Composition and method for suppressing the expression of DFFA-like effector B (CIDEB) that induces cell death

CIDEB-specific RNAi agents target and suppress CIDEB gene expression, offering a therapeutic solution for liver diseases like fibrosis and cirrhosis by reducing liver damage.

JP2026510329APending Publication Date: 2026-04-02SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-08
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current therapies are inadequate for treating CIDEB-related diseases such as liver disease, which are associated with liver fibrosis and cirrhosis, and there is a need for effective methods to suppress CIDEB gene expression.

Method used

Development of CIDEB-specific RNAi agents comprising sense and antisense strands, designed to target specific regions of the CIDEB gene, which can selectively reduce or silence CIDEB gene expression in vivo and in vitro.

Benefits of technology

The CIDEB RNAi agents effectively suppress CIDEB gene expression, providing a novel therapeutic approach for treating CIDEB-related diseases by reducing liver damage and associated health risks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026510329000001
    Figure 2026510329000001
  • Figure 2026510329000002
    Figure 2026510329000002
  • Figure 2026510329000003
    Figure 2026510329000003
Patent Text Reader

Abstract

The present invention provides compositions and methods for reducing the expression of the dffa-like effector b (CIDEB) gene, which induces cell death, and for treating CIDEB-related diseases and conditions. It also provides CIDEB dsRNA agents, CIDEB antisense polynucleotide agents, CIDEB dsRNA agent-containing compositions, and CIDEB antisense polynucleotide agent-containing compositions for reducing CIDEB expression in cells and subjects.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention partially relates to compositions and methods for suppressing the expression of the dffa-like effector b (CIDEB) gene, which induces cell death. [Background technology]

[0002] Long-term damage to liver cells leads to liver fibrosis and cirrhosis, which have resulted in enormous healthcare costs, morbidity, and mortality rates worldwide. Obesity-related non-alcoholic fatty liver disease and non-alcoholic steatohepatitis are becoming the most common diseases progressing to liver transplantation, while there is currently a shortage of approved drug therapies (Niek Verweij, et al. N Engl J Med 2022;387:332-344).

[0003] The liver plays a crucial role in regulating circulating cholesterol levels by controlling the de novo synthesis, uptake, storage, and conversion of cholesterol to bile acids. Cholesterol biosynthesis involves several enzymatically catalyzed intermediate steps, including hydroxymethylglutaryl-CoA (HMG-CoA) synthase (HMGCS), HMG-CoA reductase (HMGCR), phosphomevalonate kinase (PMVK), mevalonate diphosphate decarboxylase (MVD), and lanosterol synthase (LSS), as well as the absorption of food in the small intestine. The regulation of cholesterol biosynthesis is primarily controlled by the transcription factor sterol regulatory element-binding protein-2 (SREBP2). SREBP2 is synthesized as an inactive precursor bound to the endoplasmic reticulum (ER) membrane, then transported to the Golgi apparatus and released by proteolysis in response to a decrease in cellular sterol levels. The transport of SREBP2 from the ER to the Golgi apparatus and its cleavage by proteolysis are strictly controlled by SREBP cleavage activating protein (SCAP). When cellular sterol levels are relatively high, the interaction between SCAP and INSIG enables the transport and cleavage of SREBP. Downstream targets of SREBP2 include many genes responsible for cholesterol synthesis and cholesterol uptake, such as HMG-CoA reductase, PMVK, MVD, LSS, Insig-1, and the LDL receptor (LDLR).

[0004] DFFA-like effector B (CIDEB), which induces cell death, is a member of the Cide family, which includes CIDEA, CIDEB, and CIDEC (Fsp27). CIDEB is highly expressed in the liver and kidneys, and relatively low in white adipose tissue, small intestine, and colon (Li, JZet al. 2007. Diabetes. 56:2523-2532). CIDEB can be involved in lipid metabolism by regulating lipid droplet fusion and very low-density lipoprotein (VLDL) lipidization through interaction with ApoB. CIDEB is also required for the biodevelopment of VLDL transport vesicles and for the lipidization of chylomicrons in the small intestine. Furthermore, CIDEB regulates hepatic SREBP activation by selectively promoting the transport of the SREBP / SCAP complex from the ER to the Golgi apparatus (a major regulator of lipid metabolism). SCAP, which is consumed and induced by sterols, interacts with CIDEB, and CIDEB further binds to Sec12 (GEF of Sar1), enriching the SCAP / SREBP at the ER exit site and increasing the SREBP / SCAP ratio, which is then packaged into COPII-coated vesicles.

[0005] Therefore, novel therapies for CIDEB represent new methods for reducing CIDEB levels and treating CIDEB-related diseases (e.g., liver disease). [Overview of the project]

[0006] Generally, the features of this disclosure are novel CIDEB gene-specific RNAi agents, CIDEB RNAi agent-containing compositions, and methods for suppressing CIDEB gene expression in vitro and / or in vivo using CIDEB RNAi agents and the CIDEB RNAi agent-containing compositions described herein. The CIDEB RNAi agents described herein can selectively and effectively reduce, suppress, or silence the expression of the CIDEB gene in subjects (e.g., human or animal subjects).

[0007] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand comprising at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprising at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand are partially, basically, or completely complementary to each other.

[0008] In some embodiments, the dsRNA agent targets the corresponding portion of the CIDEB gene disclosed in Table 1. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of nucleotides 151-180, 167-190, 298-341, 393-413, 455-475, 519-544, 584-626, 820-876, or 1177-1202 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0009] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, where the sense strand comprises nucleotides 147-177, 146-176, 149-179, 150-180, 152-182, 155-185, 162-192, 163-193, 164-194, 165-195, 293-323, 313-343, 316-346, 388-418, 450-480, 514-544, 519-549, 579-609, 581-611, 586-616, 588-618, 591-621, 593-623, 594-624, 601-631, 81 The antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 5-845, 819-849, 822-852, 823-853, 825-855, 827-857, 832-862, 833-863, 834-864, 851-881, 1172-1202, 1176-1206, or 1177-1207, and the antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, where the sense strand comprises nucleotides 151-171, 152-172, 154-174, 155-175, 157-177, 160-180, 167-187, 168-188, 169-189, 170-190, 298-318, 318-338, 321-341, 393-413, 455-475, 519-539, 524-544, 584-604, 586-606, 591-611, 593-613, 596-616, 598-618, 599-619, 606-626, 82 The antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 0-840, 824-844, 827-847, 828-848, 830-850, 832-852, 837-857, 838-858, 839-859, 856-876, 1177-1197, 1181-1201, or 1182-1202, and the antisense strand contains at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.

[0011] In some embodiments, the sense strand and antisense strand may be the same length or of different lengths. In some embodiments, the length of each strand is 40 nucleotides or less. In some embodiments, the length of each strand is 30 nucleotides or less. In some embodiments, the length of each strand is 25 nucleotides or less. In some embodiments, the length of each strand is 23 nucleotides or less. In some embodiments, the length of each strand is 21 nucleotides or less. In some embodiments, the length of the sense strand and antisense strand of the RNAi agent may each be 15 to 49 nucleotides. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the sense strand is complementary or basically complementary to the antisense strand, and the length of the complementary region is between 15 and 23 nucleotides. In some embodiments, the length of the complementary region is between 19 and 21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand includes a region complementary to the CIDEB RNA transcript at nucleotide positions 2-18, where the complementary region comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally includes a target ligand.

[0013] In some embodiments, the CIDEB RNA transcript is Sequence ID No. 1.

[0014] In some embodiments, the antisense strand of the dsRNA agent is essentially complementary to at least one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, wherein the sense strand sequence is at least essentially complementary to the antisense strand sequence in the dsRNA agent. In certain embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sequence listed as a double-stranded sequence in any one of Tables 1 to 3.

