relates to the introduction of nucleic acids, particularly RNA, into cells. For the purposes of this disclosure, the term “transfection” also includes the introduction of nucleic acids into cells or the uptake of nucleic acids by such cells, where the cells may be present in a subject, e.g., a patient, or the cells may be present in vitro, e.g., outside the patient. Accordingly, according to this disclosure, the cells for nucleic acid transfection described herein may be present in vitro or in vivo, e.g., the cells may form organs, tissues, and / or parts of the patient's body. According to this disclosure, transfection may be transient or stable. In some applications of transfection, it is sufficient that the transfected genetic material is expressed only transiently. RNA can be transfected into cells to transiently express the protein it encodes. Since nucleic acids introduced in a transfection process are not typically integrated into the nuclear genome, the foreign nucleic acids are diluted or degraded by mitosis. Cells that enable episomal amplification of nucleic acids significantly reduce the dilution rate. If it is desired that the transfected nucleic acid actually remain in the genome of the cell and its daughter cells, then stable transfection must occur. Such stable transfection can be achieved, for example, by using a virus-based system or a transposon-based system for transfection. Generally, nucleic acids encoding antigens are transiently transfected into cells. RNA can be transfected into cells to transiently express the protein it encodes.
[0206] This disclosure includes analogues of peptides or polypeptides. According to this disclosure, an analogue of a peptide or polypeptide is a modified form of the peptide or polypeptide from which it is derived and possesses at least one functional property of the peptide or polypeptide. For example, a pharmacologically active analogue of a peptide or polypeptide has at least one of the pharmacological activities of the peptide or polypeptide from which the analogue is derived. Such modifications include any chemical modifications and any single or multiple substitutions, deletions and / or additions of any molecule related to the peptide or polypeptide, e.g., carbohydrates, lipids and / or peptides or polypeptides. In some embodiments, “analogues” of peptides or polypeptides include modified forms resulting from glycosylation, acetylation, phosphorylation, amidation, palmitoylation, myristoylation, isoprenylation, lipidation, alkylation, derivatization, introduction of protecting / blocking groups, proteolytic cleavage, or binding to an antibody or another cellular ligand. The term “analogue” also extends to all functional chemical equivalents of peptides and polypeptides.
[0207] As used herein, the terms “linked,” “fused,” and “fused” are interchangeable. These terms refer to the combination of two or more elements, components, or domains.
[0208] As used herein, “endogenous” means any substance produced from or within an organism, cell, tissue, or system.
[0209] As used herein, the term “exogenous” means any substance introduced from or produced outside of an organism, cell, tissue, or system.
[0210] According to various embodiments of this disclosure, nucleic acids, such as RNA encoding a peptide or polypeptide, are taken up or introduced in vitro or into a cell that may be present in the subject, i.e., transfected or transduced, resulting in the expression of the peptide or polypeptide. The cell may, for example, express the encoded peptide or polypeptide intracellularly (e.g., in the cytoplasm and / or nucleus), secrete the encoded peptide or polypeptide, and / or express it on its surface. In some embodiments, the cell secretes the encoded peptide or polypeptide.
[0211] According to this disclosure, terms such as “expressed nucleic acid” and “encoding nucleic acid” or similar terms are used interchangeably herein and, with respect to a particular peptide or polypeptide, mean that a nucleic acid can be expressed and produce a peptide or polypeptide when present in a suitable environment, such as within a cell.
[0212] In particular, the term “coding” refers to the inherent properties of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or RNA (especially mRNA), that act as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties that arise therefrom. Thus, if the transcription and translation of mRNA corresponding to a gene produces a protein in a cell or other biological system, that gene codes for a protein. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of the gene or cDNA, can be said to code for a protein or other product of that gene or cDNA.
[0213] An "open reading frame" or "ORF" is a stretch of codons that begins with a start codon and ends with a stop codon.
[0214] As used herein, the term “expression” includes the transcription and / or translation of a particular nucleotide sequence.
[0215] In the context of this disclosure, the term “transcription” refers to the process by which the genetic code in a DNA sequence is transcribed into RNA (particularly mRNA). RNA can then be translated into peptides or polypeptides.
[0216] In relation to RNA, the terms "expression" or "translation" refer to the process in the ribosome of a cell in which a strand of mRNA directs the assembly of amino acid sequences to produce a peptide or polypeptide.
[0217] The pharmaceutical formulations, in particular kits, described herein may include explanatory materials or instructions. Where used herein, “explanatory materials” or “instructions” includes publications, records, figures, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of this disclosure. The explanatory materials for the kits of this disclosure may, for example, be attached to the container containing the compositions / formulations of this disclosure, or may be shipped together with the container containing the compositions / formulations. Alternatively, the explanatory materials may be shipped separately from the container, with the intention that the explanatory materials and the compositions be used in conjunction by the recipient.
[0218] The prodrugs of specific compounds described herein are compounds that, upon administration to an individual, undergo chemical transformation under physiological conditions to provide a specific compound. Furthermore, prodrugs may be converted to specific compounds by chemical or biochemical methods in an ex vivo environment. For example, a prodrug may be slowly converted to a specific compound when placed in a transdermal patch reservoir, for example, with a suitable enzyme or chemical reagent. Exemplary prodrugs are esters (using an alcohol or carboxyl group contained in the specific compound) or amides (using an amino or carboxyl group contained in the specific compound) that are hydrolyzable in vivo. Specifically, any amino group contained in a specific compound that has at least one hydrogen atom can be converted into a prodrug form. Typical N-prodrug forms include carbamates, Mannich bases, enamines, and enaminones.
[0219] In this specification, the structural formula of a compound may represent a specific isomer of the compound. However, it should be understood that this disclosure includes all isomers and mixtures of isomers, including structurally arising geometric isomers, optical isomers based on chiral carbons, stereoisomers, and tautomers, and is not limited to the description of a specific formula. Furthermore, in this specification, the structural formula of a compound may represent a specific salt and / or solvate of the compound. However, it should be understood that this disclosure includes all salts (e.g., pharmaceutically acceptable salts) and solvates (e.g., hydrates), and is not limited to the description of a specific salt and / or solvate.
[0220] "Isomers" are compounds that have the same molecular formula but different structures ("structural isomers") or different geometric (spatial) arrangements of functional groups and / or atoms ("stereoisomers"). "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. "Racemic mixtures" or "racemates" contain equal amounts of a pair of enantiomers and are indicated by the prefix (±). "Diastereomers" are stereoisomers that are non-superimposable and not mirror images of each other. "Tautomers" are structural isomers of the same chemical substance that spontaneously and reversibly interconvert, even in pure form, due to the migration of individual atoms or groups of atoms; that is, tautomers are in dynamic chemical equilibrium with each other. An example of tautomers is the keto-enol tautomeric isomers. "Conformers" are stereoisomers that can be interconverted solely by rotation around single bonds, particularly those that result in different three-dimensional forms (conformations) of (hetero)cyclic rings such as the chair, half-chair, boat, and twist-boat forms of cyclohexane.
[0221] As used herein, the term "solvate" refers to an addition complex of a substance dissolved in a solvent (e.g., an organic solvent (e.g., aliphatic alcohols (such as methanol, ethanol, n-propanol, isopropanol, etc.), acetone, acetonitrile, ether, etc.), water, or a mixture of two or more of these liquids), and the addition complex exists in the form of a crystal or a mixed crystal. The amount of solvent included in the addition complex may be stoichiometric or non-stoichiometric. "Hydrate" is a solvate in which the solvent is water.
[0222] In an isotope-labeled compound, one or more atoms are replaced by corresponding atoms that have the same number of protons but different numbers of neutrons. For example, a hydrogen atom can be replaced by a deuterium or tritium atom. Exemplary isotopes that can be used in the present disclosure include deuterium, tritium, 11 C, 13 C, 14 C, 15 N, 18 F, 32 P, 32 S, 35 S,36 Cl, and 125 I is included.
[0223] The term "average diameter" refers to the average hydrodynamic diameter of a particle measured by dynamic light scattering (DLS) with data analysis using the so-called cumulant algorithm, which consequently has the dimension of length, known as Z. 平均 , and provides a dimensionless polydispersity index (PDI) (Koppel, D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321). Here, the "average diameter", "diameter", or "size" of the particle is Z 平均 This value is used synonymously with this value.
[0224] In some embodiments, the "polydispersion index" is calculated based on dynamic light scattering measurements by so-called cumulant analysis, as described in the definition of "average diameter." Under certain preconditions, this can be considered a measure of the size distribution of the nanoparticle aggregate.
[0225] The "radius of rotation" of a particle around its axis of rotation (R in this specification) g R (abbreviated as R) is the radial distance from the axis of rotation to the point where, assuming the entire mass of the particle is concentrated, its moment of inertia around a given axis is the same as its actual mass distribution. Mathematically, R g is the root mean square distance of the particle's components from either its center of mass or a given axis. For example, a fixed distance s from the center of mass. i The mass m located at i In the case of a polymer composed of n mass elements (i=1, 2, 3, ..., n), R g s across all mass elements i 2 It is the square root of the mass average of and can be calculated as follows:
[0226]
number
[0227] The radius of rotation can be experimentally determined or calculated, for example, by using light scattering. In particular, small scattering vectors
[0228]
number
[0229] In this case, the structure function S is defined as follows:
[0230]
number
[0231] Here, N is the number of components (Guinier's Law).
[0232] The "hydrodynamic radius" of a particle (sometimes called the "Stokes radius" or "Stokes-Einstein radius") is the radius of a hypothetical rigid sphere diffusing at the same velocity as the particle. The hydrodynamic radius is related to the particle's mobility, taking into account not only its size but also solvent effects. For example, a smaller charged particle with stronger hydration may have a larger hydrodynamic radius than a larger charged particle with weaker hydration. This is because smaller particles drag more water molecules as they move through the solution. Since the actual dimensions of particles in a solvent cannot be directly measured, the hydrodynamic radius can be defined by the Stokes-Einstein equations:
[0233]
number
[0234] Here, k Bθ is the Boltzmann constant, T is the temperature, η is the viscosity of the solvent, and D is the diffusion coefficient. The diffusion coefficient can be determined experimentally, for example, by using dynamic light scattering (DLS). Thus, one procedure for determining the hydrodynamic radius of a particle or particle ensemble (e.g., the hydrodynamic radius of particles contained in a sample or control composition disclosed herein, or the hydrodynamic radius of particle peaks obtained by subjecting such a sample or control composition to field flow fractionation) is to measure the DLS signal of the particle or particle ensemble (e.g., the DLS signal of particles contained in a sample or control composition disclosed herein, or the DLS signal of particle peaks obtained by subjecting such a sample or control composition to field flow fractionation).
[0235] As used herein, the term "light scattering" refers to a physical process in which light is deflected from a straight trajectory by one or more paths due to local non-uniformity within the medium through which it passes.
[0236] The term "UV" refers to ultraviolet light, specifically the electromagnetic spectrum band with wavelengths ranging from 10 nm to 400 nm, which is shorter than the wavelength of visible light but longer than X-rays.
[0237] As used herein, the terms “multi-angle light scattering” or “MALS” relate to techniques for measuring light scattered by a sample at multiple angles. “Multi-angle” means, in this context, that the scattered light can be detected at different discrete angles, for example, by a single detector moving over a range including a specific selected angle, or by an array of detectors fixed at a specific angular position. In certain embodiments, the light source used in MALS is a laser source (MALLS: multi-angle laser light scattering). Based on the MALS signal of a particle-containing composition, the radius of gyration (R) can be determined by using an appropriate format (e.g., Zimm plot, Berry plot, or Debye plot). g), and therefore it is possible to determine the particle size. Preferably, the Zimm plot is a graphical representation using the following equation:
[0238]
number
[0239] Here, c is the mass concentration of particles in the solvent (g / mL), and A2 is the second virial coefficient (mol·mL / g 2 ) and P(θ) is the form factor relating to the angular dependence of scattered light intensity, R θ This is the excess Rayleigh ratio (cm -1 ) and K* is 4π 2 η o (dn / dc) 2 λ0 -4 N A -1 It is an optical constant equal to η, where η o λ is the refractive index of the solvent at the incident radiation (vacuum) wavelength, λ0 is the incident radiation (vacuum) wavelength (nm), and N A Avogadro's number (mol) -1 ) where dn / dc is the differential refractive index increment (mL / g) (see, for example, Buchholz et al. (Electrophoresis 22(2001), 4118-4128); BHZimm (J.Chem.Phys.13(1945), 141; P.Debye (J.Appl.Phys.15(1944):338; and W.Burchard (Anal.Chem.75(2003), 4279-4291)). Preferably, the Berry plot is calculated using the following terms or their reciprocals:
[0240]
number
[0241] Here, c, R θ And K* are as defined above. Preferably, the Debye plot is calculated using the following terms or their reciprocals:
[0242]
number
[0243] Here, c, R θ And K* are as defined above.
[0244] As used herein, the terms “dynamic light scattering” or “DLS” refer to a technique for determining particle size and size distribution profiles, particularly with respect to the hydrodynamic radius of the particles. A monochromatic light source, usually a laser, is incident on the sample through a polarizer. The scattered light then passes through a second polarizer, where it is detected, and the resulting image is projected onto a screen. Particles in the solution strike the light, causing it to diffract in all directions. The diffracted light from the particles can interfere constructively (bright regions) or destructively (dark regions). This process is repeated at short time intervals, and the resulting set of speckle patterns is analyzed by an autocorrelator that compares the intensity of light at each spot over time.
[0245] As used herein, the terms “static light scattering” or “SLS” refer to a technique for determining particle size and size distribution profiles, particularly with respect to the particle’s radius of gyration and / or molar mass. High-intensity monochromatic light, usually a laser, is emitted into a solution containing particles. One or more detectors are used to measure the scattering intensity at one or more angles. Angle dependence is necessary to obtain accurate measurements of both the molar mass and size of all polymers at the radius. Thus, simultaneous measurements at several angles with respect to the direction of incident light, known as multi-angle light scattering (MALS) or multi-angle laser light scattering (MALLS), are generally considered a standard embodiment of static light scattering.
[0246] As used herein, the terms “microRNA” or “miRNA” refer to a class of small, naturally occurring non-coding RNA molecules, approximately 19–25 nucleotides long, e.g., approximately 21–25 nucleotides long, that bind to polynucleotides, e.g., RNA, and function to regulate gene expression in a variety of ways, including translational repression, RNA cleavage, and deadenylation.
[0247] As used herein, the term “miRNA-binding sequence” refers to a sequence in a polynucleotide having a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of a miRNA, such as an oligoribonucleotide sequence in RNA, such as mRNA, or an analogue thereof. The miRNA-binding sequence may be located in the 5'UTR, 3'UTR, or a combination thereof. In some embodiments, the miRNA-binding sequence is located in the 3'UTR. In some embodiments, the miRNA-binding sequence has sufficient complementarity to all or one region of the miRNA in order to interact with, associate with, or bind to the miRNA. In some embodiments, the miRNA-binding sequence has sufficient complementarity to the miRNA in order to facilitate miRNA-mediated regulation of the polynucleotide, such as miRNA-mediated repression or degradation of the polynucleotide. In some embodiments, a miRNA-binding sequence having sufficient complementarity to the miRNA means a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, such as miRNA-induced RNA-induced silencing complex (RISC)-mediated cleavage of RNA, such as mRNA.
[0248] As used herein, the term “oligonucleotide” refers to polymers of nucleotides, including naturally occurring nucleotides, nucleotides not naturally occurring, derivatized nucleotides, or combinations thereof. Non-exclusive examples of nucleotides and their derivatives are described herein.
[0249] As used herein, the term “oligo-ribonucleotide” refers to polymers of nucleotides, including naturally occurring ribonucleotides, ribonucleotides not found in nature, derivatized ribonucleotides, or combinations thereof. Non-exclusive examples of ribonucleotides and their derivatives are described herein.
[0250] As used herein, the term “complementary” refers to the ability of a nucleotide or its analogue to form a Watson-Crick base pair. Complementary nucleotide sequences form Watson-Crick base pairs, while non-complementary nucleotide sequences do not.
[0251] In this specification, the term "upstream" is used to refer to a position toward the 5' end of a polynucleotide from a specific reference point.
[0252] In this specification, the term "downstream" is used to refer to a position toward the 3' end of a polynucleotide from a specific reference point.
[0253] nucleic acid The term “nucleic acid” includes deoxyribonucleic acid (DNA), ribonucleic acid (RNA), combinations thereof, and modified forms thereof. The term includes genomic DNA, cDNA, mRNA, recombinantly produced molecules, and chemically synthesized molecules. In some embodiments, nucleic acid is DNA. In some embodiments, nucleic acid is RNA. In some embodiments, nucleic acid is a mixture of DNA and RNA. Nucleic acid may exist as single-stranded or double-stranded and linear or covalently bounded molecules. Nucleic acid can be isolated. According to this disclosure, “isolated nucleic acid” means that the nucleic acid is (i) amplified in vitro, for example by polymerase chain reaction (PCR) of DNA or in vitro transcription of RNA (for example using RNA polymerase), (ii) recombinantly produced by cloning, (iii) purified, for example by separation by cleavage and gel electrophoresis, or (iv) synthesized, for example by chemical synthesis.
[0254] The term "nucleoside" (abbreviated as "N" herein) refers to compounds that can be considered as nucleotides without a phosphate group. A nucleoside is a nucleic acid base bonded to a sugar (e.g., ribose or deoxyribose), while a nucleotide consists of a nucleoside and one or more phosphate groups. Examples of nucleosides include cytidine, uridine, pseudouridine, adenosine, and guanosine.
[0255] The five standard nucleosides that make up naturally occurring nucleic acids are uridine, adenosine, thymidine, cytidine, and guanosine. These five nucleosides are commonly abbreviated as the single-letter codes U, A, T, C, and G, respectively. However, thymidine is more commonly denoted as "dT" (where "d" stands for "deoxy") because it contains a 2'-deoxyribofuranose moiety rather than the ribofuranose ring found in uridine. This is because thymidine is found in deoxyribonucleic acid (DNA) rather than ribonucleic acid (RNA). Conversely, uridine is found in RNA rather than DNA. The remaining three nucleosides can be found in both RNA and DNA. In RNA, they are represented as A, C, and G, while in DNA, they are represented as dA, dC, and dG.
[0256] In some embodiments, the modified purine (A or G) or pyrimidine (C, T, or U) base moiety consists of one or more alkyl groups, for example, one or more C 1-4 Modified by alkyl groups, for example, one or more methyl groups. Specific examples of modified purine or pyrimidine base moieties include N 7 -alkyl-guanine, N 6 -Alkyl-adenine, 5-alkyl-cytosine, 5-alkyl-uracil, and N(1)-alkyluracil, e.g., N 7 -C 1-4 Alkyl-guanine, N 6 -C 1-4 Alkyl-adenine, 5-C 1-4 Alkyl-cytosine, 5-C 1-4Alkyl-uracil and N(1)-C 1-4 Alkyl-uracil, preferably N 7 -methyl-guanine, N 6 Examples include methyl-adenine, 5-methyl-cytosine, 5-methyl-uracil, and N(1)-methyluracil.
[0257] DNA In this specification, the term “DNA” refers to nucleic acid molecules consisting entirely or at least substantially of deoxyribonucleotide residues. In preferred embodiments, DNA comprises all or most of the deoxyribonucleotide residues. As used herein, “deoxyribonucleotide” refers to a nucleotide lacking a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. DNA includes, but is not limited to, double-stranded DNA, single-stranded DNA, isolated DNA such as partially purified DNA, essentially pure DNA, synthetic DNA, recombinant DNA, and modified DNA that differs from naturally occurring DNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations may refer to the addition of non-nucleotide material to internal DNA nucleotides or to the ends (one or both) of DNA. In this specification, nucleotides in DNA are also construed to be non-standard nucleotides such as chemically synthesized nucleotides or ribonucleotides. In this disclosure, these modified DNAs are considered analogues of naturally occurring DNA. A molecule contains “a majority of deoxyribonucleotide residues” if the content of deoxyribonucleotide residues in the molecule exceeds 50% (e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues in the molecule is the sum of all nucleotide residues (whether the nucleotide residues are standard (i.e., naturally occurring) nucleotide residues or analogues thereof).
[0258] DNA can be recombinant DNA and can be obtained by cloning nucleic acids, particularly cDNA. cDNA can be obtained by reverse transcription of RNA.
[0259] RNA The term “RNA” refers to nucleic acid molecules containing ribonucleotide residues. In preferred embodiments, RNA comprises all or most of the ribonucleotide residues. As used herein, “ribonucleotide” refers to a nucleotide having a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. RNA includes, but is not limited to, isolated RNA such as double-stranded RNA, single-stranded RNA, partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, and modified RNA which differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations may refer to the addition of non-nucleotide material to internal RNA nucleotides or to the ends (one or both) of RNA. In this disclosure, nucleotides in RNA may also be non-standard nucleotides such as chemically synthesized nucleotides or deoxynucleotides. In this disclosure, these altered / modified nucleotides may be referred to as analogs of naturally occurring nucleotides, and the corresponding RNA containing such altered / modified nucleotides (i.e., altered / modified RNA) may be referred to as analogs of naturally occurring RNA. A molecule contains “the majority of ribonucleotide residues” if the content of ribonucleotide residues in the molecule exceeds 50% (e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues in a molecule is the sum of all nucleotide residues (whether the nucleotide residues are standard (i.e., naturally occurring) nucleotide residues or analogues thereof).
[0260] "RNA" includes mRNA, tRNA, ribosomal RNA (rRNA), nuclear small RNA (snRNA), self-amplified RNA (saRNA), trans-amplified RNA (taRNA), single-stranded RNA (ssRNA), dsRNA, inhibitory RNA (e.g., antisense ssRNA, small interfering RNA (siRNA), or microRNA (miRNA)), activating RNA (e.g., small activating RNA), and immunostimulatory RNA (isRNA). In some embodiments, "RNA" refers to mRNA.
[0261] As used herein, the terms “in vitro transcription” or “IVT” mean that transcription (i.e., RNA production) is performed without the use of cells. That is, IVT uses a transcription mechanism extracted from cells (e.g., cell lysates or their isolated components containing RNA polymerase (preferably T7, T3, or SP6 polymerase)) rather than living / cultured cells.
[0262] According to this disclosure, the term “RNA” includes “mRNA.” According to this disclosure, the term “mRNA” means “messenger RNA” and includes “transcripts” that can be produced by using a DNA template. Generally, mRNA encodes a peptide or polypeptide.
