System and method for writing data stored in a polymer using inkjet droplets

Abstract

This disclosure provides a novel system and method for writing a code specific to polymer memory chains located on at least one write spot on a wafer array using at least one inkjet printhead, such as a piezoelectric printhead, as well as reagents and materials useful therefor.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 485,832, filed on 17 February 2023, the entire contents of which are incorporated herein by reference.

[0002] This invention relates to a novel method and system for information storage using DNA sequences. [Background technology]

[0003] The need to store more data on or within physical media continues, and storage devices are becoming increasingly smaller as their capacity increases. The amount of data stored is reported to double in size every two years, and according to one study, by 2020, the amount of data we create and replicate each year will reach 44 zettabytes, or 44 trillion gigabytes. Furthermore, existing data storage media such as hard drives, optical media, and magnetic tape are relatively unstable and become corrupted after long-term storage.

[0004] There is an urgent need for alternative methods to store large amounts of data over long periods, such as decades or centuries. [Brief explanation of the drawing]

[0005] The present invention will be better understood from the detailed description and accompanying drawings. [Figure 1] This is a top view of a silicon wafer having a spot pattern according to an embodiment of the present disclosure. [Figure 2] This is a side view of a silicon wafer having a patterned layer for writing encoded DNA onto its surface, according to an embodiment of the present disclosure. [Figure 3] This is a cross-sectional side view showing a manufacturing process for creating a patterned wafer according to an embodiment of the present disclosure. [Figure 4]This figure shows an HfO2 layer for attaching DNA molecules to a wafer according to an embodiment of the present disclosure. [Figure 5] This shows a partial top view of two wafers having different spot pattern sizes according to an embodiment of the present disclosure, and its relationship to Figure 2. [Figure 6] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing three nozzles of a piezoelectric print head and different stages as the emitted droplet moves toward the upper surface of the patterned wafer. [Figure 7] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing how droplets change their geometric shape at three different droplet sizes after contacting pillars on the patterned silica surface. [Figure 8A] A side view of a silicon wafer having a patterned layer showing a starter DNA strand in liquid attached to a pillar, according to an embodiment of the present disclosure, a side view of a printhead row having three or four nozzles, and showing that a cleaning cycle may be performed horizontally across the wafer surface or vertically as part of the printhead. [Figure 8B] The image shows a side view of a silicon wafer having a patterned layer showing a starter DNA strand in liquid mounted on a pillar according to an embodiment of the present disclosure, a side view of a printhead array having nozzles for 4 out of 5 2-bit binary encodings, and showing that a cleaning cycle may be performed horizontally across the wafer surface or vertically as part of the printhead. [Figure 9A] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing a starter DNA strand in liquid attached to a pillar, and a side view of a data writing (or printing) process for adding bits or codes to the free ends of the starter DNA strand on the wafer. [Figure 9B]This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing a starter DNA strand in liquid attached to a pillar, and a side view of a data writing (or printing) process for adding bits or codes to the free ends of the starter DNA strand on the wafer for 2-bit binary encoding. [Figure 10] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing a starter DNA strand attached to a pillar at one end and attached to the encoding DNA at the other end, and also showing a method for removing the encoding DNA strand from the wafer using a separation fluid. [Figure 11A] This figure shows an example of multiple spots comprising encoded DNA (after the code has been written) adhering to a wafer according to an embodiment of the present disclosure, and a process for removing, storing, and reading / decoding the data. [Figure 11B] This is a flowchart for decoding polymer memory string data according to an embodiment of the present disclosure. [Figure 12] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing a multi-nozzle printhead that releases droplets of starter DNA onto the pillars of the wafer, and showing an optional preparation fluid for preparing the wafer for the adhesion of starter DNA. [Figure 13A] This is a side view of a silicon wafer having a patterned layer according to an embodiment of the present disclosure, showing a starter DNA strand in liquid attached to a pillar, and a side view of an array of printheads, each having three nozzles for simultaneous printing to multiple spots. [Figure 13B] Figure 13A shows an embodiment of the present disclosure in which three nozzle printhead rows are replaced with five nozzle printhead rows for simultaneous printing to multiple spots. [Figure 14] This diagram shows the writing process of a dual printhead assembly according to an embodiment of the present disclosure, illustrating that an entire row and layer of 1s and 0s is written, followed by the writing of the adapter layer, and then another layer of 1s and 0s. [Figure 15] An example of an inkjet printer according to an embodiment of the present disclosure is shown, along with an enlarged view of the movement axis, computer control device, and wafer for printing DNA. [Figure 16A] Images of printing droplets of various sizes for an active spot with a diameter of 50 microns according to an embodiment of the present disclosure are shown. [Figure 16B] Images of the results of printing and washing 5 times on an active wafer spot with a diameter of 50 um separated by 100 dpi according to an embodiment of the present disclosure are shown. [Figure 16C] Images of the results of printing and washing 5 times on an active wafer spot with a diameter of 50 um separated by 100 dpi according to an embodiment of the present disclosure are shown. [Figure 16D] Images of the results of printing and washing 5 times on an active wafer spot with a diameter of 50 um separated by 100 dpi according to an embodiment of the present disclosure are shown. [Figure 17A] An image of a wafer and two graphs showing the results of mass spectrometric profiling by HIDI emission after writing according to an embodiment of the present disclosure are shown. [Figure 17B] An image of a wafer after drying for 3 weeks and two graphs showing the results of mass spectrometry by formamide emission from the dried wafer according to an embodiment of the present disclosure are shown. [Figure 18A] A list of two different data formats of bits on a memory string according to an embodiment of the present invention is shown. [Figure 18B] A list of the data formats of bits on a memory string for each spot on a wafer in an array according to an embodiment of the present disclosure is shown. [Figure 19A] A block diagram showing an inkjet printing system according to an embodiment of the present disclosure, showing print head control and wafer array / stage control logic as well as equipment for fluids / reagents. [Figure 19B] A block diagram of the computer system of FIG. 19A according to an embodiment of the present disclosure. [Figure 20A]A flowchart for performing loading of starter DNA, writing (printing) of encoded polymer, and unloading in an inkjet writing system according to an embodiment of the present disclosure. [Figure 20B] A flowchart for performing writing (printing) of bits and codes onto a polymer in an inkjet writing system according to an embodiment of the present disclosure. [Figure 21] A schematic diagram showing "bit addition" or "topogenation" without phosphatase is shown. [Figure 22] A schematic diagram of phosphatase-free topoisomerase-mediated synthesis of a DNA polymer storing binary information "10110" is shown. [Figure 23A] A side cross-sectional view of a patterned wafer substrate having a hydrophobic coating according to an embodiment of the present disclosure, showing a process for creating the hydrophobic coating using silanization. [Figure 23B] A side view of a patterned wafer having two different hydrophobic silane coatings (PFOTES above the dashed line, DDTMS below the dashed line) according to an embodiment of the present disclosure, shown at three different temperatures. [Figure 24A] An example image of topoisomerase-based ink printed on a slide glass at two different resolutions according to an embodiment of the present disclosure is shown. [Figure 24B] A graph of conversion % vs. time in the example of FIG. 24A according to an embodiment of the present disclosure, comparing the ligation rate performance of jet-type and non-jet-type topoisomerase-based inks at four different time points. [Figure 25A] Another example image of topoisomerase-based ink printed on a slide glass at a resolution of 300 dpi according to an embodiment of the present disclosure is shown. [Figure 25B] A graph of conversion % vs. time in the example of FIG. 25A according to an embodiment of the present disclosure, comparing the ligation rate performance of jet-type and non-jet-type topoisomerase-based inks at four different time points, and an enlarged comparison at the 20-second time point. [Figure 26A]This figure shows an example of bonding and linking chemistry for printing a patterned wafer suitable for receiving a topoisomerase ink, according to embodiments of the present disclosure, with and without a hydrophobic coating. [Figure 26B] Figure 26A shows a sequence of images obtained by five printing cycles of topoisomerase ink on a patterned wafer, according to an embodiment of the present disclosure. [Figure 27A] This is a side view of a flat substrate having patterned spots with acceptors for synthesis, according to an embodiment of the present invention, wherein the substrate moves in a first direction under a fixed inkjet head. [Figure 27B] This is a side view of a flat substrate according to an embodiment of the present invention, where the substrate moves under the fixed inkjet head in the opposite direction to that shown in Figure 27A. [Figure 27C] Figure 27A is a side view of the substrate according to an embodiment of the present invention, showing details of the cell (or spot) size, dimensions, and receptor density. [Figure 27D] Figure 27C is a side view of the substrate according to an embodiment of the present invention, illustrating the process for a topogation reaction on the surface of cells (or spots) on the substrate. [Figure 27E] This is a side view of a step in one embodiment of a washing cycle and / or washing / deblocking cycle after a topogation reaction, according to an embodiment of the present invention. [Figure 28A] This is a side view of a conveyor track, linear actuator, and inkjet writing system for moving (or shuttle) a portable inkjet writable wafer (or shuttle), including loading and unloading of a shuttle or coded polymer, through an inkjet head writing station and a cleaning station, for example, via an electromagnetic track and a queue elevator. [Figure 28B] Figure 28A is a perspective view of a portable inkjet writable silicon wafer according to an embodiment of the present invention, and is an enlarged view of a hexagonal fluid well within the wafer. [Figure 29] This is a perspective view of a stacked rotating disk (or platen)-based turntable type inkjet writing system for an inkjet writable silicon wafer disk according to an embodiment of the present invention, wherein the outer edge of the disk rotates through an inkjet head writing station and a cleaning station. [Figure 30A] This is a perspective view of a vacuum manifold plate according to an embodiment of the present invention, which draws fluid from each well in a microwell plate into a manifold and discharges it to a drainage system via an outlet or drainage port in order to accelerate the wafer cleaning cycle. [Figure 30B] Figure 30A shows three perspective cutaway views of the vacuum manifold plate according to an embodiment of the present invention, and two enlarged views show the fluid injection path to the well and the fluid extraction path from the well. [Figure 30C] Figure 30B shows a perspective view of a vacuum manifold showing a vacuum needle, an enlarged view showing the needle, and a perspective cutaway view of an inkjet writing assembly equipped with a vacuum manifold, according to an embodiment of the present invention. [Figure 31] This is a cross-sectional side view illustrating an alternative manufacturing process for creating patterned wafers according to embodiments of the present disclosure. [Figure 32] This diagram shows the writing process of a dual printhead assembly using a print / paddle method with two printheads according to an embodiment of the present disclosure, illustrating two writing cycles, four layers with 1s and 0s written, and the corresponding written code. [Modes for carrying out the invention]

[0006] The following description of preferred embodiments is purely illustrative and is not intended to limit the invention, its uses, or applications in any way.

[0007] The following jointly owned issued patents, each containing subject matter relating to the matters described herein, are incorporated herein by reference in whole to the maximum extent permitted by applicable law: U.S. Patent No. 10,438,662 and U.S. Patent No. 10,640,822. The aforementioned jointly owned patents, as described herein, describe methods for writing (or storing) data into charged polymers, such as DNA, using addition "0" and addition "1" enzymes and deblocking enzymes.

[0008] The following jointly owned U.S. Patent Applications No. 63 / 369,339 and No. 63 / 369,340, which contain subject matter relating to the matters described herein, are incorporated herein by reference to the maximum extent permitted by applicable law. The aforementioned jointly owned patent applications describe other methods for writing (or storing) data on charged polymers, such as DNA, including, as described herein, the use of an AB adapter instead of a deblocking enzyme and the use of "A0B" and "A1B" as addition "0" and addition "1" reagents.

[0009] As described herein, the disclosure provides a novel system for storing (or writing or printing) information (or data) using a charged polymer, such as DNA, having monomers corresponding to machine-readable codes, such as binary (or other base) codes, the charged polymers can be synthesized using novel configurations of: a piezoelectric inkjet printer system; a novel method and apparatus for synthesizing polymers using a piezoelectric inkjet printer system; a novel method and apparatus for loading, writing, and unloading polymers; and a novel patterned silicon wafer for writing polymers and a method for manufacturing the same, which can be reliably manufactured.

[0010] Referring to Figure 1, a top view of a silicon wafer 10 having a circular spot pattern 14 according to an embodiment of the present disclosure is shown. In particular, the silicon wafer 10 has a square region or array or matrix 12 on the top surface of the wafer 10 having multiple spots 14 (or print spots, print spots, memory spots, reaction regions, reaction spots) designed to allow data to be continuously written onto each spot 14 using a print head, such as a piezoelectric print head (described further below), and to minimize chemical interactions between the spots. The size of the array 12 shown is a square with 250 × 250 spots, having dimensions of approximately 63.446 mm × 63.446 mm, and the spots are arranged on the top surface of the silicon wafer substrate 10 at a center-to-center spacing (or pitch) d1 of approximately 100 dpi (dots per inch) or approximately 0.01 inches or 254 microns. Other dimensions, number of spots, and spot spacing (or pitch) may be used for the array or matrix 12 as needed.

[0011] Spot 14 is shown in three regions 16, 18, and 20, which are expanded from three regions 16A, 18A, and 20A on the array 12, and may be shown as two concentric circles 14A, 15A, consisting of an inner circle 14A and an outer circle 15A. The inner circle 14A is the outer surface of a raised circular spot pillar, providing an active spot attachment region or region 14, surrounded by a circular spacing, separation channel, valley, or depression region 15 having an inner surface 15A. The separation channel 15 provides a physical barrier between adjacent spots 14, preventing cross-contamination and chemical interaction between spots. In addition, one or more reference markers 22A, 22B may be provided or placed on the wafer 10 for wafer alignment on the printer, as shown in the upper left region 18 and lower left region 20 of the array region 12. There may also be a gap region or region 17 between the spot pillar 14 and the channel 15, which further separates the spots 14 from each other.

[0012] Referring to Figure 2, a side view, with dimensions, of the silicon wafer array of Figure 1 having a patterned layer for writing encoded DNA onto the surface, according to an embodiment of the present disclosure, is shown. In particular, the silicon wafer 10 has a patterned layer 202 of SiO2 on the top of the wafer 10 to form spot pillars 14 and channels 15. The distance d1 (Figures 1 and 2) is the center-to-center distance between the spots 14, and is also referred herein to as pitch, spacing between spots, or spot spacing. For a spot spacing d1 of 100 dpi (dots per inch) shown in Figure 1, d1 = approximately 0.01 inches, or approximately 254 microns. Other dpi values ​​and spot spacings of 200 dpi, 300 dpi, 400 dpi, 500 dpi, 600 dpi, or higher may also be used, as long as the spots do not chemically interact. Furthermore, d2 is the width of the spot pillar 14, d3 is the width of the circular channel 15 around the pillar 14, and d4 is the height from the bottom of the circular channel 15 to the top of the wall of the pillar 14, for example, about 1 micron. The distance d5 is the width (or length) of the adhesive top coating 204 on the top of the pillar 14, for example, HfO2, which facilitates the adhesion of the DNA starter strand to the spot pillar 14. The width d5 ​​of the HfO2 coating may be slightly smaller than the width d2 of the top of the pillar 14. In some embodiments, the width d5 ​​of the adhesive top coating 204 may be substantially the same size as the width d2 of the pillar. The HfO2 adhesive top coating 204 allows the DNA starter (or receptor) strand 210 to be easily and stably attached to the top of the pillar. In some embodiments, the spacing channels 15 may also be treated or coated with a hydrophobic material (e.g., fluorosilane or perfluoroalkyltriethoxysilane) to repel water, which may help prevent the cleaning fluid from chemically interacting between adjacent spots 14 during and after cleaning. Similarly, the top of the pillars 14 may be treated or coated with a hydrophilic material to adsorb water, which may help prevent the cleaning fluid from chemically interacting between adjacent spots during and after cleaning.

[0013] Referring to Figure 3, a cross-sectional side view of a manufacturing process 300 that may be used to create the patterned wafers of Figures 1 and 2 according to embodiments of the present disclosure is shown. Specifically, in step 1, a layer of silicon dioxide or silica (SiO2) with a thickness of 1 micron is applied or deposited on the upper surface of a silicon (Si) wafer substrate using PECVD (plasma-enhanced chemical vapor deposition). SiO2 may be applied using other techniques. Next, in step 2, the SiO2 is patterned or etched to form desired pillars 14 and spacing channels 15. Next, in step 3, a layer of SiO2 with a thickness of 150 nanometers (nm) is applied or deposited on the upper surface of the SiO2 layer using PECVD to coat the bottom of the channels. Next, in step 4, a layer of metal oxide (preferably hafnium oxide (HfO2), but other metal oxides such as titanium oxide or aluminum oxide can also be used as alternatives), for example, with a thickness of about 10 nanometers (nm), is applied or deposited on the upper surface of the SiO2 layer, for example, using atomic layer deposition (ALD). Next, in step 5, the layer of metal oxide, such as HfO2, is removed or etched away except for the top of pillar 14, creating a DNA starter strand attachment region 204 on the top of pillar 14, leaving a circular portion of metal oxide, such as HfO2, with a diameter of approximately 50-100 μm. If necessary, other methods or processes may be used to create the same shape and layer or region 204.

[0014] In some embodiments, a substrate, such as a silicon wafer or glass surface, is thermally oxidized until, for example, a target oxide layer of about 188 nm thickness is reached. This oxidized surface is then photolithographed, where, for example, a positive photoresist is spin-coated onto the wafer surface, followed by exposure to a mask pattern forming a desired grid or substrate pattern, and then the surface is developed and rinsed. Next, a layer of metal oxide, such as HfO2, is added to the patterned substrate surface until, for example, a target metal oxide layer of about 70 nm thickness is reached. The photoresist mask on the substrate surface is then peeled off from the underlying oxide layer, resulting in only the metal oxide layer remaining on top of the oxide layer on the substrate, with only the oxide layer surface remaining between the patterned metal oxide spots. After the preparation of the wafer substrate, the metal oxide, such as HfO2, is functionalized with a first surface modifier, such as phosphonic acid, such as phosphonic acid linked to an azide-terminated alkyl linker. The interstitial oxide layer between metal oxide spots, such as SiO2, is functionalized with a second surface modifier, such as a silane, for example, a silane having non-reactive or inert groups, thereby inhibiting subsequent reactivity.