[0015] In some embodiments, the dsRNA agent contains at least one modified nucleotide. In certain embodiments, all or nearly all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide includes 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-3'-seconucleotide mimetic, locked nucleotide, ring-open nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannoside nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, 5'-phosphorothioate group-containing nucleotide, 5'-phosphate modified nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphoramidate, or a nucleotide containing a non-natural base. In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5' end of the guide strand. In certain embodiments, the dsRNA agent contains at least one phosphorothioate nucleotide linkage. In certain embodiments, the sense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the antisense strand contains at least one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, or 6 phosphorothioate nucleotide linkages. In some embodiments, all or nearly all nucleotides in the sense and antisense strands are modified nucleotides.In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, where fewer than 6 modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In certain embodiments, the antisense strand comprises 5 2'-fluoronucleotides and 5'-phosphonate-modified nucleotides, preferably nucleotides containing vinyl phosphonate. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, where fewer than 4 modified nucleotides are 2'-fluoronucleotides. In certain embodiments, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense chain comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, where at least 16 modified nucleotides are 2'-O-methylnucleotides, and positions 2, 5, 7, 12, 14 and / or 16, when counted from the first matching position at the 5' end of the antisense chain in the nucleotides located therein, are independently 2'-fluoronucleotides. In some embodiments, the antisense chain comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, where at least 16 modified nucleotides are 2'-O-methylnucleotides, and positions 2, 5, 7, 11, 14 and / or 16, when counted from the first matching position at the 5' end of the antisense chain in the nucleotides located therein, are independently 2'-fluoronucleotides. In some embodiments, the antisense chain comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides.In some embodiments, the antisense strand contains one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16 when counted from the first matching position at the 5' end, with the remaining modifications being 2'-O-methylnucleotides. In some embodiments, the antisense strand contains at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand contains one UNA-modified nucleotide at position 7 and five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16 when counted from the first matching position at the 5' end, with the remaining modifications being 2'-O-methylnucleotides. In some embodiments, the antisense strand contains five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16 when counted from the first matching position at the 5' end, with the remaining modifications being 2'-O-methylnucleotides. In some embodiments, when the antisense chain is counted from the first matching position at the 5' end, it contains five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16, with the remainder being 2'-O-methylnucleotides. In some embodiments, when the antisense chain is counted from the first matching position at the 5' end, the nucleotides at positions 2, 7, 12, 14, and 16 are 2'-fluoronucleotides, and the 5' terminal nucleotide of the antisense chain is a vinyl phosphonate-containing nucleotide, preferably, where the vinyl phosphonate-containing nucleotide is VPu* as defined in the present invention. In some embodiments, when the antisense chain is counted from the first matching position at the 5' end, the nucleotides at positions 2, 5, 12, 14, and 16 are 2'-fluoronucleotides, the nucleotide at position 7 is a UNA-modified nucleotide, and the 5' terminal nucleotide of the antisense chain is a vinyl phosphonate-containing nucleotide, preferably, where the vinyl phosphonate-containing nucleotide is VPu* as defined in the present invention.In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, preferably, where at least 18 modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 9, 11, and / or 13 when counted from the first matching position at the 3' end of the sense strand are 2'-fluoronucleotides. In some embodiments, the modified sense strand is one of the modified sense strand sequences listed in Tables 2-3. In some embodiments, the modified antisense strand is one of the modified antisense strand sequences listed in Tables 2-3.

[0016] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups. In some embodiments, one or more target groups or binding groups are conjugated to the sense strand. In some embodiments, the target group or binding group comprises N-acetyl-galactosamine (GalNAc).

[0017] In some embodiments, the target group has the structure shown in formula (X), [ka] Each n'' is independently chosen from 1 or 2.

[0018] In some embodiments, the target group has the following structure. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0019] In certain embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes one reverse debase residue at its 3' end. In certain embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides. In a particular embodiment, dsRNA is AD00898, AD00899, AD00900, AD00901, AD00902, AD00903, AD00904, AD00905, AD00906, AD00907, AD00908, AD00944, AD00945, AD00946, AD00947, AD00948, AD00949, AD00950, AD009 Includes a double-stranded form selected from 51, AD00952, AD00953, AD00954, AD00955, AD00956, AD00957, AD00958, AD00959, AD00960, AD00961, AD00962, AD01038, AD01039, AD01040, AD01041, AD01042, AD01043, AD01044, and AD01045.

[0020] In some embodiments, provided is a double-stranded ribonucleic acid (dsRNA) agent for suppressing cell death-inducing dffa-like effector b (CIDEB) expression, the dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, the antisense strand comprises a region that is partially complementary to the mRNA encoding CIDEB, the length of each strand is from about 15 to about 30 nucleotides, the sense strand sequence is represented by formula (I), 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I) wherein, each N′ F represents a 2′-fluoro-modified nucleotide, each N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , and N′ N6 independently represent a modified or unmodified nucleotide, and optionally, N′ N1 N′ N2 N′ N3 and N′ N4 N′ N5 N′ N6 each independently represent a motif comprising at least two different modified nucleotides, each N’ L independently represents a modified or unmodified nucleotide, but does not represent a 2′-fluoro-modified nucleotide, and m′ and n′ are each independently an integer from 0 to 7.

[0021] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0022] In some embodiments, the dsRNA agent includes a target group conjugated to the 5' end of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1 to GLS-16, and more preferably GLS-15. In certain embodiments, the dsRNA agent includes a target group conjugated to the 3' end of the sense strand. In certain embodiments, the antisense strand includes one reverse debase residue at its 3' end. In certain embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5' ends. In certain embodiments, each of the 3' and 5' ends of the sense strand independently includes a reverse debase residue. In certain embodiments, each of the 3' and 5' ends of the sense strand independently includes an imann residue. In certain embodiments, the sense strand comprises two reverse debase residues at the 3' and 5' ends and is further conjugated to a target group at either the 3' or 5' end, preferably GLS-15. In certain embodiments, the sense strand comprises two imann residues at the 3' and 5' ends and is further conjugated to a target group at either the 3' or 5' end, preferably GLS-15.

[0023] In several embodiments, a double-stranded ribonucleic acid (dsRNA) agent is provided for suppressing the expression of dffa-like effector b (CIDEB), which induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, where the sense strand is complementary to the antisense strand, and the antisense strand includes a region that is partially complementary to the mRNA encoding CIDEB, with each strand having a length of approximately 18 to 30 nucleotides, and the antisense strand sequence is shown by formula (II). 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ (II) Here, each N F represents a 2'-fluoromodified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 Each N independently represents a modified or unmodified nucleotide. L The nucleotides represent modified or unmodified nucleotides independently, but are not 2'-fluoromodified nucleotides, and n is an integer from 0 to 7.

[0024] In some embodiments, N M2 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide. In some embodiments, N M2 , N M3 and N M7represents a 2'-fluoro modified nucleotide independently, and N M6 represents an UNA modified nucleotide, In some embodiments, n is 1, or n is 2, or n is 3.

[0025] In some embodiments, N M6 , N M3 and N M2 are 2'-fluoro modified nucleotides.

[0026] In some embodiments, the antisense strand sequence is represented by formula (II'), 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (II’) where each N F represents a 2'-fluoro modified nucleotide, and each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N z independently represents a modified or unmodified nucleotide, and each N L independently represents a modified or unmodified nucleotide, but is not a 2'-fluoro modified nucleotide, and n is an integer from 0 to 7.

[0027] In some embodiments, N zrepresents a nucleotide containing a phosphate analog, preferably N z This represents a nucleotide containing vinylphosphonate.

[0028] In some embodiments, n is 1, or n is 2, or n is 3.

[0029] In some embodiments, N M2 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide. In some embodiments, N M2 , N M6 and N M9 Each of these independently represents a 2'-fluoromodified nucleotide. In some embodiments, N M2 , N M3 and N M7 Each of these independently represents a 2'-fluoromodified nucleotide, and N M6 This represents a UNA-modified nucleotide, In some embodiments, N M2 , N M9 and N M7 Each of these independently represents a 2'-fluoromodified nucleotide, and N M6 This represents a UNA-modified nucleotide, In some embodiments, the modified nucleotide is the modified nucleotide defined above.

[0030] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0031] In some embodiments, N z This is a vinyl phosphonate-modified nucleotide.

[0032] In some embodiments, Nz is VPu*, and structure [ka] It has.

[0033] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent is provided for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, where the sense strand and antisense strand form a dsRNA duplex, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the mRNA encoding CIDEB, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III). Sense chain: 5′-(N′ L ) n′ N' L N' L N' L N' N1 N' N2 N' N3 N' L N' F N' L N' N4 N' N5 N' N6 N' L N' L N' L (N' L ) m′ -3′ Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ (III) Here, Each chain has a length of approximately 17 to 30 nucleotides. each NF and N′ F This independently represents a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N′ N6 Each represents a modified or unmodified nucleotide independently, and each N L and N′ L The terms represent modified or unmodified nucleotides independently, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7.

[0034] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0035] In some embodiments, n is 1, or n is 2, or n is 3.

[0036] In some embodiments, N′ N1 N' N2 N' N3 and N′ N4 N' N5 N' N6 Each independently represents a single motif containing at least two different modified nucleotides.

[0037] In some embodiments, N M2 , N M3 and N M6Each of these independently represents a 2'-fluoromodified nucleotide, and in certain embodiments, N M2 , N M3 and N M6 This is a 2'-fluoromodified nucleotide.

[0038] In some embodiments, N M2 , N M3 and N M7 Each of these independently represents a 2'-fluoromodified nucleotide, and N M6 This represents a UNA-modified nucleotide.

[0039] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent is provided for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, where the sense strand and antisense strand form a dsRNA duplex, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the mRNA encoding CIDEB, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III'). Sense chain: 5′-(N′ L ) n′ N' L N' L N' L N' N1 N' N2 N' N3 N' L N' F N' L N' N4 N' N5 N' N6 N' L N' L N' L (N' L ) m′ -3′ Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (III') Here, Each chain has a length of approximately 17 to 30 nucleotides. each N F and N′ F This independently represents a 2'-fluoromodified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N z Each represents a modified or unmodified nucleotide independently, and each N L and N′ L The terms represent modified or unmodified nucleotides independently, but do not represent 2'-fluoromodified nucleotides, and m', n', and n are each independently integers from 0 to 7.

[0040] In some embodiments, N z represents a nucleotide containing a phosphate analog, preferably N z This represents a nucleotide containing vinylphosphonate.