[0263] Although mRNA is single-stranded, it may contain self-complementary sequences that allow a portion of the mRNA to fold and pair with itself to form a double helix.
[0264] According to this disclosure, "dsRNA" means double-stranded RNA, which is RNA having two partially or completely complementary strands.
[0265] In preferred embodiments of this disclosure, mRNA refers to an RNA transcript encoding a peptide or polypeptide.
[0266] In some embodiments, the mRNA encoding the peptide or polypeptide preferably has a length of at least 45 nucleotides (e.g., at least 60, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000 nucleotides), preferably up to 15,000, for example up to 14,000, up to 13,000, up to 12,000 nucleotides, up to 11,000 nucleotides, or up to 10,000 nucleotides).
[0267] As is established in the art, mRNA generally comprises a 5' untranslated region (5'-UTR), a peptide / polypeptide coding region, and a 3' untranslated region (3'-UTR). In some embodiments, mRNA is produced by in vitro transcription or chemical synthesis. In some embodiments, mRNA is produced by in vitro transcription using a DNA template. In vitro transcription methods are known to those skilled in the art; for example, Molecular Cloning: A Laboratory Manual, 4 thSee Edition, MR. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012. Furthermore, various in vitro transcription kits are commercially available from, for example, Thermo Fisher Scientific (TranscriptAid® T7 kit, MEGAscript® T7 kit, MAXIscript®, etc.), New England BioLabs Inc. (HiScribe® T7 kit, HiScribe® T7 ARCA mRNA kit, etc.), Promega (RiboMAX®, HeLaScribe®, Riboprobe® systems, etc.), Jena Bioscience (SP6 or T7 transcription kit, etc.), and Epicentre (AmpliScribe®, etc.). To provide modified mRNA, correspondingly modified nucleotides, such as modified naturally occurring nucleotides, unnaturally occurring nucleotides, and / or modified unnaturally occurring nucleotides, can be incorporated during synthesis (preferably in vitro transcription), or modifications can be performed in mRNA after transcription and / or modifications can be added to mRNA.
[0268] In some embodiments, the RNA is in vitro transcription RNA (IVT-RNA), which can be obtained by in vitro transcription of a suitable DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. Specific examples of RNA polymerases are T7, T3, and SP6 RNA polymerases. Preferably, in vitro transcription is controlled by the T7 or SP6 promoter. The DNA template for in vitro transcription can be obtained by cloning nucleic acid, particularly cDNA, and introducing it into a suitable vector for in vitro transcription. cDNA can be obtained by reverse transcription of RNA.
[0269] In some embodiments of this disclosure, RNA is “replicon RNA” or simply “replicon,” in particular “self-replicating RNA” or “self-amplifying RNA.” In certain embodiments, the replicon or self-replicating RNA is derived from or contains elements derived from ssRNA viruses, particularly positive-strand ssRNA viruses such as alphaviruses. Alphaviruses are typical representatives of positive-strand RNA viruses. Alphaviruses replicate in the cytoplasm of infected cells (for a review of the alphavirus life cycle, see Jose et al., Future Microbiol., 2009, vol. 4, pp. 837–856). The whole genome length of many alphaviruses is typically in the range of 11,000–12,000 nucleotides, and the genomic RNA typically has a 5' cap and a 3' poly(A) tail. The alphavirus genome encodes non-structural proteins (involved in the transcription, modification, and replication of viral RNA, as well as protein modification) and structural proteins (forming the viral particle). Typically, there are two open reading frames (ORFs) in the genome. The four non-structural proteins (nsP1-nsP4) are typically encoded together by a first ORF beginning near the 5' end of the genome, while the alphaviral structural proteins are found downstream of the first ORF and are encoded together by a second ORF extending near the 3' end of the genome. Typically, the first ORF is larger than the second ORF, with a ratio of approximately 2:1. In cells infected with alphavirus, only the nucleic acid sequences encoding non-structural proteins are translated from the genomic RNA, while the genetic information encoding structural proteins is translatable from subgenomic transcripts, which are RNA molecules similar to eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol.87, pp.111-124). After infection, i.e., in the early stages of the viral life cycle, the (+) strand genomic RNA acts directly like messenger RNA for the translation of the open reading frame encoding the non-structural polyprotein (nsP1234).
[0270] Alphavirus-derived vectors have been proposed for delivering foreign genetic information to target cells or target organisms. A simple approach involves replacing an open reading frame encoding an alphavirus structural protein with an open reading frame encoding the protein of interest. Alphavirus-based trans replication (trans amplification) systems rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules: one nucleic acid molecule encodes a viral replicase, and the other nucleic acid molecule can be replicated in trans by the replicase (hence the name trans replication system). Trans replication requires the presence of both of these nucleic acid molecules in a given host cell. The nucleic acid molecule that can be replicated in trans by the replicase must contain specific alphavirus sequence elements to enable recognition and RNA synthesis by the alphavirus replicase.
[0271] In some embodiments of the present disclosure, the RNA (particularly mRNA) described herein (e.g., contained in the compositions / formulations of the present disclosure and / or used in the methods of the present disclosure) includes one or more modifications to, for example, enhance its stability and / or increase its translation efficiency and / or decrease its immunogenicity and / or decrease its cytotoxicity. For example, to increase the expression of RNA (particularly mRNA), modifications may be made within the coding region, i.e., the sequence encoding the peptide or polypeptide to be expressed, without altering the sequence of the peptide or polypeptide to be expressed. Such modifications are described, for example, in International Publication No. 2007 / 036366 and PCT / EP2019 / 056502 and include: 5' cap structure; extension or cleavage of the naturally occurring poly(A) tail; modification of the 5' and / or 3' untranslated region (UTR), e.g., introduction of a UTR unrelated to the coding region of the RNA; substitution of one or more naturally occurring nucleotides with synthetic nucleotides; and codon optimization (e.g., to alter, preferably increase, the GC content of the RNA). The combinations of modifications described above, namely the incorporation of a 5' cap structure, the incorporation of a poly(A) sequence, the unmasking of a poly(A) sequence, the modification of the 5'-UTR and / or 3'-UTR (such as the incorporation of one or more 3'-UTRs), the replacement of one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine in the case of cytidine, and / or pseudouridine (Ψ) or N(1)-methylpseudridine (m1Ψ) or 5-methyluridine (m5U) in the case of uridine), and codon optimization, have a synergistic effect on increasing the stability and translation efficiency of RNA (preferably mRNA).Accordingly, in some embodiments, the RNA (in particular mRNA) described herein includes a combination of at least two, at least three, at least four or all five of the modifications described above, namely (i) incorporation of a 5' cap structure, (ii) incorporation of a polyA sequence, unmasking of a polyA sequence, (iii) modification of the 5'-UTR and / or 3'-UTR (such as incorporation of one or more 3'-UTRs), (iv) replacement of one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine in the case of cytidine, and / or pseudouridine (Ψ) or N(1)-methylpseudridine (m1Ψ) or 5-methyluridine (m5U) in the case of uridine), and (v) codon optimization.
[0272] 5' Cap In some embodiments, the RNA (in particular mRNA) described herein includes a 5' cap structure. In some embodiments, the RNA does not have an uncapped 5'-triphosphate. In some embodiments, the RNA (in particular mRNA) may include a conventional 5' cap and / or a 5' cap analogue. The term “conventional 5' cap” refers to a cap structure found at the 5' end of an RNA molecule, and generally includes guanosine 5'-triphosphate (Gppp) ligated to the 5' end of the next nucleotide of the RNA via its triphosphate moiety (i.e., guanosine is ligated to the rest of the RNA via a 5'-5' triphosphate bond). Guanosine is N 7 It can be methylated at the position (cap structure m 7 (resulting in Gppp). The term "5' cap analogue" is based on the conventional 5' cap, but to avoid inverted incorporation of the 5' cap analogue, m 7The guanosine structure includes a 5' cap modified at either the 2' or 3' position (such 5' cap analogs are also called anti-reverse cap analogs (ARCA)). Particularly preferred 5' cap analogs are those having one or more substitutions on the crosslinked and uncrosslinked oxygen atoms in the phosphate crosslink, as described in PCT / EP2019 / 056502, for example, phosphorothioate-modified 5' cap analogs at β-phosphate (e.g., m2 7,2’O This is G(5')ppSp(5')G (referred to as beta-S-ARCA or β-S-ARCA). Providing RNA (especially mRNA) having the 5' cap structure described herein can be achieved by in vitro transcription of a DNA template in the presence of the corresponding 5' cap compound, the 5' cap structure being co-transcribed into the resulting RNA (especially mRNA) strand, or the RNA (especially mRNA) may be generated, for example, by in vitro transcription, and the 5' cap structure may be conjugated to the RNA post-transcriptionally using a capping enzyme, such as the capping enzyme of vaccinia virus.
[0273] In some embodiments, RNA (particularly mRNA) is m2 7,2’O G(5')ppSp(5')G (especially its D1 diastereoma), m2 7,3’O G(5')ppp(5')G, and m2 7,3’-O Gppp(m1 2’-O )Includes a 5' cap structure selected from the group consisting of ApG. In some embodiments, RNA has m2 as the 5' cap structure. 7,2’O It includes G(5')ppSp(5')G (especially its D1 diastereoma). In some embodiments, the RNA has m2 as the 5' cap structure. 7,3’-O Gppp(m1 2’-O ) Includes ApG.
[0274] In some embodiments, RNA (particularly mRNA) includes cap 0, cap 1, or cap 2, preferably cap 1 or cap 2. According to this disclosure, the term "cap 0" refers to the structure "m 7"GpppN" means, where N is any nucleoside having an OH moiety at the 2' position. According to this disclosure, the term "cap 1" means structure "m 7 "GpppNm" means any nucleoside having an OCH3 moiety at the 2' position. According to this disclosure, the term "cap 2" means structure "m 7 This means "GpppNmNm", where each Nm is an arbitrary nucleoside that independently has an OCH3 moiety at the 2' position.
[0275] The 5' cap analog β-S-ARCA (β-S-ARCA) has the following structure:
[0276] [ka]
[0277] "Beta-S-ARCA D1 diastereoma" or "Beta-S-ARCA(D1)" is a diastereoma of Beta-S-ARCA that elutes first on the HPLC column and therefore exhibits a shorter retention time compared to the Beta-S-ARCA D2 diastereoma (Beta-S-ARCA(D2)). HPLC is preferably analytical HPLC. In some embodiments, a Supelcosil LC-18-T RP column in a preferred 5 μm, 4.6 × 250 mm format is used for separation, thereby allowing a flow rate of 1.3 ml / min. In some embodiments, a methanol gradient in ammonium acetate is used, for example, a 0-25% linear gradient of methanol in 0.05 M ammonium acetate within 15 minutes, pH = 5.9. UV detection (VWD) can be performed at 260 nm, and fluorescence detection (FLD) can be performed with excitation at 280 nm and detection at 337 nm.
[0278] 5' cap analogue m2, which is the building block of cap 1. 7,3’-O Gppp(m1 2’-O )ApG(m2 7,3’O G(5')ppp(5')m 2’-OApG (also known as ApG) has the following structure:
[0279] [ka]
[0280] An exemplary cap 0 mRNA containing β-S-ARCA and mRNA has the following structure:
[0281] [ka]
[0282] m2 7,3’O An exemplary cap 0 mRNA containing G(5')ppp(5')G and mRNA has the following structure:
[0283] [ka]
[0284] m2 7,3’-O Gppp(m1 2’-O )An exemplary cap 1 mRNA containing ApG and mRNA has the following structure:
[0285] [ka]
[0286] Poly A tail As used herein, the terms “polyA tail” or “polyA sequence” typically refer to a continuous or discontinuous sequence of adenylate residues located at the 3' end of an RNA (especially mRNA) molecule. PolyA tails or polyA sequences are known to those skilled in the art and may follow the 3'-UTR of the RNA (especially mRNA) described herein. A continuous polyA tail is characterized by a sequence of adenylate residues. In nature, continuous polyA tails are typical. The RNA (especially mRNA) disclosed herein may have a polyA tail that is attached to the free 3' end of the RNA by template-independent RNA polymerase after transcription, or a polyA tail encoded by DNA and transcribed by template-dependent RNA polymerase.
[0287] The polyA tail, consisting of approximately 120 A nucleotides, has been shown to have beneficial effects on RNA levels and protein levels translated from the open reading frame located upstream (5' end) of the polyA tail in transfected eukaryotic cells (Holtkamp et al., 2006, Blood, vol.108, pp.4009-4017).
[0288] The poly-A tail can be of any length. In some embodiments, the poly-A tail contains, essentially consists of, or comprises at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, particularly about 120 A nucleotides. In this context, “essentially consists of” means that most of the nucleotides in the poly-A tail, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the number of nucleotides in the poly-A tail are A nucleotides, but the remaining nucleotides may be other nucleotides, such as U nucleotides (uridylic acid), G nucleotides (guanylic acid), or C nucleotides (cytidylic acid). In this context, "consisting of" means that all nucleotides in the polyA tail, i.e., 100% of the nucleotides in the polyA tail, are A nucleotides. The term "A nucleotide" or "A" refers to adenylic acid.
[0289] In some embodiments, the poly(A) tail is bound during RNA transcription, for example, during the preparation of in vitro transcription RNA, based on a DNA template containing repeating dT nucleotides (deoxythymidylate) in a strand complementary to the coding strand. The DNA sequence encoding the poly(A) tail (coding strand) is called the poly(A) cassette.
[0290] In some embodiments, poly(A) cassettes present in the coding strand of DNA are essentially composed of dA nucleotides but interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such random sequences may be 5–50, 10–30, or 10–20 nucleotides long. Such cassettes are disclosed in International Publication 2016 / 005324 A1, which is incorporated herein by reference. Any poly(A) cassette disclosed in International Publication 2016 / 005324 A1 may be used in this disclosure. Poly(A) cassettes, essentially composed of dA nucleotides but having an equal distribution of four nucleotides (dA, dC, dG, and dT) and interrupted by a random sequence having, for example, a length of 5–50 nucleotides, are still associated with beneficial properties in terms of sustained plasmid DNA growth in Escherichia coli (E. coli) at the DNA level and supporting RNA stability and translation efficiency at the RNA level. As a result, in some embodiments, the poly-A tail contained in the RNA (particularly mRNA) molecules described herein consists essentially of A nucleotides but is interrupted by a random sequence of four nucleotides (A, C, G, U). Such a random sequence may be 5–50, 10–30, or 10–20 nucleotides long.
[0291] In some embodiments, the poly(A) tail contains 30 adenine nucleotides followed by 70 adenine nucleotides, with the 30 adenine nucleotides and the 70 adenine nucleotides separated by a linker sequence of 10 nucleotides.
[0292] In some embodiments, nucleotides other than A nucleotides are not adjacent to the polyA tail at their 3' end, i.e., the polyA tail is not masked or followed by nucleotides other than A at its 3' end.
[0293] In some embodiments, the polyA tail may contain at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the polyA tail may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the polyA tail may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 nucleotides, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the polyA tail includes the polyA tail shown in Sequence ID No. 4. In some embodiments, the polyA tail contains at least 100 nucleotides. In some embodiments, the polyA tail contains about 150 nucleotides. In some embodiments, the polyA tail contains about 120 nucleotides.
[0294] In some embodiments, the RNA includes a poly-A tail containing the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence of SEQ ID NO: 4.
[0295] Untranslated area (UTR) In some embodiments, the RNA (particularly mRNA) described herein includes a 5'-UTR and / or a 3'-UTR. The terms “untranslated region” or “UTR” refer to a region within a DNA molecule that is transcribed but not translated into an amino acid sequence, or a corresponding region within an RNA molecule such as an mRNA molecule. Untranslated regions (UTRs) may be located on the 5' side (upstream) (5'-UTR) and / or the 3' side (downstream) (3'-UTR) of the open reading frame. The 5'-UTR, if present, is located at the 5' end upstream of the start codon of the protein-coding region. The 5'-UTR is downstream of the 5' cap (if present), for example, directly adjacent to the 5' cap. The 3'-UTR, if present, is located at the 3' end downstream of the stop codon of the protein-coding region, although the term “3'-UTR” generally does not include a polyA sequence. Thus, the 3'-UTR is upstream of a polyA sequence (if present), for example, directly adjacent to the polyA sequence. The incorporation of 3'-UTRs into the 3' untranslated region of an RNA (preferably mRNA) molecule can improve translation efficiency. Synergistic effects can be achieved by incorporating two or more such 3'-UTRs (preferably arranged in a head-tail orientation; see, e.g., Holtkamp et al., Blood 108, 4009-4017 (2006)). The 3'-UTRs can be self- or heterologous to the RNA (e.g., mRNA) into which they are introduced.
[0296] In some embodiments, the 5'-UTR is or comprises the 5'-UTR of modified human alpha-globin. A particularly preferred 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the 3'-UTR comprises a first sequence derived from the amino-terminal enhancer (AES) messenger RNA of the split and a second sequence derived from the mitochondrial-encoded 12S ribosomal RNA. A particularly preferred 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the 3'-UTR includes a first sequence comprising, or consisting thereof, the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising, or consisting thereof, the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence of SEQ ID NO: 2.
[0297] In some embodiments, the RNA includes a 5'-UTR comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence of SEQ ID NO: 5.
[0298] In some embodiments, the RNA includes a 3'-UTR comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence of SEQ ID NO: 3.
[0299] chemical modification The RNA (especially mRNA) described herein may have modified ribonucleotides to enhance its stability and / or reduce its immunogenicity and / or cytotoxicity. For example, in some embodiments, uridine in the RNA (especially mRNA) described herein is replaced (partially or completely, preferably completely) with a modified nucleoside. In some embodiments, the modified nucleoside is a modified uridine.
[0300] In some embodiments, the modified uridines that substitute for uridine are selected from the group consisting of pseudouridine (ψ), N1-methyl-pseudridine (m1ψ), 5-methyl-uridine (m5U), and combinations thereof.
[0301] In some embodiments, the modified nucleoside that replaces uridine in RNA (partially or completely, preferably completely) is 3-methyluridine (m3U), 5-methoxyuridine (mo5U), 5-azauridine, 6-azauridine, 2-thio-5-azauridine, 2-thiouridine (s2U), 4-thiouridine (s4U), 4-thio-pseudridine, 2-thio-pseudridine, 5-hydroxyuridine (ho5U), 5-aminoallyluridine, 5-halouridine (e.g., 5-iodouridine or 5-bromo-uridine). Uridine, Uridine 5-oxyacetic acid (cmo5U), Uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudruridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5- Tylaminomethyluridine (mnm5U), 1-ethyl-pseuduridine, 5-methylaminomethyl-2-thiouridine (mnm5s2U), 5-methylaminomethyl-2-selenouridine (mnm5se2U), 5-carbamoylmethyluridine (ncm5U), 5-carboxymethylaminomethyluridine (cmnm5U), 5-carboxymethylaminomethyl-2-thiouridine (cmnm5s2U), 5-propynyluridine, 1-propynyl-pseuduridine, 5-taurinomethyluridine (τm5U), 1-taurinomethyluridine Chil-pseuduridine, 5-taurinomethyl-2-thio-uridine (τm5s2U), 1-taurinomethyl-4-thio-pseuduridine), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseuduridine (m1s4Ψ), 4-thio-1-methyl-pseuduridine, 3-methyl-pseuduridine (m3Ψ), 2-thio-1-methyl-pseuduridine, 1-methyl-1-deaza-pseuduridine, 2-thio-1-methyl-1-deaza-pseuduridine, dihydrouridine (D), dihydropseuduridine, 5,6-Dihydrouridine, 5-Methyl-Dihydrouridine (m5D), 2-Thio-Dihydrouridine, 2-Thio-Dihydropsuduridine, 2-Methoxy-uridine, 2-Methoxy-4-Thio-uridine, 4-Methoxypsuduridine, 4-Methoxy-2-Thio-psuduridine, N1-Methylpsuduridine, 3-(3-Amino-3-Carboxypropyl)uridine (acp3U), 1-Methyl-3-(3-Amino-3-Carboxypropyl)psuduridine (acp3Ψ), 5-(Isopentenylaminomethyl)uridine (inm5U), 5-(Isopentenylaminomethyl)-2-Thio-uridine (inm5s2U), α-Thio-uridine, 2'-O-Methyl-uridine (Um), 5,2'-O-Dimethyl-uridine (m5Um), 2'-O-Methyl-Shu It may be one or more of the following modified uridines known in the art: doluridine (Ψm), 2-thio-2'-O-methyluridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 3,2'-O-dimethyluridine (m3Um), 5-(isopentenylaminomethyl)-2'-O-methyluridine (inm5Um), 1-thiouridine, deoxythymidine, 2'-F-ala-uridine, 2'-F-uridine, 2'-OH-ala-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.
[0302] RNA (preferably mRNA) modified with pseudouridine (partially or completely, preferably completely, substituting uridine) is referred to herein as “Ψ-modified,” and the term “m1Ψ-modified” means that the RNA (preferably mRNA) contains N(1)-methylpseudridine (partially or completely, preferably completely, substituting uridine). Furthermore, the term “m5U-modified” means that the RNA (preferably mRNA) contains 5-methyluridine (partially or completely, preferably completely, substituting uridine). Such Ψ-modified, m1Ψ-modified, or m5U-modified RNAs typically exhibit reduced immunogenicity compared to their unmodified forms and are therefore preferred in applications where the induction of an immune response should be avoided or minimized. In some embodiments, the RNA (preferably mRNA) contains N(1)-methylpseudridine that completely substitutes uridine.
[0303] Codon optimization and GC enrichment The codons of the RNA (particularly mRNA) described herein may be further optimized, for example, to increase the GC content of the RNA and / or to replace rare codons in the cell (or subject) in which the peptide or polypeptide of interest is to be expressed with codons that are synonymous and more frequent in the cell (or subject). In some embodiments, the amino acid sequence encoded by the RNA (particularly mRNA) described herein is encoded by a codon-optimized coding sequence and / or a coding sequence in which its G / C content is increased compared to the wild-type coding sequence. This also includes embodiments in which one or more sequence regions of the coding sequence are codon-optimized and / or have increased G / C content compared to the corresponding sequence regions of the wild-type coding sequence. In some embodiments, the codon optimization and / or increased G / C content preferably do not alter the sequence of the encoded amino acid sequence.