[0015] Referring to Figure 4, a diagram is shown illustrating an HfO2 layer 302 for the attachment of DNA molecules 210 to a wafer according to an embodiment of the present disclosure, and a magnified view of a portion of the attachment region 210A with attached starter strands 210B. Specifically, a portion of the surface of the HfO2 layer is shown on a pillar 14, a plurality of starter strands 210 are attached to the surface of the HfO2 layer, and data-encoded DNA or polymer 402 is suspended in a liquid buffer 404. The HfO2 (hafnium oxide) layer 302 is bonded to an SiO2 layer 202 on the substrate pillar 14 and is used as a base layer to which starter or acceptor DNA is bound. HfO2 provides a high dielectric constant (as an insulating material). The metal oxide surface (e.g., TiO2, Al2O3, or HfO2) can be linked to a linker, e.g., polyethylene glycol (e.g., PEG2-PEG6) or a hydrocarbon linker, e.g., C, by selective phosphononization using a phosphonic acid linked to a reactive group (e.g., an azide group), for example. 6-20Functionalization can be performed via an alkylene linker, for example, using azido-PEG3-phosphonic acid (available from BroadChem, catalog no. BP-23162), which consists of a PEG linker having an azide group at one end and a phosphonic acid group at the other, or using 95% 12-azidododecylphosphonic acid from Sikemia, which consists of a dodecyl linker having an azide group at one end and a phosphonic acid group at the other. The phosphonic acid group selectively binds to metal oxides, such as HfO2, rather than SiO2 or hydrophilic coatings, while the reactive group can bind to a partner on the oligonucleotide. The reactive group that binds to the oligonucleotide can be, for example, a carboxyl group that binds to an amine on the oligonucleotide, a streptavidin group that binds to a biotin group on the oligonucleotide, or a group that can participate in a "click" chemical reaction, such as an azide group that can bind to an alkyne-modified oligonucleotide via a "click" reaction. In certain embodiments, the click reaction does not require a catalyst and is, for example, a strain-enhanced azido-alkyne cycloaddition (SPAAC) between an azido and a cyclooctin group, such as a dibenzocyclooctin (DBCO) group or aza-dibenzocyclooctin (ADIBO) group. For example, Figure 23A shows an HfO2 surface functionalized with 12-azidododecylphosphonic acid, and Figure 26A shows an oligonucleotide linked to 12-azidododecylphosphonic acid via a click reaction with aza-dibenzocyclooctin attached to the oligonucleotide. Once the starter or acceptor DNA strand 210 is attached to or bound to the surface of the pillar 14, for example to the HfO2 attachment region 204, the free end of strand 210 becomes available for attachment to a data encoding polymer or DNA strand 402, as described herein.

[0016] The oligonucleotide-supported surface is optionally surrounded by a hydrophobic coating-supported surface 410, as shown, for example, in Figures 23A and 26A. In these figures, the HfO2 region is deposited on a silica substrate, so the deposited HfO2 surface supporting the oligonucleotide as described above is surrounded by an SiO2 substrate region coated with a hydrophobic perfluorinated alkane material using 1H,1H,2H,2H-perfluorooctyltriethoxysilane, as seen in Figure 23A, and / or the oligonucleotide is added to the HfO2 region using the click chemistry described, as seen in Figure 26A.

[0017] Printing is not limited to patterned silicon wafers, but can be performed on many patterned or unpatterned substrates, such as silicon substrates, oxide surfaces, patterned hydrophilic / hydrophobic regions defined by depth differences (posts), hafnium oxide functional regions (with or without the use of posts, as mentioned above), glass substrates, patterned hydrophilic / hydrophobic regions, polymer substrates, glass coatings, porous ceramic substrates, or ceramic coated paper.

[0018] For example, in certain embodiments, instead of using HfO2 deposition on a silicon substrate, the silicon oxide surface may be silanized with a functionalized linker containing the DNA attachment groups described above, for example, streptavidin-biotin or click conjugation.

[0019] The pattern of spots containing DNA receptor groups can also be created using inkjet printing, for example, by inkjet printing DNA in the desired pattern onto a surface uniformly modified with phosphonic acid and azide groups.

[0020] Referring to Figure 5, partial top views of two wafers 18C and 18D having different spot pattern sizes on a spot pillar 14 according to an embodiment of the present disclosure, and their relationship to Figure 2. Specifically, the upper left image 18C shows an active pattern size d5 of 50 microns at 100 dpi on the pillar 14, and the upper right image 18D shows an active pattern size d5 of 100 microns at 100 dpi on the pillar 14.

[0021] Referring to Figure 6, this is a side view of a silicon wafer 10 having patterned layers 202, 204 with three nozzles 602, 604, 606 of a piezoelectric printhead 600 according to an embodiment of the present disclosure, showing different stages as ejected droplets 610, 612 move toward the upper surface 204 of a pillar 14 on the patterned wafer. As is well known, the piezoelectric printhead 600 uses piezoelectric material 620 sandwiched, mounted, or positioned between a flexible plate 622, which bends when a voltage is applied to the piezoelectric material 620, resulting in a diaphragm action as shown in Figure 6. The bent diaphragm 622 pushes liquid 610 held in a chamber or printhead 630, 632, 634 through one or more nozzles 640, 642, 644 to provide precisely sized droplets 610, 612, which land on top of the pillars or reaction spots 204 of an array described later. Generally, the design and control of such piezoelectric printheads 600 and inkjet supply systems are well known to those skilled in the art and are described in the following published U.S. Patents No. 5,474,796, No. 6,921,636 and No. 5,094,594, which are incorporated herein by reference to the extent necessary for understanding this disclosure.

[0022] Referring to Figure 7, a side view of a silicon wafer 10 having patterned layers 202, 204 according to an embodiment of the present disclosure is shown, which includes how the geometric shape of three different sized droplets 702, 704, and 706 changes after contact with the pillars 14 on the patterned silica surface at three different times 710 (initial contact), 712 (time after initial contact), and 714 (final resting or steady-state position of the droplet). In particular, the leftmost droplets 702, 702A, and 702B are sized such that the final droplet position 702B remains on the pillar 14 while overflowing onto the HfO2 coating or adhesion area 204. The middle droplets (smallest) 704, 704A, and 704B are sized such that the final droplet position 702B remains on the pillar and also on the HfO2 coating or adhesion area 204. The rightmost droplets (largest) 706, 706A, and 706B are sized such that the final droplet position 706B overflows beyond pillar 14 into the spacing channel 15.

[0023] Figure 8A shows a side view of a silicon wafer 10 having patterned layers 202, 204 showing starter DNA strands 210 in liquid 802 attached to pillars 14, according to an embodiment of the present disclosure, and a side view of a printhead row 804 having three or four printheads 810, 812, 814 with nozzles, showing that a cleaning cycle using a cleaning fluid 820 may be diffused, flowed, applied or sprayed horizontally across the wafer surface, or applied vertically as a separate printhead 816 which is part of the printhead row 804. The printhead row 804 may be controlled to move across the wafer array (as a group) as indicated by arrow 818, to deliver desired droplets at precise spot locations. In this case, the printhead or printhead array 804 has three chambers 810, 812, and 814, each equipped with associated nozzles 810A, 812A, and 814A, and has reagents used to add codes to a starter DNA strand 210 in a liquid bubble 802 indicated at the top of each pillar 14 via droplets, e.g., an add-0 head 810, an add-1 head 812, and a deblock / adapter head 814. The add-1 reagent can add a single base or multiple bases, which may be called a "cassette," and the chemical reaction of the addition reaction functions as described in the jointly owned U.S. patent and patent application.

[0024] Figure 8B is similar to Figure 8A, but differs in that the printhead array 822 has four additional chambers or heads 830, 832, 834, and 836, each with associated nozzles 830A, 832A, 834A, and 836A, corresponding to 00, 01, 10, and 11 in 2-bit binary encoding, respectively, for adding associated cassettes. The printhead array 822 may include a deblock / adapter head 834, similar to Figure 8A. A cleaning cycle using a cleaning fluid 820 is also shown (Figure 8A), which may flow horizontally across the wafer surface or be applied vertically as a separate printhead 816 which is part of the printhead array 822.

[0025] In some embodiments, the addition "0" and addition "1" chemical reactions used for writing to the polymer may be the chemical reactions described in the aforementioned jointly owned U.S. patent, in which case the central chamber becomes the "deblock" chamber. Also in some embodiments, the addition "0" and addition "1" chemical reactions used for writing to the polymer may be the chemical reactions described in the aforementioned jointly owned pending U.S. patent application, in which case the "adapter" is used instead of the deblock enzyme, and addition "0" and addition "1" may be called "A0B" and "A1B," respectively. Thus, the operation of preparing a DNA strand for the execution of another addition reaction may be referred to herein as the "deblock / adapter" or "adapter BA" operation.

[0026] In some embodiments, after the addition reaction, a washing fluid 820 is flowed over the array 12 to remove any unattached DNA strands and prepare the DNA for the next addition or deblocking reaction. In some embodiments, instead of having the side-flow washing shown, or in addition thereto, printhead rows 804, 822 may have an additional head chamber 816 with a nozzle 816A having a washing fluid inside that is discharged during the washing cycle.

[0027] Figure 9A shows a cross-sectional side view of a silicon wafer 10 having patterned layers 202, 204 according to an embodiment of the present disclosure, showing a starter polymer or DNA strand 210 in liquid 802 attached to a pillar 14, and a side view of a data writing (or printing) process 900 for adding bits or codes to the free ends of the starter polymer DNA strand 210 on the wafer. Specifically, the write-add process begins with performing a wash cycle 820 to prepare the DNA strand 210 for the initial write-add reaction. The printhead then ejects add "0" or add "1" droplets at desired spot locations, as shown in Figure 6, depending on the desired bits or cassettes to be written, as indicated by blocks 902A, 902B, and 902C. After the addition reaction is complete, a wash cycle 802 is performed to prepare the DNA strand for the deblock / adapter reaction. The printhead then ejects deblock / adapter droplets over the desired spot locations where the addition reaction has just occurred, as indicated by blocks 904A, 904B, and 904C. After the deblocking / adapter reaction is complete, a wash cycle 802 is performed to prepare the DNA strand for the next addition reaction. The printhead then ejects an add "0" or add "1" droplet at the desired spot location, depending on the desired bits or cassettes to be written, as indicated in blocks 906A, 906B, and 906C. After the addition reaction is complete, a wash cycle 820 is performed to prepare the DNA strand for the deblocking / adapter reaction. The printhead then ejects a deblocking / adapter droplet over the desired spot location where the addition reaction has just occurred, as indicated in blocks 908A, 908B, and 908C. The above process is repeated until all the desired bits, cassettes, or codes have been written to the DNA strand. The writing and addition process is further described below in relation to Figures 20A and 20B.

[0028] Figure 9B shows a writing process 930 that adds bits or codes to the DNA strand, similar to Figure 9A, but differs in that writing blocks 912A, 912B, 912C and 916A, 916B, 916C are writing cassettes that display 2-bit binary codes 00, 01, 10, and 11, and use a printhead array 822 as shown in Figure 8B.

[0029] Figure 10 shows a side view of a silicon wafer 10 according to an embodiment of the present disclosure, having patterned layers 202, 204 showing starter DNA strands 210 attached to pillars at one end and to coding DNA at the other end, and also shows a method for removing coding DNA strands 1002, 1004, 1006 from the wafer 10 using a separation fluid 1008. Specifically, each pillar or spot 14 has a plurality of coding polymers or DNA strands 1002, 1004, 1006. Once all bits, cassettes, or codes have been written or printed, a separation fluid 1008 flows across the wafer array (or chip), thereby releasing the encoded DNA 1002, 1004, 1006 (which may include the starter strand 210), which can then be removed or flushed away (indicated by arrow 1010) from the solid substrate 204 and stored in a storage container (Figure 11A), which may contain a liquid to keep the memory strings hydrated or may dehydrate them for later rehydration and reading.

[0030] Referring to Figure 11A, an example of a plurality of spots 1142-1148 having encoded DNA 1002-1008 (after the code has been written) attached to a wafer shown as a flat surface 1101 according to an embodiment of the present invention is shown, and a diagram illustrating the process for removing, storing, and reading the data written at each spot (spot 1-spot N). Specifically, after the desired code has been written to the DNA memory strings (or strands or nuketes) 1002-1008, each of the spots 1142-1148 to which the encoded DNA memory strings 1002-1008 are attached can be unloaded to remove or detach the encoded DNA memory strings from each spot (as described herein). In some embodiments, there may be a plurality of encoded DNA memory strings attached to a given spot (as described herein). The removed coded DNA memory strings are then fluidically transported along the output channel to a collection bin or container 1112 (indicated by arrow 1110), which holds coded DNA strings from all spots in a given wafer array outside (or separated from) the wafer. If it is necessary to read the stored data, the coded DNA memory strings in the collection bin 1112, collectively 1100, can be read by any off-the-shelf DNA sequencer 1114 having sufficient accuracy to meet the requirements of the desired application, and the codes written to each DNA memory string can be determined. The results of the DNA reading of the code values ​​may also be analyzed by a decoding logic 1127, and a graph 1130 is shown to determine the codes with the most quantity or number of hits.

[0031] The DNA reader / sequencer 1114 can provide coded data values ​​from a memory string to a computer-based system 1126, where it performs decoding logic 1127 (described herein with reference to Figure 11B) to analyze and decode the data from the DNA sequencer 1114. The computer system 1126 may be the one shown in Figure 19B or similar. The computer system 1126 can communicate with a DNA data server 1124 (similar to Figure 19A) and a display 1125 that can display or report data results 1130 obtained by reading the DNA coded data memory string 1100. In some embodiments, the DNA sequencer 1114 can store the coded data directly in the DNA data server 1124, where it can be retrieved by the decoding logic 1127.

[0032] In some embodiments, data can be written to the DNA string using an address / data 1120 / 1122 format similar to that shown in Figure 11A or Figure 11B, where the address or number of the spot 1120 being written is encoded, followed by data 1122 associated with that address (or spot number), which may also include other error correction information. In this case, the result may be similar to the graph 1130 shown at the bottom of Figure 11A, showing the quantity (number of hits) versus the code value for each coded DNA string in the collection bin. In some embodiments, multiple spots may be written with the same data for redundancy and error correction purposes. In this case, addresses may be used to identify all spots or strands written with the same data. The resulting graph 1130 shows the distribution of values ​​for each spot or address, with the height of each line 1133 representing the quantity of each code value read. Write errors are expected to occur. Therefore, each spot is provided with multiple DNA starter strings (as described herein), all of which are either written simultaneously in a single drop from the printhead or pre-placed on the wafer, as described herein. In some embodiments, data associated with an address having the maximum number or amount of the same value indicated by the highest arrows 1132, 1134, 1136, 1138 for a given spot or address is used to determine the resulting value to be used for that spot or address / ID by the decoding logic 1127 (described below with reference to Figure 11B). The number of DNA strings or strands per spot depends on the liquid spot size, e.g., about 10,000 to 1,000,000, and other amounts of DNA strands may be used as needed. Also, in some embodiments, spot addresses may not be used or required as part of the code in applications where spot addresses are not critical, e.g., when the encoding DNA remains on the array.

[0033] Figure 11B is a flowchart 1170 for implementing the decoding logic 1127 (Figure 11A) for decoding polymer memory string data according to an embodiment of the present disclosure. Specifically, the logic begins in block 1132 by retrieving DNA bases obtained from DNA sequencer reads of all memory strings on the wafer from the DNA data server. Next, block 1174 identifies the address and data for each memory string and groups them by common address. The next block 1176 identifies the memory string that has the most matches for the current address having the same data. Next, block 1178 stores the most matching address and data in the DNA data server. Next, block 1180 determines whether all memory strings or nuket addresses or IDs have been decoded. If not, the logic proceeds to block 1182 to retrieve the next string address and repeats the process blocks 1176 through 1180 described above. If the result of block 1180 is yes, all memory strings have been evaluated and decoded, and the logic terminates.

[0034] Figure 12 shows a side view of a silicon wafer 10 having patterned layers 202, 204 according to an embodiment of the present disclosure, showing a multi-nozzle printhead 1202 that discharges droplets 1210 of starter DNA strands 210 onto HfO2-treated pillars 14 (or spots) of the wafer array, and showing an optional preparation fluid 1220 that has been washed across the surface to prepare the wafer for the adhesion of starter DNA. In this case, depending on the number of nozzles 1204-1208, it may be possible to load all of the DNA simultaneously or in groups.

[0035] Figure 13A is a diagram of Figure 8A for Addition "0", Addition "1", and deblock / adapter, where three nozzles are grouped together to form a row, and multiple or arrays of printhead rows 1302, 1304, 1306 are used to write or print to multiple corresponding spots 14 on the wafer array. In this case, in the array of printhead rows, each row 1302, 1304, 1306 has three nozzles, for example 1302A, 1302B, 1302C for printhead row 1302, 1304A, 1302B, 1302C for printhead row 1304, and 1306A, 1306B, 1306C for printhead row 1306, which allows for simultaneous printing or writing of data to multiple spots, significantly speeding up the writing or printing process.

[0036] Figure 13B is a diagram of Figure 13A in which, according to an embodiment of the present disclosure, the three nozzle printhead rows are replaced with five nozzle printhead rows, e.g., G, C, A, T and deblock / adapter, for simultaneous printing to multiple spots. In this case, the number of different types of bits becomes quaternary (G, C, A, T), and the amount of data that can be stored increases. As described herein, each bit may be a single base or multiple bases (or cassette). In the case of a cassette, the enumerated quaternary are merely labels indicating the four possible states of each digit, position, and bit in a word, depending on the type of encoding used. For example, in the case of a 2-bit binary encoding, as shown in Figure 8B, they represent a cassette (or base string) of 00, 01, 10, and 11.

[0037] In particular, DNA using 4 bits (or bases or sets of bases) representing the GCAT data to be written, using any number of "bits" (or monomers or bases), can be used in data storage polymers (or memory strings) as needed, as long as the desired functional and performance requirements are met. More specifically, referring to Figure 13B, side views of four append printhead rows 1352, 1354, and 1356 are shown, and each of the four append heads, nozzles, or chambers has a unique chemical structure (or monomer, multiple bases, cassette) or code to be appended to the polymer memory string. In the case of quaternary (e.g., GCAT in DNA-based systems), there are four append heads or chambers or nozzles and one deblock / adapter head or chamber or nozzle (five in total). These can be considered as four unique codes, which in binary are 00, 01, 10, and 11 (or 0 through 3 in decimal). The four codes can also be four bases in DNA, i.e., GCAT, as described herein and in the jointly owned patents and patent applications mentioned above. Such a configuration enables bulk writing (multi-bit writing) of information or data with a single (multi-nozzle) printhead array, resulting in improved data storage density and data storage speed compared to writing a single bit with each write cycle (or additive reaction). This can be done for any number of unique additive printheads, chambers, and nozzles that provide a unique code (or chemical or structure) to a given spot, with the only limitation being the number of unique chemicals or structures (or cassettes) that can be added to or written to the memory string (or polymer) and identified (or read), as described herein.

[0038] Figure 14 shows a diagram of the writing process of a dual printhead assembly according to an embodiment of the present disclosure, showing that an entire row and layer of 1s and 0s is written, followed by an adapter layer, followed by another layer of 1s and 0s. In this case, such a dual head assembly (or dual nozzle or dual chamber) allows the printhead to write an entire layer of 1s and 0s (or "1" cassette and "0" cassette) before it becomes necessary to deblock the layer to enable writing of the next layer. In particular, at 1402 on the left, A0B and A1B of the first layer are printed (using two heads), showing a top and side view of the first layer with "0"s and "1"s printed. Next, a cleaning step 1404 is performed to clean the surface with a buffer to inactivate or wash away all unbound molecules. Next, at 1406, the adapter BA is printed, with the corresponding side view shown below. Then, the cleaning step 1408 is performed again, as before. Next, at 1410, the second layer of "0"s and "1"s is printed again using A0B and A1B, with the corresponding side view shown below. Such a dual-head assembly allows two cassettes to be printed simultaneously on different reaction spots, enabling faster data writing, minimizing material loss due to smaller volumes, and potentially requiring buffer optimization to improve the efficiency of cycle conversion at small volumes and control spot liquid evaporation.