[0041] In some embodiments, the modified nucleotide is the modified nucleotide defined above.

[0042] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0043] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0044] In some embodiments, n is 1, or n is 2, or n is 3.

[0045] In some embodiments, N′ N1 N' N2 N' N3 and N′ N4 N' N5 N' N6 Each independently represents a single motif containing at least two different modified nucleotides.

[0046] In some embodiments, N M2 , N M3 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide, and in certain embodiments, N M2 , N M3 and N M6 This is a 2'-fluoromodified nucleotide.

[0047] In some embodiments, N M2 , N M9 and N M6 Each of these independently represents a 2'-fluoromodified nucleotide.

[0048] In some embodiments, N M2 , N M3 and N M7 Each of these independently represents a 2'-fluoromodified nucleotide, and N M6 This represents a UNA-modified nucleotide.

[0049] In some embodiments, N M2 , N M9 and N M7 Each of these independently represents a 2'-fluoromodified nucleotide, and N M6 This represents a UNA-modified nucleotide.

[0050] In some embodiments, N z This is a vinyl phosphonate-modified nucleotide.

[0051] In some embodiments, Nz is VPu*, and structure [ka] It holds.

[0052] In some embodiments, the dsRNA agent includes a target group conjugated to the 5'-terminus of the sense strand, preferably one selected from GLO-1 to GLO-16 and GLS-1 to GLS-16, and more preferably GLS-15. In certain embodiments, the dsRNA agent includes a target group conjugated to the 5'-terminus of the sense strand. In certain embodiments, the antisense strand includes one reverse debase residue at its 3'-terminus. In certain embodiments, the sense strand includes one or two reverse debase residues and / or one or two imann residues at its 3' and / or 5'-terminus. In certain embodiments, each end of the sense strand includes one reverse debase residue. In certain embodiments, each end of the sense strand includes one imann residue. In certain embodiments, the sense strand includes two reverse debase residues at the 3' and 5' ends and is further conjugated to a target group at either the 3' or 5' end, preferably GLS-15. In certain embodiments, the sense strand includes two imann residues at the 3' and 5' ends and is further conjugated to a target group at either the 3' or 5' end, preferably GLS-15. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In certain embodiments, at least one strand includes 3' overhangs of at least two nucleotides.

[0053] In some embodiments, at least one bond on the sense strand and / or antisense strand is a phosphodiester (PO) bond. In some embodiments, at least one bond on the sense strand and / or antisense strand is a modification bond. In some embodiments, at least one bond on the sense strand and / or antisense strand is a phosphorothioate (PS) bond. In some embodiments, at least one phosphorothioate (PS) bond is introduced at the 5'-terminus, 3'-terminus, or both ends of the sense strand and / or antisense strand. In some embodiments, one, two, three, four, five, or six phosphorothioate (PS) bonds are introduced at the 5'-terminus, 3'-terminus, or both ends of the sense strand and / or antisense strand. In some embodiments, at least two terminally modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphorothioate bonds. In some embodiments, three terminally modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphorothioate bonds. In some embodiments, at least two terminally modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphorothioate bonds. In some embodiments, three terminally modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphorothioate bonds. In some embodiments, three terminally modified or unmodified nucleotides at the 5' end of the sense strand are linked by phosphorothioate bonds, and two terminally modified or unmodified nucleotides at the 3' end of the sense strand are linked by phosphorothioate bonds. In some embodiments, the sense strand includes phosphorothioate bonds between the target group and a reverse debasing residue or imann residue, and between the reverse debasing residue or imann residue and the terminally modified or unmodified nucleotides at the 5' end of the sense strand.

[0054] In some embodiments, any one sense strand in Table 1 may be modified in the mode shown in formula (I) or (III). In some embodiments, any one antisense strand in Table 1 may be further modified in the mode shown in formula (II), (II'), (III), or (III'). In some embodiments, any one double-stranded body in Table 1 may be further modified in the mode shown in formula (III) or (III'). In some embodiments, the modified sense strand has one of the modification modes listed in Tables 2-3. In some embodiments, the modified antisense strand has one of the modification modes listed in Tables 2-3.

[0055] According to one aspect of the present invention, a composition is provided that includes any embodiment relating to the above-described embodiment of the dsRNA agent of the present invention. In certain embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more other therapeutic agents. In certain embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial. In some embodiments, the composition is prepared for use in subcutaneous or intravenous (IV) administration.

[0056] According to another aspect of the present invention, cells are provided, including any embodiment of the above-described embodiment of the dsRNA agent of the present invention. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0057] Another aspect of the present invention provides a method for suppressing CIDEB gene expression in cells, the method comprising (i) producing cells containing an effective amount of any one embodiment of the dsRNA agent according to the present invention or any embodiment of the composition according to the present invention. In certain embodiments, the method further comprises (ii) suppressing CIDEB gene expression in cells by maintaining the produced cells for a time sufficient to obtain degradation of the mRNA transcript of the CIDEB gene. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the cells are located in the body of a subject and the dsRNA agent is administered to the subject by intravenous administration. In certain embodiments, the method further comprises evaluating the suppression of the CIDEB gene after administering a dsRNA agent to a subject, wherein the means used for evaluation include (i) determining one or more physiological features of a CIDEB-related disease, or (ii) comparing the determined physiological features with baseline physiological features of a CIDEB-related disease or disorder and / or control physiological features of a CIDEB-related disease or disorder before treatment, wherein the comparison indicates one or more of the presence or absence of suppression of CIDEB gene expression in the subject. In some embodiments, the physiological features are one or more of CIDEB mRNA levels and CIDEB protein levels. The reduction in CIDEB expression can be indirectly assessed by measuring the reduction in CIDEB biological activity, for example, by reducing cholesterol ester (CE), triglyceride levels (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) in plasma or tissue samples, and / or reducing fat accumulation and / or lipid droplet dilation in the liver.

[0058] Another aspect of the present invention provides a method for suppressing CIDEB gene expression in a subject, the method comprising administering to the subject an effective amount of any one embodiment of the dsRNA agent according to the present invention or any embodiment of the composition according to the present invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV dosing. In some embodiments, the method further comprises evaluating the suppression of the CIDEB gene after administration of the dsRNA agent, wherein the means used for evaluation include (i) determining one or more physiological features of a CIDEB-related disease or condition, and (ii) comparing the determined physiological features with baseline physiological features of a CIDEB-related disease or condition before treatment and / or control physiological features of a CIDEB-related disease or condition, wherein the comparison indicates one or more of the presence or absence of suppression of CIDEB gene expression in the subject. In some embodiments, CIDEB gene expression can be evaluated by the level or level change of any variable related to CIDEB gene expression, such as CIDEB mRNA level or CIDEB protein level. A reduction in CIDEB expression can be further evaluated indirectly by measuring a reduction in CIDEB biological activity, such as a reduction in cholesterol ester (CE), triglyceride levels (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) in plasma or tissue samples, and / or a decrease in fat accumulation and / or lipid droplet dilation in the liver.

[0059] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of the CIDEB protein, the method comprising administering to a subject an effective amount of any embodiment of the dsRNA agent according to the present invention, or any embodiment of any composition according to the present invention, in order to suppress CIDEB gene expression. In some embodiments, the disease, disorder, or condition associated with CIDEB is selected from, but is not limited to, hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, hyperlipidemia, hypertriglyceridemia, and cardiovascular disease, such as aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