[0304] The term “codon-optimized” refers to the modification of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage frequency of a host organism, preferably without altering the amino acid sequence encoded by the nucleic acid molecule. In the context of this disclosure, the coding region may be codon-optimized for optimal expression in a target treated with the RNA (particularly mRNA) described herein. Codon optimization is based on the finding that translation efficiency is also determined by the different frequencies of tRNA appearance in a cell. Thus, the sequence of RNA (particularly mRNA) may be modified so that codons where frequently occurring tRNA is available are inserted in place of “rare codons.”
[0305] In some embodiments, the guanosine / cytosine (G / C) content of the coding region of the RNA (particularly mRNA) described herein is increased compared to the G / C content of the corresponding coding sequence of wild-type RNA, and the amino acid sequence encoded by the RNA is preferably unmodified compared to the amino acid sequence encoded by wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region being translated is important for the efficient translation of that RNA. Sequences with increased G (guanosine) / C (cytosine) content are more stable than sequences with increased A (adenosine) / U (uracil) content. With respect to the fact that some codons encode exactly the same amino acids (so-called degeneracy of the genetic code), it is possible to determine the most preferred codon for stability (so-called alternative codon usage frequency). Depending on the amino acids encoded by the RNA, there are various possibilities for modification of the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleotides can be modified by substituting these codons with other codons that encode the same amino acids but do not contain A and / or U or contain lower amounts of A and / or U nucleotides.
[0306] In various embodiments, the G / C content of the coding region of the RNA (particularly mRNA) described herein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, or more, compared to the G / C content of the coding region of wild-type RNA.
[0307] non-immunogenic RNA In some embodiments, the RNA (particularly mRNA) described herein, such as RNA encoding a vaccine antigen, is non-immunogenic. RNA encoding an immunostimulant may be administered in accordance with this disclosure to provide an adjuvant effect. The RNA encoding the immunostimulant may be standard RNA or non-immunogenic RNA.
[0308] As used herein, the term “non-immunogenic RNA” (e.g., “non-immunogenic mRNA”) refers to RNA that does not induce an immune response when administered to mammals, for example, or induces a weaker response than that induced by the same RNA, which is only different in that it has not undergone the modification and processing that makes it non-immunogenic; i.e., RNA that induces a weaker response than that induced by standard RNA (stdRNA). In certain embodiments, non-immunogenic RNA is made non-immunogenic by incorporating a modified nucleoside into the RNA that suppresses RNA-mediated activation of innate immune receptors, and / or by limiting the amount of double-stranded RNA (dsRNA), for example by restricting the formation of double-stranded RNA (dsRNA) during in vitro transcription, and / or by removing double-stranded RNA (dsRNA), for example after in vitro transcription. In certain embodiments, non-immunogenic RNA is made non-immunogenic by incorporating a modified nucleoside into the RNA that suppresses RNA-mediated activation of innate immune receptors, and / or by removing double-stranded RNA (dsRNA), for example after in vitro transcription.
[0309] To render non-immunogenic RNA (especially mRNA) by incorporating modified nucleosides, any modified nucleoside can be used as long as it reduces or suppresses the immunogenicity of the RNA. Modified nucleosides that suppress the RNA-mediated activation of innate immune receptors are particularly preferred. In some embodiments, the modified nucleoside comprises the substitution of one or more uridines with nucleosides containing a modified nucleobase. In some embodiments, the modified nucleobase is a modified uracil. In some embodiments, the nucleoside containing a modified nucleobase is 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid (cmo 5 U), methyl ester of uridine 5-oxyacetic acid (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm 5 U), methyl ester of 5-carboxyhydroxymethyl-uridine (mchm 5 U), 5-methoxycarbonylmethyl-uridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm 5 s 2 U), 5-aminomethyl-2-thio-uridine (nm 5 [[ID=?]] 2 s 2 U), 5-methylaminomethyl-uridine (mnm 5 U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uridine (mnm 5se 2 U), 5-carbamoylmethyl-uridine (ncm 5 U), 5-carboxymethylaminomethyl-uridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm 5 s 2 U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine (τm5s2U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 Ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 Ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m 5 D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 Ψ), 5-(isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm 5 s 2 U), α-thio-uridine, 2’-O-methyl-uridine (Um), 5,2’-O-dimethyl-uridine (m 5 Um), 2’-O-methyl-pseudouridine (Ψm), 2-thio-2’-O-methyl-uridine (s2 Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm 5 Um), 5-Carbamoylmethyl-2'-O-methyluridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm 5 Um), 3,2'-O-dimethyluridine (m 3 Um), 5-(isopentenylaminomethyl)-2'-O-methyluridine(inm 5 The group is selected from Um), 1-thiouridine, deoxythymidine, 2'-F-alar-uridine, 2'-F-uridine, 2'-OH-alar-uridine, 5-(2-carbomethoxyvinyl)uridine, and 5-[3-(1-E-propenylamino)uridine. In certain embodiments, the nucleoside containing the modified nucleic acid base is pseudouridine (ψ), N1-methyl-pseudridine (m1ψ), or 5-methyl-uridine (m5U), particularly N1-methyl-pseudridine.
[0310] In some embodiments, the substitution of one or more uridines by nucleosides containing modified nucleic acid bases includes substitutions of at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the uridine.
[0311] During mRNA synthesis by in vitro transcription (IVT) using T7 RNA polymerase, a significant amount of abnormal products, including double-stranded RNA (dsRNA), are produced due to the enzyme's unconventional activity. dsRNA induces inflammatory cytokines and activates effector enzymes, leading to inhibition of protein synthesis. dsRNA formation can be limited during mRNA synthesis by, for example, limiting the amount of uridine triphosphate (UTP) during synthesis. Optionally, UTP may be added once or several times during mRNA synthesis. Furthermore, dsRNA can be removed from RNA, such as IVT RNA, by ion-pair reversed-phase HPLC using a non-porous or porous C-18 polystyrene-divinylbenzene (PS-DVB) matrix. Alternatively, an enzyme-based method using E. coli RNase III can be used to specifically hydrolyze dsRNA rather than ssRNA, thereby removing dsRNA contaminants from the IVT RNA preparation. Additionally, dsRNA can be separated from ssRNA by using cellulose material. In some embodiments, an RNA preparation is brought into contact with a cellulose material to allow the binding of dsRNA to the cellulose material, while separating the ssRNA from the cellulose material under conditions that do not allow the binding of ssRNA to the cellulose material. A suitable method for providing ssRNA is disclosed, for example, in International Publication No. 2017 / 182524.
[0312] "Remove" or "remove," as used herein, refers to the characteristic of a population of a first substance, such as non-immunogenic RNA, being isolated from a population of a second substance, such as dsRNA, where the population of the first substance is not necessarily devoid of the second substance, and the population of the second substance is not necessarily devoid of the first substance. However, a population of the first substance characterized by the removal of a population of the second substance has a measurably lower content of the second substance compared to an unseparated mixture of the first and second substances.
[0313] In some embodiments, the amount of double-stranded RNA (dsRNA) is limited, for example, dsRNA (especially dsmRNA) is removed from the non-immunogenic RNA such that less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.3%, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, or less than 0.0005% of the RNA in the non-immunogenic RNA composition is dsRNA. In some embodiments, the non-immunogenic RNA (especially mRNA) does not contain dsRNA or does not contain it in any meaningful way. In some embodiments, the non-immunogenic RNA (especially mRNA) composition includes a purified preparation of single-stranded nucleoside-modified RNA. In some embodiments, the non-immunogenic RNA (especially mRNA) composition comprises single-stranded nucleoside-modified RNA (especially mRNA) and substantially contains no double-stranded RNA (dsRNA). In some embodiments, the non-immunogenic RNA (especially mRNA) composition comprises at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, at least 99.991%, at least 99.992%, at least 99.993%, at least 99.994%, at least 99.995%, at least 99.996%, at least 99.997%, or at least 99.998% single-stranded nucleoside-modified RNA compared to all other nucleic acid molecules (DNA, dsRNA, etc.).
[0314] The amount of dsRNA can be determined using various methods. For example, the sample may be contacted with a dsRNA-specific antibody, and the amount of antibody that binds to RNA can be considered a measure of the amount of dsRNA in the sample. A sample containing a known amount of dsRNA can be used as a reference.
[0315] For example, RNA can be spotted onto a membrane, such as a nylon blotting membrane. The membrane can be blocked in TBS-T buffer containing, for example, 5% (w / v) skim milk powder (20 mM TRIS pH 7.4, 137 mM NaCl, 0.1% (v / v) TWEEN-20). For dsRNA detection, the membrane can be incubated with a dsRNA-specific antibody, such as a dsRNA-specific mouse mAb (English & Scientific Consulting, Szirak, Hungary). After washing with, for example, TBS-T, the membrane may be incubated with a secondary antibody, such as HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, catalog no. 715-035-150), and the signal provided by the secondary antibody can be detected.
[0316] In some embodiments, non-immunogenic RNA (particularly mRNA) is translated more efficiently in cells than standard RNA having the same sequence. In some embodiments, translation is enhanced by a factor of 2 compared to its unmodified counterpart. In some embodiments, translation is enhanced by a factor of 3. In some embodiments, translation is enhanced by a factor of 4. In some embodiments, translation is enhanced by a factor of 5. In some embodiments, translation is enhanced by a factor of 6. In some embodiments, translation is enhanced by a factor of 7. In some embodiments, translation is enhanced by a factor of 8. In some embodiments, translation is enhanced by a factor of 9. In some embodiments, translation is enhanced by a factor of 10. In some embodiments, translation is enhanced by a factor of 15. In some embodiments, translation is enhanced by a factor of 20. In some embodiments, translation is enhanced by a factor of 50. In some embodiments, translation is enhanced by a factor of 500. In some embodiments, translation is enhanced by a factor of 1000. In some embodiments, translation is enhanced by a factor of 2000. In some embodiments, the coefficient is 10 to 1000 times. In some embodiments, the coefficient is 10 to 100 times. In some embodiments, the coefficient is 10 to 200 times. In some embodiments, the coefficient is 10 to 300 times. In some embodiments, the coefficient is 10 to 500 times. In some embodiments, the coefficient is 20 to 1000 times. In some embodiments, the coefficient is 30 to 1000 times. In some embodiments, the coefficient is 50 to 1000 times. In some embodiments, the coefficient is 100 to 1000 times. In some embodiments, the coefficient is 200 to 1000 times. In some embodiments, the translation is augmented by any other significant amount or range of amounts.
[0317] In some embodiments, non-immunogenic RNA (especially mRNA) exhibits significantly lower innate immunogenicity than standard RNA with the same sequence. In some embodiments, non-immunogenic RNA (especially mRNA) exhibits twice the innate immune response of its unmodified counterpart. In some embodiments, innate immunogenicity is reduced to one-third. In some embodiments, innate immunogenicity is reduced to one-quarter. In some embodiments, innate immunogenicity is reduced to one-fifth. In some embodiments, innate immunogenicity is reduced to one-sixth. In some embodiments, innate immunogenicity is reduced to one-seventh. In some embodiments, innate immunogenicity is reduced to one-eighth. In some embodiments, innate immunogenicity is reduced to one-ninth. In some embodiments, innate immunogenicity is reduced to one-tenth. In some embodiments, innate immunogenicity is reduced to one-fifteenth. In some embodiments, innate immunogenicity is reduced to one-twentieth. In some embodiments, innate immunogenicity is reduced to one-fiftieth. In some embodiments, innate immunogenicity is reduced to one-hundredth. In some embodiments, innate immunogenicity is reduced to 1 / 200th. In some embodiments, innate immunogenicity is reduced to 1 / 500th. In some embodiments, innate immunogenicity is reduced to 1 / 1000th. In some embodiments, innate immunogenicity is reduced to 1 / 2000th.
[0318] The term "significantly lower innate immunogenicity" refers to a detectable reduction in innate immunogenicity. In some embodiments, this term refers to a reduction such that an effective amount of non-immunogenic RNA (particularly mRNA) can be administered without inducing a detectable innate immune response. In some embodiments, this term refers to a reduction such that non-immunogenic RNA (particularly mRNA) can be repeatedly administered without inducing an innate immune response sufficient to detectably reduce the production of proteins encoded by the non-immunogenic RNA. In some embodiments, the reduction is such that non-immunogenic RNA (particularly mRNA) can be repeatedly administered without inducing an innate immune response sufficient to eliminate the detectable production of proteins encoded by the non-immunogenic RNA.
[0319] "Immunogenicity" is the ability of foreign substances, such as RNA, to trigger an immune response in the body of a human or other animal. The innate immune system is a relatively nonspecific and immediate component of the immune system. It is one of the two main components of the vertebrate immune system, along with the adaptive immune system.
[0320] Pharmacologically active peptides or polypeptides In some embodiments, the RNA (in particular mRNA) described herein includes nucleic acid sequences encoding a peptide or polypeptide having biological activity, such as a pharmaceutically active peptide or polypeptide.
[0321] In some embodiments, the RNA (in particular mRNA) described herein comprises a nucleic acid sequence encoding a peptide or polypeptide, preferably a pharmaceutically active peptide or polypeptide, which can express the peptide or polypeptide, especially when transferred to a cell or subject. Therefore, in some embodiments, the RNA (in particular mRNA) described herein comprises a coding sequence or region (open reading frame (ORF)) encoding a peptide or polypeptide, for example, a pharmaceutically active peptide or polypeptide. Such nucleic acids encoding a pharmaceutically active peptide or polypeptide are also referred to herein as “pharmaceutically active nucleic acids.” In particular, such RNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as “pharmaceutically active RNA,” and such mRNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as “pharmaceutically active mRNA.” In some embodiments, the RNA used in this disclosure comprises nucleic acid sequences encoding two or more peptides or polypeptides, for example, two, three, four or more peptides or polypeptides.
[0322] According to this disclosure, the term “pharmaceutically active peptide or polypeptide” means a peptide or polypeptide that can be used to treat an individual whose expression would be beneficial, for example, to improve the symptoms of a disease. Preferably, a pharmaceutically active peptide or polypeptide has therapeutic or mitigating properties and may be administered to improve, mitigate, reduce, reverse, delay the onset of, or reduce the severity of one or more symptoms of a disease. In some embodiments, a pharmaceutically active peptide or polypeptide, when administered to an individual in a therapeutically effective amount, has a positive or beneficial effect on the individual’s condition or pathology. A pharmaceutically active peptide or polypeptide may have preventive properties and may be used to delay the onset of a disease or to reduce the severity of such a disease. The term “pharmaceutically active peptide” or “pharmaceutically active polypeptide” may include the whole peptide or polypeptide and may also refer to a pharmaceutically active fragment thereof. The term may also include pharmaceutically active variants and / or analogs of the peptide or polypeptide.
[0323] Specific examples of pharmaceutically active peptides and polypeptides include, but are not limited to, immunostimulants such as cytokines, hormones, adhesion molecules, immunoglobulins, immunoactive compounds, growth factors, protease inhibitors, enzymes, receptors, apoptosis regulators, transcription factors, tumor suppressor proteins, structural proteins, reprogramming factors, genome-engineered proteins, and blood proteins. In some embodiments, the pharmaceutically active peptides and polypeptides include substitution proteins.
[0324] An "immunostimulant" is any substance that stimulates the immune system by inducing or increasing the activation of any component of the immune system, particularly immune effector cells. Immunostimulants may be pro-inflammatory (e.g., when treating infections or cancer) or anti-inflammatory (e.g., when treating autoimmune diseases).
[0325] In one embodiment, the immunostimulant is a cytokine or a variant thereof. Examples of cytokines include interferons, e.g., interferon-alpha (IFN-α) or interferon-gamma (IFN-γ), interleukins, e.g., IL2, IL7, IL12, IL15 and IL23, colony-stimulating factors, e.g., M-CSF and GM-CSF, and tumor necrosis factor. In another embodiment, the immunostimulant includes adjuvant immunostimulants such as APC Toll-like receptor agonists or costimulatory / adhesion membrane proteins. Examples of Toll-like receptor agonists include costimulatory / adhesion proteins such as CD80, CD86, and ICAM-1.
[0326] The term "cytokine" refers to proteins with a molecular weight of approximately 5–60 kDa that are involved in cellular signaling (e.g., paracrine, endocrine, and / or autocrine signaling). In particular, when released, cytokines affect the behavior of cells in the vicinity of their release site. Examples of cytokines include lymphokines, interleukins, chemokines, interferons, and tumor necrosis factor (TNF). According to this disclosure, cytokines do not include hormones or growth factors. Cytokines differ from hormones in that (i) they typically act at far more variable concentrations than hormones, and (ii) they are generally produced by a wide range of cells (almost all nucleated cells can produce cytokines). Specific examples of cytokines include erythropoietin (EPO), colony-stimulating factor (CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor (TNF), bone morphogenetic protein (BMP), interferon alpha (IFNα), interferon beta (IFNβ), interferon gamma (INFγ), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 10 (IL-10), interleukin 11 (IL-11), interleukin 12 (IL-12), interleukin 15 (IL-15), and interleukin 21 (IL-21), as well as their variants and derivatives.
[0327] According to this disclosure, cytokines may be naturally occurring cytokines or their functional fragments or variants. Cytokines may be human cytokines and may originate from any vertebrate, in particular any mammal. One particularly preferred cytokine is interferon-alpha.
[0328] Immunostimulants may be delivered to a subject by administering RNA encoding the immunostimulant in a formulation for selective RNA delivery to the liver or liver tissue. Such RNA delivery to a target organ or tissue is preferred, in particular, when it is desired to express a large amount of the immunostimulant, and / or when systemic presence of the immunostimulant, especially in a significant amount, is desirable or required.
[0329] RNA delivery systems, such as lipid-based particles, cationic and neutral nanoparticles, and especially lipid nanoparticles, can be used for delivery to the liver.
[0330] Suitable immunostimulants for targeting the liver include cytokines involved in T cell proliferation and / or maintenance. Examples of suitable cytokines include IL2 or IL7, their fragments and variants, and fusion proteins of these cytokines, fragments and variants, such as extended PK cytokines.
[0331] In another embodiment, the RNA encoding the immunostimulant may be administered in a formulation for selective delivery of the RNA to the lymphoid system, particularly to secondary lymphoid organs, and more specifically to the spleen. Delivery of the immunostimulant to such target tissue is particularly preferred when the presence of the immunostimulant in this organ or tissue is desired (e.g., when an immunostimulant such as cytokines is needed to induce an immune response, particularly during T cell priming or for the activation of commensal immune cells), but the systemic presence of the immunostimulant, especially in significant amounts, is not desired (e.g., because the immunostimulant is systemic toxic).
[0332] Examples of suitable immunostimulants include cytokines involved in T cell priming. Suitable cytokines include IL-12, IL-15, IFN-α, or IFN-β, their fragments and variants, as well as fusion proteins of these cytokines, fragments and variants, such as extended PK cytokines.
[0333] Interferons (IFNs) are a group of signaling proteins produced and released by host cells in response to the presence of several pathogens, including viruses, bacteria, parasites, and tumor cells. In a typical scenario, virus-infected cells release interferons to enhance the antiviral defenses of nearby cells. Interferons are typically characterized by antiviral, antiproliferative, and immunomodulatory activity. Interferons are proteins that alter and regulate the transcription of genes within cells by binding to interferon receptors on the surface of the cells they regulate, thereby preventing viral replication within the cell.
[0334] Based on the type of receptor through which interferons signal, interferons are typically divided into three classes: type I interferons, type II interferons, and type III interferons.
[0335] All type I interferons bind to specific cell surface receptor complexes known as IFN-α / β receptors (IFNARs), which consist of IFNAR1 and IFNAR2 chains.
[0336] The type I interferons present in humans are IFNα, IFNβ, IFNε, IFNκ, and IFNω. Generally, type I interferons are produced when the body recognizes a virus that has entered the body. They are produced by fibroblasts and monocytes. Upon release, type I interferons bind to specific receptors on target cells, leading to the expression of proteins that prevent the virus from producing and replicating its RNA and DNA.
[0337] IFNα proteins are primarily produced by plasmacytoid dendritic cells (pDCs). They are mainly involved in innate immunity against viral infections. The genes involved in their synthesis belong to 13 subtypes called IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. These genes are found together in a cluster on chromosome 9.
[0338] IFNβ proteins are produced in large quantities by fibroblasts. They possess antiviral activity, primarily involved in the innate immune response. Two types of IFNβ, IFNβ1 and IFNβ3, have been described. Both native and recombinant forms of IFNβ1 have antiviral, antibacterial, and anticancer properties.
[0339] Type II interferon (IFNγ in humans), also known as immunointerferon, is activated by IL-12. Furthermore, type II interferon is released by cytotoxic T cells and T helper cells.
[0340] Type III interferons signal via a receptor complex consisting of IL10R2 (also known as CRF2-4) and IFNLR1 (also known as CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of type III IFNs in several types of viral or fungal infections.
[0341] Generally, type I and type II interferons are responsible for regulating and activating the immune response.
[0342] According to this disclosure, the type I interferon is preferably IFNα or IFNβ, more preferably IFNα.
[0343] According to this disclosure, interferon may be a naturally occurring interferon or a functional fragment or variant thereof. Interferon may be a human interferon and may originate from any vertebrate, in particular any mammal.
[0344] Interleukins (ILs) are a group of cytokines (secreted proteins and signaling molecules) that can be divided into four main groups based on their prominent structural characteristics. However, their amino acid sequence similarity is quite weak (typically 15-25% identity). The human genome encodes more than 50 interleukins and related proteins.
[0345] According to this disclosure, interleukins may be naturally occurring interleukins or their functional fragments or variants. Interleukins may be human interleukins and may originate from any vertebrate, in particular any mammal.
[0346] The immunostimulant polypeptides described herein may be prepared as fusion polypeptides or chimeric polypeptides comprising an immunostimulant moiety and a heterogeneous polypeptide (i.e., a polypeptide that is not an immunostimulant). Immunostimulants may be fused to an extended PK group that increases their circulating half-life. Non-limiting examples of the extended PK group are described below. It should be understood that other PK groups that increase the circulating half-life of immunostimulants, such as cytokines or their variants, are also applicable to this disclosure. In certain embodiments, the extended PK group is a serum albumin domain (e.g., mouse serum albumin, human serum albumin).
[0347] As used herein, the term “PK” is an acronym for “pharmacokinetics” and encompasses, for example, the properties of a compound including absorption, distribution, metabolism, and elimination by a subject. As used herein, “extended PK group” refers to a protein, peptide, or portion that, when fused to or administered together with a biologically active molecule, increases the circulating half-life of a biologically active molecule. Examples of extended PK group include serum albumin (e.g., HSA), immunoglobulin Fc or Fc fragments and their variants, transferrin and its variants, and human serum albumin (HSA) binders (disclosed in U.S. Patent Applications Publications 2005 / 0287153 and 2007 / 0003549). Other exemplary extended PK group is disclosed in Kontermann, Expert Opin Biol Ther, 2016 Jul;16(7):903-15, which is incorporated herein by reference in its entirety. As used herein, “extended PK” immunostimulant refers to an immunostimulatory moiety combined with an extended PK group. In some embodiments, the extended PK immunostimulant is a fusion protein in which the immunostimulatory moiety is linked to or fused with an extended PK group.