[0039] Referring to Figure 15, an image is shown of the setup of the inkjet printer 1502 according to an embodiment of the present disclosure, showing an enlarged view of the operating axis, the computer control unit 1504, and the wafer 10. In some embodiments, the printing portion of the wafer may be about one-third of the wafer, and other parts of the wafer may be used for printing as needed. The printer used was a Suss Microtec LP50 inkjet printer with PiXDRO technology.

[0040] Figure 16A shows images 1600 of various sizes of printed droplets on an active spot with a diameter of 50 microns according to embodiments of the present disclosure, showing how they cover the active region or pillar. Image 1602 shows an active region without droplets. Image 1604 shows an active region with rows of 30 pL, 60 pL, and no spots from left to right. Image 1606 shows a region with rows of 30 pL, 60 pL, 150 pL, 300 pL, 600 pL, and no spots from left to right.

[0041] Referring to Figures 16B and 16C, images are shown of the results of printing and washing five times on an active wafer spot with a diameter of 50 μm at a distance of 100 dpi using 300 pL according to an embodiment of the present disclosure. Printing layer count and drop size (e.g., 10 layers of 30 pL drops printed on a cassette with 10% PEG, 5% glycerol, and 0.1% tween) and washing details (e.g., four washes with 1 M NaCl / 0.05% tween washing buffer; rinse with topogation buffer and manually deposit cassette 5; four washes with 1 M NaCl / 0.05% tween washing buffer; wash topobuff (PEG, glycerol, no tween); attempt drying with or without air). The patterned wafer retains liquid and is more difficult to dry. Spot fusion is also observed in certain areas, which can be reduced or eliminated by using hydrophobic treatment on the outside of the pillars. Figure 16B shows the first print, and Figure 16C shows prints 2-5. Images 1654 and 1664 show wet areas of the wafer in the second and fourth prints, indicating significant spot liquid overlap due to cleaning and that drying is not fully achieved.

[0042] Figure 16D shows image 1670 of the results of five printing and washing of an active wafer spot with a diameter of 50 μm at a distance of 100 dpi according to an embodiment of the present disclosure. The reaction spot sizes ranged from 300 pL to 450 pL to 600 pL.

[0043] Figure 17A shows an image of wafer 10 and two graphs 1702 and 1704 showing mass spectrometry results from the emission of HIDI after writing from a portion of the wafer 1701, according to an embodiment of the present disclosure. In particular, graph 1702 shows 5 microliters of data loaded into the CE, and graph 1704 shows 9.5 microliters of data loaded into the CE. This indicates that 10-bit or cassette writing and reading was possible.

[0044] Figure 17B shows an image of wafer 10 after drying for three weeks according to an embodiment of the present disclosure, and two graphs 1722 and 1724 showing mass spectrometry results from the release of formamide from a portion 1705 of the dried wafer 10. This indicates that the data was preserved after three weeks of dehydration storage after printing, and a good signal was received from a release volume of 30 microliters (uL). DNA was left standing in formamide at room temperature for three weeks. Specifically, graph 1706 shows data from 5 microliters loaded into the CE, and graph 1708 shows data from 9.5 microliters loaded into the CE.

[0045] Referring to Figures 18A and 18B, the format of the data written to the polymer can be modified based on various factors and design criteria. In particular, the “memory string” (or memory strand, DNA, polymer) 1802 may be shown as a line on which there is a series of ellipses 1804 indicating that individual “bits” have been written (or appended) and may exist in the form of a cassette (or string of DNA bases) on the memory string in a given memory cell. In some embodiments, the bits 1802 may be written sequentially to construct a “memory word.” The first exemplary data format shows three components for a memory word: an address portion, a data portion, and an error-checking portion. The address portion may be a label or pointer used by the memory system to identify the desired data. Unlike conventional semiconductor memory storage in which hardware address lines on a computer memory bus address specific memory locations on a physical memory chip, the nano-writing system of this disclosure has an address (or label) that is part of the data being stored and may indicate the location of data to be retrieved. In the examples shown in Figures 18A and 18B, the addresses of the data written to each or more spots for redundancy are located adjacent to or contiguous with the data, as well as error-checking data such as parity, checksum, error correction code (ECC), cyclic redundancy check (CRC), any other form of error checking, and / or encryption information. In a memory word, each of the components, address, data, and error check, are located contiguous with each other within the memory string 1802. Each component has a known length (number of bits), for example, address = 32 bits, data = 16 bits, error check = 8 bits, so each memory word and its components can be determined by counting the number of bits. Also, as described in the jointly owned issued patents and patent applications mentioned above, a given bit 1804 may be represented by one or more DNA bases or oligomers, etc. When multiple bases are used to represent bits (i.e., "0" or "1" in binary, or G, C, A, T in quaternary), they may be called "cassettes," as described herein.Therefore, as used herein, the terms bit and cassette may be used interchangeably. In some embodiments, depending on the writable length of the DNA string, there may be multiple digital words (address, data, error check) stored in a given DNA memory string.

[0046] Referring to Figure 18A, the right side shows an exemplary data format having three components similar to memory string 1802: an address portion, a data portion, and an error-checking portion. However, in memory string 1812, there are “special bit or array” portions S1, S2, S3 between each portion. These special bits S1, S2, S3 may be a predetermined sequence of bits or codes indicating which portion comes next; for example, 1001001001 may indicate that the address comes next, 10101010 may indicate that the data comes next, and 1100110011 may indicate that the error-checking portion comes next. In some embodiments, the special bits may be different molecular bits or bit structures attached to the string, such as dumbbell-shaped, flower-shaped, or other “large” molecular structures, which are easily identifiable when the DNA memory string is read offline outside the nanowriting chip described herein. Instead of being large, it may have other molecular properties that result in variations inherent to the 1-bit and 0-bit polymer structures as described herein.

[0047] Figure 19A is a block diagram of an inkjet printing system 1900, which includes an inkjet printing machine 1902 and a computer system 1904 that interfaces with the machine 1902. The inkjet printing machine 1902 may include piezoelectric inkjet printheads 1906 (similar to those described herein) that supply reagent droplets, as described herein, to desired write spots on a wafer array 10 mounted on an XY stage 1907. The printheads and XY stage may be controlled by printhead, array stage control devices, and inspection logic 1908, which communicate with local control logic 1910 to write desired reagents and codes to DNA strands, as described herein. For example, one or more of read / write addresses and / or data inputs / outputs and / or control lines may be received from or provided to a serial (or parallel) bus, the serial (or parallel) bus containing digital commands for which codes or data to write to the array. The computer system 1909 can receive commands from user 1903 and provide information to display 1905 for use by user 1903, and can also provide commands to local control logic 1910 which provides specific write requests to printhead 1106 and array stage control device and inspection logic 1908. The printhead 1906, array stage control device and inspection logic 1908 control the printhead position XYZ and wafer array XY stage 1907, and also receive data from droplet viewer (or sensor) 1911 to determine the quality of the droplets, and report the results and errors to local control logic 1910 and computer system 1904, in which computer system 1904 may store droplet error information in DNA data server 1915 or other memory device for future use when reading the data. Such information may be used to correct or ignore specific data that is known to have a particular error caused by a droplet error in the data.

[0048] The inkjet printing machine 1902 may also include instrument (fluid / reagent) control logic 1914, which controls the supply of reagents 1916 to the printhead, controls the flow of fluids 190 across the wafer array 10 through the inlet manifold 1921, such as cleaning fluid 1922, separation fluid 1924, preparation fluid 1926, etc., via valves 1920A, 1920B, 1920C, and control line 1919, respectively, and controls the outflow fluid 1930 flowing through the outlet manifold 1931, for example, controlling waste liquid 1932 via valve 1930A and control line 1933, and controls fluid 1934 containing encoded DNA removed from the wafer array via valve 1930B and control line 1933, which is collected, for example, in a collection bin 1936 for later reading.

[0049] Figure 19B is a block diagram of the computer system 1904 of Figure 19A according to an embodiment of the disclosure. The computer system (Figure 19B) 1904 may interact with an inkjet printer 1902, or with equipment controls 914 that interact with a separate fluid supply, etc., all of which interact with one or more CPUs / processors 1952, or logic that performs specific functions as described herein. The computer systems of Figures 19A and 19B may also interface with a user 1903 and a display screen 1905.

[0050] The local control logic 1910 (Figure 19A), fluid equipment control 1914, print head, and array stage control device 1908 have the necessary electronic equipment, computer processing power, interfaces, memory, hardware, software, firmware, logic / state machine, database, microprocessor, communication link, display or other visual or audio user interface, printing device, and any other input / output interfaces, including sufficient fluid control and / or pneumatic control, supply, and measurement capabilities, to provide the functions described herein or to achieve the results described herein.

[0051] Figure 20A is a flowchart 2000 for performing starter DNA loading, coding polymer writing (printing), and unloading in an inkjet writing system according to an embodiment of the present disclosure, the logic of which may be performed by system 1900 of Figure 19A. In some embodiments, the above writing process may be repeated for each new set of DNA having beads to be written.

[0052] Specifically, logic 2000 begins in block 2002 by loading or printing a starter DNA strand onto a spot on the wafer array. Next, block 2004 receives a binary code to print / write to the current memory string (or nuket). Next, block 2006 performs a cleaning cycle across the wafer array to remove any excess reagent from the wafer surface. Next, block 2008 writes / prints the code to the memory string / nuket using the appropriate cassette at the desired spot for each writing process shown in Figure 20B. After the code is written, block 2010 determines if there are any more spots to write before the deblock / adapter is applied to the spot. If yes, logic returns and writes / prints the code to the memory string / nuket using the appropriate cassette at the desired spot for each writing process shown in Figure 20B until all desired spots have been written for that code. Block 2012 then waits for the addition reaction to complete. Once the reaction is complete, block 2014 prints the deblock / adapter for the desired spot. In some embodiments, the deblock / adapter may be cleaned across the surface of the array instead of using an inkjet cartridge or head for the deblock / adapter. Next, block 2016 determines whether all code has been written for the current string or nuket. If not, block 2018 retrieves the next code in the string, returns to the clean cycle to continue, and repeats the process for the next code. Once all code has been written, block 2020 determines whether all memory strings or nuket have been written for the wafer array or chip. If not, block 2022 retrieves the next desired memory string or nuket to write, returns to retrieve the binary code to write, and the logic repeats the process of writing the next desired binary code until all available desired spots on the wafer array or chip have been written or all desired binary codes have been written.Next, block 2024 washes the wafer array with a separation fluid, unloads and captures the DNA / polymer memory strings or nuket into containment bins as shown in Figure 11A (for future reading), and the logic is complete.

[0053] Figure 20B is a flowchart 2050 for writing (printing) bits or codes onto a polymer in an inkjet writing system according to an embodiment of the present disclosure, the logic of which may be performed by the system in Figure 11A. Specifically, logic 2050 begins with block 2052, which determines whether to write or add 0 bits. If yes, block 2054 causes the appropriate inkjet cartridge or head to print a 0-bit code at the desired spot / location on the wafer array or chip. Next, or if the result of block 2052 is no, block 2056 determines whether to write or add 1 bit. If yes, block 2058 causes the appropriate inkjet cartridge or head to print a 1-bit code at the desired spot / location on the wafer array or chip. Next, or if the result of block 2056 is no, block 2060 determines whether bit writing is complete for the spot or group of spots to be written. If no, the logic returns to block 2052 to determine which code and location to write. If the result of block 2060 is yes, the appropriate code for the desired number of spots has been written, and block 2062 determines whether a droplet error has been detected by a droplet viewer (or sensor), which may be part of the print head and array stage control unit and inspection logic. If an error is detected, block 2064 saves the error location and bit number for future reading, and the logic terminates. If the result of block 2062 is no, no errors were found, and the logic terminates.

[0054] Referring to Figure 23A, a side section view of a patterned wafer substrate according to an embodiment of the present disclosure is shown, having a hydrophobic coating (right image), illustrating a process for creating the hydrophobic coating using silanization. In particular, the left side 2302 of Figure 23A shows an embodiment of the patterned substrate, and a magnified view 2304 of the top surface of a pillar or spot 14, which also shows the chemical reaction used for attachment to a starter DNA / polymer string or strand (or acceptor) 210, such as azido-C12-phosphonic acid or 12-azidododecylphosphonic acid (sichemia). Furthermore, Figure 23A, on the right 2310, shows an embodiment of the patterned substrate on the left 2302, and a magnified view 2312 of the top surface of a pillar or spot 14, which comprises a hydrophobic layer 410 surrounding the chemia attachment region 204 on the top surface of the pillar, for example, 1H,1H,2H,2H-perfluorooctyltriethoxysilane, which can be used for attachment to a starter DNA strand (or string, receptor).

[0055] Referring to Figure 23B, side view images of patterned wafers having two different hydrophobic silane coatings according to embodiments of the present disclosure, PFOTES (1H,1H,2H,2H-perfluorooctyltriethoxy-silane) above the dashed line and DDTMS (dodecyltrimethoxy-silane) below the dashed line, are shown at three different temperatures. In particular, for PFOTES, the images are shown at 112°F with water, 85°F with inkjet buffer and tween, and 70°F with inkjet butter and EcoSurf. For DDTMS, below the dashed line, side view images of patterned wafers are shown at 105°F with water, 65°F with inkjet buffer and tween, and 35°C with inkjet butter and EcoSurf. Analysis of the contact angle indicating surface hydrophobicity is also shown.

[0056] Referring to Figure 24A, three images are shown of an example of a topoisomerase-based ink according to an embodiment of the present disclosure: two images printed on a glass slide at two different resolutions and one image on a clean silicon wafer. In particular, these show images of the topoisomerase-based ink printed on a glass slide (the two images on the left) and on a clean 4-inch diameter silicon wafer (the image on the right) at a frequency of 10 kHz, a pulse of 28 V, and a slew rate of 40 V / us, with resolutions of 225 dpi (glass slide), 450 dpi (glass slide), and 450 dpi (silicon wafer).

[0057] Referring to Figure 24B, a graph 2400 of conversion % versus time in the example shown in Figure 24A, according to an embodiment of the present disclosure, is shown, comparing the ligation speed performance of jet-type and non-jet-type topoisomerase-based inks at four different time points. In particular, the performance at 0 seconds, 20 seconds, 60 seconds, and 5 minutes (300 seconds) is shown. For jet data, printing was performed using a 30V 10kHz inkjet with a samba12 nozzle head and 10% PEG8000.

[0058] Referring to Figure 25A, Image 2500 shows another example of a topoisomerase-based ink printed on a glass slide at a resolution of 300 dpi according to an embodiment of the present disclosure. In particular, it shows an image of a topoisomerase-based ink printed on a clean 4-inch diameter silicon wafer with a frequency of 10 kHz and a pulse of 75 V, showing printing on a clean silicon wafer at a resolution of 300 dpi and a pitch of 85 microns.

[0059] Referring to Figure 25B, a graph 2502 of conversion % versus time in the example in Figure 25A, according to an embodiment of the present disclosure, is shown, comparing the ligation speed performance of jet-type and non-jet-type topoisomerase-based inks at four different time points, and is an enlarged view of a detailed comparison bar graph 2506 of conversion at 20 seconds. In particular, as shown in the detailed comparison bar graph at 20 seconds, performance at 0 seconds, 20 seconds, 60 seconds, and 5 minutes is shown for eight different points using a Spectrum 128 nozzle head, 10% PEG, and 10% glycerol.

[0060] Referring to Figure 26A, this figure shows an example of bonding and linking chemistry for printing topoisomerase ink onto a patterned wafer according to embodiments of the present disclosure, showing 2608 with and without a hydrophobic coating 410. In particular, it shows 12-azidododecylphosphonic acid (Schemia) bonded to HfO2, and the copper-free click chemistry between the azido group on the phosphonic acid and the ADIBO group bonded to the DNA receptor chain via an amide alkyl linker is shown collectively as 2602. It also shows a surface having a hydrophobic coating 410, for example, a perfluoroalkyl group linked to a silyl group linked to the substrate, such as 1H,1H,2H,2H-perfluorooctyltriethoxysilane. Region 2604 is shown enlarged in 2608, as indicated by the dashed line 2610.

[0061] Referring to Figure 26B, a sequence of images 2600 obtained from five printing cycles of topoisomerase ink on a patterned wafer, according to an embodiment of the present disclosure, for the example shown in Figure 26A.

[0062] Referring to Figure 27A, a side view of a flat substrate having pattern spots 2702A with acceptors 210 for synthesis according to an embodiment of the present invention is shown, where the substrate 10 is moving in a first direction 2704 under a fixed inkjet head A2702A. In particular, the substrate 10 moves rapidly over the inkjet head 2702A at a high speed of about 1 to 3 m / sec. Other speeds may be used as needed. Registration or alignment of the substrate with respect to the inkjet head 2702A may be performed using an online optical micrometer to ensure proper alignment, or other alignment techniques may be used. In some embodiments, the high-resolution system may be 1600 dpi (or 16 micron pitch or spot spacing) or higher, however, other spacings such as 64 micron spacing or other spacings may be used as needed. As the substrate moves (or advances) through the inkjet head 2702A, 1.2 to 2.1 pL of addition reagent ("addition" reaction fluid) is released by dropping droplets 2710, for example, 5 to 20 droplets per cell (or spot), landing on the substrate indicated by bubbles 2712 and covering the spot or reaction area 2720. In some embodiments, the inkjet head 2702A can use nozzle redundancy, e.g., 2x, 3x, 4x, 5x or more, or other redundancy, to ensure that all spots (or substantially all spots) receive enough fluid to cause the desired addition reaction. In some embodiments, the inkjet head 2702A may also move to facilitate the placement of the desired droplets 2710 onto the wafer. In some embodiments, multiple inkjet heads (or rows of heads) may be provided along the path through the substrate. In some embodiments, the wafer 10 is fixed, and the inkjet heads may move or position (as described herein) to facilitate the placement of the desired droplets onto the wafer.

[0063] Referring to Figure 27B, this is a side view of the flat spot pattern substrate 10 of Figure 27A according to an embodiment of the present invention, showing the substrate 10 moving under a fixed inkjet head B2702B (which may be a different head from the one in Figure 27A) in the opposite direction to that in Figure 27A. In particular, this process is similar to the process shown in Figure 27A, but differs in that it uses a second writing fluid 2730 (or “addition” reaction fluid). In some embodiments, multiple inkjet heads (or rows of heads) for the inkjet head B2702B may be provided along a path 2724 passing through the substrate 10. A separate track for the second head may be provided, as shown in Figure 28A. This “pipelined” (or arranged in rows) the substrates (or wafers) so that both substrates (or wafers) always pass under the inkjet writing heads, and adjacent steps (not shown) (e.g., air / wash cycle, see Figure 28A) may be parallelized to suit the desired processing volume.