[0060] In some embodiments, the method further includes administering an alternative treatment to a subject. In some embodiments, the alternative treatment includes treatment for a CIDEB-related disease or condition. In certain embodiments, the alternative treatment includes administering one or more CIDEB antisense polynucleotides of the present invention to a subject, administering a non-CIDEB dsRNA therapeutic agent to the subject, and a behavioral change in the subject. In some embodiments, non-CIDEB dsRNA therapies include patatin-like phospholipase domain 3 (PNPLA3) inhibitors, hydroxysteroid 17-β dehydrogenase 13 (HSD17B13) inhibitors, antibodies (e.g., anti-CIDEB antibodies), peptide inhibitors (e.g., CIDEB peptide inhibitors), cholesterol-lowering agents, lipid-lowering agents, hypoglycemic agents, HMG-CoA reductase inhibitors (e.g., atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, or simvastatin), triglyceride-lowering agents (e.g., fibrates, nicotinic acid, or fish oil), cholesterol absorption inhibitors (e.g., ezetimibe), MTP inhibitors, FXR agonists (e.g., obeticholic acid), GLP-1 receptor agonists (e.g., For example, semaglutide), SGLT2 inhibitors (e.g., Canagliflozin), DDP-IV inhibitors (e.g., sitagliptin, vildagliptin), THR-β agonists (e.g., resmethylome), SCD1 inhibitors (e.g., Aramchol), PPARα / δ / γ agonists (e.g., Lanifbranor), Galectin-3 inhibitors (e.g., Belapectin), FGF21 analogs (e.g., Pegbelfermin), monoclonal antibody agonists of the β-Klotho / FGFR1c receptor complex (e.g., MK-3655), FASN inhibitors (e.g., TVB-2640), dual GIP and GLP-1 receptor agonists (e.g., tilzepatide, BI456906), HSP47 The dsRNA agent is one or more of the following: siRNA (e.g., BMS-986263), a JNK inhibitor (e.g., CC-90001), an antisense compound targeting ApoB, and an anti-inflammatory agent or any combination thereof. In some embodiments, the dsRNA agent is administered subcutaneously to the subject.In certain embodiments, a dsRNA agent is administered to a subject by IV. In some embodiments, the method further includes determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, the method for determining therapeutic efficacy in the subject includes (i) determining one or more physiological characteristics of a CIDEB-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with baseline physiological characteristics of the CIDEB-related disease or condition before treatment, wherein the comparison indicates one or more of the efficacy, absence, and levels of administering the double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, CIDEB gene expression can be evaluated by the level or level change of any variable related to CIDEB gene expression, such as CIDEB mRNA levels, CIDEB protein levels in a subject, or cholesterol ester (CE), triglyceride (TG) levels, cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) levels in plasma or tissue samples, and / or a decrease in fat accumulation and / or dilation of lipid droplets in the liver. Abbreviations: MTP, triglyceride transfer protein; FXR, farnesol X receptor; GLP-1, glucagon-like peptide-1; SGLT2, sodium glucose cotransporter 2; DDP-IV, dipeptidyl peptidase-4; THR-β, thyroid hormone receptor-β; SCD1, stearoyl coenzyme A desaturase 1; PPAR, peroxisome proliferator-activated receptor; FGF, fibroblast growth factor; FGFR, FGF receptor; FASN, fatty acid synthase; GIP, glucose-dependent insulinotropic polypeptide; HSP, heat shock protein; JNK, Jun N-terminal kinase; Apo, apolipoprotein.

[0061] Another aspect of the present invention provides a method for reducing the level of CIDEB protein in a subject compared to a baseline level of CIDEB protein in the subject before treatment, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent or any embodiment of the composition according to the present invention to reduce the level of CIDEB gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously.

[0062] Another aspect of the present invention provides a method for modifying the physiological characteristics of a CIDEB-related disease or condition in a subject compared to baseline physiological characteristics of the subject before treatment, the method comprising administering to the subject an effective amount of any embodiment of the dsRNA agent according to the present invention or any embodiment of the composition according to the present invention in order to modify the physiological characteristics of the CIDEB-related disease or condition in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or intravenously. In certain embodiments, physiological features include one or more CIDEB mRNA levels, CIDEB protein levels, or cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) levels in a plasma or tissue sample, and / or fat accumulation and / or lipid droplet dilation in the liver.

[0063] According to another aspect of the present invention, the above-mentioned dsRNA agent is provided in a method for treating a disease or condition associated with the presence of the CIDEB protein. In some embodiments, the disease or condition is one or more of the following: hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, hyperlipidemia, hypertriglyceridemia, and cardiovascular disease, for example, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

[0064] According to another aspect of the present invention, an antisense polynucleotide reagent for suppressing CIDEB protein expression is provided, the reagent comprising 10 to 30 consecutive nucleotides, where at least one of the consecutive nucleotides is a modified nucleotide, and the nucleotide sequence of the reagent is approximately 80% complementary in its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one target region of SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1 to 3. In a particular embodiment, the antisense polynucleotide reagent comprises one of the antisense sequences provided in one of Tables 1 to 3.

[0065] Another aspect of the present invention provides compositions comprising any embodiment of the above-described antisense polynucleotide reagent. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises another therapeutic agent for treating one or more CIDEB-related diseases or conditions. In certain embodiments, the composition is packaged in reagent kits, containers, packaging, dispensers, pre-filled syringes or vials. In certain embodiments, the composition is prepared for use in subcutaneous or intravenous administration.

[0066] According to another aspect of the present invention, cells comprising any embodiment of the antisense polynucleotide reagent described above are provided. In some embodiments, the cells are mammalian cells, and optionally human cells.

[0067] Another aspect of the present invention provides a method for suppressing CIDEB gene expression in cells, the method comprising (i) producing cells containing an effective amount of any embodiment of the antisense polynucleotide reagent. In some embodiments, the method further comprises (ii) suppressing CIDEB gene expression in cells by maintaining the cells produced in (i) for a time sufficient to obtain degradation of the mRNA transcript of the CIDEB gene.

[0068] Another aspect of the present invention provides a method for suppressing CIDEB gene expression in a subject, the method comprising administering an effective amount of any embodiment of the antisense polynucleotide reagent to the subject.

[0069] Another aspect of the present invention provides a method for treating a disease or condition associated with the presence of the CIDEB protein, the method comprising administering to a subject an effective amount of any embodiment of the antisense polynucleotide reagent or any composition of the present invention to suppress the expression of the CIDEB gene. In certain embodiments, the disease or condition is one or more of the following: hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, hyperlipidemia, hypertriglyceridemia, and cardiovascular diseases, such as aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

[0070] Another aspect of the present invention provides a method for reducing the level of CIDEB protein in a subject compared to a baseline level of CIDEB protein in the subject before treatment, the method comprising administering to the subject an effective amount of any of the embodiments of the antisense polynucleotide reagent or any of the embodiments of the present invention to reduce the level of CIDEB gene expression. In a particular embodiment, the antisense polynucleotide reagent is administered to the subject subcutaneously or intravenously.

[0071] According to another aspect of the present invention, an antisense polynucleotide reagent for suppressing CIDEB gene expression is provided, the reagent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and the nucleotide sequence of the reagent is approximately 80% or approximately 85% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 in its entire length.

[0072] Another aspect of the present invention provides a method for modifying the physiological characteristics of a CIDEB-related disease or disorder in a subject compared to baseline physiological characteristics of the subject before treatment, the method comprising administering to the subject an effective amount of any embodiment of the antisense polynucleotide reagent or any embodiment of the composition of the present invention to modify the physiological characteristics of the CIDEB disease or disorder in the subject. In some embodiments, the antisense polynucleotide reagent is administered to the subject subcutaneously or intravenously. In some embodiments, the physiological characteristics are one or more of the following in the subject: CIDEB mRNA levels, CIDEB protein levels, or cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST), and / or a decrease in fat accumulation and / or dilation of lipid droplets in the liver. A brief explanation of arrays

[0073] Sequence ID 1 and Sequence ID 2 (reverse complement) are dffa-like effector b(CIDEB) mRNA [NCBI reference sequence: NM_001393339.1] that induce cell death in Homo sapiens.

[0074] Sequence IDs 3 and 4 (reverse complement) are dffa-like effector b(CIDEB) mRNA [NCBI reference sequence: XM_005560976.3] that induce predicted macaque cell death.

[0075] Sequence numbers 5-355 are sense strand sequences, shown in Table 1.

[0076] Sequence IDs 356-706 are antisense strand sequences, shown in Table 1.

[0077] Sequence IDs 707-940 are shown in Table 2, where chemical modifications are represented by uppercase 2'-fluoro, lowercase 2'-OMe, and phosphorothioate '*', where, as can be understood by those skilled in the art, '*' is a symbol representing a linkage, where the presence of '*' indicates that the monomers are linked by a thiophosphodiester bond, where the absence of '*' indicates that the monomers are linked to each other by a phosphodiester bond, and invab represents reverse debasement.

[0078] Sequence IDs 941-1094 are shown in Table 3, and the delivery molecule is represented as "GLX-__" at the 3' or 5' end of each sense chain. Chemical modifications are represented by uppercase: 2'-Fluoro, lowercase: 2'-OMe, and phosphorothioate: *, where, as can be understood by those skilled in the art, "*" is a symbol representing a linkage, where the presence of "*" indicates that the monomers are linked by a thiophosphodiester bond, where the absence of "*" indicates that the monomers are linked to each other by a phosphodiester bond, invab represents reverse debasement, and imann is present at the end of each chain. [ka] Furthermore, when linked to a delivery molecule, [ka] And VPu* is [ka] That is the case. [Modes for carrying out the invention]

[0079] The present invention partially comprises an RNAi agent for suppressing the expression of the dffa-like effector b (CIDEB) gene, which induces cell death, for example, a double-stranded (ds) RNAi agent. The present invention further partially comprises a CIDEB RNAi agent-containing composition and a method of using the composition. The CIDEB RNAi agents disclosed herein can be attached to a delivery compound so as to be delivered to cells, including hepatocytes. The pharmaceutical composition of the present invention may comprise at least one dsRNA CIDEB agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a delivery compound containing GalNAc. The CIDEB RNAi agent delivered to cells reduces the activity of the CIDEB protein product of the gene in the cells by suppressing CIDEB gene expression. The dsRNAi agents of the present invention can be used to treat CIDEB-related diseases and conditions.

[0080] In some embodiments of the present invention, CIDEB expression in cells or subjects is reduced to treat diseases or conditions associated with CIDEB expression in cells or subjects. Non-limiting examples of diseases and conditions that can be treated by reducing CIDEB activity include, but are not limited to, hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, hyperlipidemia, hypertriglyceridemia, and cardiovascular diseases, such as aneurysms, angina pectoris, arrhythmias, atherosclerosis, cerebrovascular disease (stroke), coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, hypercholesterolemia, or other conditions for which reducing CIDEB protein levels and activity would be medically beneficial.