[0348] In certain embodiments, the serum half-life of the extended PK immunostimulant is increased compared to the immunostimulant alone (i.e., the immunostimulant not fused to the extended PK group). In certain embodiments, the serum half-life of the extended PK immunostimulant is at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 120%, at least 150%, at least 180%, at least 200%, at least 400%, at least 600%, at least 800%, or at least 1000% longer than the serum half-life of the immunostimulant alone. In certain embodiments, the serum half-life of the extended PK immunostimulant is at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 10, 12, 13, 15, 17, 20, 22, 25, 27, 30, 35, 40, or 50 times the serum half-life of the immunostimulant alone. In certain embodiments, the serum half-life of the extended PK immunostimulant is at least 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 50 hours, 60 hours, 70 hours, 80 hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, 135 hours, 140 hours, 150 hours, 160 hours, or 200 hours.
[0349] As used herein, “half-life” refers to the time required for the serum or plasma concentration of a compound, such as a peptide or polypeptide, to decrease by 50% in vivo, for example, due to degradation and / or clearance or sequestration by natural mechanisms. Extended PK immunostimulants suitable for use herein are stabilized in vivo, and their half-lives are increased, for example, by fusion with serum albumin (e.g., HSA or MSA) that is resistant to degradation and / or clearance or sequestration. The half-life can be determined by any method known in itself, such as by pharmacokinetic analysis. Appropriate techniques will be apparent to those skilled in the art and may generally include, for example, the steps of appropriately administering an appropriate dose of an amino acid sequence or compound to a subject; taking blood samples or other samples from the subject at regular intervals; determining the level or concentration of the amino acid sequence or compound in the blood samples; and calculating, from the data (plots thereof) thus obtained, the time required for the level or concentration of the amino acid sequence or compound to decrease by 50% compared to the initial level at administration. Further details are provided, for example, in standard handbooks such as Kenneth, A. et al., Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and Peters et al., Pharmacokinetic Analysis: A Practical Approach (1996). See also Gibaldi, M. et al., Pharmacokinetics, 2nd Rev. Edition, Marcel Dekker (1982).
[0350] In certain embodiments, the extended PK group includes serum albumin, or a fragment thereof, or a variant of serum albumin or a fragment thereof (all of which are included in the term “albumin” for the purposes of this disclosure). The polypeptides described herein may be fused to albumin (or a fragment or variant thereof) to form an albumin fusion protein. Such an albumin fusion protein is described in U.S. Patent Application Publication No. 20070048282.
[0351] As used herein, “albumin fusion protein” refers to a protein formed by the fusion of at least one molecule of albumin (or a fragment or variant thereof) with at least one molecule of a protein, such as a therapeutic protein, particularly an immunostimulant. Albumin fusion proteins can be produced by the translation of a nucleic acid in which a polynucleotide encoding a therapeutic protein is in-frame linked to a polynucleotide encoding albumin. When the therapeutic protein and albumin become part of an albumin fusion protein, they may be referred to as a “part,” “region,” or “fragment” of the albumin fusion protein (e.g., “therapeutic protein portion” or “albumin protein portion”). In a very preferred embodiment, the albumin fusion protein comprises at least one molecule of a therapeutic protein (including, but not limited to, a mature form of the therapeutic protein) and at least one molecule of albumin (including, but not limited to, a mature form of albumin). In some embodiments, the albumin fusion protein is processed by host cells, such as hepatocytes, of the target organ of the administered RNA and secreted into circulation. Processing of nascent albumin fusion proteins generated in the secretory pathway of host cells used for RNA expression may include, but are not limited to, signal peptide cleavage; disulfide bond formation; proper folding; carbohydrate addition and processing (e.g., N- and O-linked glycosylation); specific proteolytic cleavage; and / or assembly into a multimeric protein. Albumin fusion proteins are preferably encoded by an unprocessed form of RNA having a signal peptide, particularly at its N-terminus, and after secretion by the cell, preferably exist in a processed form in which the signal peptide has been cleaved. In the most preferred embodiment, “processed form of albumin fusion protein” refers to the albumin fusion protein product that has undergone N-terminal signal peptide cleavage, also referred herein to as “mature albumin fusion protein.”
[0352] In preferred embodiments, albumin-fused proteins containing a therapeutic protein have higher plasma stability compared to the plasma stability of the same therapeutic protein when it is not fused to albumin. Plasma stability typically refers to the period from when the therapeutic protein is administered in vivo and transported into the bloodstream until it is broken down, removed from the bloodstream by organs such as the kidneys or liver, and ultimately removed from the body. Plasma stability is calculated with respect to the half-life of the therapeutic protein in the bloodstream. The half-life of a therapeutic protein in the bloodstream can be readily determined by common assays known in the art.
[0353] As used herein, “albumin” collectively refers to albumin proteins or amino acid sequences, or albumin fragments or variants, that possess one or more functional activities (e.g., biological activity) of albumin. In particular, “albumin” refers to human albumin or its fragments or variants, especially mature forms of human albumin, or albumin or its fragments from other vertebrates, or variants of these molecules. Albumin may be derived from any vertebrate, especially any mammal, such as humans, cattle, sheep, or pigs. Non-mammalian albumins include, but are not limited to, hens and salmon. The albumin portion of an albumin fusion protein may be derived from a different animal than the therapeutic protein portion.
[0354] In certain embodiments, albumin is human serum albumin (HSA), or a fragment or variant thereof, as disclosed in, for example, U.S. Patent No. 5,876,969, International Publication No. 2011 / 124718, International Publication No. 2013 / 075066, and International Publication No. 2011 / 0514789.
[0355] The terms human serum albumin (HSA) and human albumin (HA) are used interchangeably herein. The terms "albumin" and "serum albumin" are broader and include human serum albumin (as well as its fragments and variants) as well as albumin (as well as its fragments and variants) from other species.
[0356] As used herein, an albumin fragment sufficient to prolong the therapeutic activity or plasma stability of a therapeutic protein refers to an albumin fragment of sufficient length or structure to stabilize or extend the therapeutic activity or plasma stability of a protein, such that the plasma stability of the therapeutic protein portion of an albumin fusion protein is prolonged or enhanced compared to its plasma stability in the unfused state.
[0357] The albumin portion of the albumin fusion protein may contain the full length of the albumin sequence, or one or more fragments thereof that can stabilize or extend therapeutic activity or plasma stability. Such fragments may be 10 or more amino acids long, or may contain about 15, 20, 25, 30, 50 or more consecutive amino acids from the albumin sequence, or may contain part or all of a specific domain of albumin. For example, one or more fragments of HSA spanning the first two immunoglobulin-like domains may be used. In a preferred embodiment, the HSA fragment is a mature form of HSA.
[0358] Generally speaking, albumin fragments or variants are at least 100 amino acids long, preferably at least 150 amino acids long.
[0359] According to this disclosure, albumin may be naturally occurring albumin or a fragment or variant thereof. Albumin may be human albumin and may originate from any vertebrate, in particular any mammal.
[0360] Preferably, the albumin fusion protein contains albumin as the N-terminal portion and a therapeutic protein as the C-terminal portion. Alternatively, an albumin fusion protein containing albumin as the C-terminal portion and a therapeutic protein as the N-terminal portion may also be used. In other embodiments, the albumin fusion protein has the therapeutic protein fused to both the N-terminus and the C-terminus of albumin. In a preferred embodiment, the therapeutic proteins fused to the N-terminus and C-terminus are the same therapeutic protein. In another preferred embodiment, the therapeutic proteins fused to the N-terminus and C-terminus are different therapeutic proteins. In some embodiments, the different therapeutic proteins are both cytokines.
[0361] In some embodiments, a therapeutic protein(s) is linked to albumin via a peptide linker(s). The peptide linkers between fusion sites provide greater physical separation between the sites, thus maximizing accessibility to the therapeutic protein site for binding, for example, to its homologous receptor. The peptide linker(s) may be composed of amino acids, either flexible or more rigid. The linker sequence may be cleavable by proteases or chemically.
[0362] As used herein, the term “Fc region” refers to a portion of innate immunoglobulin formed by the respective Fc domains (or Fc portions) of the two heavy chains of innate immunoglobulin. As used herein, the term “Fc domain” refers to a portion or fragment of a single immunoglobulin (Ig) heavy chain in which the Fc domain does not contain an Fv domain. In certain embodiments, the Fc domain begins in a hinge region immediately upstream of the papain cleavage site and ends at the C-terminus of the antibody. Thus, a complete Fc domain includes at least a hinge domain, a CH2 domain, and a CH3 domain. In certain embodiments, the Fc domain includes at least one of the hinge (e.g., upper, middle, and / or lower hinge region) domains, a CH2 domain, a CH3 domain, a CH4 domain, or variants, portions, or fragments thereof. In certain embodiments, the Fc domain includes a complete Fc domain (i.e., a hinge domain, a CH2 domain, and a CH3 domain). In certain embodiments, the Fc domain includes a hinge domain (or a portion thereof) fused to a CH3 domain (or a portion thereof). In certain embodiments, the Fc domain includes a CH2 domain (or a portion thereof) fused to a CH3 domain (or a portion thereof). In certain embodiments, the Fc domain consists of a CH3 domain or a portion thereof. In certain embodiments, the Fc domain consists of a hinge domain (or a portion thereof) and a CH3 domain (or a portion thereof). In certain embodiments, the Fc domain consists of a CH2 domain (or a portion thereof) and a CH3 domain. In certain embodiments, the Fc domain consists of a hinge domain (or a portion thereof) and a CH2 domain (or a portion thereof). In certain embodiments, the Fc domain lacks at least a portion of the CH2 domain (e.g., all or part of the CH2 domain). As used herein, an Fc domain generally refers to a polypeptide that includes all or part of the Fc domain of an immunoglobulin heavy chain. This includes, but is not limited to, polypeptides that include the entire CH1, hinge, CH2, and / or CH3 domains, as well as fragments of such peptides that include only, for example, the hinge, CH2, and CH3 domains.The Fc domain may originate from any species and / or any subtype of immunoglobulin, including but not limited to human IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibodies. The Fc domain encompasses both native Fc and Fc variant molecules. As described herein, it will be understood by those skilled in the art that any Fc domain may be modified to have a different amino acid sequence from the native Fc domain of naturally occurring immunoglobulin molecules. In certain embodiments, the Fc domain has reduced effector function (e.g., FcγR binding).
[0363] The Fc domains of the polypeptides described herein may be derived from different immunoglobulin molecules. For example, the Fc domain of a polypeptide may include CH2 and / or CH3 domains derived from the IgG1 molecule and a hinge region derived from the IgG3 molecule. In another example, the Fc domain may include a chimeric hinge region that is partly derived from the IgG1 molecule and partly from the IgG3 molecule. In yet another example, the Fc domain may include a chimeric hinge that is partly derived from the IgG1 molecule and partly from the IgG4 molecule.
[0364] In certain embodiments, the extended PK group includes an Fc domain or a fragment thereof, or a variant of an Fc domain or a fragment thereof (all of which, for the purposes of this disclosure, are included in the term “Fc domain”). The Fc domain does not contain a variable region that binds to an antigen. Fc domains suitable for use in this disclosure can be obtained from several different sources. In certain embodiments, the Fc domain is derived from human immunoglobulin. In certain embodiments, the Fc domain is derived from the human IgG1 constant region. However, it is understood that the Fc domain may be derived from immunoglobulins of other mammalian species, including, for example, rodent species (e.g., mouse, rat, rabbit, guinea pig) or non-human primate species (e.g., chimpanzee, macaque).
[0365] Furthermore, the Fc domain (or its fragments or variants) may originate from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, as well as any immunoglobulin isotype, including IgG1, IgG2, IgG3, and IgG4.
[0366] Various Fc domain gene sequences (e.g., mouse and human constant region gene sequences) are available in the form of publicly accessible deposits. Constant region domains containing Fc domain sequences lacking specific effector function and / or possessing specific modifications that reduce immunogenicity can be selected. Many sequences of antibodies and antibody-coding genes are publicly available, and suitable Fc domain sequences (e.g., hinge, CH2 and / or CH3 sequences, or fragments or variants thereof) can be derived from these sequences using techniques widely accepted in the art.
[0367] In certain embodiments, the extended PK group is a serum albumin-binding protein, such as those described in U.S. Patent Application No. 2005 / 0287153, U.S. Patent Application No. 2007 / 0003549, U.S. Patent Application No. 2007 / 0178082, U.S. Patent Application No. 2007 / 0269422, U.S. Patent Application No. 2010 / 0113339, International Publication No. 2009 / 083804, and International Publication No. 2009 / 133208, which are incorporated herein by reference in their entirety. In certain embodiments, the extended PK group is transferrin, as disclosed in U.S. Patent No. 7,176,278 and U.S. Patent No. 8,158,579, which are incorporated herein by reference in their entirety. In certain embodiments, the extended PK group consists of serum immunoglobulin-binding proteins, such as those disclosed in U.S. Patent Application No. 2007 / 0178082, U.S. Patent Application No. 2014 / 0220017, and U.S. Patent Application No. 2017 / 0145062, which are incorporated herein by reference in their entirety. In certain embodiments, the extended PK group consists of serum albumin-binding fibronectin (Fn)-based scaffold domain proteins, such as those disclosed in U.S. Patent Application No. 2012 / 0094909, which are incorporated herein by reference in their entirety. Methods for producing fibronectin-based scaffold domain proteins are also disclosed in U.S. Patent Application No. 2012 / 0094909. A non-limiting example of the Fn3-based extended PK group is Fn3(HSA), i.e., a human serum albumin-binding Fn3 protein.
[0368] In certain embodiments, an extended PK immunostimulant suitable for use according to this disclosure may use one or more peptide linkers. As used herein, the term "peptide linker" refers to a peptide or polypeptide sequence that links two or more domains (e.g., an extended PK portion and an immunostimulatory portion) in the linear amino acid sequence of a polypeptide chain. For example, a peptide linker may be used to link an immunostimulatory portion to an HSA domain.
[0369] For example, linkers suitable for fusing extended PK groups to immunostimulants are well known in the art. Exemplary linkers include glycine-serine polypeptide linkers, glycine-proline polypeptide linkers, and proline-alanine polypeptide linkers. In certain embodiments, the linker is a glycine-serine polypeptide linker, i.e., a peptide consisting of glycine and serine residues.
[0370] In some embodiments, the pharmaceutically active peptide or polypeptide includes a substitution protein. In these embodiments, the disclosure provides a method for treating a subject having a disorder requiring protein substitution (e.g., a protein deficiency disorder), comprising administering to the subject an RNA (particularly mRNA) described herein that encodes a substitution protein. The term “protein substitution” refers to the introduction of a protein (including its functional variant) into a subject having a deficiency of such a protein. The term also refers to the introduction of a protein into a subject suffering from protein deficiency, for example, a subject that requires or benefits from the provision of a protein. The term “disorder characterized by protein deficiency” refers to any disorder that presents with a pathological condition caused by a lack or insufficient amount of a protein. The term includes protein folding disorders, i.e., structural disorders, that result in biologically inactive protein products. Protein deficiency may be associated with infection, immunosuppression, organ failure, glandular disorders, radiation injury, malnutrition, poisoning, or other environmental or external injury.
[0371] The term “hormone” refers to a class of signaling molecules produced by glands, where signaling typically involves the following steps: (i) synthesis of hormones in specific tissues; (ii) storage and secretion; (iii) transport of hormones to their targets; (iv) binding of hormones to receptors; (v) relaying and amplification of signals; and (vi) degradation of hormones. Hormones differ from cytokines in that (1) they usually act at less variable concentrations, and (2) they are generally produced by specific types of cells. In some embodiments, “hormones” are peptide or polypeptide hormones such as insulin, vasopressin, prolactin, adrenocorticotropic hormone (ACTH), thyroid hormones, growth hormones (such as human growth hormone or bovine somatotropin), oxytocin, atrial natriuretic peptide (ANP), glucagon, somatostatin, cholecystokinin, gastrin, and leptin.
[0372] The term "adhesion molecules" refers to proteins located on the surface of cells that are involved in the binding of cells to other cells or the extracellular matrix (ECM). Adhesion molecules are typically transmembrane receptors and can be classified into calcium-independent (e.g., integrins, immunoglobulin superfamilies, lymphocyte homing receptors) and calcium-dependent (cadherins and selectins). Specific examples of adhesion molecules include integrins, lymphocyte homing receptors, selectins (e.g., P-selectins), and adresins.
[0373] Integrins are also involved in signal transduction. In particular, upon ligand binding, integrins regulate cellular signaling pathways, such as the pathways of transmembrane protein kinases, including receptor tyrosine kinases (RTKs). Such regulation can lead to cell growth, division, survival or differentiation, or apoptosis. Specific examples of integrins include α1β1, α2β1, α3β1, α4β1, α5β1, α6β1, α7β1, α L β2, α M β2, α IIb β3, α V β1, αV β3, α V β5, α V β6, α V β8 and α6β4 are examples.
[0374] The terms “immunoglobulin” or “immunoglobulin superfamily” refer to molecules involved in cell recognition, binding, and / or adhesion processes. Molecules belonging to this superfamily share the characteristic of containing a region known as an immunoglobulin domain or immunoglobulin fold. Members of the immunoglobulin superfamily include antibodies (e.g., IgG), T cell receptors (TCRs), major histocompatibility complex (MHC) molecules, co-receptors (e.g., CD4, CD8, CD19), antigen receptor accessory molecules (e.g., CD-3γ, CD3-δ, CD-3ε, CD79a, CD79b), and costimulatory or inhibitory molecules (e.g., CD28, CD80, CD86).
[0375] The term "immunologically active compound" refers to any compound that alters the immune response by altering humoral immunity, for example, by inducing and / or suppressing the maturation of immune cells, inducing and / or suppressing cytokine biosynthesis, and / or stimulating antibody production by B cells. Immunologically active compounds possess potent immunostimulatory activity, including but not limited to antiviral and antitumor activity, and can also downregulate other aspects of the immune response, for example, by shifting the immune response away from the TH2 immune response, which is useful for treating a wide range of TH2-mediated diseases. Immunologically active compounds may be useful as vaccine adjuvants. Specific examples of immunologically active compounds include interleukins, colony-stimulating factors (CSFs), granulocyte colony-stimulating factors (G-CSFs), granulocyte-macrophage colony-stimulating factors (GM-CSFs), erythropoietin, tumor necrosis factor (TNF), interferons, integrins, adresins, selectins, homing receptors, and antigens, particularly tumor-associated antigens, pathogen-associated antigens (such as bacterial, parasitic, or viral antigens), allergens, and autoantigens. Immunologically active compounds may also be vaccine antigens, i.e., antigens that, when administered to a target, induce an immune response.
[0376] In some embodiments, the RNA (in particular mRNA) described herein comprises a nucleic acid sequence encoding a peptide or polypeptide containing an epitope for inducing an immune response to an antigen in a subject. The “peptide or polypeptide containing an epitope for inducing an immune response to an antigen in a subject” is also referred herein to as “vaccine antigen,” “peptide antigen and protein antigen,” or simply “antigen.”
[0377] In some embodiments, RNA encoding the vaccine antigen is expressed in target cells, such as muscle cells or antigen-presenting cells (APCs), to provide the vaccine antigen. In some embodiments, antigen expression occurs on the cell surface. In some embodiments, the vaccine antigen is presented in relation to the MHC. In some embodiments, RNA encoding the vaccine antigen is transiently expressed in target cells. In some embodiments, RNA encoding the vaccine antigen is administered systemically, for example, intravenously. In some embodiments, after systemic administration of RNA encoding the vaccine antigen, expression of RNA encoding the vaccine antigen occurs in the spleen. In some embodiments, after systemic administration of RNA encoding the vaccine antigen, expression of RNA encoding the vaccine antigen occurs in antigen-presenting cells, preferably professional antigen-presenting cells. In some embodiments, antigen-presenting cells are selected from the group consisting of dendritic cells, macrophages, and B cells. In some embodiments, after systemic administration of RNA encoding the vaccine antigen, expression of RNA encoding the vaccine antigen in the lungs and / or liver does not occur, or is essentially absent. In some embodiments, after systemic administration of RNA encoding the vaccine antigen, expression of RNA encoding the vaccine antigen in the spleen is at least five times the expression level in the lungs. In some embodiments, RNA encoding the vaccine antigen is administered intramuscularly.
[0378] A vaccine antigen contains an epitope for inducing an immune response to the antigen in a target. Therefore, a vaccine antigen contains an antigen sequence for inducing an immune response to the antigen in a target. Such an antigen sequence may correspond to a target antigen or disease-related antigen, such as a protein or tumor antigen of an infectious agent (e.g., a viral or bacterial antigen), or an immunogenic variant thereof, or an immunogenic fragment or immunogenic variant thereof of a target antigen or disease-related antigen. Therefore, an antigen sequence may contain at least one epitope of a target antigen or disease-related antigen or an immunogenic variant thereof.
[0379] Antigen sequences suitable for use as described herein, such as epitopes, may typically be derived from target antigens, i.e., antigens that elicit an immune response. For example, antigen sequences contained within a vaccine antigen may be the target antigen or a fragment or variant of the target antigen.
[0380] An antigen sequence or its processing product, such as a fragment thereof, can bind to an antigen receptor, such as a TCR or CAR, carried by an immune effector cell. In some embodiments, the antigen sequence is selected from the group consisting of an antigen or fragment thereof expressed by a target cell targeted by the immune effector cell, or a variant of the antigen sequence or fragment.
[0381] A vaccine antigen, which may be provided to a subject pursuant to this disclosure by administering RNA encoding the vaccine antigen, preferably induces an immune response in the subject to which the vaccine antigen is provided, e.g., stimulation, priming, and / or proliferation of immune effector cells. The immune response, e.g., stimulated, primed, and / or proliferated immune effector cells, is preferably against a target antigen, particularly a target antigen expressed by disease cells, tissues, and / or organs, i.e., a disease-related antigen. Thus, the vaccine antigen may comprise a disease-related antigen, or a fragment or variant thereof. In some embodiments, such a fragment or variant is immunologically equivalent to the disease-related antigen.