[0064] In some embodiments, the writing techniques described herein may be performed using a flat substrate as shown in Figures 27A to 27C, or may be used with an etched patterned substrate as shown in Figures 1 to 3, which has raised pillars as described herein.

[0065] Referring to Figure 27C, a side view of the substrate in Figure 27A is shown, detailing the size, dimensions, and receptor (or starter DNA strand) density of the cell (or spot) 2720 according to embodiments of the present invention. In particular, the spacing of the cell (or spot) 2720 may be 32 microns, 64 microns, or any other desired spacing that satisfies the desired function and performance. The diameter of the spots may be 25 microns, 50 microns, or any other desired diameter (or equivalent area of ​​a different shape) that satisfies the desired function and performance. In some embodiments, the density of receptors (or starter DNA strands) on the surface of a given spot or cell 2720 is 1.0 × 10⁻¹⁶. 4(or 10,000) receptors, or 3.0 × 10 4 The number of receptors may be (or 30,000) or any other desired receptor density that satisfies the desired function and performance, and the receptor density may be adjusted by the chemical reaction used.

[0066] Referring to Figure 27D, Figure 27C shows a side view of the substrate illustrating the process for a topogation reaction on the surface of a cell (or spot, reaction region, reaction spot) 2720 on the substrate 10 according to an embodiment of the present invention. This shows that, for a given receptor, only one topoenzyme 402A binds to one receptor 210, and the encoding DNA strand 402 remains bound to the receptor 210, and no other topoenzymes bind, as indicated by arrow 2750.

[0067] Referring to Figure 27E, a step of one embodiment of a cleaning cycle 2770 performed after the completion of a topogation addition reaction is shown according to an embodiment of the present invention. In some embodiments, the cleaning cycle or process 2770 may include a first step 2772 in which air 2775 is blown using a rapid change of direction and air jet 2774 (or air blade) to discharge or remove any unattached, unbound, or free-floating topoaddition fluid / reagent from the surface, and then cleaning fluid (or buffer) 2780 is sprayed with a spray head 2778 over the reaction spot 2710 or over the whole or a predetermined portion of the wafer or substrate 10 being written. In some embodiments, an optional incubation or waiting step 2782 may be provided to allow the cleaning fluid 2780 to remove any unattached topo or enzyme from the surface from the writing cycle. In some embodiments, the cleaning cycle may be combined with or alternated with a deblock or adapter cycle. In this case, the cleaning fluids (steps 2 and 3 above) 2776, 2782 may be changed or alternated with, for example, cleaning fluid, deblocking / adapter fluid, cleaning fluid, etc., each time the cycle is passed. Next, another air blade step 2786 may be provided to remove any remaining cleaning fluid 2780, similar to the first step 2772. The cleaning cycle process 2770 (or a part thereof, e.g., steps 2 to 4) may be repeated as many times as necessary to prepare the surface for the next addition reaction, as shown in step 2788.

[0068] Referring to Figure 28A, according to embodiments of the present invention, a portable inkjet-writable silicon wafer or other wafer is transported through, for example, electromagnetic tracks 2804A, 2804B, 2804C, 2804D, 2804E, 2804F (collectively referred to herein as 2804) and / or queue elevators (2806A, 2806B, 2806C, 2806D (collectively referred to herein as 2806) to inkjet head writing stations 2810A, 2810B and cleaning / drying stations 2812A, 2812B, via inkjet head writing stations 2810A, 2810B and cleaning / drying stations 2812A, 2812B. A side view of the linear actuator DNA / polymer inkjet writing system 2800 is shown, which is a conveyor track for moving (or shuttle) the EHA shuttle 2802. The system 2800 can move the wafer 2802 in and out via the inlet / outlet queue / elevator 2806A and load / unload conveyors (left side) 2804C, 2804D using a fluid discharge XY robot 2814 and an air / washing conveyor 2804E. In one embodiment, the wafer (or wafer shuttle) 2802 is on the left side The wafer 2802 may enter or be loaded from the left side via the air / cleaning conveyor 2804 and the XY robot 2814B. The wafer 2802 can be inserted into a writing loop 2820 having two writing conveyors or tracks (upper / lower) 2804A, 2804B and two queuing / elevators (left / right) 2806, 2806B, and each writing conveyor has an inkjet head A2810A (along the upper track) and ( The lower track has inkjet heads 2810A, 2810B, such as inkjet head B2810B. In some embodiments, inkjet heads A2810A and B2810B may be a row or multiple inkjet printheads, respectively, as described herein. The air / washing conveyor 2804E moves the wafer 2802 in and out of the write loop 2820 based on which code or cassette needs to be written to which spot on which wafer.After each addition reaction, the air / cleaning conveyors 2804E, 2804F remove the wafer 2802 from the write loop 2820 and may perform a cleaning cycle (e.g., air blade 2774 and cleaning station 2778) as described herein in Figure 27E. In some embodiments, the air / cleaning conveyors 2804E, 2804F accelerate the shuttle 2802 away from the write loop 2820, then quickly change direction to generate inertial force and remove surface liquid from the substrate surface (similar to a vortex spinner or shaker). Once the writing process is complete for a given wafer 2802, the inlet / exit queue / elevator 2806D can pull the wafer 2802 from the air / washing conveyor 2804E to a separate load / unload conveyor loop 2830, and it passes through an ejection XY robot 2816 which can selectively remove the written or encoded polymer / DNA from the wafer and place them in a storage container 2818, as described herein with reference to Figures 11A and 19A.

[0069] In this case, the fluid discharge XY robot 2816 can discharge the separated (or discharged) fluid into each 2802 shuttle or the fluid zone within the shuttle 2802, aspirating or washing away the encoding polymer / DNA and fluidly transferring them to a multiwell microplate 2818 or other storage container. In some embodiments, the discharge XY robot 2816 may also wash and / or recondition the substrate surface and add new acceptors (or starter polymer / DNA strands) if done inline without removing the shuttle 2802 from the conveyor or track 2804C. The load / unload conveyor / loop 2830 may operate at a slower speed than the write loop 2820 to allow the fluid discharge and reconditioning processes to be performed with the shuttle 2802 remaining on the conveyor track 2904C, or to allow the removal and replacement of the shuttle on the conveyor track 2904C. Once a new or cleaned shuttle 2802 is replaced on track 2804C, the return elevator 2806D moves the shuttle to the upper load track 2804D, from where it is fed to the load / unload elevator 2806C, completing the load / unload loop 2830.

[0070] In some embodiments, instead of cleaning and / or readjusting the substrate surface, the shuttle 2802 may be removed from the load / unload conveyor loop by a SCARA robot 2814A, a pick-and-place robot, or other robots that can pick up or extract the used written shuttle / wafer 2802 and replace it with a clean, writable shuttle / wafer 2802. This can be done from the upper load / unload loop 2830, the air / cleaning conveyor 2804E using the SCARA robot 2814B, the upper and / or lower write conveyors 2804A, 2804B, or anywhere within the write loop 2820. In some embodiments, the SCARA robot may perform a "hot swap" while the loop is operating. The SCARA robots 2814A and 2814B can provide a shuttle 2802 to a storage / handling system, as described herein, which receives the shuttle from robot 2814A and places it in a storage container 2832 for subsequent fluid discharge, or places it in a fluid discharge robot 2816, as shown in line 2834, for fluid removal or discharge and fluid storage of the encoded DNA.

[0071] Referring to Figure 28B, a perspective view of the portable inkjet writable silicon wafer shuttle 2802 of Figure 28A, according to an embodiment of the present invention, is shown. In particular, in some embodiments, the wafer shuttle 2802 may be a silicon wafer etched with shallow (e.g., 1-2 microns) fluid wells (or regions or zones) 2853 for fluid discharge (or fluid discharge zones or discharge zones), and each fluid discharge zone 2850 has patterned reaction spots or cells 214 (flat surfaces or pattern-etched surfaces) for coding polymers or DNA extension as described herein. The fluid discharge zones 2850 may be hexagons having wetted boundaries or walls 2852, which may be physical / structural (e.g., depressions or ridges of about 1-2 microns, other heights or depths may also be used) and / or chemical (e.g., hydrophobic boundaries as described herein). The size of the discharge zone 2850 may be 2 mm wide, 1000 spots, 64 μm spacing, or 90 mm wide, 80000 spots, 32 μm spacing, or any other dimensions, spacing, or spot density, as long as it provides the desired function and performance. The shape of the fluid discharge zone 2850 may be hexagonal (as shown in Figure 28B), or it may be square, rectangular, circular, elliptical, trapezoidal, parallelogram, or any other shape that provides the desired function and performance. During operation, in some embodiments, the fluid discharge zone 2850 may be configured to receive pipette tips 2854 (shown as circles in the enlarged view) from a robot such as the fluid discharge robot 2816 shown in Figure 28A. The pipette tip 2854 can dispense separation (release) fluid onto each shuttle or zone 2850 within the shuttle, allowing for aspiration or washing removal of encoding polymer / DNA (and transfer to a multiwell microplate or other storage unit), further washing and / or readjusting the substrate surface and adding new receptors, thereby preparing the shuttle 2802 for writing additional encoding polymer or DNA.

[0072] In some embodiments, the writable wafer or substrate 2856 within the shuttle 2802 may be a passively stretched substrate (i.e., without electrodes or electronics), thereby keeping manufacturing costs low and allowing for easy on-site updating of the stretched surface as part of ongoing service or maintenance of the wafer shuttle. In some embodiments, the wafer shuttle 2802 may have an active wafer writing area of ​​approximately 210 mm × 210 mm, which is mounted on or part of a rectangular stainless steel non-ferromagnetic frame. Other dimensions and materials may be used for the wafer and wafer shuttle as needed, as long as they provide the desired functionality and performance.

[0073] The outer edges of the two opposing sides 2862A and 2862B of the frame 2860 may have equally spaced ferromagnetic inserts or plugs 2864, and the shuttle frame 2860 can be operated or moved using electromagnetic control in the electromagnetic track 2804 described above using Figure 28A. Other shapes and materials may be used for the wafer shuttle 2802 as needed, insofar as they provide the desired functionality and performance.

[0074] Referring to Figure 29, a perspective view is shown of a stacked rotating disk (or platen)-based turntable inkjet writing system 2900 for an inkjet-writable silicon wafer disk 2901 according to an embodiment of the present invention, in which the outer edge of a writable wafer disk 1901 having multiple wafers or shuttles 2902 is positioned on the outer edge of the disk 1901 and rotates through inkjet head writing stations 1910A, 1910B and cleaning stations 1912A, 1912B and removal station 1914. The inkjet head writing stations (or rows) 1910A, 1910B may have multiple heads 1920 per station or row, for example, 16 heads. Each write head 1920 may have several nozzles 1922 with some redundancy, for example, five rows with 14,000 nozzles per row, and each head 1920 provides addition reagents as described herein (as described herein, addition "0" or addition "1", addition "A0B" or addition "A1B", and / or deblocking or adapter reactions, "A0B" addition or "A1B" addition, or "B0A" addition or "B1A" addition without a deblocking reaction).

[0075] In some embodiments, column 1 (additional "AB") 1910A may have 16 heads 1920, which represent 16 different oligos or chemicals (or cassettes) to be added, represented by 4 binary bits, and column 2 (additional "BA") 2910B may have 16 heads 1920, which represent 16 different oligos or chemicals (or cassettes) to be added, represented by 4 binary bits. Since one byte can be 8 bits, in some embodiments, two (4-bit) oligos are added in one rotation, adding 8 bits (or 1 byte) of data as shown in the table below. Such a two-sided writing technique may be performed using separate selectable printheads (as shown in Figure 29), which doubles the data storage capacity of each write cycle, as each separate selectable adapter response can add its own set of bits. Such methods may not be readily achievable in some other size-constrained designs, such as chip-based designs, where the encoding polymer / DNA returns to a common deblock or adapter chamber during each write cycle, as described in the aforementioned patent applications and patents. Column 1 (2910A) (16 print heads) - Left side - Write "AB" A-0000-B A-0001-B A-0010-B A-0011-B A-0100-B A-0101-B A-0110-B A-0111-B A-1000-B A-1001-B A-1010-B A-1011-B A-1100-B A-1101-B A-1110-B A-1111-B Column 2 (2910B) (16 printheads) - Right side - Write "BA" B-0000-A B-0001-A B-0010-A B-0011-A B-0100-A B-0101-A B-0110-A B-0111-A B-1000-A B-1001-A B-1010-A B-1011-A B-1100-A B-1101-A B-1110-A B-1111-A

[0076] Between the two inkjet head rows 2910A and 2910B along the outer circumference of the disk, cleaning stations 2912A and 2912B may be present, which can provide the air / cleaning capabilities described above in Figure 27E. The circular turntable design in Figure 29 can achieve simpler control and better positional control than linear conveyor type systems such as those shown in Figure 28A, and can be suitable for maintenance because it requires less overhead space for handling and improves accessibility. In some embodiments, the wafer or shuttle 2902 may be removed from the disk by a SCARA robot 2930, a pick-and-place robot, or other robot, which can pick up or extract the used written shuttle / wafer 2902 and replace it with a clean, writable shuttle / wafer. In some embodiments, the SCARA robot 2930 can perform "hot swaps" while the system is operating. The SCARA robot 2930 can provide a wafer or shuttle 2902 to the storage / handling system as described herein, the storage / handling system receives the shuttle and places it in a storage container 2932 for subsequent fluid discharge, or places it in a fluid discharge robot 2934 for fluid removal or discharge and fluid storage 2936.

[0077] In some embodiments, there may be four rotating mask disks or platens 2901 relative to a given rotating stage. Other numbers of disks 2901 may be used as needed. In some embodiments, the disk handling system 2900 can control the rotation direction and / or speed of the disks 2901. In some embodiments, the disk handling system can handle releasing or unloading a given wafer or shuttle 2902 to a separate storage area when full, and / or loading a new empty wafer or shuttle into the system for writing / storing data.

[0078] In some embodiments, an example of the system is a platen 1901 (or disk) with a diameter of 2.4 m, having a square active area of ​​33 × ~220 mm along its outer edge, or a wafer or shuttle 2902, an active spot size of 16 μm, a spot area utilization rate of 90%, a platen rotation speed of 13 RPM, 300 cassettes, and 4 bits of fluid (each head row having 16 different oligos or chemicals to be added). The number of wafers may be 30 to 40 or any other number, depending on the platen size and wafer size. In some embodiments, the reaction and cleaning time may be about 1.2 seconds, a 4-bit fluid base (16 × 2 fluids) may be present, and the speed is probably about 3.3 m / s (outside). In some embodiments, the exemplary rack may include four rotating platens having a rack footprint of 16, and about 6 to 10 additional racks may be used for fluid input and control.

[0079] In some embodiments, an exemplary thermal inkjet printing system may comprise four printhead groups having known printhead specifications and performance characteristics for printheads or other components typically used in a system according to embodiments of the present invention. In particular, in some embodiments, thermal inkjet writing heads and / or systems such as VersaPass® or DuraLink® from Memjet may be used or adapted in some embodiments described herein. Based on the desired performance characteristics, data parameters that must be set include cell spacing, active area, nozzle redundancy, module writing width, module writing speed (m / s), total number of spots in the module, spot speed through the module (lines / second), and spot bandwidth (spots / second), as well as fluid supply rate. The VersaPass printhead table also provides specifications for desktop VersaPass printheads, including printhead type, print width, number of printheads per engine, number of nozzles, nozzle redundancy, drop size, resolution, and print speed. Other models, versions, or specifications may be used as needed.

[0080] Referring to Figures 30A, 30B, and 30C, in some embodiments, automated cleaning and liquid removal from the writing substrate, wafer, or shuttle may be performed using a vacuum manifold 3000, which removes or aspirates excess or unwanted cleaning fluid, other liquids, and fluids from the substrate surface and can be directly integrated with a multiwell or microtiter plate.

[0081] More specifically, referring to Figure 30A, a perspective view of a vacuum manifold 3000 plate is shown, according to an embodiment of the invention, which draws fluid from each well into the manifold and into a drainage system to facilitate a cleaning cycle of a wafer or shuttle. In particular, the vacuum manifold may be located on top of a 96-well plate, and the vacuum manifold is equipped with 96 subcutaneous needles that draw fluid from each well into fluid outlet channels 3002A, 3002B and outlet port 3010. The manifold 3000 is held at a low pressure so that the fluid is drawn into the drainage system.

[0082] For example, rows ABCD may be drained to the upper section 3002A, and rows EFGH may be drained to the bottom section 3002B. The upper and bottom sections may be drained to the left side, where an integrated 1 / 4-inch inner diameter hose return (not shown) or port may be present, which can be fluidly piped to a container (not shown) connected to the vacuum section. The vacuum level is controllable, but is unlikely to be required to be highly precise.

[0083] A three-way electric ball valve (or other valve) (not shown) may be used between the manifold and the drainage system. When the valve is activated, the vacuum is released, and any residual fluid remains in the manifold until the next vacuum cycle. Gravity also helps prevent backflow from the manifold to the apparatus.

[0084] Referring to Figure 30B, a perspective cutaway view 3040 of the vacuum manifold plate in Figure 30A, along with two enlarged views 3042 and 3030 of its parts, illustrates the fluid flow according to an embodiment of the present invention. In particular, the fluid is injected into well 3028 as a jet, indicated by a dashed downward arrow in the figure, using, for example, a Dragonfly® bulk dispenser, a small-volume, volumetric, non-contact dispenser. Because the reaction amount of the topo-addition reagent is small, a washing cycle can remove any residue at higher positions in well 3028. The needle 3028, shown in the enlarged view 3030 on the left, may have a gap distance d of about 500 microns from the bottom and aspirates all the fluid (other bottom gaps (d) may be used if necessary). The fluid flows down well 3028 (dashed arrow) and then, aspirated by needle 3020, flows in the direction of the solid arrow into the fluid outlet channel 3022.

[0085] Referring to Figure 30C, a perspective view 3062 of the vacuum manifold in Figure 30B showing a vacuum needle 3020, a magnified view 3064 showing the needle 3020, and a perspective cutaway view 3066 of an inkjet writing assembly with a vacuum manifold are shown according to an embodiment of the present invention. In particular, the needle 3020 may be bonded in place with an ultraviolet-curing adhesive (or any other adhesive or mounting method) and may have a wicking guide, as shown in the magnified view 3064 on the far left. The fluid well 3028 of the well plate may also be aligned with the vacuum manifold using a post shown in the magnified view 3064. Figure 3066 on the far right shows one embodiment of a wafer or shuttle assembly having a vacuum manifold (bottom), a well plate with the fluid well 3028, and a separate small wafer (top) 3070.