[0081] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, the terms “ribonucleotide” or “nucleotide” may also refer to modified nucleotides, as shown below, or should be understood to be nucleotide analogs. It should be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted by other parts without substantially altering the basic pairing properties of oligonucleotides containing the following substitutional parts. For example, a nucleotide containing inosine as a base can pair with a nucleotide base containing adenine, cytosine, or uracil, but is not limited to these. Therefore, in the nucleotide sequences of the present invention, a nucleotide containing uracil, guanine, or adenine can be substituted with a nucleotide containing inosine, etc. Sequences containing such substitutional parts are examples of the present invention.

[0082] As used herein, the terms “cell death-inducing dffa-like effector b” and “CIDEB” are interchangeable and refer to naturally occurring genes encoding a cell death-inducing dffa-like effector b protein from any vertebrate or mammal, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs. Unless otherwise specified, the terms further refer to fragments and variants of natural CIDEB that retain at least one in vivo or in vitro activity of natural CIDEB. The amino acid and complete coding sequences of the human CIDEB gene reference sequence can be found, for example, at GenBank reference sequence registry number NM_001393339.1 (SEQ ID NO: 1 and SEQ ID NO: 2). The human mammalian ortholog CIDEB gene can be referenced, for example, with reference sequence registration number XM_005560976.3, and the predicted macaque (SEQ ID NOs. 3 and 4). Other examples of CIDEB mRNA sequences can be easily obtained using publicly available databases such as GenBank, UniProt, Ensembl, and OMIM.

[0083] The following describes how to manufacture and use compositions containing CIDEB single-stranded (ssRNA) and dsRNA agents to suppress CIDEB gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by CIDEB gene expression. The term "RNAi" is also known in this field, and is also called "siRNA".

[0084] As used herein, the term “RNAi” includes RNA and refers to reagents that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region is defined as a “target region” or “target portion” and refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed in the gene transcription process, including messenger RNA (mRNA) which is the primary transcript, an RNA processed product. The target portion of the sequence is at least long enough to function as a substrate for performing RNAi directed cleavage in or near that portion. The target sequence may be 8–30 nucleotide lengths (inclusive), 10–30 nucleotide lengths (inclusive), 12–25 nucleotide lengths (inclusive), 15–23 nucleotide lengths (inclusive), 16–23 nucleotide lengths (inclusive), or 18–23 nucleotide lengths (inclusive), including all relatively short lengths within each specified range. In some embodiments of the present invention, the length of the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In certain embodiments, the length of the target sequence is between 9 and 26 nucleotides (including both endpoints), encompassing all subranges and integers within that range. For example, but not intended to be limiting, in certain embodiments of the present invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, and its sequence is at least partially, completely, or at least fundamentally complementary to the RNA transcript of the CIDEB gene. Some aspects of the present invention include a pharmaceutical composition comprising one or more CIDEB dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the present invention, the CIDEB RNAi described herein suppresses the expression of the CIDEB protein.

[0085] As used herein, “dsRNA reagent” refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or repressing the translation of a target mRNA transcript. While not intending to limit ourselves to any particular theory, the dsRNA reagents of the present invention may function by an RNA interference mechanism (i.e., by inducing the production of RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Methods for achieving gene silencing in plant, invertebrate, and vertebrate cells are known in the art (see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the respective disclosures of which are incorporated herein by reference in their entirety. Gene silencing methods known in the art can be used in combination with the disclosures provided herein to achieve suppression of CIDEB expression.

[0086] The dsRNA agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, short interfering RNA (siRNA), RNAi reagents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the targeted mRNA. In the art, it should be understood that dsRNA double-stranded structures of different lengths can be used to suppress target gene expression. For example, dsRNA double-stranded structures with 19, 20, 21, 22, and 23 base pairs are known to be able to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference. As used herein, the terms “double-stranded region,” “double-stranded region,” and “complementary region” are interchangeable and refer to regions in which the sense strand, known in the art, is completely or essentially completely complementary to the antisense strand. The CIDEB dsRNA in certain embodiments of the present invention may include at least one strand having a length of at least 21 nt, or it may have a shorter double-stranded body based on one of the sequences listed in any one of Tables 1-3, but it may be effective to reduce one, two, three, or four nucleotides at one or two ends compared to the dsRNAs listed in Tables 1-3, respectively. In some embodiments of the present invention, the CIDEB dsRNA agent may have a portion of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotide sequences of one or more sequences shown in Tables 1-3, and its ability to suppress CIDEB gene expression differs from the suppression level of dsRNA containing the complete sequence by 5%, 10%, 15%, 20%, 25%, or 30% or less. In this specification, the sense sequences, antisense sequences, and double-stranded bodies disclosed in Tables 1-3 are also referred to as “parent” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, or lengthened, or may include substitutions.As described herein, the obtained sequences retain the effectiveness of all or at least part of their parent sequences in the methods and compositions of the present invention. The sense strand and antisense strand to be included in the dsRNA of the present invention are selected independently. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of other elements. For example, though not intended to be limiting, when producing the dsRNA of the present invention, two strands of “elements” may be selected to be included in a double-stranded body. With respect to one selective element, the sense sequence may be SEQ ID NO: 707 (shown in Table 2), while with respect to another selective element, the antisense sequence may be SEQ ID NO: 824, or a modified SEQ ID NO: 824, which, compared to its parent SEQ ID NO: 824, is shortened, lengthened, and / or contains one, two, or three substitutions. It should be understood that the double-stranded bodies of the present invention do not necessarily need to contain both the sense and antisense sequences shown in the pairings in the double-stranded bodies in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO: 707.

[0087] Specific embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or single-stranded RNA administered to a subject. For example, the antisense strand may be in the composition, such as the antisense strands listed in any one of Tables 1-3, or may be administered to a subject in the composition to reduce CIDEB polypeptide activity and / or CIDEB gene expression in the subject. Tables 1-3 show the core extension nucleotide sequences of the antisense and sense strands of specific CIDEB dsRNA agents. Single-stranded antisense molecules contained in specific compositions of the present invention and / or administered in specific methods of the present invention are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents.” Single-stranded sense molecules contained in specific compositions of the present invention and / or administered in specific methods of the present invention are referred herein as “single-stranded sense reagents” or “sense polynucleotide reagents.” The term “nucleotide sequence” herein refers to a polynucleotide sequence that is free from chemical modifications or delivery compounds. For example, the sense strand GUUACUCAGGUCAGUAUCUAA (SEQ ID NO: 10) shown in Table 1 is the nucleotide sequence of SEQ ID NO: 712 in Table 2 and SEQ ID NO: 941 in Table 3, where SEQ ID NO: 712 and SEQ ID NO: 941 indicate their chemical modifications and delivery compounds. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be labeled with "sense strand SS#", a single-stranded antisense sequence may be labeled with "antisense strand AS#", and a double-stranded compound containing the sense strand and antisense strand may be labeled with "double-stranded compound AD# / AV#".

[0088] Table 1 includes sense strands and antisense strands, and provides the label numbers for the double-stranded bodies formed by the sense strands and antisense strands in the same row of Table 1. Sense strand sequence numbers 239-355 include random nucleic acid bases (n) at positions 1, 2, 3 and 21 from the 5' end. Antisense strand sequence numbers 590-706 include random nucleic acid bases (n) at positions 1, 19, 20 and 21 from the 5' end. In certain embodiments of the present invention, the antisense sequence includes nucleic acid base u or nucleic acid base a located at position 1 of the antisense sequence. In certain embodiments of the present invention, the antisense sequence includes nucleic acid base u located at position 1 of the antisense sequence. In the sequences shown in Table 1, "n" may be any one of the nucleotides including nucleic acid bases a, u, c, g and t, and may be independently selected in the sense strand and antisense strand, and each "n" in the sense strand or antisense strand may be homologous or different. When used in the context of "n" in sense and antisense strands, the nucleic acid base "n" at the sense strand position is to be understood as selecting and containing a different nucleic acid base sense strand pair from "n" in the antisense strand, but usually complementary to the nucleic acid base "n" at the matching position of the opposite strand. As used herein, the term "matching position" in sense and antisense strands refers to the position where the two strands "pair" when the two strands form a distrand. For example, in 21 nucleic acid base sense strands and 21 nucleic acid base antisense strands, the nucleic acid base at position 1 of the sense strand and the nucleic acid base at position 21 of the antisense strand are in a "matching position". In another non-limiting example, in 23 nucleic acid base sense strands and 23 nucleic acid base antisense strands, the nucleic acid base 2 of the sense strand and position 22 of the antisense strand are in a matching position. In yet another non-limiting example, in 18 nucleic acid base sense strands and 18 nucleic acid base antisense strands, the nucleic acid base at position 1 of the sense strand and nucleic acid base 18 of the antisense strand are in a matching position, and nucleic acid bases 4 and 15 of the sense strand are also in a matching position. This is a positional matching in the antisense strand.Those skilled in the art will understand how to identify, or become, matching positions in the sense and antisense strands of a double-stranded body and its paired strand.