[0382] In the context of this disclosure, the terms “antigen fragment” or “antigen variant” mean an agent that induces an immune response, e.g., stimulation, priming, and / or proliferation of immune effector cells, which in turn target an antigen, i.e., a disease-related antigen, particularly when presented by disease cells, tissues, and / or organs. Therefore, a vaccine antigen may correspond to or contain a disease-related antigen, a fragment of a disease-related antigen, or an antigen homologous to a disease-related antigen or its fragment. If a vaccine antigen contains a fragment of a disease-related antigen or an amino acid sequence homologous to a fragment of a disease-related antigen, the fragment or amino acid sequence may contain an epitope of the disease-related antigen targeted by the antigen receptor of an immune effector cell, or a sequence homologous to an epitope of a disease-related antigen. Therefore, according to this disclosure, a vaccine antigen may contain an immunogenic fragment of a disease-related antigen, or an amino acid sequence homologous to an immunogenic fragment of a disease-related antigen. The “immunogenic fragments of antigens” as disclosed herein preferably relate to fragments of antigens that can induce, for example, stimulate, prime, and / or proliferate an immune response to immune effector cells carrying antigen receptors that bind to the antigen or to cells expressing the antigen. Vaccine antigens (similar to disease-related antigens) preferably provide relevant epitopes for binding by antigen receptors present on immune effector cells. In some embodiments, the vaccine antigen or a fragment thereof (similar to a disease-related antigen) is expressed (optionally in relation to MHC) on the surface of cells such as antigen-presenting cells to provide relevant epitopes for binding by immune effector cells. The vaccine antigen may be a recombinant antigen.
[0383] In some embodiments of all aspects of the present invention, RNA encoding a vaccine antigen is expressed in a target cell to provide the antigen or a processed product thereof for binding by an antigen receptor expressed by an immune effector cell, the binding resulting in stimulation, priming, and / or proliferation of the immune effector cell. “Antigen” as used in this disclosure encompasses any substance that elicits an immune response and / or any substance to which an immune mechanism, such as an immune response, cellular response, and / or humoral response, is directed. This also includes situations in which an immune response or immune mechanism is directed to one or more antigen peptides, such as when the antigen is processed into an antigen peptide and presented in particular in relation to an MHC molecule. In particular, “antigen” relates to any substance, such as a peptide or polypeptide, that specifically reacts with an antibody or T lymphocyte (T cell). The term “antigen” may include molecules containing at least one epitope, such as a T cell epitope. In some embodiments, the antigen is a molecule that, optionally after processing, induces an immune response that may be specific to the antigen (including the cell expressing the antigen). In some embodiments, the antigen is a disease-related antigen such as a tumor antigen, viral antigen, or bacterial antigen, or an epitope derived from such an antigen.
[0384] In some embodiments, the antigen is presented or present on the surface of immune system cells, such as dendritic cells or antigen-presenting cells like macrophages. The antigen or its processing product, such as a T cell epitope, is bound by an antigen receptor in some embodiments. Thus, the antigen or its processing product can specifically react with immune effector cells, such as T lymphocytes (T cells).
[0385] The term "autoantigen" refers to an antigen that originates within the body of a target (i.e., autoantigens can also be called "autogenous antigens") and elicits an abnormally strong immune response against this normal part of the body. Such a strong immune response to an autoantigen can be the cause of an "autoimmune disease."
[0386] According to this disclosure, any suitable antigen that is a candidate for an immune response may be used, and the immune response may include humoral or cellular immune responses, or both. In relation to some embodiments of this disclosure, the antigen is presented by cells, such as antigen-presenting cells, in relation to MHC molecules, and elicits an immune response to the antigen. The antigen may correspond to or be a product derived from a naturally occurring antigen. Such naturally occurring antigens may include, or be derived from, allergens, viruses, bacteria, fungi, parasites, and other infectious agents and pathogens, or the antigen may be a tumor antigen. According to this disclosure, the antigen may correspond to a naturally occurring product, such as a viral protein, or a part thereof.
[0387] The term "disease-associated antigen," in its broadest sense, refers to any antigen associated with a disease. A disease-associated antigen is a molecule containing an epitope that stimulates the host's immune system to produce an antigen-specific cellular immune response and / or humoral antibody response to the disease. Examples of disease-associated antigens include pathogen-associated antigens, i.e., antigens associated with infection by microorganisms, typically microbial antigens (such as bacterial or viral antigens), or antigens associated with cancer, typically tumors, such as tumor antigens.
[0388] In some embodiments, the antigen is a tumor antigen, i.e., a part of a tumor cell, particularly one that exists primarily intracellularly or as a surface antigen of tumor cells. In other embodiments, the antigen is a pathogen-associated antigen, i.e., an antigen derived from a pathogen, such as a virus, bacterium, unicellular organism, or parasite, such as a viral antigen, such as a viral ribonucleoprotein or coat protein. In some embodiments, the antigen should be presented by an MHC molecule that leads to regulation, particularly activation of immune system cells such as CD4+ and CD8+ lymphocytes, through the modulation of T cell receptor activity.
[0389] The term “tumor antigen” or “tumor-associated antigen” refers to a component of cancer cells that may originate from the cytoplasm, cell surface, or cell nucleus. In particular, the term refers to an antigen produced intracellularly or as a surface antigen on tumor cells. Examples of tumor antigens include carcinoembryonic antigens, α1-fetoprotein, isoferritin, and fetal sulfoglycoprotein, α2-H-ferroprotein and γ-fetoprotein, as well as various viral tumor antigens. According to some embodiments of this disclosure, tumor antigens include any antigens characteristic of tumors or cancers, as well as tumor cells or cancer cells, in terms of type and / or level of expression.
[0390] The term "viral antigen" refers to any viral component that possesses antigenic properties, i.e., can trigger an immune response in an individual. Viral antigens can be viral ribonucleoproteins or envelope proteins.
[0391] The term "bacterial antigen" refers to any bacterial component that possesses antigenic properties, i.e., can trigger an immune response in an individual. Bacterial antigens may originate from the bacterial cell wall or cytoplasmic membrane.
[0392] The term “epitope” refers to an antigenic determinant in a molecule such as an antigen, i.e., a part or fragment of a molecule recognized by the immune system, for example, an antibody, particularly when presented in relation to an MHC molecule, or recognized by a T cell or a B cell. Protein epitopes may consist of continuous or discontinuous portions of a protein, and may be, for example, about 5 to about 100, about 5 to about 50, about 8 to about 30, or about 10 to about 25 amino acids in length. For example, an epitope may preferably be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, the epitope in the context of this disclosure is a T cell epitope.
[0393] The terms “epitope,” “antigen fragment,” “immunogenic peptide,” and “antigen peptide” are used interchangeably herein and may relate, for example, to an incomplete representation of an antigen that expresses or contains an antigen and can induce an immune response against a cell presenting it. In some embodiments, these terms relate to the immunogenic portion of an antigen. In some embodiments, this is a portion of an antigen that is recognized (i.e., specifically bound) by a T cell receptor, particularly when presented in relation to an MHC molecule. Certain preferred immunogenic portions bind to MHC class I or class II molecules. The term “epitope” refers to a portion or fragment of a molecule, such as an antigen, that is recognized by the immune system. For example, an epitope may be recognized by a T cell, a B cell, or an antibody. An antigen epitope may comprise a continuous or discontinuous portion of the antigen and may be about 5 to about 100 amino acids long, for example, about 5 to about 50, about 8 to about 30, or about 8 to about 25 amino acids long. For example, an epitope may be about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long. In some embodiments, the epitope is about 10 to about 25 amino acids long. The term “epitope” includes T cell epitopes.
[0394] The term "T cell epitope" refers to a portion or fragment of a protein that is recognized by T cells when presented in association with an MHC molecule. The term "major histocompatibility complex" and the abbreviation "MHC" refer to a complex of genes present in all vertebrates, including MHC class I and MHC class II molecules. MHC proteins or molecules are important for signaling between lymphocytes and antigen-presenting cells or disease cells in immune responses, and MHC proteins or molecules bind to peptide epitopes and present them for recognition by T cell receptors on T cells. Proteins encoded by MHC are expressed on the surface of cells and present both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to T cells. In the case of class I MHC / peptide complexes, the bound peptide is typically about 8 to 10 amino acids long, although longer or shorter peptides may be effective. For class II MHC / peptide complexes, the bound peptide is typically about 10 to 25 amino acids long, and especially about 13 to 18 amino acids long, although longer and shorter peptides may also be effective.
[0395] Peptides and polypeptide antigens can be 2 to 100 amino acids long, including, for example, lengths of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids. In some embodiments, the peptide may contain more than 50 amino acids. In some embodiments, the peptide may contain more than 100 amino acids.
[0396] A peptide or polypeptide antigen can be any peptide or polypeptide that can induce or increase the immune system's ability to produce antibody and T-cell responses against the peptide or polypeptide.
[0397] In some embodiments, the vaccine antigen, i.e., the antigen that, when administered to a target, induces an immune response, is recognized by immune effector cells. In some embodiments, when the vaccine antigen is recognized by immune effector cells, in the presence of appropriate co-stimulatory signals, this can induce stimulation, priming, and / or proliferation of immune effector cells carrying antigen receptors that recognize the vaccine antigen. In relation to embodiments of this disclosure, the vaccine antigen may be presented or present on the surface of cells, such as antigen-presenting cells.
[0398] In some embodiments, the antigen is expressed in diseased cells (such as tumor cells or infected cells).
[0399] In some embodiments, the antigen is presented by diseased cells (such as tumor cells or infected cells). In some embodiments, the antigen receptor is a TCR that binds to the epitope of the antigen presented in relation to the MHC. In some embodiments, the binding of the TCR, expressed by and / or present on T cells, to the antigen presented by cells such as antigen-presenting cells results in stimulation, priming, and / or proliferation of the T cells. In some embodiments, the binding of the TCR, expressed by and / or present on T cells, to the antigen presented on diseased cells results in cytolysis and / or apoptosis of the diseased cells, and the T cells release cytotoxic factors, such as perforin and granzymes.
[0400] In some embodiments, the antigen is expressed on the surface of diseased cells (such as tumor cells or infected cells). In some embodiments, the antigen receptor is a CAR that binds to the extracellular domain of the antigen or an epitope within the extracellular domain. In some embodiments, the CAR binds to a native epitope of the antigen present on the surface of living cells. In some embodiments, binding of the CAR, when expressed by and / or present on T cells, to an antigen present on cells such as antigen-presenting cells results in stimulation, priming, and / or proliferation of the T cells. In some embodiments, binding of the CAR, when expressed by and / or present on T cells, to an antigen present on diseased cells results in cytolysis and / or apoptosis of the diseased cells, and the T cells preferably release cytotoxic factors, such as perforin and granzymes.
[0401] According to some embodiments, an amino acid sequence that enhances antigen processing and / or presentation is fused to an antigen peptide or polypeptide (antigen sequence) directly or via a linker. Thus, in some embodiments, the RNA described herein includes at least one coding region encoding an antigen peptide or polypeptide as well as an amino acid sequence that enhances antigen processing and / or presentation.
[0402] Such amino acid sequences that enhance antigen processing and / or presentation are, but are not limited, preferably located at the C-terminus of an antigen peptide or polypeptide (and optionally at the C-terminus of an amino acid sequence that disrupts immune tolerance). The amino acid sequences that enhance antigen processing and / or presentation as defined herein preferably improve antigen processing and presentation. In some embodiments, the amino acid sequences that enhance antigen processing and / or presentation as defined herein include, but are not limited, sequences derived from human MHC class I complexes (HLA-B51, haplotype A2, B27 / B51, Cw2 / Cw3), particularly sequences including the amino acid sequence of SEQ ID NO: 13 or functional variants thereof.
[0403] In some embodiments, the amino acid sequence that enhances antigen processing and / or presentation includes the amino acid sequence of SEQ ID NO: 13, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the amino acid sequence of SEQ ID NO: 13, or a functional fragment of the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the amino acid sequence of SEQ ID NO: 13. In some embodiments, the amino acid sequence that enhances antigen processing and / or presentation includes the amino acid sequence of SEQ ID NO: 13.
[0404] Accordingly, in some embodiments, the RNA described herein comprises at least one coding region encoding an antigen peptide or polypeptide and an amino acid sequence that enhances antigen processing and / or presentation, wherein the amino acid sequence that enhances antigen processing and / or presentation is preferably fused to the C-terminus of the antigen peptide or polypeptide, more preferably to the antigen peptide or polypeptide described herein.
[0405] Furthermore, the secretory sequence can be fused to the N-terminus of an antigenic peptide or polypeptide.
[0406] The amino acid sequence derived from the tetanus toxoid of Clostridium tetani may be used to overcome self-tolerance mechanisms in order to efficiently initiate an immune response against autoantigens by providing T cell support during priming.
[0407] According to some embodiments, an amino acid sequence that disrupts immune tolerance is fused to an antigen peptide or polypeptide, either directly or via a linker.
[0408] Such amino acid sequences that disrupt immune tolerance are, but are not limited, preferably located at the C-terminus of an antigen peptide or polypeptide (and optionally at the N-terminus of an amino acid sequence that enhances antigen processing and / or presentation), where the amino acid sequence that disrupts immune tolerance and the amino acid sequence that enhances antigen processing and / or presentation may be fused directly or via a linker. The amino acid sequences that disrupt immune tolerance as defined herein preferably improve the T cell response. In some embodiments, the amino acid sequences that disrupt immune tolerance as defined herein include, but are not limited, sequences derived from tetanus toxoid-derived helper sequences p2 and p16 (P2P16), particularly sequences including the amino acid sequence of SEQ ID NO: 14 or its functional variants.
[0409] In some embodiments, the amino acid sequence that disrupts immune tolerance includes the amino acid sequence of SEQ ID NO: 14, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the amino acid sequence of SEQ ID NO: 14, or a functional fragment of the amino acid sequence of SEQ ID NO: 14 or an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the amino acid sequence of SEQ ID NO: 14. In some embodiments, the amino acid sequence that disrupts immune tolerance includes the amino acid sequence of SEQ ID NO: 14.
[0410] In some embodiments, the antigen receptor is an antibody or B cell receptor that binds to an epitope in the antigen. In some embodiments, the antibody or B cell receptor binds to a native epitope of the antigen.
[0411] The terms "expressed on the cell surface" or "associated with the cell surface" mean that a molecule, such as an antigen, is positioned in association with the cell's plasma membrane, with at least a portion of the molecule facing the extracellular space of the cell and accessible from the outside of the cell, for example, by an antibody located outside the cell. In this context, the portion may be, for example, at least 4, at least 8, at least 12, or at least 20 amino acids. The association may be direct or indirect. For example, the association may be by one or more transmembrane domains, one or more lipid anchors, or by interaction with any other protein, lipid, sugar, or other structure that may be found on the outer layer of the cell's plasma membrane. For example, a molecule associated with the cell surface may be a transmembrane protein having an extracellular portion, or a protein that associates with the cell surface by interacting with another protein that is a transmembrane protein.
[0412] "Cell surface" or "surface of a cell" is used according to its usual meaning in the art and therefore includes the outside of the cell accessible by binding by proteins and other molecules. Antigens are expressed on the cell surface if they are located on the cell surface and accessible by binding by, for example, antigen-specific antibodies added to the cell. In some embodiments, the antigen expressed on the cell surface is an intrinsic membrane protein having an extracellular component that can be recognized by CARs.
[0413] In the context of this disclosure, the terms “exodomain” refer to a portion of a molecule, such as a protein, that faces the extracellular space of a cell and is accessible from outside the cell, preferably by binding to a molecule such as an antibody located outside the cell. In some embodiments, the terms refer to one or more extracellular loops or domains or fragments thereof.
[0414] The terms “T cell” and “T lymphocyte” are used interchangeably herein and include T helper cells (CD4+ T cells) and cytotoxic T cells (CTLs, CD8+ T cells), including cytolytic T cells. The term “antigen-specific T cell” or similar terms refer to T cells that recognize a target antigen when presented on the surface of antigen-presenting cells or disease cells such as cancer cells, particularly in relation to MHC molecules, and preferably exert effector function as a T cell. A T cell is considered antigen-specific if it kills target cells expressing the antigen. T cell specificity can be assessed using any of various standard techniques, for example, in a chromium release assay or proliferation assay. Alternatively, the synthesis of lymphokines (such as interferon-γ) can be measured.
[0415] In some embodiments, the term “target” refers to an active substance, such as a cell or tissue, that is the target of an immune response, such as a cellular immune response. Targets include cells that present an antigen or antigen epitope, i.e., a peptide fragment derived from an antigen. In some embodiments, target cells are cells that express an antigen and present the antigen together with a class I MHC.
[0416] "Antigen processing" refers to the breakdown of an antigen into processing products, which are fragments of the antigen (e.g., breakdown of polypeptides into peptides), and the association (e.g., by binding) of one or more of these fragments with an MHC molecule for presentation to specific T cells by cells such as antigen-presenting cells. Antigen-presenting cells can be classified into professional antigen-presenting cells and non-professional antigen-presenting cells.
[0417] The term "professional antigen-presenting cells" refers to antigen-presenting cells that constitutively express major histocompatibility complex class II (MHC class II) molecules necessary for interaction with naive T cells. When T cells interact with the MHC class II molecular complex on the membrane of antigen-presenting cells, the antigen-presenting cells produce costimulatory molecules that induce T cell activation. Professional antigen-presenting cells include dendritic cells and macrophages.
[0418] The term "non-professional antigen-presenting cells" refers to antigen-presenting cells that do not constitutively express MHC class II molecules but express them in response to stimulation by certain cytokines, such as interferon-gamma. Examples of non-professional antigen-presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells, or vascular endothelial cells.
[0419] The term “dendritic cells” (DCs) refers to a subtype of phagocytic cells belonging to the class of antigen-presenting cells. In some embodiments, dendritic cells originate from hematopoietic myeloid progenitor cells. These progenitor cells first transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T-cell activating ability. Immature dendritic cells constantly sample the surrounding environment for pathogens such as viruses and bacteria. When they come into contact with presentable antigens, they are activated and become mature dendritic cells, and begin to migrate to the spleen or lymph nodes. Immature dendritic cells phagocytose pathogens, breaking down their proteins into small fragments, and upon maturation, they use MHC molecules to present these fragments on their cell surface. At the same time, they upregulate cell surface receptors that function as co-receptors in T-cell activation, such as CD80, CD86, and CD40, greatly enhancing their ability to activate T cells. They also upregulate CCR7, a chemotactic receptor that induces dendritic cells to migrate through the bloodstream to the spleen or through the lymphatic system to the lymph nodes. Here, they act as antigen-presenting cells, activating helper T cells, killer T cells, and B cells by presenting antigens along with non-antigen-specific costimulatory signals. Thus, dendritic cells can actively induce immune responses related to T cells or B cells. In some embodiments, the dendritic cells are splenic dendritic cells.
[0420] The term "macrophage" refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Activated by inflammation, immune cytokines, or microbial products, macrophages nonspecifically engulf and kill foreign pathogens within the macrophage through hydrolytic and oxidative attacks that lead to the degradation of the pathogens. Peptides derived from the degraded proteins are presented on the surface of macrophage cells, where they can be recognized by T cells. They can then directly interact with antibodies on the surface of B cells, leading to the activation of T and B cells and further stimulation of the immune response. Macrophages belong to the class of antigen-presenting cells. In some embodiments, macrophages are splenic macrophages.
[0421] "Antigen-responsive CTLs" are CD8 cells that are responsive to antigens or peptides derived from antigens, and are presented on the surface of antigen-presenting cells along with class I MHC. + This refers to T cells.
[0422] According to this disclosure, CTL responsiveness may include sustained calcium flow, cell division, production of cytokines such as IFN-γ and TNF-α, upregulation of activation markers such as CD44 and CD69, and specific cytolytic death of target cells expressing tumor antigens. CTL responsiveness may also be determined using artificial reporters that accurately demonstrate CTL responsiveness.
[0423] As used herein, “activation” or “stimulation” refers to a state of immune effector cells, such as T cells, that have been sufficiently stimulated to induce detectable cell proliferation. Activation may also involve the initiation of signaling pathways, induction of cytokine production, and detectable effector function. The term “activated immune effector cell” refers, among other things, to an immune effector cell undergoing cell division.
[0424] The term "priming" refers to the process by which immune effector cells, such as T cells, first come into contact with their specific antigens, triggering differentiation into effector cells, such as effector T cells.
[0425] The term "proliferation" refers to the process by which a particular entity increases in number. In some embodiments, this term is used in the context of an immunological response in which immune effector cells are stimulated by an antigen, proliferate, and specific immune effector cells that recognize the antigen are amplified. In some embodiments, proliferation leads to the differentiation of immune effector cells.
[0426] The terms “immune response” and “immune reaction” are used herein interchangeably in their conventional meanings and refer to an integrated bodily response to an antigen, which may refer to a cellular immune response, a humoral immune response, or both. According to this disclosure, the terms “immune response to” or “immune response to” an active substance such as an antigen, cell, or tissue refer to an immune response such as a cellular response to an active substance. An immune response is the expression of antibodies against one or more antigens, as well as antigen-specific T lymphocytes, e.g., CD4, which can be detected in various in vitro proliferation or cytokine production tests. + and CD8 + T lymphocytes, for example, CD8 + This may include one or more reactions selected from the group consisting of T lymphocyte proliferation.
[0427] In the context of this disclosure, the terms “induce an immune response” and “trigger an immune response” and similar terms refer to the induction of an immune response, e.g., a cellular immune response, a humoral immune response, or both. An immune response may be protective / defensive / preventive and / or therapeutic. An immune response may be against any immunogen or antigen or antigenic peptide, e.g., tumor-associated antigen or pathogen-associated antigen (e.g., an antigen of a virus (such as influenza virus (type A, B, or C), CMV, or RSV)). In this context, “induce” may mean that no immune response to a particular antigen or pathogen existed before induction, but may also mean that some degree of immune response to a particular antigen or pathogen existed before induction, and the immune response is enhanced after induction. Thus, “induce an immune response” in this context also includes “enhance an immune response.” In some embodiments, after inducing an immune response in an individual, the individual is protected from the development of a disease, such as an infectious disease or cancer, or the disease state is improved by inducing an immune response.