[0086] Figure 31 is a cross-sectional side view showing an alternative manufacturing process 3100 for creating a patterned wafer according to an embodiment of the present disclosure. In particular, the process begins in step 1 with RCA cleaning of a single 4-inch diameter polished silicon wafer. Next, in step 2, the surface is subjected to thermal oxidation using an oxide target of approximately 188 nm. Next, in step 3, a photolithography is performed using a mask to form an SiO2 layer. Next, in step 4, a metal oxide layer, for example, with a thickness of approximately 70 nanometers (nm), is applied, deposited, or sprayed onto the top surface of the top layer (hafnium oxide (HfO2) is preferred, but other metal oxides such as titanium oxide or aluminum oxide can be used as alternatives), and then, as shown in step 5, a peeling step is performed leaving HfO2 spots 204 on the surface as reaction spots. If necessary, other methods or processes may be used to create the same shape and layer or region 204.

[0087] Figure 32 is a diagram illustrating the writing process of a dual printhead assembly using a print / paddle method with two printheads according to an embodiment of the present disclosure, showing two writing cycles, four layers with 1s and 0s written, and the corresponding written code. In particular, the left side shows process 3202 for one writing cycle, which has four writing steps and a cleaning step between each writing step. In the first writing step, the first printhead prints B0A as 1 at a desired spot on the wafer. Next, a cleaning step is performed. The second writing step is a “paddle” writing step, in which the wafer is placed in a bath or immersed in a fluid of B1A and an addition reaction is performed to add 1s without using an inkjet printhead. In this step, any spot not filled with 0s is by definition always 1, and B1A adheres only to spots that B0A did not write to. Next, a cleaning step is performed. Next, in the third writing step, the second printhead prints A0B as 0 at a desired spot on the wafer. Next, a cleaning step is performed. The fourth writing step is the “paddle” writing step, in which the wafer is placed in a bath or immersed in the A1B fluid and an addition reaction occurs, adding 1s without using an inkjet printhead. In this step, any spot not filled with 0s is by definition always a 1, and A1B adheres only to spots that A0B did not write to. This completes one cycle of writing using this technique. Figure 3204 shows the result of the above print / paddle process, showing that for cycle 1, writing steps 1 and 2 have 0s and 1s in the first row, and writing steps 3 and 4 have 0s and 1s in the second row. Each circle represents a cassette, and the 0 / 1 within the circle represents the value of the bit being written (in the case of single-bit binary encoding). As the process is repeated, for cycle 2, another pair of rows is created, as shown in Figure 3204. Figure 3206 above Figure 3204 shows the resulting binary code being written to a memory string. Other variations of the print / paddle (or print / pool) technique may be used.The advantage of this print / paddle process is that one bit is written per cycle. Potential drawbacks of this method are the long cycle time (e.g., about 6 minutes / cycle) and the possibility of crosstalk, but these can be mitigated by performing topological deactivation.

[0088] The embodiments described herein may be carried out using a piezoelectric inkjet printhead, a thermoelectric (or thermal) inkjet printhead, or any other type of inkjet head, provided that they provide desired functionality and performance, including, but not limited to, supplying desired fluid droplets to a wafer, substrate, or shuttle at a desired reaction spot or cell, as described herein. In the case of a thermal inkjet printhead, a small amount of fluid located away from the nozzle may be electronically vaporized, and the vaporized gas increases the pressure inside the head, thereby pushing the fluid out of the nozzle at the opposite end of the head.

[0089] In some embodiments, the corresponding fluid buffers and reagents described herein may be loaded and / or unloaded by fluid equipment attached to, or part of, the inkjet printer system or instrument of this disclosure. Other configurations may be used in the fluid circuit as needed, provided they provide the desired functionality and performance.

[0090] In some embodiments, instead of using printhead nozzles or chambers to perform deblocking / adapter operations, deblocking may be performed on the array using known photo-induced deprotection or deblocking and / or known electrochemical deprotection or deblocking, as described in U.S. Patent Application Publication No. 2021 / 0332351, which is incorporated herein by reference to the extent necessary to understand this disclosure. For electrochemical deprotection or deblocking, such functionality may be provided by adding the necessary electrodes and voltage controls to the array and / or instrument. For photo-induced deprotection or deblocking, such functionality may be provided by adding the necessary light sources and / or mirrors, such as digital micromirror devices (DMDs) and associated components and controls, to the array and / or instrument.

[0091] As used herein, the term “data” includes all forms of data, including addresses (or labels or pointers, whether physical or virtual) that can be stored in memory, any type of machine code (including, but not limited to, object code, executable code, etc.), error checking, cryptography, libraries, databases, stacks, and the like. In certain examples, the term “data” may be shown or described as distinct from “address” or “error checking.” In such cases, these terms may be used for illustrative purposes only to indicate different forms of data.

[0092] The starter DNA (or polymer) strand or string can be loaded by any process that attaches the starter polymer or DNA strand or string to desired spots on a wafer array, provided that the desired functional and performance requirements are met. For example, the starter DNA (or polymer) may be loaded onto the spots before the wafer is placed in an inkjet printer, or it may be loaded onto the spots by an inkjet printer as described herein.

[0093] In some embodiments of the present disclosure, the addition nozzle and the deblock / adapter nozzle may be fluidically connected to one or more respective supply vessels capable of providing the appropriate fluids and enzymes necessary to carry out the addition reaction and the deblock / adapter reaction, as described herein and in the aforementioned co-owned patents and patent applications.

[0094] In some aspects or embodiments, the Disclosure provides a method for writing a code specific to polymer memory strands located on at least one write spot on a wafer array using at least one write printhead, wherein the head or nozzle writes the same code to a plurality of DNA memory strands located on at least one spot, the method comprising loading a starter polymer or DNA attached to a desired spot to be written to, cleaning the surface of the wafer array, and positioning an add-0 or add-1 piezoelectric inkjet nozzle equipped with corresponding add-0 and add-1 reagents on the desired spot to be written. The process includes: discharging droplets of the corresponding Add-0 or Add-1 reagent onto a spot using a piezoelectric inkjet nozzle to write bits or codes to the DNA or polymer memory string (or strand) associated with the spot; cleaning the surface of the spot; discharging droplets of the deblock / adapter reagent onto the spot using a piezoelectric inkjet nozzle; cleaning the surface of the spot; and, once coding onto the memory string at the spot is complete, flowing a separation fluid over the spot to remove the memory string from the spot and flushing the memory string from the spot into a collection container or storage container for later reading.

[0095] In some aspects or embodiments, the Disclosure provides a method for simultaneously writing a code specific to polymer memory strands located on multiple write spots on a wafer array using a plurality of write printheads, each head or nozzle providing a method for writing the same code to a plurality of DNA memory strands located on a given spot, the method comprising loading a starter polymer or DNA onto a desired spot to be written, cleaning the surface of the wafer array, positioning an Add-0 or Add-1 piezoelectric inkjet nozzle equipped with corresponding Add-0 and Add-1 reagents on the desired spot to be written, and applying the corresponding Add-0 to the piezoelectric inkjet nozzle. The process includes: releasing droplets of "0" or additional "1" reagent onto spots to write bits or codes to DNA or polymer memory strings (or strands) associated with the spots on the wafer array; cleaning the surface of the wafer array; releasing droplets of deblock / adapter reagent onto spots using a piezoelectric inkjet nozzle; cleaning the surface of the wafer array; and, once coding has been completed for all memory strings at all spots on the wafer array, cleaning the surface of the wafer array with a separation fluid to remove the memory strings from the spots and flushing the memory strings from the wafer array into a collection container or storage container for later reading.

[0096] In some embodiments, the method includes simultaneously writing code specific to polymer memory chains located on multiple write spots on a wafer array using multiple write printheads.

[0097] In some embodiments, spots are patterned on a wafer array using pillars surrounded by circular channels. In some embodiments, the pillars have regions of HfO2 for attaching starter polymers or DNA strands.

[0098] In some embodiments, the method further includes the step of cleaning the wafer array with a prepared fluid before the starter chain is attached to the spots. Also in some embodiments, cleaning may be performed by flowing the cleaning fluid through an input port or manifold fluidically connected to one side of the wafer array, allowing the fluid to flow across the wafer surface and out through an output port or manifold on the opposite side of the wafer. Also in some embodiments, cleaning may be performed by providing a cleaning printhead equipped with nozzles that discharge a predetermined amount of cleaning fluid to each desired spot on the wafer array surface.

[0099] In some embodiments, the starter chain or string may be loaded and attached to spots by providing a cleaning printhead equipped with nozzles that dispense a predetermined amount of the starter chain in a fluid to each desired spot on the wafer array surface.

[0100] In some embodiments, the starter string adheres to the spot, is then dried, and subsequently rehydrated before use in an inkjet printer. In some embodiments, after writing the code, the coded polymer adhering to the spot on the array is dried and stored, then rehydrated to remove it, and then read or stored.

[0101] Furthermore, in some embodiments, the method includes evaluating the printing density using a unique molecular identifier (UMI). For example, the repeating of addition cycles using multiple different oligomers randomly added to the chain in each addition generates diverse sequences, and the sequence diversity increases exponentially with each cycle. Thus, if four different oligomers are randomly added in each cycle, there will be four different chain types after one cycle, sixteen different chain types after two cycles, and so on. After 10 cycles, the number of sequences will exceed one million (4 10 ), after 25 iterations, the number of elements in the array is 10 15exceeds it. If the number of possible arrays exceeds the number of DNA molecules, each molecule is predicted to have a unique array and thus has a UMI. Then, the DNA sequences can be released from the substrate, and the number of unique DNA sequences separated from the printed surface area can be quantified, such as the area of the substrate strand, e.g., per um 2 per, or an approximate number of DNA strands per dot on the substrate carrying the receptor strand can be obtained. For example, when grafting a cycloalkyne-functionalized (ADIBO or DBCO-functionalized) receptor strand onto an azide-functionalized substrate at a concentration of 1 nM, (repeatedly adding a random combination of oligomers to obtain diverse arrays to extend the DNA strand), by UMI analysis, approximately 340 DNA molecules / um 2 can be obtained. At a concentration of 5 nM, approximately 740 DNA molecules / um 2 can be obtained by UMI analysis. At a concentration of 10 nM, approximately 1100 DNA molecules / um 2 can be obtained by UMI analysis. At a concentration of 25 nM, approximately 2900 DNA molecules / um 2 can be obtained by UMI analysis. At a concentration of 100 nM, approximately 8500 DNA molecules / um 2 can be obtained. This analysis is useful for quantifying the number of molecules per nanowell and evaluating the bias / error of PCR amplification.

[0102] Topoisomerase ligation In certain embodiments, DNA strands are synthesized using topoisomerase-mediated ligation of DNA oligomers or cassettes. Topoisomerases are enzymes that spontaneously recognize and separate at least one strand of a double helix of nucleic acid within a sequence segment known as a site-directed recombination sequence. For example, vaccinia topoisomerase is a type I DNA topoisomerase with the ability to cleave the 3' of the DNA strand of its recognition sequence 5'-(C / T)CCTT-3', e.g., 5'CCCTT3', and then rejoin or rejoin the DNA. SFV topoisomerase I recognizes the same sequence as vaccinia topoisomerase, 5'-(C / T)CCTT-3', and can also recognize the variant sequence 5'-CCCTG-3'. Oligonucleotide cassettes containing digital information can be linked together by topoisomerase. In this method, the DNA base cassette contains a topoisomerase recognition sequence, which allows the topoisomerase to "load" it, causing the DNA strand to be enzymatically separated and temporarily covalently bound to the topoisomerase at its 3-terminus. Once a suitable DNA receptor is found, the topoisomerase ligates the cassette to the DNA receptor strand in a process called "bit addition" or "topogation." After ligating the DNA cassette to the DNA receptor strand, the topoisomerase is no longer bound to the DNA. The DNA thus formed can then serve as a base for further additions if its 5' end is not protected. This allows for more additions to the receptor DNA than oligomers in each addition cycle. The 5' end of oligonucleotides can be protected, for example, by a 5' phosphate, preventing more additions than oligomers in each addition cycle. The ability of the 5'-phosphate on the "receptor" DNA to inhibit the addition reaction is strong enough that the elongating receptor DNA strand with a 5' phosphate cannot ligate to the topo-loaded cassette until it is exposed to a phosphatase that removes the 5' phosphate.

[0103] U.S. Patent Application Publication No. 20210262023, which is incorporated herein by reference in its entirety, describes a method for synthesizing DNA in the 3' to 5' direction using a topoisomerase. In this method, a DNA molecule is synthesized by adding a single nucleotide or oligomer to a DNA strand in the 3' to 5' direction using topoisomerase-mediated ligation, and the method includes (i) reacting the DNA molecule with a topoisomerase loaded with the desired nucleotide or oligomer so that the nucleotide or oligomer is blocked from further addition at the 5' end, and then (ii) deblocking the 5' end of the DNA thus formed, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained. For example, by using only two different oligonucleotides or two different single nucleotides, a DNA sequence embodying a binary code can be formed, providing a compact information storage means. DNA encoding ternary codes or DNA encoding genetic information can be synthesized in a similar manner.

[0104] In the embodiments described in U.S. Patent Application Publication No. 20210262023, the 5' end of the DNA base cassette is protected, for example, by a 5' phosphate group, so that the DNA formed by topogation cannot function as a substrate for further additions until its 5' end is deprotected, thus preventing uncontrolled additions of multiple cassettes. The DNA is deprotected before the next addition, for example, by being exposed to a phosphatase if the protecting group is a 5'-phosphatase, to remove the protecting group.

[0105] U.S. Provisional Patent Application No. 63 / 369,339, filed on 25 July 2022, which is incorporated herein by reference in its entirety, describes a phosphatase-free method of topoisomerase-mediated DNA synthesis in which the DNA cassette attached to the receptor DNA strand contains an overhang and can only be attached by a cassette having a complementary overhang, as shown in Figures 21 and 22. By using a double-stranded oligomer having 5' overhangs on both strands, the need for a deprotection step is eliminated. It has been found that if the 5' overhang of the receptor DNA is not complementary to the 5' overhang of the strand ("bottom strand") of the double-stranded donor oligomer that is complementary to the strand carrying the topoisomerase, the receptor DNA cannot ligate to the topo-loaded oligomer, even if the 5' end of the receptor DNA is not protected, e.g., not phosphorylated. Based on this finding, the inventors have developed a method for synthesizing DNA by topoisomerase-mediated ligation without protection / deprotection steps by using a double-stranded oligomer having 5' overhangs on both strands, where the two overhangs are not complementary and the 5' end of the oligomer is not protected, for example, not phosphorylated.

[0106] Figure 21 shows a schematic diagram of "bit addition" or "topogation" that does not contain phosphatase. In the schematic diagram shown in Figure 21, the 5' end of the oligomer is unprotected, for example, unphosphorylated. Oligomer 1, a topoloaded oligomer, is reacted with receptor DNA 1. Oligomer 1 has a 5' overhang (type A) on the strand carrying the topoisomerase ("upper strand") and a 5' overhang (type B) on the strand complementary to the topoisomerase-carrying strand ("bottom strand"). In this disclosure, the 5' overhang of oligomer 1 is denoted as "type AB". The 5' overhang of receptor DNA 1 is complementary to the 5' overhang (type B) of the bottom strand of oligomer 1. The 5' overhang of receptor DNA 1 is denoted as "type B". Note that the type B overhang of receptor DNA1 is complementary (but not identical) to the type B overhang of the bottom strand of oligomer 1. For example, if the sequence of the type B overhang of the bottom strand is 3'-GCCG-5', then the sequence of the type B overhang of the top strand is 5'-CGGC-3'. Since the 5' overhang of the bottom strand of oligomer 1 is complementary to the 5' overhang of the top strand of receptor DNA1, oligomer 1 is ligated to receptor DNA1 to form receptor DNA2. The 5' overhang (type A) of the top strand of the DNA thus formed is not complementary to the 5' overhang (type B) of the bottom strand of oligomer 1. Therefore, in the first cycle of bit addition, the 5' end of the DNA thus formed (receptor DNA2) is not protected, but no additional oligomers can be added to receptor DNA2. In cycle 2, a topographically loaded oligomer with a type BA 5' overhang is added. The 5' overhang (type A) of the bottom strand of oligomer 2 is complementary to the 5' overhang (type A) of the top strand of receptor DNA 2. Therefore, oligomer 2 ligates to receptor DNA 2 to form receptor DNA 3. The 5' overhang of the top strand of the DNA thus formed (receptor DNA 2) is type B and is not complementary to the 5' overhang (type A) of the bottom strand of oligomer 2. Consequently, no additional oligomers can be added to receptor DNA 3 in the second cycle of bit addition.This process can be repeated until the desired nucleotide sequence is obtained. In this way, only one oligomer is added to the receptor DNA in each bit addition cycle without a protection / deprotection step.

[0107] The upper chain of the oligomer carrying the topoisomerase includes a 5' overhang, an information sequence, and a topoisomerase recognition sequence, e.g., 5'-(C / T)CCTT-3'. The 3' end of the upper chain is covalently bonded to the topoisomerase. The upper and bottom chains of the oligomer are complementary to each other, except for the 5' overhangs at the ends of both chains. The DNA polymer synthesized by the method of the present invention includes a series of information sequences, each of which is in contact with one of the topoisomerase recognition sequences and 5' overhang sequences on both sides. In some embodiments, the DNA polymer is designed to store data. In some embodiments, the data is stored in binary code (1s and 0s). In some embodiments, a readily recognizable sequence of two or more bases (e.g., 5'-CCG-3') corresponds to 1, and another readily recognizable sequence of two or more bases (e.g., 5'-AAA-3') corresponds to 0. In other embodiments, the data can be stored in ternary, quaternary, or other codes.

[0108] For data stored in binary code (1s and 0s), DNA polymers can be synthesized using four oligomers: A0B, B0A, A1B, and B1A. The "A" or "B" at the left and right ends indicate the type of oligomer overhang. The "0" or "1" indicates the binary code corresponding to the oligomer's information sequence. For example, A0B: GCCG GGCCTCGAAACCCTT * CCGGAGCTTTGGGAAGCCGp[Sequence ID 1] A1B: GCCG GGCCTCGCCGCCCTT * CCGGAGCGGCGGGAAGCCGp[Sequence ID 2] B0A: CGGC CTCGACGAAACCCTT * GAGCTGCTTTGGGAACGGCp[Sequence ID 3] B1A: CGGC CTCGACGCCGCCCTT * GAGCTGCGGCGGGAACGGCp[Sequence No. 4] In this example, the information sequence (in this case, AAA corresponds to "0" and CCG corresponds to "1", but almost any sequence will do) is shown in bold, the topoisomerase recognition domain (in this case, 5'-CCCTT-3') is shown in italics, the 5'-overhang (in this case, the "A" sequence is CGGC and the "B" sequence is GCCG) is underlined, and the topoisomerase enzyme is indicated by an asterisk (*). Addition to the receptor DNA proceeds as shown in Figure 21.