[0089] (n) may be any one of a, u, c, g, or t, but "n" at position 1 of the sense strand is usually complementary to (n) at position 21 of the antisense strand. In two non-limiting examples, (1) when position 1 of the sense strand is "g", position 21 of the antisense strand is "c", and (2) when position 1 of the sense strand is "a", position 21 of the antisense strand is "u" or "t". This type of complementary matching pairing applies to (n) at position 2 of the sense strand and position 20 of the antisense strand, and to (n) at position 21 of the sense strand and position 1 of the antisense strand. n may be any nucleotide at these positions, but it should be understood that the nucleotides of the sense strand and antisense strand are usually complementary (matched), however, in certain embodiments they may have mispairs. For example, without intending to limit, in some embodiments "n" may be "random", i.e., complementary, but not necessarily. In certain embodiments, "n" is complementary. In a non-limiting example, "n" at the position of antisense chain 1 is "u", and "n" at the position of sense chain 21 is "a". Those skilled in the art will understand how to identify, or become, matching positions in the sense and antisense chains of the double-stranded body and the paired chain.

[0090] The last column of Table 1 indicates the AD# of a bistranded body, and the sense sequence and antisense sequence of that bistranded body are included in the same row of the table. For example, Table 1 discloses a bistranded body designated AD#AD01474.um, which includes sense sequence number 5 and antisense sequence number 356. Thus, each row of Table 1 labels a bistranded body of the present invention, the sense and antisense sequences included in each row are shown in the same row, and the designating identifier of each bistranded body is shown in the last column of that row.

[0091] In some embodiments of the method of the present invention, an RNAi agent containing a polynucleotide sequence shown in any one of Tables 1 to 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a double-stranded body, which contains at least one nucleotide sequence listed in Table 1 and includes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, the RNAi agent containing the polynucleotide sequence shown in Tables 1 to 3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound containing a GalNAc compound or a GLS-15 compound.

[0092] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] Table 2-10 Table 2-11

[0093] Table 2 shows the antisense and sense strand sequences of specific chemically modified CIDEB RNAi agents of the present invention. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject includes a double-stranded body labeled in the first row of the first column of Table 2, and includes the sequence modifications shown in the sense strand and antisense strand sequences in the same row of the third column of Table 2. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be conjugated (also referred to herein as "conjugated") to a compound that can deliver the RNAi agent to cells and / or tissues in the subject. Non-limiting examples that can be used as delivery compounds in specific embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15. In Table 2, the first column shows the double-stranded AV# of the nucleotide sequence shown in Table 1. Table 2 discloses the double-stranded AV# and further shows the chemical modifications included in the sense and antisense sequences of the double-stranded product. For example, Table 1 shows the single-stranded base sequences of SEQ ID NO: 10 (sense) and SEQ ID NO: 361 (antisense), which together form a double-stranded product labeled Duplex AD#AD01479.um, and Table 2 lists the double-stranded AV#AV01479, which shows the double-stranded products of SEQ ID NO: 712 and SEQ ID NO: 829, which contain the base sequences of SEQ ID NO: 10 and SEQ ID NO: 361, respectively, and have the following chemical modifications, with the antisense sequences shown in the 3rd and 6th columns, respectively. The "Sense Strand SS#" in the 2nd column of Table 2 is the identifier assigned to the sense sequence (including modifications) shown in the 3rd column of the same row. The "Antisense Strand AS#" in the 5th column of Table 2 is the identifier assigned to the antisense sequence (including modifications) shown in the 6th column.

[0094] [Table 3-1] Table 3-2 Table 3-3 Table 3-4

[0095] Fhyou 4 The table shows the antisense and sense strand sequences of a specific chemically modified CIDEB RNAi agent of the present invention. In some embodiments of the method of the present invention, the RNAi agent shown in Table 3 is administered to cells and / or subjects. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequence shown in Table 3 is administered to subjects. In some embodiments of the present invention, the RNAi agent administered to the subjects comprises a double-stranded body labeled in the first row of the first column of Table 3, and comprises the sequence modifications and / or delivery compounds shown in the sense strand and antisense strand sequences in the third and sixth columns of the same row of Table 3, respectively. These sequences are used in specific in vivo study research described elsewhere in this specification. In some embodiments of the method of the present invention, the sequences shown in Table 3 may be conjugated to a compound used for delivery, a non-limiting example of which is a compound containing GalNAc, where the delivery compound is labeled as "GLX-n" in the sense strand in the third column of Table 3. As used herein, "GLX-n" represents a "GLS-n" or "GLO-n" delivery compound (where "X" may be "S" or "O"), and GLX-0 may be any "GLS-n" or "GLO-n" delivery compound, which may be attached to the 3' end of an oligonucleotide during the synthesis process. As used herein and as shown in Table 3, "GLX-n" can be used to indicate a compound containing GalNAc linked thereto, which is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is provided elsewhere in this specification.Those skilled in the art can manufacture and use the dsRNA compounds of the present invention, wherein the ligated delivery compound is one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-stranded AD# assigned to the double-stranded sense and antisense sequences in the corresponding row of the table. For example, the double-stranded compound AD#AD00898 is a double-stranded compound of sense strand SEQ ID NO: 941 and antisense strand SEQ ID NO: 979. Each row in Table 3 provides a sense strand and an antisense strand, and discloses the double-stranded compounds of the sense strand and antisense strand. The "Sense Strand SS#" in the second column of Table 3 is an identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The "Antisense Strand AS#" in the fifth column of Table 3 is a designating identifier for the antisense sequence (including modifications) shown in the sixth column. Identifiers for specific linked GalNAc-containing "GLO-n" or "GLS-n" compounds are shown as GLS-5, GLS-15, or GLX-0, and other "GLO-n" or "GLS-n" compounds may be substituted for the GLO-0 compound, and the resulting compounds should be understood to be included in embodiments of the methods and / or compositions of the present invention.

[0096] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]

[0097] In certain embodiments of the present invention, the dsRNA (also referred to herein as the “double-stranded DNA”) is a dsRNA disclosed in one of Tables 1 to 3. Each row in Tables 1 to 3 discloses a double-stranded DNA comprising the sense strand sequence and antisense strand sequence of the row in the table. In addition to the double-stranded DNA disclosed in Tables 1 to 3, in some embodiments the double-stranded DNA of the present invention may include the sense and antisense sequences shown in Tables 1 to 3, which differ from the sequences shown in Tables 1 to 3 by 0, 1, 2, or 3 nucleotides. Thus, as a non-limiting example, in some embodiments the antisense strand in the double-stranded DNA of the present invention may be SEQ ID NOs: 979, 980, 981, 982, 983, 984, 985, or 986, which differ from the nucleotides in SEQ ID NOs: 979, 980, 981, 982, 983, 984, 985, or 986 by 0, 1, 2, or 3 nucleotides, respectively.

[0098] It should be understood that the sense strand sequence and antisense strand sequence in the double-stranded form of the present invention can be selected independently. Therefore, the dsRNA of the present invention may include the sense strand and antisense strand of the double-stranded form disclosed in a row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or two of the sense strand and antisense strand selected for the dsRNA may include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense sequences may contain nucleic acid base substitutions derived from one, two, three or more parent sequences. In some embodiments, the selected sequences may be longer or shorter than their parent sequences. Therefore, the dsRNA agents included in the present invention may, but may not necessarily, include the precise sequences of the sense and antisense pairs disclosed as double-stranded forms in Tables 1-3.

[0099] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the nucleotide positions 2-18 of the antisense strand comprise a region complementary to the CIDEB RNA transcript, where the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprises a target ligand. In some cases, the region complementary to the CIDEB RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by 3 or fewer nucleotides from one of the antisense sequences listed in Tables 1-3. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is essentially complementary to at least one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is fully complementary to any one of the target regions of Sequence ID No. 1 and is provided in any one of Tables 1 to 3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is at least fundamentally complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1 to 3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence listed in any one of Tables 1 to 3. Some embodiments of the dsRNA agent of the present invention include a sense strand and an antisense strand disclosed as a double-stranded body in any one of Tables 1 to 3. As described herein, it should be understood that the sense strand and antisense strand in the double-stranded body of the present invention can be independently selected.

[0100] Mismatch As is known to those skilled in the art, mispairs, particularly those within the terminal region of the dsRNA, are acceptable for the efficacy of dsRNA. Tolerance to specific mispairs is better; for example, tolerance to mispairs having fluctuating base pairs G:U and A:C is better for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the CIDEB dsRNA reagent may contain one or more mispairs with the CIDEB target sequence. In some embodiments, the CIDEB dsRNA reagent of the present invention does not contain mispairs. In certain embodiments, the CIDEB dsRNA reagent of the present invention contains one or fewer mispairs. In some embodiments, the CIDEB dsRNA reagent of the present invention contains two or fewer mispairs. In certain embodiments, the CIDEB dsRNA reagent of the present invention contains three or fewer mispairs. In some embodiments of the present invention, the antisense strand of the CIDEB dsRNA reagent contains mispairs with CIDEB target sequences that are not located in the center of the complementary region. In some embodiments, the antisense strand of the CIDEB dsRNA reagent contains one, two, three, four or more mispairs located within the last five, four, three, two, or one nucleotide of one or both of the 5' or 3' ends of the complementary region. Methods described herein and / or methods known in the art can be used to determine whether a CIDEB dsRNA reagent containing mispairs with CIDEB target sequences effectively suppresses the expression of the CIDEB gene.