[0428] The terms “cellular immune response,” “cellular response,” “cellular immunity,” or similar terms are intended to include cellular responses to cells characterized by antigen expression and / or antigen presentation by class I or class II MHC. Cellular responses relate to cells called T cells or T lymphocytes that act as either “helper” or “killer” cells. Helper T cells (CD4 + T cells (also called T cells) play a central role in regulating the immune response, and killer cells (cytotoxic T cells, cytolytic T cells, CD8) + T cells (also called CTLs) kill diseased cells and other types of cells.
[0429] The term "humoral immune response" refers to the process in living organisms in which antibodies are produced in response to agents and organisms, ultimately neutralizing and / or eliminating them. The specificity of the antibody response is mediated by T cells and / or B cells via membrane-bound receptors that bind to monospecific antigens. After binding to the appropriate antigen and receiving various other activation signals, B lymphocytes divide to produce memory B cells and antibody-secreting plasma cell clones, each producing antibodies that recognize the same antigenic epitope recognized by its antigen receptor. Memory B lymphocytes remain dormant until subsequently activated by their specific antigens. These lymphocytes provide the cellular basis for memory and the increased antibody response that occurs when re-exposed to a particular antigen.
[0430] As used herein, the term “antibody” refers to an immunoglobulin molecule capable of specifically binding to an epitope on an antigen. In particular, the term “antibody” refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds. The term “antibody” includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies, and any combination thereof. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The variable region and constant region are also referred to herein as the variable domain and constant domain, respectively. The VH and VL regions can be further subdivided into a hypervariable region called the complementarity-determining region (CDR) and a more conserved region called the framework region (FR) interspersed between them. Each VH and VL consists of three CDRs and four FRs arranged from the amino-terminus to the carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The CDRs of the VH are called HCDR1, HCDR2, and HCDR3, and the CDRs of the VL are called LCDR1, LCDR2, and LCDR3. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody includes a heavy chain constant region (CH) and a light chain constant region (CL), and the CH can be further subdivided into the constant domain CH1, the hinge region, and the constant domains CH2 and CH3 (arranged from the amino-terminus to the carboxy-terminus in the following order: CH1, CH2, CH3). The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. Antibodies can be intact immunoglobulins derived from natural or recombinant sources, or they can be the immunoactive portion of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Antibodies can exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies and humanized antibodies.
[0431] The term "immunoglobulin" refers to proteins of the immunoglobulin superfamily, such as antibodies or antigen receptors like B cell receptors (BCRs). Immunoglobulins are characterized by a structural domain, or immunoglobulin domain, that has a characteristic immunoglobulin (Ig) fold. This term encompasses membrane-bound immunoglobulins and soluble immunoglobulins. Membrane-bound immunoglobulins are generally part of BCRs and are also called surface immunoglobulins or membrane immunoglobulins. Soluble immunoglobulins are generally called antibodies. Immunoglobulins generally consist of several chains, typically two identical heavy chains and two identical light chains linked by disulfide bonds. These chains are primarily V L (variable light chain) domain, C L (constant light chain) domain, V H (variable heavy chain) domain, and C H (Stationary heavy chain) Domain C H 1, C H 2, C H 3 and C H It is composed of immunoglobulin domains such as 4. There are five types of mammalian immunoglobulin heavy chains, namely α, δ, ε, γ, and μ, which make up different classes of antibodies, namely IgA, IgD, IgE, IgG, and IgM. In contrast to the heavy chains of soluble immunoglobulins, the heavy chains of membrane or surface immunoglobulins contain a transmembrane domain and a short cytoplasmic domain at their carboxyl terminus. In mammals, there are two types of light chains, namely lambda and kappa. Immunoglobulin chains contain a variable region and a constant region. The constant region is essentially conserved within different isotypes of immunoglobulins, while the variable region is highly diverse and is responsible for antigen recognition.
[0432] The terms “vaccination” and “immunization” refer to the process of treating an individual for therapeutic or preventive reasons and relate to the procedure of administering one or more immunogens or antigens or derivatives thereof to an individual, particularly in the form of the RNA (particularly mRNA) encoding them, to stimulate an immune response to one or more immunogens or antigens or to cells characterized by the presentation of one or more immunogens or antigens, as described herein.
[0433] The terms "cells characterized by antigen presentation," "cells that present antigens," or "MHC molecules that present antigens on the surface of antigen-presenting cells," or similar expressions, refer to disease cells, particularly tumor cells or infected cells, or cells that present antigens or antigenic peptides, either directly or after processing, in relation to MHC molecules such as MHC class I and / or MHC class II molecules. In some embodiments, the MHC molecule is an MHC class I molecule.
[0434] The term "allergen" refers to a type of antigen that originates from outside the body of the target (i.e., allergens are sometimes called "external antigens") and causes the target's immune system to produce an unusually strong immune response to a perceived threat that would otherwise be harmless to the target. "Allergy" is a disease caused by such a strong immune response to an allergen. Allergens are typically antigens that can stimulate a type I hypersensitivity reaction in atopic individuals through an immunoglobulin E (IgE) response. Specific examples of allergens include those derived from peanut protein (e.g., Ara h 2.02), ovalbumin, grass pollen protein (e.g., Phl p 5), and dust mite protein (e.g., Der p 2).
[0435] The term "growth factor" refers to molecules that can stimulate cell growth, proliferation, healing, and / or cell differentiation. Typically, growth factors function as intercellular signaling molecules. The term "growth factor" includes certain cytokines and hormones that bind to specific receptors on the surface of their target cells. Examples of growth factors include bone morphogenetic proteins (BMPs), fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), e.g., VEGFA, epidermal growth factor (EGF), insulin-like growth factor, ephrin, macrophage colony-stimulating factor, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor, neuregulin, neurotrophins (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF)), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS) (anti-apoptotic survival factor), T cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factors (transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β)), and tumor necrosis factor alpha (TNF-α). In some embodiments, the “growth factor” is a peptide or polypeptide growth factor.
[0436] The term "protease inhibitor" refers to molecules, particularly peptides or polypeptides, that inhibit the function of proteases. Protease inhibitors can be classified by the protease they inhibit (e.g., aspartate protease inhibitors) or by their mechanism of action (e.g., suicide inhibitors such as serpines). Specific examples of protease inhibitors include alpha-1 antitrypsin, aprotinin, and serpines such as bestatin.
[0437] The term "enzyme" refers to a polymeric biological catalyst that facilitates a chemical reaction. Like any catalyst, enzymes are not consumed in the reaction they catalyze and do not alter the equilibrium of the reaction. Unlike many other catalysts, enzymes are far more specific. In some embodiments, enzymes are essential for the homeostasis of the subject, and any dysfunction of an enzyme (in particular, decreased activity which may be caused by mutation, deletion, or reduced production) can lead to disease. Examples of enzymes include herpes simplex virus type 1 thymidine kinase (HSV1-TK), hexosaminidase, phenylalanine hydroxylase, pseudocholinesterase, and lactase.
[0438] The term "receptor" refers to a protein molecule that receives signals (particularly chemical signals called ligands) from outside the cell. Binding of a signal (e.g., ligand) to a receptor triggers a certain cellular response, such as the activation of a kinase within the cell. Receptors include transmembrane receptors (such as ion channel-coupled receptors, G protein-coupled (metabotropic) receptors, and enzyme-coupled receptors) as well as intracellular receptors (such as cytoplasmic and nuclear receptors). Specific examples of receptors include steroid hormone receptors, growth factor receptors, and peptide receptors (i.e., receptors whose ligand is a peptide), such as P-selectin glycoprotein ligand-1 (PSGL-1). The term "growth factor receptor" refers to a receptor that binds to a growth factor.
[0439] The term "apoptosis regulator" refers to molecules, particularly peptides or polypeptides, that regulate apoptosis, i.e., activate or inhibit it. Apoptosis regulators can be broadly classified into two classes: those that regulate mitochondrial function and those that regulate caspases. The first class includes proteins (e.g., BCL-2, BCL-xL) that work to maintain mitochondrial integrity by preventing the loss of mitochondrial membrane potential and / or the release of pro-apoptotic proteins such as cytochrome C into the cytosol. Pro-apoptotic proteins that promote the release of cytochrome C (e.g., BAX, BAK, BIM) also belong to this first class. The second class includes proteins such as anti-apoptotic proteins (e.g., XIAP) or FLIP that block caspase activation.
[0440] The term "transcription factor" refers specifically to proteins that regulate the rate of transcription of genetic information from DNA to messenger RNA by binding to specific DNA sequences. Transcription factors can regulate cell division, proliferation, and death throughout life, regulate cell migration and organization during embryonic development, and / or regulate in response to extracellular signals such as hormones. Transcription factors typically contain at least one DNA-binding domain that binds to a specific DNA sequence adjacent to the gene regulated by the transcription factor. Specific examples of transcription factors include MECP2, FOXP2, FOXP3, the STAT protein family, and the HOX protein family.
[0441] The term "tumor suppressor protein" refers to molecules, particularly peptides or polypeptides, that protect cells from one step in the pathway to cancer. Tumor suppressor proteins (usually encoded by corresponding tumor suppressor genes) exert attenuating or suppressive effects on the regulation of the cell cycle and / or promote apoptosis. Their functions may include one or more of the following: suppression of genes essential for the continuation of the cell cycle; linking the cell cycle to DNA damage (cell division should not occur as long as damaged DNA is present in the cell); initiation of apoptosis when damaged DNA cannot be repaired; suppression of metastasis (e.g., prevention of the dispersion of tumor cells, blocking the loss of contact inhibition, and inhibiting metastasis); and DNA repair. Specific examples of tumor suppressor proteins include p53, phosphatase-tensin homolog (PTEN), SWI / SNF (SWItch / Sucrose Non-Fermentable), von Hippel-Lindau tumor suppressor (pVHL), adenomatous polyposis of colorectal disease (APC), CD95, tumor suppressor 5 (ST5), tumor suppressor 5 (ST5), tumor suppressor 14 (ST14), and Yippee-like 3 (YPEL3).
[0442] The term "structural protein" refers to proteins that impart rigidity and stiffness to otherwise fluid biological components. Structural proteins are mostly fibrous (such as collagen and elastin), but can also be spherical (such as actin and tubulin). Spherical proteins are usually soluble as monomers, but can polymerize to form long fibers that can, for example, make up the cytoskeleton. Other structural proteins include motor proteins (such as myosin, kinesin, and dynein) that can generate mechanical forces, as well as surfactant proteins. Specific examples of structural proteins include collagen, surfactant protein A, surfactant protein B, surfactant protein C, surfactant protein D, elastin, tubulin, actin, and myosin.
[0443] The terms “reprogramming factor” or “reprogramming transcription factor” refer to molecules, particularly peptides or polypeptides, that, when expressed in somatic cells, optionally with additional agents, such as further reprogramming factors, result in the reprogramming or dedifferentiation of somatic cells into stem cell-like properties, especially pluripotent cells. Specific examples of reprogramming factors include OCT4, SOX2, c-MYC, KLF4, LIN28, and NANOG.
[0444] The term "genome-engineered protein" refers to a protein that can insert, delete, or replace DNA in a target genome. Specific examples of genome-engineered proteins include meganucleases, zinc finger nucleases (ZFNs), activator-like effectanucleases (TALENs), and clustered, regularly spaced, short-palindromic repeat CRISPR-related protein 9 (CRISPR-Cas9).
[0445] The term "blood proteins" refers to peptides or polypeptides present in the plasma of a subject, particularly in the plasma of a healthy subject. Blood proteins have diverse functions, including transport (e.g., albumin, transferrin), enzymatic activity (e.g., thrombin or ceruloplasmin), blood coagulation (e.g., fibrinogen), defense against pathogens (e.g., complement components and immunoglobulins), and protease inhibitors (e.g., alpha-1 antitrypsin). Specific examples of blood proteins include thrombin, serum albumin, factor VII, factor VIII, insulin, factor IX, factor X, tissue plasminogen activator, protein C, von Willebrand factor, antithrombin III, glucocerebrosidase, erythropoietin, granulocyte colony-stimulating factor (G-CSF), modified factor VIII, and anticoagulant factors.
[0446] Therefore, in some embodiments, the pharmaceutically active peptide or polypeptide is (i) a cytokine, more preferably EPO, selected from the group consisting of erythropoietin (EPO), interleukin 4 (IL-2), and interleukin 10 (IL-11); (ii) adhesion molecules, particularly integrins; (iii) immunoglobulins, particularly antibodies; (iv) immunologically active compounds, particularly antigens such as viral or bacterial antigens, e.g., SARS-CoV-2 antigens, e.g., SARS-CoV-2 spike (S) protein or its variants; (v) hormones, particularly vasopressin, insulin, or growth hormone; (vi) growth factors, particularly VEGFA; (vii) protease inhibitors, particularly alpha-1 antitrypsin; (viii) preferably herpes simplex virus type 1 thymidinequinate (ix) enzymes selected from the group consisting of -ase (HSV1-TK), hexosaminidase, phenylalanine hydroxylase, pseudocholinesterase, pancreatic enzymes and lactase; (x) receptors, especially growth factor receptors; (x) apoptosis regulators, especially BAX; (xi) transcription factors, especially FOXP3; (xii) tumor suppressor proteins, especially p53; (xiii) structural proteins, especially surfactant protein B; (xiv) reprogramming factors selected from the group consisting of, for example, OCT4, SOX2, c-MYC, KLF4, LIN28 and NANOG; (xv) genome engineering proteins, especially clustered regular short-spacing palindromic repeat CRISPR-related protein 9 (CRISPR-Cas9); and (xvi) blood proteins, especially fibrinogen.
[0447] In some embodiments, the pharmaceutically active peptide or polypeptide comprises one or more antigens or one or more epitopes, i.e., administration of the peptide or polypeptide to a subject may induce an immune response in the subject to one or more antigens or one or more epitopes, which may be therapeutic, partially, or completely protective.
[0448] In some embodiments, the RNA encodes at least one epitope, for example, at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes.
[0449] In some embodiments, the target antigen is a tumor antigen, and the antigen sequence (e.g., an epitope) is derived from the tumor antigen. The tumor antigen may be a “standard” antigen that is commonly known to be expressed in various cancers. The tumor antigen may also be a “neoantigen” that is specific to the tumor of an individual and has not been previously recognized by the immune system. A neoantigen or neoepitope may arise from one or more cancer-specific mutations in the genome of a cancer cell that result in an amino acid change. If the tumor antigen is a neoantigen, the vaccine antigen preferably includes an epitope or fragment of the neoantigen containing one or more amino acid changes.
[0450] Examples of tumor antigens include, but are not limited to, p53, ART-4, BAGE, beta-catenin / m, Bcr-abL CAMEL, CAP-1, CASP-8, CDC27 / m, CDK4 / m, CEA, claudin family cell surface proteins such as claudin 6, claudin 18.2 and claudin 12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, and Gap. 100, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, preferably MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, or MAGE-A12, MAGE-B, MAGE-C, MART-1 / Melan A, MC1R, Myosin / m, MUC Examples include 1, MUM-1, MUM-2, MUM-3, NA88-A, NF1, NY-ESO-1, NY-BR-1, pl90 minor BCR-abL, Pml / RARa, PRAME, Proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, Survivin, TEL / AML1, TPI / m, TRP-1, TRP-2, TRP-2 / INT2, TPTE, WT, and WT-1.
[0451] Cancer mutations vary from individual to individual. Therefore, cancer mutations encoding novel epitopes (neoepitopes) are attractive targets in the development of vaccine compositions and immunotherapies. The effectiveness of tumor immunotherapy depends on the selection of cancer-specific antigens and epitopes that can induce a robust immune response within the host. RNA can be used to deliver patient-specific tumor epitopes to patients. Dendritic cells (DCs) present in the spleen are particularly interesting antigen-presenting cells for RNA expression of immunogenic epitopes or antigens, such as tumor epitopes. The use of multiple epitopes has been shown to enhance the therapeutic effect in tumor vaccine compositions. Rapid sequencing of tumor mutanomes may provide multiple epitopes for personalized vaccines that can be encoded by the RNAs (particularly mRNA) described herein, for example, as single polypeptides with the epitopes optionally isolated by linkers. In some embodiments of this disclosure, RNA (particularly mRNA) encodes at least one epitope, at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes. Exemplary embodiments include RNA (particularly mRNA) encoding at least five epitopes (referred to as "pentatopes") and RNA (particularly mRNA) encoding at least ten epitopes (referred to as "decatopes").
[0452] In some embodiments, the antigen or epitope is derived from a pathogen-associated antigen, particularly a viral antigen.
[0453] In some embodiments, the antigen or epitope is derived from a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of a coronavirus protein or its immunogenic variant. Thus, in some embodiments, the RNA used in this disclosure, for example mRNA, encodes an amino acid sequence comprising a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of a coronavirus protein or its immunogenic variant.
[0454] In some embodiments, the antigen or epitope is derived from the coronavirus S protein, its immunogenic variant, or an immunogenic fragment of the coronavirus S protein or its immunogenic variant. Therefore, in some embodiments, the RNA (in particular mRNA) described herein encodes an amino acid sequence comprising the coronavirus S protein, its immunogenic variant, or an immunogenic fragment of the coronavirus S protein or its immunogenic variant. In some embodiments, the coronavirus is MERS-CoV. In some embodiments, the coronavirus is SARS-CoV. In some embodiments, the coronavirus is SARS-CoV-2.
[0455] The term “immunologically equivalent” means that immunologically equivalent molecules, such as immunologically equivalent amino acid sequences, exhibit the same or essentially the same immunological properties and / or exert the same or essentially the same immunological effects, for example, with respect to the type of immunological effect. In the context of this disclosure, the term “immunologically equivalent” is preferably used with respect to the immunological effects or properties of an antigen or antigen variant used for immunization. For example, if an amino acid sequence induces an immune response that has specificity to react with a reference amino acid sequence when exposed to the immune system of interest, then that amino acid sequence is immunologically equivalent to the reference amino acid sequence. Thus, in some embodiments, an antigen and an immunologically equivalent molecule exhibit the same or essentially the same properties as the antigen targeted by T cells and / or exert the same or essentially the same effects with respect to the stimulation, priming, and / or proliferation of T cells.
[0456] miRNA binding sequence The RNA described herein comprises one or more miRNA binding sequences. In some embodiments, the one or more miRNA binding sequences function to recruit one or more miRNA molecules, for example, selectively expressed, which are expressed in one or more cell types or tissue types where RNA expression is not desired. In some embodiments, the one or more miRNA molecules target RNA, thereby regulating (e.g., inhibiting) or destabilizing the translation of the target RNA. In some embodiments, the one or more miRNA molecules are absent or present in smaller amounts in one or more cell types or tissue types where RNA expression is desired. In some embodiments, one or more miRNAs endogenously present in one or more cell types or tissue types where RNA expression is not desired can target RNA having one or more binding sites for one or more miRNAs. In some embodiments, the miRNAs are expressed, or selectively expressed, in one or more cell types or tissue types where RNA expression is not desired.
[0457] MicroRNAs (miRNAs) are small (approximately 20-25 nt) non-coding RNAs that are abundant in cells and function as important regulators of gene expression. The canonical model of miRNA biosynthesis is tightly controlled by several enzymes that produce three major RNA products: primary (pri-)miRNA, precursor (pre-)miRNA, and mature miRNA. Mature miRNAs are derived from the 5' or 3' arm of the precursor product, denoted by the suffixes -5p or -3p, respectively. One arm is incorporated into the RNA-induced silencing complex (RISC) and becomes functional, while the other arm is a byproduct and is either degraded or both the mature miR-5p and miR-3p arms of pre-miRNA can associate with RISC.
[0458] Examples of tissues in which miRNAs regulate mRNA and thereby regulate protein expression are known include endothelial cells (miR-126, miR-17-92), hepatocytes (miR-122, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, miR-4783-3p), muscle (miR-208, miR-133, miR-206), and hematopoietic cells (miR-142-3p, miR Examples include, but are not limited to, miR-142-5p, miR-16, miR-223-3p, miR-150-5p, miR-650, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126). Therefore, RNA expression can be suppressed in one or more selected tissues by incorporating one or more binding sites for one or more miRNAs known to be present in one or more selected tissues. In some cases, the RNA contains one or more miRNA binding sequences for a miRNA selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, miR-206, miR-208, miR-216, miR-217, miR-16-5p, miR-223-3p, miR-150-5p, miR-650, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, or miR-4783-3p. In some cases, the RNA contains one or more miRNA binding sequences for miRNAs selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, miR-206, miR-208, miR-216, or miR-217.In some cases, the RNA contains one or more miRNA binding sequences for miRNAs selected from miR-126-5p, miR-126-3p, miR-122, or miR-142-3p.
[0459] Human miR-126 (also known as miR-126-3p) and its complement, miR-126* (also known as miR-126-5p), originate from the same precursor, and their gene loci are hosted by intron 7 of the Egfl7 (epidermal growth factor-like domain 7) gene on chromosome 9. miR-126-3p and miR-126-5p are expressed in endothelial cells, throughout capillaries and larger blood vessels. Human miR-122 is encoded at a single genomic locus on chromosome 18, and miR-122 (more specifically miR-122-5p) is highly expressed in the liver. Human miR-142 (particularly miR-142-3p and miR-142-5p) is encoded on chromosome 17 and is highly expressed in hematopoietic cells.
[0460] In some embodiments, the RNA described herein, which includes one or more miRNA binding sequences, includes one or more miRNA binding sequences that are complementary to one or more miRNAs. The RNA may contain any number of miRNA binding sequences (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or more). Two or more miRNA binding sequences may be more potent than a single miRNA binding sequence in repressing the gene expression of the RNA. Due to limitations in the size of the RNA, it becomes practical to have one, two, or three miRNA binding sequences. When the RNA contains multiple miRNA binding sequences, each of the miRNA binding sequences may bind to the same or different miRNAs, or a combination thereof. In some embodiments, the RNA described herein, which includes one or more miRNA binding sequences, includes one miRNA binding sequence. In some embodiments, the RNA described herein, which includes one or more miRNA binding sequences, includes two miRNA binding sequences. In some embodiments, the RNA described herein, which includes one or more miRNA binding sequences, includes three miRNA binding sequences. In some embodiments, the RNA described herein, which includes one or more miRNA binding sequences, includes four miRNA binding sequences. In some embodiments, multiple miRNA-binding sequences bind to the same miRNA, different miRNAs, or a combination thereof. In some embodiments, multiple miRNA-binding sequences bind to the same miRNA. In some embodiments, multiple miRNA-binding sequences are linked in series in the RNA.
[0461] The miRNA binding sequence can be of any length sufficient to recruit the desired miRNA. In certain embodiments, the miRNA binding sequence is about 5 to about 25 nucleotides long (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 nucleotides).