[0109] Figure 22 shows a schematic diagram of the phosphatase-free topoisomerase-mediated synthesis of a DNA polymer that stores the binary information "10110". Type AB or type BA topo-loaded oligomers are alternately added to the elongating receptor DNA. In the example shown in Figure 22, type AB topo-loaded oligomers are added in the 1st, 3rd, and 5th bit additions, and type BA topo-loaded oligomers are added in the 2nd and 4th bit additions. Which topo-loaded oligomer is added in any given bit addition is determined by the binary information stored at that position. For example, to store the bit information "1" at the 3rd position, the topo-loaded oligomer A1B is added to the elongating receptor DNA in the 3rd bit addition. In some embodiments, the oligomer is selected from four oligomers, for example A0B, B0A, A1B, B1A, where the "A" or "B" at the left and right ends indicates the type of oligomer overhang, and "0" or "1" indicates the binary code corresponding to the oligomer's information array. The information density can be increased by using oligomers containing two or more bits, for example, eight different oligomers can realize all possible two-bit additions, A00B, A01B, A10B, A11B, B00A, B01A, B10A, B11A.

[0110] In this AB / BA method, as shown in Figures 21 and 22, the information-containing "AB" reagent can only be added to chains having a "B" complementary end, and the "BA" reagent can only be added to chains having an "A" complementary end, thus enabling a "print / paddle" method using only two inkjet printers, as shown in Figure 32. For example, in some embodiments, a first cassette, e.g., one of A0B or A1B, is printed on a desired spot, and then the substrate is paddled (i.e., completely washed, immersed, or coated) using a second cassette, e.g., the other of A0B or A1B, to add the other cassette to all areas that were not covered in the first printing step. For example, in Figure 32, an inkjet is used to deposit a loaded topoisomerase with a B0A cassette onto a specific spot, wash it, and then the entire surface is exposed to a loaded topoisomerase with a B1A cassette and washed by paddle. The "B1A" cassette does not react with chains that have already been covered with the B0A cassette. Next, using an inkjet, a loaded topoisomerase equipped with an A0B cassette can be deposited onto specific spots, washed, and then the entire surface can be exposed to a loaded topoisomerase equipped with an A1B cassette and washed using a paddle. The process of printing with the first AB reagent, washing, paddle with the second AB reagent, washing, printing with the first BA reagent, washing, paddle with the second BA reagent, and washing can be repeated until the desired sequence is obtained. This method allows the use of only two inkjet printers (in the example shown in Figure 32, one dispensing topoisomerase loaded with B0A and the other dispensing topoisomerase loaded with A0B).

[0111] Using a print / paddle technique, gap errors, i.e., DNA strands formed at sites between desired print spots that could contaminate the desired DNA strand population on the print spots, can be reduced. For example, in one embodiment, all print spots are printed with a first cassette, e.g., AB, and then the substrate is paddled with a non-amplifying / non-extending cassette, e.g., "AxB," so that all locations on the substrate that were not subjected to the first cassette (i.e., any strands in gap locations that are not on the desired "print" spots) are prevented from further extension (i.e., capping) by the "AxB" cassette.

[0112] In some embodiments, the “print / paddle” method may use the same or different ink compositions in the printing and paddle steps. In some embodiments, the printing ink has a higher viscosity than the paddle ink. For example, in one embodiment, the printing ink comprises 10% PEG8000, 10% glycerol, 500 mM ammonium acetate (NH4Ac), 20 mM Tris (pH 8.0), and DNA loading topoisomerase, e.g., 2.5 μM loading topoisomerase, while the paddle ink comprises 5% PEG8000, 500 mM NH4Ac, 20 mM Tris (pH 8.0), and DNA loading topoisomerase, e.g., 0.5 μM loading topoisomerase. In some embodiments, the printing and / or paddle ink further comprises an inert dye, e.g., 0.1% or less saturated water-soluble inert dye, for visualization.

[0113] In some embodiments, DNA-loaded topoisomerase in printing and / or paddle inks contains terminal phosphate groups during storage and removes them before use. Without being bound by theory, it is believed that including terminal groups in the topoisomerase-binding DNA oligomers improves the stability of the loaded topoisomerase and prevents undesirable reactions / polymerization during ink storage. To remove terminal phosphate groups from the topoisomerase-binding DNA oligomers before use of the printing and / or paddle ink (i.e., to "activate" the loaded topoisomerase), magnesium chloride (MgCl2), e.g., 100 μM MgCl2, and phosphatase, e.g., calf intestinal phosphatase (CIP) and / or shrimp alkaline phosphatase (SAP), e.g., 10 μg of phosphatase per 2.5 nmol of topoisomerase, are added to the ink. In some embodiments, the inks are mixed and filtered before being added to the printhead.

[0114] By using A0B and A1B to provide "0" or "1", and using the BA adapter to provide a "deprotection" function for the DNA strand after the addition of A0B or A1B, the number of oligomers required to provide the binary code can be reduced to just three. After the addition of the oligomer bit, the strand end receives the "BA" adapter, thereby creating another "B" 5' overhang, which can then receive either the A0B or A1B oligomer bit. In other words, the adapter cassette can modify the "end" and topogate with either of the two bits, a process conceptually similar to the synthesis described in U.S. Patent Application Publication No. 20210262023, but instead of removing phosphate for the deprotection of the receptor strand, an adapter oligomer is added to provide a suitable sequence overhang for the subsequent bit addition, using the exemplary A0B and A1B sequences described above, as well as, for example, the BA adapter. A0B: GCCG GGCCTCGAAACCCTT * CCGGAGCTTTGGGAAGCCGp[Sequence ID 1] A1B: GCCGGGCCTCGCCGCCCTT * CCGGAGCGGCGGGAAGCCGp[Sequence ID 2] BA adapter: CGGCCTCGACGCCCTT * GAGCTGCGGGAACGGCp[Sequence ID 5]

[0115] For example, using this technique in an inkjet synthesis system requires only two jets. If A0B is loaded into the first nozzle and A1B into the second nozzle, after depositing the selected cassette (A0B or A1B), the substrate is rinsed with buffer, then with a buffer solution containing the BA adapter, and then rinsed again with buffer to remove the BA adapter. After that, the selected second cassette is added, and this procedure is continued until the desired arrangement is reached.

[0116] In certain embodiments, a method for synthesizing DNA involves treating the DNA with a ligase and ATP. The topoisomerase binds only one side of the DNA together (the other side is essentially cleaved). The ligase repairs the cleavage, preventing the topoisomerase itself from re-cleaving and separating the reaction product. In some embodiments, the ligase and ATP are provided in each addition cycle. In other embodiments, the ligase and ATP are provided after the desired nucleotide sequence has been obtained. In yet another embodiment, the cleavage is not repaired. Single-stranded DNA may be preferred as the final product. Single-stranded DNA ("top strand") can be obtained by dehybriding double-stranded DNA and removing the strand consisting of unbound oligomeric fragments, i.e., the strand with cleavage ("bottom strand").

[0117] In some embodiments, the method involves inhibiting the binding and activity of free topoisomerase to DNA oligomers using a topoisomerase inhibitor. Suitable inhibitors include novobiosin and cumermycin. It should be noted that complete inhibition is undesirable, as low levels of topoisomerase activity can help "relax" coiled DNA, which is particularly useful when synthesizing long DNA strands.

[0118] Topoisomerase ligation reagent and compatible "ink" media Significant technical challenges exist in designing carrier media or "inks" for supplying topoisomerase ligation reagents. Firstly, the medium must be compatible with the reaction, must not denature the topoisomerase, must allow for a relatively fast ligation reaction rate, and must not damage DNA. Secondly, the medium must be compatible with inkjet nozzles, for example, capable of forming consistent droplets quickly and reliably without causing jet clogging. Thirdly, it must possess physical properties that allow the reaction to proceed once the droplet is transferred to the reaction surface. Viscosity, surface tension, density, and printhead dimensions affect not only the fluid flow crucial for supplying droplets but also the forces on the enzyme. Topoisomerase activity can also be affected by the concentration and pH of the reagents and ions, and droplets must not diffuse or evaporate excessively rapidly, as this can also affect topoisomerase activity.

[0119] Printing using piezoelectric nozzles requires a medium with a certain degree of viscosity, such as approximately 5–14 cP. Viscosity for this purpose is measured at room temperature (although heating is possible as the topoisomerase enzyme is very robust, inkjet printing experiments are also performed at room temperature without heating the ink or substrate). Viscosity is measured in the following examples using a TA Instruments® Discovery® HR-30 hybrid rheometer or a RheoSense m-VROC viscometer. The medium may include solvents such as glycerol, ethylene glycol, or diethylene glycol, as well as low molecular weight polymers such as polyvinyl alcohol, polyethylene glycol, polypropylene glycol, sodium carboxymethylcellulose (CMC), hydroxyethylcellulose, sodium alginate, hyaluronic acid, or carrageenan. In one embodiment, the medium contains PEG8000 at a concentration of, for example, 10%–15%. For example, the buffer medium may be 10% PEG8000, 0.6 M NaCl, and 10 mM Tris (pH 8.0).

[0120] In some embodiments, the buffer medium may include a nonionic surfactant, such as tween 20. For example, the buffer medium may include 10% PEG8000, 0.6 M NaCl, 10 mM Tris (pH 8.0), and 0.1% tween, such as tween 20.

[0121] In some embodiments, the buffer medium may use an organic salt instead of NaCl, such as sodium acetate (NaOAc), for example the buffer medium may contain 12% PEG8000, 0.6 M NaOAc, 10 mM Tris (pH 8.0), and 0.1% Tween. In alternative embodiments, the buffer medium may use an organic ammonium salt instead of NaCl, such as ammonium acetate (NH4Ac), for example the buffer medium may contain 10% PEG8000, 10% glycerol, 500 mM ammonium acetate, 20 mM Tris (pH 8.0), 100 μM MgCl2, and optionally 0.1% of the following saturated water-soluble inert dye for visualization.

[0122] To slow evaporation, a wetting agent, such as glycerol, ethylene glycol, or pentanediol, may be added in amounts ranging from 1 to 20%, for example, 5% glycerol or 10% glycerol.

[0123] After each cassette is added, the substrate is washed with a buffer to remove the reagents. The buffer may contain a nonionic surfactant, such as tween (e.g., 1M NaCl / 0.05% tween) washing buffer, and washing can be repeated to ensure all reagents are removed, followed by a final wash with a surfactant-free buffer.

[0124] In one embodiment, the invention is a method for synthesizing DNA polymers using topoisomerase-mediated ligation (Method 1), (i) Reacting double-stranded receptor DNA attached to a substrate with a topoisomerase loaded with double-stranded DNA oligomers (i.e., oligomers covalently bound to the topoisomerase at the 3' end of the strand), The receptor DNA strand has a 5' overhang. The oligomer optionally includes an information sequence, a topoisomerase recognition sequence, and a 5' overhang on both strands. The 5' overhang of the oligomer strand that does not support topoisomerase ("bottom strand") is complementary to the 5' overhang of the receptor DNA, but not to the 5' overhang of the oligomer strand that supports topoisomerase ("top strand"). The 5' end of the oligomer's topoisomerase-carrying strand ("upper strand") and the 5' end of the receptor DNA are not protected, for example, they are not phosphorylated (i.e., 5'-OH), The topoisomerase loaded with double-stranded DNA oligomers is supplied to the receptor strand position by a piezoelectric inkjet nozzle, and (ii) The extended receptor DNA is reacted with a topoisomerase loaded with further double-stranded DNA oligomers, Further oligomers may optionally include an information sequence that is the same as or different from any information sequence in the oligomer of step (i), a topoisomerase recognition sequence, and 5' overhangs on both strands. The 5' overhang of the additional oligomer strand that does not carry topoisomerase ("bottom strand") is complementary to the 5' overhang of the extended receptor DNA, but not to the 5' overhang of the additional oligomer strand that carries topoisomerase ("top strand"). The 5' end of the chain carrying the topoisomerase of the further oligomer ("upper chain") is unprotected, for example, not phosphorylated (i.e., 5'-OH), and (iii) Repeating steps (i) and (ii) until a desired nucleotide sequence is obtained.

[0125] For example, the invention provides the following: 1.1. Method 1, comprising providing a ligase and ATP to seal a cleavage site in DNA [Note: Topoisomerase ligation ligates only one strand]. 1.2. Ligase and ATP are provided in step (i) and step (ii) of Method 1.1. 1.3. Ligase and ATP are provided after the desired nucleotide sequence has been obtained, method 1.1. 1.4. The topoisomerase loaded with the double-stranded DNA oligomer in step (i) and step (ii) is supplied in a buffer containing a viscosity modifier, e.g., reagent 1 and any of the following reagents, in any of the aforementioned methods. 1.5. The topoisomerase loaded with the double-stranded DNA oligomer in step (i) and step (ii) is supplied in a buffer containing a viscosity modifier, the viscosity modifier being selected from polyethylene glycol (PEG), glycerol, sodium carboxymethylcellulose, and combinations thereof, e.g., PEG8000 or a combination of PEG8000 and glycerol, as described above. 1.6. The viscosity modifier comprises 5% to 15%, for example, PEG8000 at a concentration of about 10%, as described above. 1.7. The viscosity modifier further comprises 5% to 15%, for example, about 10% glycerol, in the manner described above. 1.8. The topoisomerase loaded with the double-stranded DNA oligomer in step (i) and step (ii) is supplied in a buffer containing a viscosity modifier, the buffer further comprising a salt selected from NaCl, e.g., about 0.6 M NaCl, NaOAc, e.g., about 0.6 M NaOAc, and / or NH4Ac, e.g., about 500 mM NH4Ac, as in any of the aforementioned methods. 1.9. The topoisomerase loaded with the double-stranded DNA oligomer in step (i) and step (ii) is supplied in a buffer containing a viscosity modifier, the buffer further comprising a nonionic surfactant, such as tween, as described above. 1.10. The topoisomerase loaded with double-stranded DNA oligomers in steps (i) and (ii) was supplied in a buffer containing a viscosity modifier, the buffer being (i) 10% PEG8000, 0.6 M NaCl, 10 mM Tris (pH 8.0), (ii) 10% PEG8000, 0.6 M NaCl, 10 mM Tris (pH 8.0), 0.1% Tween, (iii) 12% Any of the aforementioned methods comprising: (iv) PEG8000, 0.6 M NaOAc, 10 mM Tris (pH 8.0), 0.1% Tween, (iv) 10% PEG8000, 10% glycerol, 500 mM NH4Ac, 20 mM Tris (pH 8.0), 100 μM MgCl2, (v) 5% PEG8000, 500 mM NH4Ac, 20 mM Tris (pH 8.0), 100 μM MgCl2. 1.11. Any of the aforementioned methods further comprising one or more rinsing steps, for example, using a buffer solution, after step (i) and after step (ii). 1.12. The above method, wherein one or more rinsing steps after step (i) and step (ii) include first rinsing with a buffer solution containing, for example, 1 M NaCl and a surfactant containing 0.05% tween, and then rinsing with a buffer solution without a surfactant, for example, one or more rinsing steps after step (i) and step (ii) include first rinsing with a buffer containing 1 M or more NaCl and optionally an anionic surfactant, for example sodium dodecyl sulfate (SDS), to denature any remaining enzyme, and then rinsing with a diluted buffer solution without a surfactant. 1.13. Any of the aforementioned methods further comprising one or more rinsing steps after step (i) and after step (ii), wherein one or more rinsing steps after step (i) and after step (ii) comprises rinsing first with a surfactant, e.g., a solution containing 1% SDS in water, and then rinsing with a surfactant-free buffer solution, e.g., 20 mM Tris (pH 8.0), for example, one or more rinsing steps after step (i) and after step (ii) comprises rinsing first with a surfactant-containing solution, e.g., to denature any remaining enzyme, and then rinsing with a surfactant-free buffer solution, e.g., 20 mM Tris (pH 8.0), and optionally drying the sample (and any part or all of any associated substrate) between the rinsing steps. 1.14. The topoisomerase loaded with further double-stranded DNA oligomers in step (ii) is supplied to the receptor strand position by a piezoelectric inkjet nozzle, as described above. 1.15. Any of the aforementioned methods other than the method of 1.14, wherein topoisomerase loaded with further double-stranded DNA oligomers in step (ii) is supplied to the receptor strand location by paddle (i.e., complete washing, immersion, or coating) the substrate with a reagent containing topoisomerase loaded with further double-stranded DNA oligomers. 1.16. A topoisomerase-loaded double-stranded DNA oligomer has the following structure, as described above. 5'-<overhang><information array><topo recognition array>* 3'<-----------------Complementary Chain------------------------------><Overhang>-5' * is a topoisomerase covalently bonded to the 3' end of the upper chain. 1.17. The topoisomerase is selected from vaccinia topoisomerase I and SFV topoisomerase I, and optionally, the topoisomerase is vaccinia topoisomerase I, as in any of the aforementioned methods. 1.18. The topoisomerase recognition sequence is 5'-(C / T)CCTT-3' or 5'-CCCTG-3', and optionally, the topoisomerase recognition sequence is 5'-CCCTT-3', as described above. 1.19. A topoisomerase-loaded double-stranded DNA oligomer has the following structure, as described above. 5'-<overhang><information array>CCCTT* 3'<----Complementary Strand----->GGGAA<Overhang>-5' * is a topoisomerase covalently bonded to the 3' end of the upper chain. 1.20. The information array of the oligomer is selected from at least two different arrays, and optionally, the information array of the oligomer is selected from two different arrays, for example, one array corresponding to "0" in binary code and the other corresponding to "1", in any of the aforementioned ways. 1.21. The information sequence is a sequence of 3 to 12 nucleotides, for example, approximately 8 nucleotides, in any of the aforementioned methods. 1.22. The 5' overhang sequence of the chain complementary to the oligomer topoisomerase-carrying chain ("bottom chain") is selected from at least two different sequences, and optionally, the 5' overhang sequence of the bottom chain is selected from two different sequences, in any of the aforementioned methods. 1.23. The 5' overhang sequence of the oligomer topoisomerase-carrying chain ("upper chain") is selected from at least two different sequences, and optionally, the 5' overhang sequence of the oligomer topoisomerase-carrying chain ("upper chain") is selected from two different sequences, in any of the aforementioned methods. 1.24. The 5' overhang of the oligomer is a sequence of 2 to 6 nucleotides, and optionally the 5' overhang is a sequence of 4 nucleotides, in any of the aforementioned methods. 1.25. The oligomer is selected from four oligomers: A0B, B0A, A1B, B1A, where the "A" or "B" at the left and right ends indicates the type of oligomer overhang, and the "0" or "1" indicates the binary code corresponding to the oligomer's information array, in any of the aforementioned ways. 1.26. The oligomer is selected from three oligomers: A0B, A1B, and BA, where the "A" or "B" at the left and right ends indicates the type of oligomer overhang, and "0" or "1" indicates a binary code corresponding to the oligomer's information sequence, and BA is an adapter oligomer, for example, a receptor chain receives a topoisomerase-binding oligomer A0B or A1B, where the "A" or "B" at the left and right ends indicates the type of oligomer overhang, and "0" or "1" indicates a binary code corresponding to the oligomer's information sequence, and the receptor chain is then fitted to the adapter oligomer BA, which binds to the terminal A0B or A1B, enabling the addition of further A0B or A1B, in any of the aforementioned methods. 1.27. The oligomer is selected from the eight oligomers: A00B, A01B, A10B, A11B, B00A, B01A, B10A, B11A, in any of the aforementioned ways, where the "A" or "B" at the left and right ends indicates the type of oligomer overhang, and "0" or "1" indicates the binary code corresponding to the oligomer's information array. 1.28. Any of the aforementioned methods, comprising the use of a topoisomerase inhibitor to suppress the binding and activity of free topoisomerase to DNA oligomers, wherein the inhibitor is optionally selected from novobiosin and cumermycin. 1.29. Any of the aforementioned methods, wherein the receptor DNA is located on a substrate or magnetic beads and can be selectively exposed to or removed from a reagent as necessary to achieve a desired sequence. 1.30. Any of the aforementioned methods, including the alternating addition of information oligonucleotides and adapter oligonucleotides, for example, the method is: (i) Reacting double-stranded receptor DNA with a topoisomerase-loaded double-stranded DNA oligomer having the structure of formula 1 below, 5'-HO-<Overhang A><Information Array><Topo Recognition>* 3'<---------------------Complementary Strand---------------><Overhang A>P-5' * is a topoisomerase covalently bonded to the 3' end of the upper chain. The information sequence may be modified, for example, by selecting from two different sequences and providing a binary code to the synthesized DNA sequence. "Topo recognition" refers to the topoisomerase recognition sequence, e.g., 5'-(C / T)CCTT-3' or 5'-CCCTG-3', e.g., 5'-CCCTT-3'. The receptor DNA strand has a 5' overhang containing a sequence complementary to overhang A (overhang B). The complementary strand refers to a sequence that is complementary to "<information sequence 0 or 1><topo recognition>", P is phosphoric acid, The 5' end of receptor DNA is not protected, for example, it is not phosphorylated (i.e., 5'-OH), Formula 1 may optionally include, in addition to the specifically identified region, a region of one or more spacer nucleotides. As a result, the double-stranded DNA oligomer extends the double-stranded receptor DNA in the 3' to 5' direction, including the unprotected overhang (i.e., 5'-OH) which is overhang A, and topoisomerase is released. (ii) Reacting the thus extended double-stranded receptor DNA with a topoisomerase-loaded double-stranded DNA oligomer having the structure of the following formula 2, 5'-HO-<Overhang B><Topo Recognition>* 3'<--Complementary chain---><Overhang B>P-5' * is a topoisomerase covalently bonded to the 3' end of the upper chain. "Topo recognition" refers to the topoisomerase recognition sequence, e.g., 5'-(C / T)CCTT-3' or 5'-CCCTG-3', e.g., 5'-CCCTT-3'. Overhang B is complementary to overhang A mentioned above. The complementary strand refers to a sequence that is complementary to the "<topo-recognition sequence>". P is phosphoric acid, Equation 2 may optionally include, in addition to the specifically identified region, a region of one or more spacer nucleotides. As a result, the double-stranded DNA oligomer extends the double-stranded receptor DNA in the 3' to 5' direction, accompanied by an unprotected overhang (i.e., 5'-OH) which is overhang B, and topoisomerase is released. (iii) Repeating steps (i) and (ii) as necessary, modifying the information sequence in the oligonucleotide sequence of step (i) until a desired nucleotide sequence is obtained. 1.31. Method 1.27, comprising providing ligase and ATP to seal the DNA cleavage site [Note: topoisomerase ligation ligates only one strand], for example, ligase and ATP are provided in step (i) and step (ii), and / or ligase and ATP are provided after the desired nucleotide sequence has been obtained. 1.32. The topoisomerase is selected from vaccinia topoisomerase I and SFV topoisomerase I, and optionally, the topoisomerase is vaccinia topoisomerase I, as in any of the aforementioned methods. 1.33. The topoisomerase recognition sequence is 5'-(C / T)CCTT-3' or 5'-CCCTG-3', as described above. 1.34. The topoisomerase recognition sequence is 5'-CCCTT-3', as described above. 1.35. In step (i), the information array is selected from at least two different arrays, and optionally, the information array is selected from two different arrays, for example, one array corresponding to "0" in binary code and the other corresponding to "1", in any of the aforementioned ways. 1.36. The information sequence is a sequence of 3 to 12 nucleotides, for example, approximately 8 nucleotides, in any of the aforementioned methods. 1.37. The 5' overhang of the oligomer is a sequence of 2 to 6 nucleotides, and optionally the 5' overhang is a sequence of 4 nucleotides, in any of the aforementioned methods. 1.38. Any of the aforementioned methods, comprising the use of a topoisomerase inhibitor to suppress the binding and activity of free topoisomerase to DNA oligomers, wherein the inhibitor is optionally selected from novobiosin and cumermycin. 1.39. Once the desired sequence is obtained, the DNA is released from the substrate by, for example, a separation reagent, for example, an endonuclease specific to the site of the original receptor strand, and the DNA is collected by any of the aforementioned methods. 1.40. The substrate is a silicon wafer, in any of the aforementioned ways. 1.41. Double-stranded receptor DNA was attached to the substrate via strain-promoting azide-alkyne cycloaddition (SPAAC), as described above. 1.42. Double-stranded DNA receptors attach to phosphonate groups via SPAAC reactions, such as the reaction of azide with azodibenzocyclooctin (ADIBO) or dibenzocyclooctin (DBCO), for example, the following attachments: [ka] The phosphonate group is attached to a metal oxide substrate, for example, hafnium oxide or silica, and linker 1 and linker 2 are alkyl linkers containing one or more hydroxyl groups, ether groups, ester groups, amine groups, or amide groups, as shown in Figure 4 or Figure 26A, as in any of the aforementioned methods. 1.43. Any of the aforementioned methods, wherein the substrate contains regions of a DNA receptor chain separated by hydrophobic regions, such as hydrophobic regions coated with perfluorinated alkyl groups, as shown, for example, in Figures 23A and 23B. 1.44. The strand density of DNA molecules in the DNA receptor strand region is um 2 100 to 10,000 chains per unit, for example, um 2 Any of the aforementioned methods, with 500 to 2500 chains per unit. 1.45. The substrate is substantially flat, in any of the aforementioned ways. 1.46. Reagents containing loaded topoisomerase are reagent 1 and any of the above methods selected from one or more of the following:

[0126] In another embodiment, the Disclosure provides a reagent (Reagent 1) comprising a topoisomerase loaded with a double-stranded DNA oligomer in a buffer solution containing a viscosity modifier, for use, for example, in the above method. For example, the Disclosure provides the following: a) Reagent 1, solution having a viscosity of 5-14 cP. b) Reagent 1, the viscosity modifier comprising one or more of polyethylene glycol (PEG), such as PEG8000, glycerol, and sodium carboxymethylcellulose. c) Any of the aforementioned reagents, including polyethylene glycol, as a viscosity modifier. d) Any of the aforementioned reagents, including glycerol, as a viscosity modifier. e) Any of the aforementioned reagents, comprising glycerol and polyethylene glycol, as a viscosity modifier. f) Any of the aforementioned reagents, comprising glycerol and PEG8000, as a viscosity modifier. g) Any of the aforementioned reagents, comprising a viscosity modifier of PEG8000 in a concentration of 5% to 15%, for example, about 10% or 12%, and glycerol in a concentration of 0% to 15%, for example, about 10%. h) Any of the aforementioned reagents, comprising approximately 10% PEG8000 and approximately 10% glycerol as a viscosity modifier. i) The reagent further comprises any of the aforementioned reagents, for example, NaCl, for example 0.6 M NaCl, NaOAc, for example 0.6 M NaOAc, and / or NH4Ac, for example 500 mM NH4Ac. j) The buffer solution is any of the aforementioned reagents having a pKa of 7-9 at 25°C. k) The buffer solution is tris(hydroxymethyl)aminomethane (Tris) buffer solution, for example, 5 mM to 30 mM Tris at pH 8, for example, 10 mM Tris (pH 8.0) or 20 mM Tris (pH 8.0), any of the aforementioned reagents. l) Any of the aforementioned reagents further comprising an organic salt, such as an organic ammonium salt, such as ammonium acetate. m) Any of the aforementioned reagents, for example, ammonium acetate, at a concentration of 200-800 mM, for example, approximately 500 mM ammonium acetate. n) Any of the aforementioned reagents further comprising a magnesium salt, for example, magnesium chloride. o) Any of the aforementioned reagents further comprising a phosphatase, for example, calf intestinal phosphatase (CIP). p) Any of the aforementioned reagents further comprising a nonionic surfactant, e.g., tween, e.g., 0.1% tween. q) Any of the aforementioned reagents selected from the reagents including the following: i. 10% PEG8000, 0.6M NaCl, 10mM Tris (pH 8.0), ii. 10% PEG8000, 0.6M NaCl, 10mM Tris (pH 8.0), 0.1% Tween, iii. 12% PEG8000, 0.6M NaOAc, 10mM Tris (pH 8.0), 0.1% Tween, iv. 10% PEG8000, 10% glycerol, 500 mM NH4Ac, 20 mM Tris (pH 8.0), 100 μM MgCl2, or v.5% PEG8000, 500mM NH4Ac, 20mM Tris (pH 8.0), 100uM MgCl2. r) The concentration of topoisomerase loaded with double-stranded DNA oligomers is 0.5–3 μM, for example, about 1 μM or about 2.5 μM, any of the aforementioned reagents. s) Any of the aforementioned reagents selected from the reagents including the following: i. Double-stranded DNA oligomer, 1 μM topoisomerase loaded with 0.6 M sodium chloride, 10 mM Tris (pH 8.0), 10% PEG8000, 10% glycerol, 0.1% Tween 20, 100 μM EDTA, and 150 μM MgCl2. ii. 2.5 μM topoisomerase loaded with double-stranded DNA oligomer, 10% PEG8000, 10% glycerol, 500 mM NH4Ac, 20 mM Tris (pH 8.0), 100 μM MgCl2, optionally calf enteral phosphatase (CIP), optionally 0.1% or less saturated inactive dye. iii. Double-stranded DNA oligomer, 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 10% w / v PEG8000, 10% v / v glycerol, less than 0.1% saturated inactive dye (for visualization), 2.5 μM topoisomerase loaded with 10 μg of CIP (CIP = phosphatase, alkaline derived from calf intestinal mucosa) per 2.5 nmol of topoisomerase. iv. 0.5 μM topoisomerase loaded with a double-stranded DNA oligomer, 5% PEG8000, 500 mM NH4Ac, 20 mM Tris (pH 8.0), 100 μM MgCl2, optionally CIP, optionally 0.1% or less saturated inactive dye, or v. 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 5% w / v PEG8000, less than 0.1% saturated inactive dye (for visualization), 0.5 μM loaded topoisomerase, 10 μg of CIP per 2.5 nmol of topoisomerase (CIP = phosphatase, alkaline derived from calf intestinal mucosa).

[0127] More generally, the Disclosure provides methods for generating polymer memory strands by inkjet-based reagent supply, including, but not limited to, methods involving topoisomerase-mediated ligation of DNA. For example, the Disclosure provides a method (Method A) for writing a code specific to polymer memory strands located on at least one write spot on a wafer array using at least one inkjet write printhead, wherein the head or nozzle writes the same code to multiple polymer memory strands located on at least one spot. For example, Method A includes: A.1. The method is, a) Loading a starter polymer or DNA, with one end attached to the desired spot, into the desired spot to be written, b) Clean the surface of the spot, c) Placing an add-0 or add-1 inkjet nozzle having corresponding add-0 and add-1 reagents over a desired spot to be written corresponding to a unique code, wherein the add-0 and add-1 reagents comprise a monomer or oligomer encoding "0" or "1". d) Discharging a droplet of the corresponding Add-0 or Add-1 reagent onto the spot from the inkjet nozzle, thereby writing a bit or a portion of the code specific to the DNA or polymer memory string (or strand) associated with the spot, e) Cleaning the surface of the spot, Method A, including. A.2. The method is, f) Discharging droplets of deblock / adapter reagent onto a spot from the inkjet nozzle, g) Clean the surface of the spot, h) Repeat steps (c) through (g) until a specific code is written to the memory string in a spot, Method A.1 further includes. A.3. The method is, f) Applying an addition "0" or addition "1" reagent to the substrate, which is added only to polymer memory chains that have not been modified in step c), g) Repeat steps (b) through (f) until specific code is written to the memory string in a spot, Method A.1 further includes. A.4. Any of the foregoing methods, which include simultaneously writing code specific to polymer memory chains located on multiple write spots on a wafer array using multiple write print heads. A.5. The polymer memory strand is DNA, as described above. A.6. The writing print head is any of the aforementioned methods, comprising a piezoelectric print head. A.7. Any of the foregoing methods, further comprising flowing a separation fluid over the spot to remove the memory string from the spot and flowing the memory string from the spot into a collection container or storage container for later reading. A.8. A method for simultaneously writing a code specific to polymer memory strands located on multiple write spots on a wafer array using multiple write print heads, wherein each head or nozzle writes the same code to multiple DNA memory strands located on a given spot, and the method is as follows: a. Loading starter polymer or DNA onto the desired spots to be written, and cleaning the surface of the wafer array. b. Placing an Add-0 or Add-1 inkjet nozzle having the corresponding Add-0 and Add-1 reagents over the desired spot to be written on, c. Discharging droplets of the corresponding Add-0 or Add-1 reagent onto a spot from an inkjet nozzle, thereby writing bits or codes to the DNA or polymer memory string (or strand) associated with the spot on the wafer array. d. Cleaning the surface of the wafer array, e. Dispense droplets of deblock / adapter reagent onto the inkjet nozzle, f. Cleaning the surface of the wafer array, g. When code writing is complete for all memory strings at all spots on the wafer array, h. Cleaning the surface of the wafer array with a separation fluid that removes memory strings from the spot, Method A, which includes, i. pouring the memory string from the wafer array into a collection container or storage container for later reading. A.9. Any of the aforementioned methods, wherein at least one spot comprises a metal oxide surface that can accept a phosphonate group that can be ligated to a DNA starter strand, and the spot is surrounded by a hydrophobic region. A.10. The metal oxide is HfO2, and the hydrophobic region contains a perfluoroalkyl group, as described above. A.11. Any of the foregoing methods further comprising the step of cleaning the wafer array with a prepared fluid before adhering the starter chain to the spots. A.12. Any of the foregoing methods, comprising cleaning after each additional step, wherein cleaning may be performed by flowing a cleaning fluid into an input port or manifold fluidically connected to one side of the wafer array, allowing the fluid to flow across the wafer surface and out through an output port or manifold on the opposite side of the wafer. A.13. Any of the foregoing methods, comprising cleaning after each additional step, wherein cleaning may be performed by providing a cleaning printhead equipped with nozzles that discharge a predetermined amount of cleaning fluid to each desired spot on the surface of the wafer array. A.14. The starter chain or string may be loaded and attached to a spot by any of the aforementioned methods, provided that a cleaning printhead is equipped with a nozzle that dispenses a predetermined amount of the starter chain in a fluid to each desired spot on the wafer array surface. A.15. The starter string is attached to the spot, then dried, and subsequently rehydrated before use in an inkjet printer, in any of the aforementioned methods. A.16. Any of the aforementioned methods for drying and storing the coded polymer that has adhered to the spots on the array after writing the code, then rehydrating and removing it, and then reading or storing it. A.17. Any of the aforementioned methods further comprising the step of unloading polymer memory strands, such as encoded DNA, after the writing is complete.

[0128] The systems, computers, servers, devices, etc. described herein have the necessary electronic equipment, computer processing power, interfaces, memory, hardware, software, firmware, logic / state machines, databases, microprocessors, communication links (wired or wireless), displays or other visual or audio user interfaces, printing devices, and any other input / output interfaces to provide the functions described herein or to achieve the results described herein. Unless otherwise specifically indicated herein, expressly or implicitly, the steps of the processes or methods described herein may be implemented in software modules (or computer programs) that run on one or more general-purpose computers. Alternatively, hardware specifically designed to perform a particular operation may be used. Thus, any of the methods described herein may be performed by hardware, software, or any combination thereof. In addition, computer-readable storage media may store instructions that, when executed by a machine (such as a computer), result in performance according to any of the embodiments described herein.

[0129] Furthermore, the computers or computer-based devices described herein may include, but are not limited to, tablets, laptop computers, desktop computers, smartphones, mobile communication devices, smart televisions, set-top boxes, and electronic readers / players, as well as any number of computing devices capable of performing the functions described herein.

[0130] While this disclosure has described using exemplary techniques, algorithms, or processes for carrying out the disclosure, those skilled in the art will understand that the same functions and results described herein can be achieved using the techniques, algorithms, and processes described herein, or other combinations or sequences thereof, and that such methods are included within the scope of this disclosure.

[0131] The process descriptions, steps, or blocks of process or logic flow diagrams provided herein represent only one possible implementation and do not imply a fixed order. As will be understood by those skilled in the art, alternative implementations are included within the scope of preferred embodiments of the systems and methods described herein, in which functions or steps may be omitted from the illustrated or described order, or reversed in order, depending on the function in question, and may be performed substantially concurrently or in reverse order.

[0132] Unless otherwise explicitly or implicitly indicated herein, any features, functions, characteristics, alternatives, or modifications described in relation to a particular embodiment herein may also be applied to, used in, or incorporated into any other embodiment described herein. Furthermore, unless otherwise stated, the drawings herein are not drawn to scale.

[0133] In particular, conditional language such as “can,” “could,” “might,” or “may,” unless otherwise specified or understood to have a different meaning in the context in which they are used, is generally used to indicate that a particular embodiment may include, but does not require, certain features, elements, or steps. Therefore, such conditional language is generally not intended to suggest that features, elements, or steps are required in any way in one or more embodiments, or that one or more embodiments necessarily include logic determining whether these features, elements, or steps should be included in or performed in any particular embodiment, with or without user input or prompts.

[0134] While the present invention has been described and illustrated with respect to exemplary embodiments thereof, various other additions and omissions may be made without departing from the spirit and scope of this disclosure.

[0135] Example 1 - Printing using topoisomerase-based "ink" In this embodiment, the topoisomerase-based ink is prepared to contain 1 μM enzyme loaded with DNA1 (upper strand: 5'GCCGCTTGAAACCCTTCG3', bottom strand: 5'GCCGAAGGGTTTCAAG3'), 0.6 M sodium chloride, 10 mM Tris (pH 8.0), 10% PEG8000, 0.1% Tween 20, 100 μM EDTA, and 150 μM MgCl2. The topoisomerase-based ink was filled into a Fujifilm Samba Dimatix material cartridge, and printing experiments were performed using a Suss Microtec PixDro LP50 piezoelectric printer. The enzyme was ejected with voltage pulses that varied from 28 to 40 V along a certain frequency range (1 to 10 kHz) and slew rate range.