[0101] Complementarity Where used herein, unless otherwise specified, the term “complementary” refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize [form interbase-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)] and form a double-stranded or double-helical structure, when used to describe a first nucleotide sequence (e.g., the sense strand of a CIDEB dsRNA agent or target CIDEB mRNA) or a single-stranded antisense polynucleotide related to a second nucleotide sequence (e.g., the antisense strand of a CIDEB dsRNA agent), and to form a double-stranded or double-helical structure under specific conditions. Other conditions may be applied, such as physiologically relevant conditions that may be encountered within an organism. Those skilled in the art can determine from the final application of the hybridized nucleotides the optimal set of conditions for testing the complementarity of the two sequences. The complementary sequences include natural or modified nucleotides or nucleotide mimeographs that include Watson-Crick base pairs or non-Watson-Crick base pairs and reach at least the extent to satisfy the above hybridization requirements. Sequence identity or complementarity is not related to modification.

[0102] For example, complementary sequences within CIDEB dsRNA as described herein include base pairings of one or two nucleotide sequences over the full length of an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence. Such sequences may be referred to herein as “fully complementary.” In embodiments in which two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, it should be understood that, for the purpose of determining complementarity, such overhangs are not considered mispairs herein. For example, in a CIDEB dsRNA agent comprising one oligonucleotide having a length of 19 nucleotides and another oligonucleotide having a length of 20 nucleotides, where the relatively longer oligonucleotide contains a sequence of 19 nucleotides that is fully complementary to the relatively shorter oligonucleotide, and may be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in the contiguous sequence of the first polynucleotide hybridize with the same number of bases in the contiguous sequence of the second polynucleotide. The consecutive sequences may include all or part of the first or second nucleotide sequence.

[0103] As used herein, the term “basically complementary” means that in a hybridization nucleic acid sequence pair, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the contiguous sequence of the first polynucleotide, but not all of the bases, hybridize with the same number of bases in the contiguous sequence of the second polynucleotide. When two sequences contain one or more mispaired base pairs, e.g., at least 1, 2, 3, 4, or 5, during hybridization, the term "basically complementary" refers to a double-stranded matrix in which the first sequence forms 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) compared to the second sequence, while simultaneously retaining the ability to hybridize under these conditions is most relevant to its ultimate application, such as the repression of CIDEB gene expression via the RISC pathway.

[0104] The term “partially complementary” means, as used herein, that in a pair of nucleic acid base sequences of hybridization, at least 75% but not all of the bases in the contiguous sequence of the first polynucleotide hybridize with the same number of bases in the contiguous sequence of the second polynucleotide. In some embodiments, “partially complementary” means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the contiguous sequence of the second polynucleotide hybridize with the same number of bases in the contiguous sequence of the second polynucleotide.

[0105] The terms “complementary,” “fully complementary,” “basically complementary,” and “partially complementary” refer, in this specification, to base pairings between the sense strand and antisense strand of a CIDEB dsRNA agent, between the antisense strand of a CIDEB dsRNA agent and the sequence of the target CIDEB mRNA, or between a single-stranded antisense oligonucleotide and the sequence of the target CIDEB mRNA. The term “antisense strand of a CIDEB dsRNA agent” should be understood to refer to the same sequence of a “CIDEB antisense polynucleotide reagent.”

[0106] As used herein, the terms “basically the same” or “basically identical” as used with nucleic acid sequences mean that a nucleic acid sequence has at least about 85% or more sequence identity with respect to a reference sequence, preferably containing sequences with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. The percentage of sequence identity is determined by comparing two sequences of optimal alignment across an alignment window. The percentage can be calculated by determining the number of positions in which the same nucleic acid bases appear in the two sequences to generate the number of matching positions, dividing the number of matching positions by the total number of positions in the alignment window, then multiplying the result and dividing by 100 to obtain the percentage of sequence identity. The inventions disclosed herein cover the basic same nucleotide sequences disclosed herein, for example, shown in Tables 1-3. In some embodiments, the sequences disclosed herein are exactly the same, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% are the same as those disclosed in Tables 1-3 herein.

[0107] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing a nucleotide chain described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term “double-stranded RNA” or “dsRNA” refers to an RNAi containing an RNA molecule or molecular complex having a hybridization double-stranded region, the hybridization double-stranded region comprising two antiparallel and essentially or completely complementary nucleic acid strands, which are said to have “sense” and “antisense” directions with respect to the target CIDEB RNA. The double-stranded region may be of any length that allows for the specific degradation of the desired target CIDEB RNA by the RISC pathway, but is generally in the length range of 9 to 30 base pairs, for example, 15 to 30 base pairs. Considering the distrands between 9 and 30 base pairs, the distrands may be of any length within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and any subrange thereof, such as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs This includes, but is not limited to, base pairs of 1, 18-22, 18-21, 18-20, 19-30, 19-26, 19-23, 19-22, 19-21, 19-20, 20-30, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-26, 21-25, 21-24, 21-23, or 21-22. The length of CIDEB dsRNA reagents generated in cells by treatment with Dicer and similar enzymes is typically in the range of 19-22 base pairs.One strand of the double-stranded region of the CIDEB dsDNA agent contains a sequence that is essentially complementary to the region of the target CIDEB RNA. The two strands forming the double-stranded structure can originate from a single RNA molecule having at least one self-complementary region, or can be formed from two or more individual RNA molecules. When the double-stranded region is formed from two strands of a single molecule, the molecule may have a double-stranded region separated from a single-stranded nucleotide chain (referred to herein as a "hairpin ring") that forms the double-stranded structure between the 3' end of one strand and the corresponding 5' end of the other strand. In some embodiments of the present invention, the hairpin ring contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. If the two essentially complementary strands of a CIDEB dsRNA agent consist of single RNA molecules, these molecules do not require covalent bonding, but may be covalently bonded. When the two strands are covalently bonded by means other than a hairpin ring, the bonding structure is called a “linker.” In this specification, the term “siRNA” refers to the dsRNA agents described herein.

[0108] In some embodiments of the present invention, the CIDEB dsRNA agent may contain sense and antisense sequences that do not have unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA agent. Ends that do not have unpaired nucleotides are called "blunt ends" and do not have nucleotide overhangs. When both ends of a dsRNA reagent are blunt ends, the dsRNA is called a "blunt-ended" dsRNA. In some embodiments of the present invention, the first end of the dsRNA agent is blunt, in some embodiments the second end of the dsRNA agent is blunt, and in certain embodiments of the present invention both ends of the CIDEB dsRNA agent are blunt.

[0109] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, at least one unpaired nucleotide is present at the end of the dsRNA strand. For example, if the 3' end of one strand of dsRNA extends from the 5' end of another strand, a nucleotide overhang is present, and vice versa. The dsRNA may contain at least one, two, three, four, five, six or more nucleotide overhangs. The nucleotide overhangs may contain or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. In some embodiments, the nucleotide overhangs are located on the sense strand of the dsRNA agent, the antisense strand of the dsRNA agent, or both ends of the dsRNA agent, and the nucleotides of the overhangs may be located at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In certain embodiments of the present invention, one or more nucleotides of the overhangs are replaced by phosphorothioate nucleosides.

[0110] As used herein, the terms “antisense strand” or “guide strand” refer to a strand of the CIDEB dsRNA agent containing a region that is essentially complementary to the CIDEB target sequence. As used herein, the terms “sense strand” or “passenger strand” refer to a strand of the CIDEB dsRNA agent containing a region that is essentially complementary to the region of the antisense strand of the CIDEB dsRNA agent.

[0111] qualification In some embodiments of the present invention, the RNA of the CIDEB RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in specific embodiments of the present invention can be synthesized and / or modified by methods well established in the art, for example, “Current protocols in Nucleic Acid Chemistry,” Beaucage, Slet al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications that may be present in specific embodiments of the CIDEB dsRNA agent of the present invention include, for example, (a) terminal modifications such as 5'-end modifications (phosphorylation, conjugate, reverse bond, etc.) and 3'-end modifications (conjugate, DNA nucleotide, reverse bond, etc.); (b) base modifications such as removing a base (debasing nucleotide) or conjugating a base with a base substitution that base pairs with a stable base, an unstable base, or an extended partner library; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions; and (d) skeletal modifications including modifications or substitutions of phosphodiester bonds. Specific examples of RNA compounds that can be used in specific embodiments of the CIDEB dsRNA agent, CIDEB antisense polynucleotide, and CIDEB sense polynucleotide of the present invention include, but are not limited to, RNAs that include a modified backbone or RNAs that do not include natural nucleoside bonds. As a non-limiting example, RNA having a modified backbone may not have a phosphorus atom in the backbone. RNA that does not have a phosphorus atom in its internucleoside skeleton can be called an oligonucleoside. In a particular embodiment of the present invention, the modified RNA has a phosphorus atom in its internucleoside skeleton.