[0462] The miRNA binding sequence may have any amount of complementarity with its congener miRNA (e.g., complementary nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25). In some embodiments, the miRNA binding sequence is manipulated to include a specific combination of Watson-Crick base pairs and their congener miRNA binding partners. In some embodiments, the miRNA binding sequence is the exact Watson-Crick complement of the miRNA, i.e., perfectly complementary to its congener miRNA.
[0463] RNA can contain one or more miRNA binding sequences in any portion of the RNA, as long as the location of one or more miRNA binding sequences does not interfere with the proper expression of the pharmaceutically active peptide or polypeptide. In some embodiments, one or more miRNA binding sequences are located in the 3'UTR of the target RNA. In some embodiments, one or more miRNA binding sequences are located between the open reading frame and the 3'UTR of the target RNA.
[0464] In some embodiments, one or more cell or tissue types in which RNA expression is not desired include endothelial cells or endothelial tissue. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules selected from the group consisting of miR-126, e.g., miR-126-5p and / or miR-126-3p, miR-216a, miR-217, or combinations thereof.
[0465] In some embodiments, one or more cell or tissue types in which RNA expression is not desired include cardiomyocytes or cardiomyocytes. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules selected from the group consisting of miR-208b, miR-499a, or combinations thereof.
[0466] In some embodiments, one or more cell or tissue types in which RNA expression is not desired include hematopoietic cells, e.g., immune cells, or hematopoietic tissue, e.g., immune tissue. In some embodiments, immune cells include dendritic cells and / or macrophages, e.g., Kupffer cells. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules selected from the group consisting of miR-142-3p, miR-16, miR-223, miR-451, miR-150, or combinations thereof. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules, including miR-142-3p, in some embodiments.
[0467] In some embodiments, one or more cell or tissue types in which RNA expression is not desired include hepatocytes or liver tissue. In some embodiments, liver cells include hepatocytes. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules, including miR-122, in some embodiments.
[0468] In some embodiments, one or more cell or tissue types in which RNA expression is not desired include muscle cells or muscle tissue. In these embodiments, one or more miRNA binding sequences function to recruit one or more miRNA molecules, including miR-206, in some embodiments.
[0469] The miRNA species and corresponding binding sequences that may be used herein include species selected from the groups shown in the table below.
[0470] [Table 2]
[0471] In some embodiments, the RNA described herein includes a binding sequence, or a plurality thereof, to a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p, or miR-122, for example, a sequence in which the binding sequence, or a plurality thereof, to a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p, or miR-122 is repeated two, three, or more times. In some embodiments, the binding sequence, or a plurality thereof, to a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p, or miR-122 is located between the open reading frame and the 3'UTR.
[0472] In some embodiments, the RNA described herein includes a binding sequence or more to miR-126-5p, for example, a sequence in which the binding sequence to miR-126-5p is repeated two, three or more times. In some embodiments, the binding sequence or more to miR-126-5p is located between the open reading frame and the 3'UTR.
[0473] In some embodiments, the RNA described herein includes a binding sequence or more to miR-126-3p, for example, a sequence in which the binding sequence to miR-126-3p is repeated two, three or more times. In some embodiments, the binding sequence or more to miR-126-3p is located between the open reading frame and the 3'UTR.
[0474] In some embodiments, the RNA described herein includes a binding sequence or more to miR-126-5p, for example, a sequence in which the binding sequence to miR-126-5p is repeated two, three or more times, and a binding sequence or more to miR-126-3p, for example, a sequence in which the binding sequence to miR-126-3p is repeated two, three or more times. In some embodiments, the binding sequence or more to miR-126-5p and the binding sequence or more to miR-126-3p are located between the open reading frame and the 3'UTR.
[0475] RNA delivery The RNA described herein may be delivered for the therapeutic application described herein by any suitable method known in the art, including, for example, delivery as naked RNA or delivery mediated by a delivery vehicle.
[0476] In some embodiments, after administration of the RNA (particularly mRNA) composition / formulation described herein, at least a portion of the RNA is delivered to target cells or target organs. In some embodiments, at least a portion of the RNA is delivered to the cytosol of target cells. In some embodiments, the RNA is RNA (particularly mRNA) encoding a peptide or polypeptide, which is translated by the target cells to produce a peptide or polypeptide. In some embodiments, the target cells are cells in the liver. In some embodiments, the target cells are muscle cells. In some embodiments, the target cells are tumor cells or cells in the tumor microenvironment. In some embodiments, the target cells are blood cells. In some embodiments, the target cells are cells in lymph nodes. In some embodiments, the target cells are cells in the lungs. In some embodiments, the target cells are cells in the skin. In some embodiments, the target cells are spleen cells. In some embodiments, the target cells are antigen-presenting cells, such as professional antigen-presenting cells in the spleen. In some embodiments, the target cells are dendritic cells in the spleen. In some embodiments, the target cells are T cells. In some embodiments, the target cells are B cells. In some embodiments, the target cells are NK cells. In some embodiments, the target cells are monocytes. Therefore, the RNA (particularly mRNA) compositions / formulations described herein may be used to deliver RNA to such target cells.
[0477] Some aspects of this disclosure involve the targeted delivery of mRNA disclosed herein to specific cells or tissues. In some embodiments, this disclosure involves targeting the lymphoid system, particularly secondary lymphoid organs, more specifically the spleen. Targeting the lymphoid system, particularly secondary lymphoid organs, more specifically the spleen, is particularly preferred when the RNA (particularly mRNA) to be administered is RNA (particularly mRNA) encoding an antigen or epitope for inducing an immune response. In some embodiments, the target cells are spleen cells. In some embodiments, the target cells are antigen-presenting cells, such as professional antigen-presenting cells in the spleen. In some embodiments, the target cells are dendritic cells in the spleen. The "lymphoid system" is part of the circulatory system and is an important part of the immune system, including a network of lymphatic vessels that carry lymph. The lymphoid system consists of lymphoid organs, a lymphatic conduction network, and circulating lymph. Primary lymphoid organs or central lymphoid organs produce lymphocytes from immature progenitor cells. The thymus and bone marrow constitute primary lymphoid organs. Secondary or peripheral lymphoid organs, including lymph nodes and the spleen, maintain mature naive lymphocytes and initiate adaptive immune responses.
[0478] Lipid-based RNA delivery systems may be useful for obtaining RNA expression in the liver, depending on the composition of the RNA delivery system used. Hepatic accumulation is caused by the discontinuous nature of the hepatic vascular system or lipid metabolism (liposomes and lipid or cholesterol conjugates). In some embodiments, the target organ for RNA expression is the liver, and the target tissue is liver tissue. Delivery to such target tissue is preferred, in particular, when the presence of RNA or encoded peptides or polypeptides in this organ or tissue is desired, and / or when the expression of encoded peptides or polypeptides in large quantities is desired, and / or when systemic presence of encoded peptides or polypeptides, especially in significant amounts, is desired or required.
[0479] Delivery vehicle To overcome barriers to safe and effective RNA delivery, RNA may be administered using one or more delivery vehicles that protect the RNA from degradation, maximize delivery to on-target cells, and minimize exposure to off-target cells. Such RNA delivery vehicles may complex or encapsulate the RNA and may contain a variety of materials, including polymers and lipids. In some embodiments, such RNA delivery vehicles may form particles together with the RNA.
[0480] The RNA described herein, particularly mRNA, may be present in particles comprising (i) RNA and (ii) at least one cationic or cationically ionizable compound, such as a polymer or lipid, that complexes the RNA. Electrostatic interactions between positively charged molecules, such as polymers and lipids, and negatively charged RNA are involved in particle formation. This results in the complexation and spontaneous formation of RNA particles.
[0481] Various types of RNA-containing particles have been previously described as suitable for the delivery of RNA in particulate form (see, for example, Kaczmarek, JCet al., 2017, Genome Medicine 9, 60). In the case of nonviral RNA delivery vehicles, encapsulation of RNA in nanoparticles physically protects the RNA from degradation and, depending on its specific chemical properties, can assist in cellular uptake and endosomal extrusion.
[0482] In the context of this disclosure, the term “particle” refers to a structured entity formed by a molecule or molecular complex, in particular by a particle-forming compound. In some embodiments, a particle includes an envelope (e.g., one or more layers or lamellae) made from one or more amphiphilic substances (e.g., amphiphilic lipids). In this context, the expression “amphiphilic substance” means that the substance has both hydrophilic and lipophilic properties. The envelope may also include further substances (e.g., further lipids) that do not need to be amphiphilic. Thus, a particle may be a monolamellar or multilamellar structure in which the substances constituting one or more layers or lamellae optionally include one or more amphiphilic substances (in particular, selected from the group consisting of amphiphilic lipids) in combination with further substances (e.g., further lipids) that do not need to be amphiphilic. In some embodiments, the term “particle” refers to a micro-sized or nano-sized structure, e.g., a micro-sized or nano-sized compact structure. According to this disclosure, the term “particle” includes nanoparticles.
[0483] RNA can be delivered to target sites of interest (e.g., cells, tissues, organs) using "RNA particles." RNA particles can be formed from lipids containing at least one cationic or cationically ionizable lipid. While not intended to be bound by any theory, it is thought that cationic or cationically ionizable lipids, together with RNA, form aggregates, and these aggregates result in colloidally stable particles.
[0484] The RNA particles described herein include lipid nanoparticle (LNP)-based and lipoplex (LPX)-based formulations.
[0485] The lipoplex (LPX) described herein can be obtained by mixing two aqueous phases, namely an RNA-containing phase and a lipid dispersion phase. In some embodiments, the lipid phase contains liposomes.
[0486] In some embodiments, liposomes are self-closed monolayer or multilayer vesicular particles, where the lamellae contain a lipid bilayer and the enclosed lumen contains an aqueous phase. A requirement for using liposomes for nanoparticle formation is that the lipids in the mixture can, if necessary, form a lamellar (bilayer) phase in the applied aqueous environment.
[0487] In some embodiments, liposomes comprise a monolayer or multilayer phospholipid bilayer surrounding an aqueous core (also referred herein as an aqueous lumen). They can be prepared from materials having polar head (hydrophilic) groups and nonpolar tail (hydrophobic) groups. In some embodiments, cationic lipids used to formulate liposomes designed for RNA delivery are inherently amphiphilic and consist of positively charged (cationic) amine head groups linked to hydrocarbon chains or cholesterol derivatives via glycerol.
[0488] In some embodiments, the lipoplex is a multilayer liposome-based formulation formed during electrostatic interactions between cationic liposomes and RNA. In some embodiments, the formed lipoplex has different internal molecular arrangements resulting from the conversion from liposome structures to compact RNA-lipoplexes.
[0489] In some embodiments, LPX particles comprise amphiphilic lipids, particularly cationic or cationically ionizable amphiphilic lipids, and RNA (particularly mRNA) as described herein. In some embodiments, electrostatic interactions between positively charged liposomes (made from one or more amphiphilic lipids, particularly cationic or cationically ionizable amphiphilic lipids) and negatively charged RNA (particularly mRNA) result in the complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes can generally be synthesized using cationic or cationically ionizable amphiphilic lipids such as DOTMA and / or DODMA, and optionally further lipids such as DOPE or DSPC.
[0490] Generally, lipid nanoparticles (LNPs) can typically be obtained from the direct mixing of RNA in an aqueous phase with lipids in a phase containing an organic solvent such as ethanol. In this case, lipids or lipid mixtures that do not form a lamellar (bilayer) phase in water can be used for particle formation.
[0491] In some embodiments, the LNP comprises or consists of cationic / cationically ionizable lipids and helper lipids, such as phospholipids, cholesterol, and / or polymer conjugate lipids (e.g., polyethylene glycol (PEG) lipids). In some embodiments, in the RNA LNP described herein, RNA (particularly mRNA) is bound to a cationically ionizable lipid occupying the central core of the LNP. In some embodiments, polymer conjugate lipids, together with phospholipids, form the surface of the LNP. In some embodiments, cholesterol and cationically ionizable lipids in charged and uncharged forms may be distributed throughout the LNP.
[0492] In some embodiments, the RNA (e.g., mRNA) described herein may non-covalently associate with the particles described herein. In embodiments, the RNA (especially mRNA) may be attached to the outer surface of the particle (surface RNA (especially surface mRNA)) and / or contained within the particle (inclusion RNA (especially inclusion mRNA)).
[0493] In some embodiments, the particles described herein (e.g., LNPs and LPXs) are in the range of about 10 to about 2000 nm, for example, at least about 15 nm (e.g., at least about 20 nm, at least about 25 nm, at least about 30 nm, at least about 35 nm, at least about 40 nm, at least about 45 nm, at least about 50 nm, at least about 55 nm, at least about 60 nm, at least about 65 nm, at least about 70 nm, at least about 75 nm, at least about 80 nm, at least about 85 nm, at least about 90 nm, at least about 95 nm, or at least about 100 nm) and / or up to about 1900 nm (e.g., up to about 1800 nm, up to about 1700 nm, up to about 1600 nm, up to about 1500 nm, up to about 1400 nm, up to about 1300 nm, up to about 1200 nm, up to about 1 100nm, up to approximately 1000nm, up to approximately 950nm, up to approximately 900nm, up to approximately 850nm, up to approximately 800nm, up to approximately 750nm, up to approximately 700nm, up to approximately 650nm, up to approximately 600nm, up to approximately 550nm, or up to approximately 500nm), for example, in the range of approximately 20 to approximately 1500nm, for example, approximately 30 to approximately 1200nm, approximately 40 to approximately 1100nm, approximately 50 to approximately 1000nm, approximately 60 to approximately The particles have sizes (such as diameter) in the range of 900 nm, about 70 to about 800 nm, about 80 to about 700 nm, about 90 to about 600 nm, or about 50 to about 500 nm or about 100 to about 500 nm, for example, 10 to 1000 nm, 15 to 500 nm, 20 to 450 nm, 25 to 400 nm, 30 to 350 nm, 40 to 300 nm, 50 to 250 nm, 60 to 200 nm, 70 to 150 nm, or 80 to 150 nm. In some embodiments, the particles described herein (e.g., LNPs and LPXs) have sizes (such as diameter) in the range of about 40 nm to about 200 nm, for example, about 50 nm to about 180 nm, about 60 nm to about 160 nm, about 80 nm to about 150 nm, or about 80 nm to about 120 nm.
[0494] In some embodiments, the particles described herein (e.g., LNP and LPX) are, in some embodiments, approximately 50 nm to approximately 1000 nm, approximately 50 nm to approximately 800 nm, approximately 50 nm to approximately 700 nm, approximately 50 nm to approximately 600 nm, approximately 50 nm to approximately 500 nm, approximately 50 nm to approximately 450 nm, approximately 50 nm to approximately 400 nm, approximately 50 nm to approximately 350 nm, and approximately 50 nm to approximately 300 nm. , about 50nm to about 250nm, about 50nm to about 200nm, about 100nm to about 1000nm, about 100nm to about 800nm, about 100nm to about 700nm, about 100nm to about 600nm, about 100nm to about 500nm, about 100nm to about 450nm, about 100nm to about 400nm, about 100nm to about 350nm, about 100nm to about 300nm, about 100nm to about 250nm, Approximately 100nm to approximately 200nm, approximately 150nm to approximately 1000nm, approximately 150nm to approximately 800nm, approximately 150nm to approximately 700nm, approximately 150nm to approximately 600nm, approximately 150nm to approximately 500nm , about 150nm to about 450nm, about 150nm to about 400nm, about 150nm to about 350nm, about 150nm to about 300nm, about 150nm to about 250nm, about 150nm to about 200nm , have an average diameter in the range of approximately 200 nm to approximately 1000 nm, approximately 200 nm to approximately 800 nm, approximately 200 nm to approximately 700 nm, approximately 200 nm to approximately 600 nm, approximately 200 nm to approximately 500 nm, approximately 200 nm to approximately 450 nm, approximately 200 nm to approximately 400 nm, approximately 200 nm to approximately 350 nm, approximately 200 nm to approximately 300 nm, approximately 200 nm to approximately 250 nm, or approximately 80 nm to approximately 150 nm. In some embodiments, the particles described herein (e.g., LNPs and LPXs) have an average diameter in the range of approximately 40 nm to approximately 200 nm, for example, approximately 50 nm to approximately 180 nm, approximately 60 nm to approximately 160 nm, approximately 80 nm to approximately 150 nm, or approximately 80 nm to approximately 120 nm.
[0495] RNA particles (especially mRNA particles) described herein may exhibit polydispersity index (PDI) less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.2, less than about 0.1, or less than about 0.05. For example, RNA particles may exhibit polydispersity index in the range of about 0.01 to about 0.4 or about 0.1 to about 0.3.
[0496] The N / P ratio gives the ratio of nitrogen groups in a lipid to the number of phosphate groups in RNA. This correlates with the charge ratio, as nitrogen atoms are typically positively charged (pH-dependent) and phosphate groups are negatively charged. The N / P ratio, when charge equilibrium exists, is pH-dependent. Since positively charged nanoparticles may be favorable for transfection, lipid formulations can be formed with N / P ratios greater than 4 and up to 12. In this case, the RNA is considered to be completely bound to the nanoparticles.
[0497] This disclosure describes compositions comprising RNA (particularly mRNA) and at least one cationic or cationically ionizable lipid that associates with the RNA to form RNA particles, and formulations comprising such particles. The RNA particles may include RNA complexed in various forms by non-covalent interactions with the particles. The particles described herein are not viral particles, in particular infectious viral particles; that is, they cannot virally infect cells.
[0498] Suitable cationic or cationically ionizable lipids that form RNA particles are included in the term “particle-forming components” or “particle-forming agents.” The term “particle-forming components” or “particle-forming agents” refers to any component that associates with RNA to form RNA particles. Such components include any component that may be part of an RNA particle.
[0499] In some embodiments, RNA particles (particularly mRNA particles) contain two or more RNA molecules, and the molecular parameters of the RNA molecules may be similar or different from each other, such as with respect to molar mass or basic structural elements such as molecular structure, capping, coding region, or other features. In particle formulations, each RNA species can be formulated separately as an individual particle formulation. In this case, each individual particle formulation contains one RNA species. Individual particle formulations may exist as distinct entities, for example, in separate containers. Such formulations can be obtained by providing each RNA species separately (typically in the form of each RNA-containing solution) together with a particle-forming agent, thereby enabling particle formation. Each particle contains only the specific RNA species provided when the particle is formed (individual particle formulation). In some embodiments, a composition, such as a pharmaceutical composition, contains two or more individual particle formulations. Each pharmaceutical composition is called a mixed particle formulation. Mixed particle formulations according to this disclosure can be obtained by the steps of forming the individual particle formulations separately and then mixing the individual particle formulations. The mixing step can yield a formulation containing a mixed population of RNA-containing particles. Individual particle populations may coexist in a single container containing a mixed population of individual particle formulations. Alternatively, all RNA species of a pharmaceutical composition can be formulated together as a combined particle formulation. Such formulations can be obtained by providing a combined formulation (typically a combined solution) of all RNA species together with a particle-forming agent, thereby enabling particle formation. In contrast to mixed particle formulations, combined particle formulations typically contain particles containing two or more RNA species. In combined particle compositions, different RNA species typically coexist within a single particle.
[0500] polymer Polymers are commonly used materials for nanoparticle-based delivery due to their high degree of chemical flexibility. Typically, cationic polymers are used to electrostatically condense negatively charged RNA into nanoparticles. These positively charged groups often consist of amines that change their protonation state in the pH range of 5.5–7.5, which is thought to lead to ionic imbalances resulting in endosomal rupture. Polymers such as poly-L-lysine, polyamidoamines, protamines, and polyethyleneimines, as well as naturally occurring polymers such as chitosan, have all been applied to nucleic acid delivery and are suitable as cationic polymers herein. Furthermore, some researchers have synthesized polymers specifically for nucleic acid delivery. Poly(β-aminoesters) have become widely used in nucleic acid delivery, particularly due to their ease of synthesis and biodegradability. Such synthetic polymers are also suitable as cationic polymers herein.
[0501] As used herein, "polymer" is given its usual meaning, namely a molecular structure comprising one or more repeating units (monomers) linked by covalent bonds. All repeating units may be identical, or in some cases, two or more types of repeating units may be present within the polymer. In some cases, the polymer is biologically derived, i.e., a biopolymer such as a protein. In some cases, further parts, such as a targeted moiety, may also be present within the polymer.
[0502] When multiple types of repeating units are present within a polymer, the polymer is said to be a "copolymer." It should be understood that the polymers used herein may be copolymers. The repeating units forming a copolymer can be arranged in any way. For example, the repeating units may be arranged in a random order, an alternating order, or as a "block" copolymer, i.e., such that each of the following regions contains one or more regions, each containing a first repeating unit (e.g., a first block), and each containing one or more regions, each containing a second repeating unit (e.g., a second block). A block copolymer may have two (diblock copolymer), three (triblock copolymer), or more distinct blocks.
[0503] In certain embodiments, the polymer is biocompatible. Biocompatible polymers are typically polymers that do not cause significant cell death at moderate concentrations. In certain embodiments, the biocompatible polymer is biodegradable, meaning the polymer can be chemically and / or biologically degraded in a physiological environment, such as inside the body.
[0504] In certain embodiments, the polymer may be a protamine or a polyalkyleneimine.
[0505] The term "protamine" refers to any of several relatively low molecular weight strongly basic proteins that are rich in arginine and found in the sperm cells of various animals (such as fish), particularly associating with DNA in place of somatic histones. Specifically, the term "protamine" refers to proteins found in fish sperm that are strongly basic, water-soluble, do not coagulate with heat, and primarily produce arginine upon hydrolysis. In purified form, they are used in long-acting insulin formulations and to neutralize the anticoagulant effect of heparin.
[0506] As used herein, the term “protamine” is intended to include any protamine amino acid sequence, fragment thereof, and polymeric forms of a protamine amino acid sequence or fragment thereof, as well as artificial, specifically designed for a particular purpose, unisolated (synthesized) polypeptides from natural or biological sources.
[0507] In one embodiment, the polyalkyleneimine includes polyethyleneimine and / or polypropyleneimine, preferably polyethyleneimine. The preferred polyalkyleneimine is polyethyleneimine (PEI). The average molecular weight of PEI is preferably 0.75 × 10⁻⁶. 2 ~10 7 Da, preferably 1000-10 5 Da, more preferably 10,000 to 40,000 Da, more preferably 15,000 to 30,000 Da, and even more preferably 20,000 to 25,000 Da.