[0136] Figure 24A shows images of topoisomerase-based inks printed on glass slides and clean 4-inch diameter silicon wafers at a frequency of 10 kHz, a pulse of 28 V, and a slew rate of 40 V / us.

[0137] Ligation activity is tested in a solution-based assay in which a topoisomerase enzyme bound to DNA1 is ejected at a frequency of 10 kHz with a pulse of 30 V, allowing the enzyme bound to DNA1 to ligate DNA1 with free DNA2 (upper strand: 5'CGGCAATCTGCACGTTAATATCGCAGGAATTCGTCAGCAG3', bottom strand: 5'CTGCTGACGAATTCCTGCGATATTAACGTGCAGATT3'). In this assay, 25 nM DNA2 is mixed with 250 nM topoisomerase bound to DNA1 (recovered after ejection from the Samba printhead) in 10 mM Tris (pH 8.0), 10% PEG8000, 0.1% Tween 20, 100 μM EDTA, and 150 μM MgCl2. 10 μL aliquots of the mixture were quenched with 1% SDS at 0 seconds, 20 seconds, 60 seconds, and 5 minutes. Ligation of two DNA fragments was monitored using a SeqStudio gene analysis system with Thermo Fisher's SmartStart. Rate traces comparing the ligation performance of jet-type and non-jet-type topoisomerases are shown in Figure 24B.

[0138] Example 2 - Printing using topoisomerase-based "ink" - Performance of jet-type versus non-jet-type topoisomerases In this embodiment, the topoisomerase-based ink is prepared to contain 1 μM enzyme loaded with DNA1 (upper strand: 5'GCCGCTTGAAACCCTTCG3', bottom strand: 5'GCCGAAGGGTTTCAAG3'), 0.6 M sodium chloride, 10 mM Tris (pH 8.0), 10% PEG8000, 10% glycerol, 0.1% Tween 20, 100 μM EDTA, and 150 μM MgCl2. The topoisomerase-based ink was loaded into a Fujifilm Spectra printhead (SE128-AA), and printing experiments were conducted using a Suss Microtec PixDro LP50 printer. The enzyme was ejected with voltage pulses that varied from 75 to 90 V along a certain frequency range (1 to 10 kHz) and slew rate range.

[0139] Figure 25A shows an image of topoisomerase-based ink printed on a clean 4-inch diameter silicon wafer using a 10kHz frequency, 75V pulse.

[0140] The topoisomerase enzyme bound to DNA1 was sprayed using a Spectra printhead, and its ligation activity was tested using the assay described in Example 1. 10 μL aliquots of the reaction mixture were quenched with 1% SDS at 0 sec, 20 sec, 60 sec, and 5 sec. Ligation of two DNA fragments was monitored using a Thermo Fisher SeqStudio gene analysis system with SmartStart. Rate traces comparing the ligation performance of sprayed and non-sprayed topoisomerases are shown in Figure 25B.

[0141] Example 3 - Printing on a patterned wafer using a topoisomerase-based "ink" In this embodiment, the topoisomerase-based ink is prepared to contain 1 μM enzyme loaded with an ABDNA cassette, 0.6 M sodium chloride, 10 mM Tris (pH 8.0), 10% PEG8000, 10% glycerol, 0.1% Tween 20, 100 μM EDTA, and 150 μM MgCl2. The ink formulation was loaded into a Fujifilm Spectra printhead (SE128-AA), and printing experiments were performed using a Suss Microtec PixDro LP50 printer. The enzyme was ejected at a frequency of 1 kHz and a pulse of 75 V.

[0142] The topoisomerase ink is printed onto a spot pattern functionalized with strands of BADNA1 (attached to the surface via click chemistry of the SPAAC reaction). The spots on the silicon wafer were 100 μm wide and spaced 100 dpi (center-to-center spacing of the circular pattern). An illustration of the pattern is shown in Figure 26C. Figure 26B shows the details of the attachment chemistry in which the hafnium oxide patches react with a carbon linker consisting of a phosphonic acid group (specifically reactive to hafnium oxide) and a terminal azide that can react with the cycloalkyne group of the 5', in this case the 5'-DBCO group, of the DNA2 strand.

[0143] After adding topoisomerase ink once onto the pattern, the enzyme is reacted with BA-DNA1 bound to the surface for 5 minutes. The wafer is then removed from the printer and washed with 1M NaCl, 5mM Tris (pH 8.0), and 0.05% tween, after which a complementary 1uM topoisomerase solution functionalized with BA-DNA2 (identical to BA-DNA1 but without 5'-DBCO) is applied to the surface. The wafer is washed again with 1M NaCl, 5mM Tris (pH 8.0), and 0.05% tween, dried, and placed back on the LP50 stage. After aligning the wafer using a reference marker, the original ink containing 1uM topoisomerase loaded with an AB-DNA cassette is printed onto the spot pattern.

[0144] After printing AB-DNA-loaded topoisomerase five times, the wafer was washed, and BA-DNA2-loaded topoisomerase was manually deposited. The wafer was then washed twice with 2×PBS buffer and air-dried. A portion of the wafer was treated with Thermo Fisher's HiDi formamide reagent (catalog no. 4311320). The released DNA sequence was then analyzed using Thermo Fisher's SeqStudio gene analysis system with SmartStart to demonstrate successful ligation.

[0145] The inventors also introduced a unique molecular identifier (UMI) into the system and performed a series of grafting / dehybridization experiments to determine the approximate concentration of receptor density on the HfOx surface by helping to quantify the number of molecules per nucket and the bias / error of PCR amplification. Different concentrations of DBCO-functionalized receptor chains were used for grafting onto azide-functionalized substrates. 2 The chain density per unit is approximately as follows: [Table 1]

[0146] Example 4 - Selection of a carrier medium for topoisomerase Various solvents are tested for viscosity and compatibility with topoisomerase. Glycerol alone lacks sufficient viscosity at low concentrations, e.g., 30% at 4 cP, likely due to hydrogen bonding by hydroxyl groups, and inhibits enzyme activity at high concentrations. However, at low concentrations, wetting agents such as glycerol, ethylene glycol, or pentanediol are useful for slowing evaporation. Sugars such as sorbitol and trehalose are also not ideal viscosity modifiers, as high concentrations are required to achieve sufficient viscosity. Sodium carboxymethylcellulose has good viscosity at low concentrations and fewer free hydroxyl groups than other carbohydrates due to sodium substitution: 0.5% sodium carboxymethylcellulose has a viscosity of 6 cP and does not significantly interfere with topoisomerase activity (96% coupling efficiency after 5 minutes). Polyethylene glycol has suitable viscosity; for example, PEG200 provides 7.6 cP at 40%, and PEG8000 provides 6.5 cP at 10%.

[0147] PEG8000 was selected for further evaluation. The stability of the "loaded" topoisomerase was measured by gel electrophoresis of topoisomerase ligated to an A0B cassette operating in 15% PEG8000, 0.6 M NaCl, and 10 mM Tris (pH 8.0) after storage in 15% PEG8000 at 4°C for up to 5 days. No DNA release was detected.

[0148] The efficiency of bit addition using various concentrations of PEG8000 was measured in a 5-minute reaction. Using 10% or 15% PEG8000 stored at 4°C, or 10% or 15% PEG8000 incubated overnight at room temperature, did not significantly affect coupling efficiency. However, with 20% PEG8000, the reaction efficiency dropped significantly to approximately 60% of the control. Therefore, 20% PEG8000 caused a decrease in topogation efficiency and a slowdown in the reaction rate, while 10–15% PEG (or 0.5% NaCMC) yielded results comparable to the control. Furthermore, the addition of nonionic surfactants (tweens) did not significantly affect the reaction.

[0149] Next, the effects of supplying the enzyme with a medium containing 10% PEG8000, 0.6M NaCl, and 10mM Tris (pH 8.0) (PEG ink) using inkjet technology are tested under various inkjet settings. • Immerse Topo-A0B in 0.6M NaCl and 10mM Tris (pH 8.0). • Prepare Topo-A0B with 10% PEG, 0.6M NaCl, and 10mM Tris (pH 8.0). • Topo-A0B is sprayed with 10% PEG ink at 28V pulse, 40V / us through. • Topo-A0B is sprayed with 10% PEG ink at 28V pulse, 80V / us through. • Topo-A0B is sprayed with 10% PEG ink at 40V pulse, 40V / us through. • Topo-A0B is sprayed with 10% PEG ink at 40V pulse, 80V / us through. • Immerse Topo-A0B in 10% PEG ink (do not spray, remove from cartridge). • Topo-A0B is ejected with 10% PEG ink at 28V pulse, 80V / us through, and a frequency of 3000Hz. • Topo-A0B is sprayed with 12.5% ​​PEG ink at 34V pulse, 80V / us through. • 2uM Topo-A0B is sprayed with 10% PEG ink at 27V pulse, 80V / us through. • 2µM Topo-A0B is sprayed with 10% PEG ink at 40V pulse, 80V / µs through.

[0150] In all tested settings, when measured using gel electrophoresis, the bands moved slightly lower on the gel with high-viscosity buffer, but there was no evidence of DNA efflux, indicating that the inkjet feed did not affect the topoisomerase-DNA complex. Using the same inkjet array setting, the efficiency of the topogation reaction was tested, and no evidence of decreased activity was observed.

[0151] The initially prepared medium containing 10% PEG8000, 0.6M NaCl, 10mM Tris (pH 8.0), and 0.1% Tween evaporates very quickly. Using a different salt, namely 0.6M NaOAc instead of 0.6M NaCl, reduces evaporation. Furthermore, since chlorides can damage piezoelectric films and potentially affect printheads over long-term use, NaOAc is considered less corrosive to printer nozzles. Further testing with a medium containing 12% PEG8000, 0.6M NaOAc, 10mM Tris (pH 8.0), and 0.1% Tween provides similar good stability and high-efficiency topogation.

[0152] To further reduce residue formation, the inventors tried ammonium acetate instead of sodium acetate. An aqueous medium containing 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 10% w / v PEG8000, 10% v / v glycerol, less than 0.1% saturated inactive dye (for visualization), 2.5 μM loaded topoisomerase, and 10 μg of CIP (CIP = phosphatase, alkaline derived from calf intestinal mucosa) per 2.5 nmol of topoisomerase provides good stability and highly efficient topogation.

[0153] For printing, relatively viscous inks are preferred to avoid ink splatter and inaccurate supply to desired spots; however, when using the ink as a "paddle," i.e., to pour the ink onto the substrate or immerse the substrate in the ink, low-viscosity inks are desirable. An aqueous medium containing 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 5% w / v PEG8000, less than 0.1% saturated inactive dye (for visualization), 0.5 μM loaded topoisomerase, and 10 μg of CIP (CIP = phosphatase, alkaline derived from calf intestinal mucosa) per 2.5 nmol of topoisomerase provides good stability and highly efficient topogation by paddle application.

[0154] For example, a certain "print / paddle" protocol is as follows: a. Substrate preparation: The wafer is sonicated before use (sonication in ethanol for 15 minutes, then rinsed with isopropanol), followed by grafting of ADIBO or DBCO-functionalized DNA strands onto the azide-functionalized substrate with 10 nM of the receptor in 2 × PBS for 30 minutes at RT (room temperature), and then passivation with 2 μM of DBCO-PEG7-OH in 2 × PBS for 30 minutes at RT. b. Printing: Printhead - Spectra SL-128 / 80 AA printhead. Head voltage: 75~90V. Head pulse length (us): 4. For accuracy, perform reference / spot alignment. Printhead storage buffer: 10% w / v PEG8000 in water, 10% v / v glycerol Ink for LP-50: 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 10% w / v PEG8000, 10% v / v glycerol, less than 0.1% saturated inactive dye (for visualization), 2.5 μM loaded topoisomerase, 10 μg of CIP per 2.5 nmol of topoisomerase (CIP = phosphatase, alkaline, derived from calf intestinal mucosa). c. Paddling: Wafer immersed in paddle ink - 500 mM ammonium acetate, 20 mM Tris-HCl (pH 8), 0.1 mM magnesium chloride, 5% w / v PEG8000, less than 0.1% saturated inactive dye (for visualization), 0.5 μM loaded topoisomerase, 10 μg of CIP per 2.5 nmol of topoisomerase (CIP = phosphatase, alkaline derived from calf intestinal mucosa). d. Cleaning protocol: 1% SDS in water (1-2 times, after which the wafer may be partially dried with an air knife); 20 mM Tris-HCl (pH 8) (3-8 times, after which air knife drying). Cleaning in this protocol is by immersion in the cleaning solution, but alternative cleaning methods such as immersion in a waterfall tank (Mini Niagara), gentle spraying (La Rinsita), or gentle spraying can also be performed. Denature agents such as SDS may be used in the cleaning solution to denature residual topoisomerase and limit undesirable reactions, or alternative denaturants may be used.

Claims

1. A method for writing a code specific to polymer memory chains located on at least one write spot on a wafer array using at least one inkjet write print head, wherein the head or nozzle writes the same code to a plurality of polymer memory chains located on the at least one spot.

2. a) A step of loading a starter polymer or DNA, with one end attached to the desired spot to be written, b) A step of cleaning the surface of the spot, c) A step of positioning an add-0 or add-1 inkjet nozzle having corresponding add-0 and add-1 reagents over the desired spot to be written, wherein the add-0 and add-1 reagents include monomers or oligomers encoding "0" or "1". d) The step of causing the inkjet nozzle to release droplets of the corresponding Add-0 or Add-1 reagent onto the spot, thereby writing bits or portions of the unique code onto the DNA or polymer memory string (or strand) associated with the spot, e) The step of cleaning the surface of the spot, The method according to claim 1, including the method described in claim 1.

3. f) The step of releasing droplets of deblock / adapter reagent onto the spot using the inkjet nozzle, g) A step of cleaning the surface of the spot, h) Repeating steps (c) through (g) until the unique code is written to the memory string at the spot, The method according to claim 2, further comprising:

4. f) A step of applying an addition "0" or addition "1" reagent to a substrate, which is added only to polymer memory chains that have not been modified in step c), g) Repeating steps (b) through (f) until the unique code is written to the memory string at the spot, The method according to claim 2, further comprising:

5. The method according to claim 1, comprising simultaneously writing a code specific to polymer memory chains arranged on a plurality of write spots on the wafer array using a plurality of write print heads.

6. The method according to claim 1, wherein the polymer memory strand is DNA.

7. The method according to claim 1, wherein the writing print head comprises a piezoelectric print head.

8. The method according to claim 1, further comprising flowing a separation fluid over the spot to remove the memory string from the spot, and flowing the memory string from the spot into a collection container or storage container for later reading.

9. A method according to claim 1 for simultaneously writing a code specific to polymer memory strands located on multiple write spots on a wafer array using multiple write print heads, wherein each head or nozzle writes the same code to multiple DNA memory strands located on a given spot, and the method is Loading a starter polymer or DNA onto the desired spot to be written, The surface of the wafer array is cleaned, The process involves placing an add-0 or add-1 inkjet nozzle equipped with the corresponding add-0 and add-1 reagents over the desired spot to be written on, The inkjet nozzle is used to release droplets of the corresponding addition "0" or addition "1" reagent onto the spot, thereby writing bits or codes to the DNA or polymer memory string (or strand) associated with the spot on the wafer array. The surface of the wafer array is cleaned, The inkjet nozzle releases droplets of the deblock / adapter reagent onto the spot, The surface of the wafer array is cleaned, When the code writing to all memory strings is completed at all spots on the wafer array, The surface of the wafer array is cleaned with a separation fluid that removes the memory strings from the spots, To read the memory string later, the memory string is poured from the wafer array into a collection container or storage container, Methods that include...

10. The method according to claim 1, wherein the at least one spot comprises a metal oxide surface that accepts a phosphonate group that can be linked to a DNA starter strand, and the spot is surrounded by a hydrophobic region.

11. The aforementioned metal oxide is HfO ２ The method according to claim 10, wherein the hydrophobic region includes a perfluoroalkyl group.

12. The method according to claim 9, wherein the cleaning can be performed by flowing a cleaning fluid into an input port or manifold fluidly connected to one side of the wafer array, allowing the fluid to flow across the wafer surface and out through an output port or manifold on the opposite side of the wafer.

13. The method according to claim 9, wherein the cleaning can be performed by providing a cleaning print head equipped with nozzles that discharge a predetermined amount of cleaning fluid to each desired spot on the surface of the wafer array.

14. The method according to claim 9, wherein the starter chain or string can be loaded onto and attached to each desired spot on the wafer array surface by providing a cleaning print head equipped with a nozzle that dispenses a predetermined amount of the starter chain in a fluid onto each desired spot.

15. The method according to claim 9, wherein the starter string is attached to the spot, then dried, and subsequently rehydrated before use in the inkjet printer.

16. The method according to claim 9, wherein, after writing the code, the coded polymer adhering to the spots on the array is dried and stored for reading or storage, and then rehydrated and removed.

17. The method according to claim 8, wherein the coded polymer memory chain is unloaded after the writing is complete.

18. The method according to claim 6, comprising synthesizing a DNA polymer using topoisomerase-mediated ligation, wherein the method is (i) A step of reacting double-stranded receptor DNA with topoisomerase loaded with a double-stranded DNA oligomer covalently bound to the topoisomerase, The receptor DNA strand has a 5' overhang. The oligomer optionally includes an information sequence, a topoisomerase recognition sequence, and 5' overhangs on both strands. The 5' overhang of the chain of the oligomer that does not support the topoisomerase ("bottom chain") is complementary to the 5' overhang of the receptor DNA, but is not complementary to the 5' overhang of the chain of the oligomer that supports the topoisomerase ("top chain"). The 5' end of the oligomer's topoisomerase-carrying chain ("upper chain") and the 5' end of the receptor DNA are not protected, for example, not phosphorylated (i.e., 5'-OH), The topoisomerase loaded with a double-stranded DNA oligomer is supplied to the position on the receptor chain by a piezoelectric inkjet nozzle, and the steps are as follows: (ii) A step of reacting the receptor DNA thus extended in step (i) with a topoisomerase loaded with a further double-stranded DNA oligomer, The further oligomer optionally includes an information sequence that is the same as or different from any information sequence in the oligomer of step (i), a topoisomerase recognition sequence, and 5' overhangs on both strands. The 5' overhang of the chain of the further oligomer that does not support the topoisomerase ("bottom chain") is complementary to the 5' overhang of the extended receptor DNA, but is not complementary to the 5' overhang of the chain of the further oligomer that does support the topoisomerase ("top chain"). The 5' end of the chain ("upper chain") of the further oligomer carrying the topoisomerase is not protected, for example, not phosphorylated (i.e., 5'-OH), and the step, (iii) Repeat steps (i) and (ii) until the desired nucleotide sequence is obtained, Methods that include...

19. The method according to claim 18, wherein there is a washing step after step (i) and after step (ii).

20. A reagent comprising topoisomerase loaded with double-stranded DNA oligomers in a buffer solution containing a viscosity modifier.

Images