[0508] According to this disclosure, linear polyalkyleneimines such as linear polyethyleneimine (PEI) are preferred.
[0509] The cationic polymers intended for use herein (including polycationic polymers) include any cationic polymers that can electrostatically bind to nucleic acids. In one embodiment, the cationic polymers intended for use herein include any cationic polymer to which nucleic acids can associate, for example, by forming a complex with nucleic acids or by forming vesicles in which nucleic acids are encapsulated or enclosed.
[0510] The particles described herein may also include polymers other than cationic polymers, namely non-cationic polymers and / or anionic polymers. Collectively, anionic polymers and neutral polymers are referred to herein as non-cationic polymers.
[0511] Lipids The terms “lipid” and “lipid-like substance” are broadly defined herein as molecules containing one or more hydrophobic moieties or groups, and optionally one or more hydrophilic moieties or groups. Molecules containing both hydrophobic and hydrophilic moieties are also often referred to as amphiphilic substances. Lipids are typically insoluble or sparingly soluble in water, but soluble in many organic solvents. In aqueous environments, their amphiphilic nature allows the molecules to self-assemble into organized structures and various phases. One of these phases consists of a lipid bilayer, if they exist in vesicles, multilayer / monolayer liposomes, or membranes in aqueous environments. Hydrophobicity can be conferred by the presence of long-chain saturated and unsaturated aliphatic hydrocarbon groups, as well as nonpolar groups, including but not limited to those substituted with one or more aromatic, alicyclic, or heterocyclic groups. Hydrophilic groups may include polar and / or charged groups, including carbohydrates, phosphate groups, carboxylic acid groups, sulfate groups, amino groups, sulfhydryl groups, nitro groups, hydroxyl groups, and other similar groups.
[0512] As used herein, the term “hydrophobic” refers to any molecule, part, or group that is substantially immiscible or insoluble in aqueous solution. The term hydrophobic group includes hydrocarbons having at least six carbon atoms. Monovalent radicals of hydrocarbons are referred to herein as hydrocarbyls. Hydrophobic groups may have functional groups (e.g., ethers, esters, halides, etc.) as well as atoms other than carbon and hydrogen, insofar as they satisfy the condition of being substantially immiscible or insoluble in aqueous solution.
[0513] The term "hydrocarbon" includes acyclic, e.g., linear or branched hydrocarbyl groups, such as alkyl, alkenyl, or alkynyl groups as defined herein. It should be understood that one or more hydrogen atoms in an alkyl, alkenyl, or alkynyl group may be substituted with other atoms, such as halogens, oxygen, or sulfur. Unless otherwise specified, hydrocarbon groups may also include cyclic (alkyl, alkenyl, or alkynyl) groups or aryl groups, as long as the overall polarity of the hydrocarbon remains relatively nonpolar.
[0514] The term "alkyl" refers to a monovalent hydrocarbon moiety of a saturated straight or branched chain that may have 1 to 30, typically 1 to 20, and often 6 to 18 carbon atoms. Examples of nonpolar alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, hexyl, decyl, dodecyl, tetradecyl, hexadecyl, and octadecyl.
[0515] The term "alkenyl" refers to a monovalent hydrocarbon segment of a straight or branched chain having at least one carbon-carbon double bond, with a total carbon atom count of 6 to 30, typically 6 to 20, and often 6 to 18. Generally, the maximum number of carbon-carbon double bonds in an alkenyl group can be equal to an integer calculated by dividing the number of carbon atoms in the alkenyl group by 2, rounding down the result of the division to the smaller integer if the number of carbon atoms in the alkenyl group is odd. For example, for an alkenyl group with 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, an alkenyl group has 1 to 6 (e.g., 1 to 4), i.e., 1, 2, 3, 4, 5, or 6 carbon-carbon double bonds.
[0516] The term "alkynyl" refers to a monovalent hydrocarbon portion of a straight or branched chain having at least one carbon-carbon triple bond, with a total carbon atom count of 6 to 30, typically 6 to 20, and often 6 to 18. An alkynyl group may have one or more carbon-carbon double bonds. Generally, the maximum number of carbon-carbon triple bonds in an alkynyl group can be equal to an integer calculated by dividing the number of carbon atoms in the alkynyl group by 2, rounding down the result of the division to the next integer if the number of carbon atoms in the alkynyl group is odd. For example, for an alkynyl group with 9 carbon atoms, the maximum number of carbon-carbon triple bonds is 4. Preferably, an alkynyl group has 1 to 6 (e.g., 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, more preferably 1 or 2 carbon-carbon triple bonds.
[0517] The term "alkylene" refers to a saturated straight-chain or branched-chain divalent hydrocarbon moiety that may have 1 to 30, typically 2 to 20, and often 4 to 12 carbon atoms. Examples of nonpolar alkylene groups include, but are not limited to, methylene, ethylene, trimethylene, hexamethylene, decamethylene, dodecamethylene, tetradecamethylene, hexadecamethylene, and octademethylene.
[0518] The term "alkenylene" refers to a straight or branched divalent hydrocarbon portion having at least one carbon-carbon double bond, with a total carbon atom count of 2 to 30, typically 2 to 20, and often 4 to 12. Generally, the maximum number of carbon-carbon double bonds in an alkenylene group can be equal to an integer calculated by dividing the number of carbon atoms in the alkenylene group by 2, rounding down the result of the division to the next integer if the number of carbon atoms in the alkenylene group is odd. For example, for an alkenylene group with 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, an alkenylene group has 1 to 6 (e.g., 1 to 4), i.e., 1, 2, 3, 4, 5, or 6 carbon-carbon double bonds.
[0519] The term "cycloalkyl" preferably refers to a cyclic non-aromatic version of "alkyl" and "alkenyl" having 3 to 14 carbon atoms, for example 3 to 12 or 3 to 10 carbon atoms, i.e., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 carbon atoms (for example 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms), more preferably 3 to 7 carbon atoms. Examples of cycloalkyl groups include cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, cyclononyl, cyclononenyl, cyclodecyl, cyclodecenyl, and adamantyl. Cycloalkyl groups may consist of one ring (monocyclic), two rings (bicyclic), or three or more rings (polycyclic).
[0520] The term "aryl" refers to a monoradical of an aromatic cyclic hydrocarbon. Preferably, the aryl group contains 3 to 14 carbon atoms (e.g., 5, 6, 7, 8, 9, or 10) that can be arranged in one ring (e.g., phenyl) or two or more fused rings (e.g., naphthyl). Exemplary aryl groups include cyclopropenilium, cyclopentadienyl, phenyl, indenyl, naphthyl, azlenyl, fluorenyl, anthryl, and phenanthryl. Preferably, "aryl" refers to a monocyclic ring containing 6 carbon atoms or an aromatic bicyclic ring system containing 10 carbon atoms. Preferred examples are phenyl and naphthyl. The term aryl does not include fullerenes.
[0521] In the context of hydrocarbons, the term "aromatic" means that the entire molecule must be aromatic. For example, when a monocyclic aryl is hydrogenated (partially ...
Claims
1. A composition or pharmaceutical preparation containing RNA, The RNA mentioned above, (a) 5' UTR, (b) Code sequence that encodes polypeptide, (c) 3'UTR, and (d) PolyA sequence This includes, where the 3'UTR is, (i) A 3'UTR sequence comprising a first sequence containing the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 1, and a second sequence containing the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 2, (ii) One or more miRNA binding sequences and Composition or pharmaceutical preparation.
2. The composition or pharmaceutical formulation according to claim 1, wherein the RNA contains at least one of the one or more miRNA binding sequences upstream of the first sequence and the second sequence, downstream of the first sequence and the second sequence, or downstream of the first sequence and upstream of the second sequence.
3. The composition or pharmaceutical formulation according to claim 1 or 2, wherein the first sequence is located upstream of the second sequence.
4. The composition or pharmaceutical formulation according to any one of claims 1 to 3, wherein the 3'UTR sequence comprises the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
3.
5. The composition or pharmaceutical formulation according to any one of claims 1 to 4, wherein the RNA comprises at least one of the one or more miRNA binding sequences downstream of the coding sequence encoding the polypeptide and upstream of the 3'UTR sequence.
6. The composition or pharmaceutical formulation according to any one of claims 1 to 5, wherein the RNA comprises one or more miRNA-binding sequences downstream of the coding sequence encoding the polypeptide and upstream of the 3'UTR sequence.
7. The composition or pharmaceutical formulation according to claim 5 or 6, wherein the RNA comprises a nucleotide sequence that links the miRNA-binding sequence(s) and the 3'UTR sequence.
8. The composition or pharmaceutical preparation according to claim 7, wherein the nucleotide sequence linking the miRNA binding sequence(s) and the 3'UTR sequence comprises the sequence (X1)nCGAX2, where X1 is any nucleotide, n is 0 to 10, and X2 is G or U.
9. The composition or pharmaceutical preparation according to claim 8, wherein n is 1 to 6, for example, 2 or 5.
10. The composition or pharmaceutical preparation according to any one of claims 7 to 9, wherein the nucleotide sequence linking the miRNA binding sequence(s) and the 3'UTR sequence comprises the sequence CUCGAG or the sequence GGAUCCCGAU.
11. The composition or pharmaceutical formulation according to any one of claims 1 to 10, wherein at least one of the one or more miRNA binding sequences binds to a miRNA present in a cell in which the expression of the polypeptide is not desired.
12. The composition or pharmaceutical formulation according to any one of claims 1 to 11, wherein each of the one or more miRNA binding sequences binds to a miRNA present in a cell in which the expression of the polypeptide is not desired.
13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the RNA comprises three or more miRNA binding sequences, and the three or more miRNA binding sequences bind to the same or different miRNAs.
14. The composition or pharmaceutical preparation according to any one of claims 1 to 12, wherein the RNA comprises two or more miRNA binding sequences, and the two or more miRNA binding sequences bind to the same or different miRNAs.
15. The composition or pharmaceutical formulation according to any one of claims 1 to 12, wherein the RNA comprises one miRNA binding sequence.
16. The composition or pharmaceutical formulation according to any one of claims 1 to 15, wherein the one or more miRNA binding sequences include a nucleotide sequence that is the exact Watson-Crick complement of the miRNA.
17. The composition or pharmaceutical preparation according to any one of claims 1 to 16, wherein the RNA comprises a nucleotide sequence linking the 3'UTR sequence with the poly-A sequence containing the sequence GAGACCUGUCCAGAGUGCCUAGCCGCGUGCCU or CUXGAGCUAGC, where X is G, C, A or U.
18. The composition or pharmaceutical preparation according to any one of claims 1 to 17, wherein the RNA comprises a nucleotide sequence linking the 3'UTR sequence and the polyA sequence containing the sequence CUXGAGCUAGC, where X is C, A, or U.
19. The composition or pharmaceutical formulation according to claim 17 or 18, wherein the nucleotide sequence linking the 3'UTR sequence and the polyA sequence comprises the sequence CUCGAGCUAGC.
20. The composition or pharmaceutical preparation according to any one of claims 1 to 19, wherein the RNA comprises, in the 5' to 3' direction, the 5'UTR, the coding sequence encoding a polypeptide, the miRNA binding sequence(s), optionally the nucleotide sequence linking the miRNA binding sequence(s) and the 3'UTR sequence, the 3'UTR sequence, optionally the nucleotide sequence linking the 3'UTR sequence and the polyA sequence, and the polyA sequence.
21. The composition or pharmaceutical formulation according to any one of claims 1 to 17 and 20, wherein the RNA comprises a 3'UTR having at least 90% identity with the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO:
9.
22. The composition or pharmaceutical formulation according to any one of claims 1 to 17 and 20, wherein the RNA comprises a 3'UTR having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO:
10.
23. The composition or pharmaceutical formulation according to any one of claims 1 to 20, wherein the RNA comprises a 3'UTR having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO:
11.
24. The composition or pharmaceutical formulation according to any one of claims 1 to 20, wherein the RNA comprises a 3'UTR having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO:
12.
25. The composition or pharmaceutical formulation according to any one of claims 1 to 24, wherein the polyA sequence is an interrupted sequence of A nucleotides.
26. The composition or pharmaceutical formulation according to any one of claims 1 to 25, wherein the polyA sequence comprises at least 100 nucleotides.
27. The composition or pharmaceutical preparation according to any one of claims 1 to 26, wherein the polyA sequence comprises or consists of the nucleotide sequence Ax-L-Ay, where Ax is a sequence of at least 20 A nucleotides, Ay is a sequence of at least 60 A nucleotides, and L is a linker of 1 to 20 nucleotides which may contain nucleotides other than A.
28. The composition or pharmaceutical preparation according to any one of claims 1 to 27, wherein the polyA sequence includes or comprises the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
4.
29. The composition or pharmaceutical formulation according to any one of claims 1 to 28, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO:
7.
30. The composition or pharmaceutical formulation according to any one of claims 1 to 29, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGX1X2X3X4AACUAGU (wherein X1 is any nucleotide, preferably A or C; X2 is any nucleotide, preferably A or C; X3 is any nucleotide, preferably C, U, or G; and X4 is A or missing).
31. The composition or pharmaceutical formulation according to any one of claims 1 to 30, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a sequence containing the nucleotide sequence AGACGAACUALAGU, preceding it.
32. The composition or pharmaceutical formulation according to any one of claims 1 to 31, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
6.
33. The RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14-53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGX1AX3AAACUAGU (wherein X1 is any nucleotide, preferably A or C, and X3 is any nucleotide, preferably C or U), the composition or pharmaceutical formulation according to any one of claims 1 to 30.
34. The composition or pharmaceutical formulation according to any one of claims 1 to 30 and 33, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGAAUAAACUAGU.
35. The composition or pharmaceutical formulation according to any one of claims 1 to 30 and 33, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, preceded by a sequence containing the nucleotide sequence AGCACAAACUALAGU.
36. The composition or pharmaceutical formulation according to any one of claims 1 to 35, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO:
7.
37. The composition or pharmaceutical formulation according to any one of claims 1 to 30, 33, 34, and 36, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
7.
38. The composition or pharmaceutical formulation according to any one of claims 1 to 30, 33, 35, and 36, wherein the RNA comprises a 5'UTR having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
8.
39. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
40. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
41. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences containing the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
11.
42. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
43. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 8, and a sequence downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences containing the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
11.
44. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
45. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5' UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
46. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5' UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 11 downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences.
47. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 8, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a polyA sequence.
48. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5' UTR containing the nucleotide sequence of SEQ ID NO: 8, and a sequence containing the nucleotide sequence of SEQ ID NO: 11 downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences.
49. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a polyA sequence.
50. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a polyA sequence.
51. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences containing the nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
12.
52. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a polyA sequence.
53. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a polyA sequence.
54. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5' UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 12 downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences.
55. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a polyA sequence.
56. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a polyA sequence.
57. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 7, and a sequence downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences containing the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
10.
58. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a polyA sequence.
59. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 7, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a polyA sequence.
60. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5' UTR containing the nucleotide sequence of SEQ ID NO: 7, and a sequence containing the nucleotide sequence of SEQ ID NO: 10 downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences.
61. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a polyA sequence.
62. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a polyA sequence.
63. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 6, and a sequence downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences containing the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:
9.
64. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a polyA sequence.
65. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, and downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences, a sequence containing the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a polyA sequence.
66. The composition or pharmaceutical formulation according to any one of claims 1 to 38, wherein the RNA comprises a 5'UTR containing the nucleotide sequence of SEQ ID NO: 6, and a sequence containing the nucleotide sequence of SEQ ID NO: 9 downstream of the coding sequence encoding a polypeptide and one or more miRNA binding sequences.
67. The composition or pharmaceutical preparation according to any one of claims 1 to 66, wherein at least 90% is at least 95%, 96%, 97%, 98%, or 99%.
68. The composition or pharmaceutical formulation according to any one of claims 1 to 67, wherein the RNA comprises two or more coding sequences that encode two or more polypeptides.
69. The composition or pharmaceutical preparation according to any one of claims 1 to 68, wherein the polypeptide is a pharmaceutically active polypeptide.
70. The composition or pharmaceutical preparation according to any one of claims 1 to 69, wherein the RNA comprises a modified nucleoside instead of uridine.
71. The composition or pharmaceutical formulation according to any one of claims 1 to 70, wherein the RNA comprises a modified nucleoside instead of each uridine.
72. The composition or pharmaceutical formulation according to claim 70 or 71, wherein the modified nucleoside is pseudouridine (ψ) and / or N1-methyl-pseudridine (m1ψ).
73. The composition or pharmaceutical preparation according to any one of claims 70 to 72, wherein the modified nucleoside is N1-methyl-pseuduridine (m1ψ).
74. The composition or pharmaceutical formulation according to any one of claims 1 to 73, wherein the RNA comprises a 5' cap.
75. The composition or pharmaceutical formulation according to any one of claims 1 to 74, wherein the RNA comprises a cap 1 structure.
76. The RNA has a 5' cap m 2 7,3’-O GPPP(m 1 2’-O A composition or pharmaceutical preparation according to any one of claims 1 to 75, comprising ApG.
77. The composition or pharmaceutical preparation according to any one of claims 1 to 76, wherein the RNA is single-stranded RNA.
78. The composition or pharmaceutical preparation according to any one of claims 1 to 77, wherein the RNA is mRNA.
79. The composition or pharmaceutical formulation according to any one of claims 1 to 78, wherein the RNA is formulated into a delivery vehicle.
80. The composition or pharmaceutical formulation according to any one of claims 1 to 79, wherein the RNA is formulated into lipid nanoparticles (LNPs).
81. The composition or pharmaceutical formulation according to claim 80, wherein the lipids forming the lipid nanoparticles include cationic lipids, polymer conjugate lipids, neutral lipids, and steroids.
82. The composition or pharmaceutical formulation according to claim 81, wherein the cationic lipid comprises a cationic ionizable lipid.
83. The composition or pharmaceutical formulation according to claim 81 or 82, wherein the polymer conjugate lipid comprises a PEG conjugate lipid.
84. The composition or pharmaceutical preparation according to any one of claims 81 to 83, wherein the neutral lipid comprises a phospholipid.
85. The composition or pharmaceutical preparation according to any one of claims 81 to 84, wherein the steroid comprises cholesterol.
86. a. The cationic lipid is present in an amount of approximately 35-65 mol% of the total lipids; b. The polymer conjugate lipid is present in an amount of approximately 1 to 5 mol% of the total lipids; c. The neutral lipids are present in an amount of approximately 5 to 15 mol% of the total lipids; and d. The steroid is present in an amount of approximately 30-50 mol% of the total lipids. The composition or pharmaceutical preparation according to any one of claims 81 to 85.
87. The composition or pharmaceutical formulation according to any one of claims 80 to 86, wherein the lipid nanoparticles have an average size of about 50 to 150 nm.
88. A pharmaceutical composition, as described in any one of claims 1 to 87.
89. The composition according to claim 88, wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and / or excipients.
90. A pharmaceutical preparation according to any one of claims 1 to 87, which is a kit.
91. The pharmaceutical formulation according to claim 90, wherein the RNA and optionally the particle-forming component are in separate vials.
92. A composition or pharmaceutical preparation according to any one of claims 1 to 91, for parenteral administration.
93. A composition or pharmaceutical preparation according to any one of claims 1 to 92, for intramuscular administration.
94. A composition or pharmaceutical preparation according to any one of claims 1 to 92, for intravenous administration.
95. The composition or pharmaceutical preparation according to any one of claims 1 to 94, wherein at least one of the one or more miRNA binding sequences, optionally each of them, binds to miRNA present in endothelial cells.
96. The composition or pharmaceutical preparation according to any one of claims 1 to 95, wherein the miRNA is miR-126, optionally miR-126-5p, or miR-126-3p.
97. The composition or pharmaceutical preparation according to any one of claims 1 to 96, wherein at least one of the miRNA binding sequences, each optionally, comprises or consists of cgcguaccaaaaguauaauaug (which binds to miR-126-5p) or cgcauuauuacucacggguacga (which binds to miR-126-3p).
98. The composition or pharmaceutical preparation according to any one of claims 1 to 97, wherein at least one of the one or more miRNA binding sequences, each optionally, binds to a miRNA present in hematopoietic cells, such as immune cells.
99. The composition or pharmaceutical formulation according to claim 98, wherein the immune cells include dendritic cells and / or macrophages, such as Kupffer cells.
100. The composition or pharmaceutical preparation according to any one of claims 1 to 99, wherein the miRNA is miR-142, and optionally miR-142-3p.
101. The composition or pharmaceutical preparation according to any one of claims 1 to 100, wherein at least one of the miRNA binding sequences, each optionally, comprises or consists of UCCAAUAAAGUAGGAAAAACUCUACA (which binds to miR-142-3p).
102. The composition or pharmaceutical preparation according to any one of claims 1 to 101, wherein at least one of the one or more miRNA binding sequences, optionally each of them, binds to miRNA present in hepatocytes.
103. The composition or pharmaceutical preparation according to any one of claims 1 to 102, wherein the miRNA is miR-122.
104. The composition or pharmaceutical preparation according to any one of claims 1 to 103, wherein at least one of the miRNA binding sequences, each optionally, comprises or consists of ACAAACACCAUUGUCACUCUCA (which binds to miR-122).
105. A method for controlling polypeptide expression in a cell type and / or tissue-specific manner, comprising administering a composition according to any one of claims 1 to 104 to the subject, wherein one or more miRNA binding sequences bind to miRNAs present in one or more cells or tissues of the subject in which polypeptide expression is not desired.
106. The method according to claim 105, wherein the miRNA is not present in one or more cells or tissues other than the one or more cells or tissues in which the polypeptide is not expressed, or is present in a lower amount in one or more cells or tissues other than the one or more cells or tissues in which the polypeptide is not expressed, compared to the one or more cells or tissues in which the polypeptide is not expressed.
107. A method for treating a subject, comprising administering to the subject a composition according to any one of claims 1 to 104 in order to express the polypeptide in selected cells of the subject while avoiding the expression of the polypeptide in those cells, wherein one or more miRNA binding sequences bind to miRNAs present in the selected cells.
108. The method according to claim 107, wherein the miRNA is not present in cells other than the selected cells, or is present in cells other than the selected cells in a smaller amount compared to the selected cells.
109. The method according to any one of claims 105 to 108, wherein the administration is by parenteral administration.
110. The method according to any one of claims 105 to 109, wherein the administration is by intramuscular administration.
111. The method according to any one of claims 105 to 109, wherein the administration is by intravenous administration.
Citation Information
Patent Citations
3' UTR sequences for stabilization of RNA
WO2017060314A2