[0112] The terms “RNA molecule” or “RNA” or “ribonucleic acid molecule” should be understood to cover not only naturally expressed or found RNA molecules, but also RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives, as described herein or known in the art. The terms “ribonucleoside” and “ribonucleotide” can be used interchangeably herein. RNA molecules can be modified in their nucleic acid base structure or ribose-phosphate backbone structure, for example, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double-stranded structures. As a non-limiting example, an RNA molecule may further include at least one modified ribonucleoside, including, but not limited to, 2'-O-methyl-modified nucleosides, nucleosides containing a 5'-phosphorothioate group, terminal nucleosides linked to cholesterol derivatives or dodecanoate bisdecanamide groups, locked nucleosides, debased nucleosides, 2'-deoxy-2'-fluoro-modified nucleosides, 2'-amino-modified nucleosides, 2'-alkyl-modified nucleosides, morpholino nucleosides, non-natural bases containing phosphoramidates or nucleosides, or any combination thereof. In some embodiments of the present invention, the RNA molecule contains the full-length modified ribonucleosides of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more CIDEB dsRNA drug molecules. The modifications of each of these multiple modified ribonucleosides in the RNA molecule do not necessarily have to be identical.

[0113] In some embodiments, the dsRNA agent, CIDEB antisense polynucleotide and / or CIDEB sense polynucleotide of the present invention may include one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. As used herein, the terms “nucleotide linkage linkage,” “nucleoside linkage linkage,” “linkage linkage,” and “linker” are interchangeable and refer to linkages between modified or unmodified nucleotides and / or between modified or unmodified nucleotides and one or more target groups. In certain embodiments, the linkage linkage may be independently selected from phosphodiester (PO) bonds, phosphorothioate (PS) bonds, and / or phosphorodithioate (PS2) bonds between two nucleotides at any position in a single-stranded or double-stranded oligonucleotide. As used herein, the term “independently selected” refers to selective elements such as modified nucleotides and nonphosphodiester bonds, and that two or more selective elements may be the same as, but not necessarily the same as, each other.

[0114] As used herein, “nucleotide base,” “nucleotide,” or “nucleic acid base” refers to heterocyclic pyrimidine or purine compounds, which are standard components of all nucleic acids, and includes nucleotide-forming bases such as adenine, guanine, cytosine, thymine, and uracil. Nucleic acid bases may be further modified to include universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases, but this is not intended to limit them. The terms “ribonucleotide” or “nucleotide” refer herein to unmodified nucleotides, modified nucleotides, or the substituted portion of a substitution. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted by other portions without fundamentally altering the base-pairing properties of oligonucleotides containing such substituted portions.

[0115] As used herein, “optionally” or “optionally” means that the events or circumstances described thereafter may occur, but are not necessarily so, and includes both the places where the events or circumstances may occur and the places where they do not. For example, “C1-6 alkyl group optionally substituted with halogen or cyano group” means that a halogen or cyano group may be present, but is not necessarily so, and includes both cases where the alkyl group is substituted with a halogen or cyano group and cases where the alkyl group is not substituted with a halogen or cyano group.

[0116] When used herein, in the chemical structure of the compound of the present invention, [ka] This bond represents an unspecified stereoconfiguration, that is, if chiral isomers exist in the chemical structure. [ka] The combination is " [ka] " or " [ka] It could be " or both could be " [ka] " and " [ka] There are two arrangements of “”. For simplicity, some parts of the above structural formula are described in several isomeric forms, but the present disclosure may include all isomers such as tautomers, rotational isomers and mixtures thereof. Suitable chiral compounds include geometric isomers, diastereomers, racemates and enantiomers.

[0117] As used herein, according to the scope of the invention described herein, the chemical formula “

Chem.

Chem.

[0118] In one embodiment, the modified RNA used in the methods and compositions described herein is expected to be a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and enables or mediates the specific degradation of target RNA by the RISC pathway. In certain embodiments of the invention, the CIDEB RNA interference agent comprises single-stranded RNA that interacts with the target CIDEB RNA sequence to direct cleavage of the target CIDEB RNA.

[0119] Modified RNA backbone may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thiophosphoramidates, thioalkyl phosphonates, thioalkyl phosphate triesters, and borate phosphates having normal 3'-5' linkages, their 2'-5' linkage analogs, and those having opposite polarity due to adjacent nucleoside unit pairs being linked from 3'-5' to 5'-3' or 2'-5' to 5'-2'. Further include various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing conjugates are common practice in the art, and such methods can be used to produce specific modified CIDEB dsRNA agents, specific modified CIDEB antisense polynucleotides, and / or specific modified CIDEB sense polynucleotides of the present invention.

[0120] Modified RNA skeletons that do not contain phosphorus atoms have skeletons formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclyl nucleoside bonds. These include, namely, morpholine bonds (partially formed from the sugar portion of a nucleoside), siloxane skeletons, sulfides, sulfoxides and sulfone skeletons, methylacetyl (formacetyl) and thiomethylacetyl skeletons, methylenemethylacetyl and thiomethylacetyl skeletons, olefin-containing skeletons, sulfamic acid ester skeletons, methylene imino and methylenehydrazino skeletons, sulfonic acid esters and sulfonamide skeletons, amide skeletons, and other parts having a mixture of N, O, S and CH2 components. Methods for producing modified RNA skeletons that do not contain phosphorus atoms are common practice in the art, and such methods can be used to produce specific modified CIDEB dsRNA agents, specific modified CIDEB antisense polynucleotides, and / or specific modified CIDEB sense polynucleotides of the present invention.

[0121] In certain embodiments of the present invention, the RNA mimeographs include, but are not limited to, CIDEB dsRNA, CIDEB antisense polynucleotides, and / or CIDEB sense polynucleotides, in which, for example, the sugar-nucleoside bonds of the nucleotide units, i.e., the backbone, are replaced with new groups. In such embodiments, the base units are maintained for use in hybridization with appropriate CIDEB nucleic acid target compounds. Such oligomeric compounds, i.e., RNA mimeographs, have been shown to have excellent hybridization properties and are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleic acid bases are retained and directly or indirectly bonded to the aza nitrogen atoms of the amide portion of the backbone. Means for producing RNA mimeographs are commonly practiced in the art, and such methods can be used to produce the specific modified CIDEB dsRNA agents of the present invention.

[0122] Some embodiments of the present invention include RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as the methylene group (methylimino group) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2- [where the natural phosphodiester backbone is represented as -OPO-CH2-]. Methods for producing RNA having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are common practices in the art, and such methods can be used to produce certain modified CIDEB dsRNA agents, certain CIDEB antisense polynucleotides and / or certain CIDEB sense polynucleotides of the present invention.

[0123] The modified RNA may further contain one or more substituted sugar moieties. The CIDEB dsRNA, CIDEB antisense polynucleotide and / or CIDEB sense polynucleotide of the present invention may contain at the 2' position one of OH, F, O-, S- or N-alkyl groups, O-, S- or N-alkenyl groups, O-, S- or N-alkynyl groups, or O-alkyl-O-alkyl groups, where the alkyl group, alkenyl group and alkynyl group may be substituted or unsubstituted C1-C 10 Alkyl alkyl group or C2-C 10 The group may be an alkenyl group or an alkynyl group. An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)2 is included, where n and m are 1 to about 10. In other embodiments, dsRNA has C1-C at the 2' position. 10The group comprises a lower alkyl group, a substituted lower alkyl group, an alkylaryl group, an aralkyl group, an O-alkylaryl group or an O-aralkyl group, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, a heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleavage group, a reporter group, an intercalator agent, a group for improving the pharmacokinetic properties of a CIDEB dsRNA agent, or one of the groups for improving the pharmacokinetic properties of a CIDEB dsRNA agent, a CIDEB antisense polynucleotide and / or a CIDEB sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (also known as 2'-O-CH2CH2OCH3, 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy group-alkoxy group. Another exemplary modification is the 2'-dimethylaminoethoxyethoxy group, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below, and the 2'-dimethylaminoethoxyethoxy group (also known as 2'-dimethylaminoethoxyethoxy group) (also known as 2'-DMAOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for producing modified RNA are common practices in the field, as described, for example, and such methods can be used to produce the specific modified CIDEB dsRNA agents of the present invention.

[0124] Other modifications include 2'-methoxy(2'-OCH3), 2'-aminopropoxy(2'-OCH2CH2CH2NH2), and 2'-fluoro(2'-F). Similar modifications can be made at other positions in the RNA of the CIDEB dsRNA agent, CIDEB antisense polynucleotide, and / or CIDEB sense polynucleotide of the present invention, particularly at the 3' position of the sugar in the 3' terminal nucleotide, or at the 5' position of the CIDEB dsRNA, CIDEB antisense polynucleotide, or CIDEB sense polynucleotide linked from 2' to 5', and the 5' position of the 5' terminal nucleotide. The CIDEB dsRNA agent, CIDEB antisense polynucleotide, and / or CIDEB sense polynucleotide may also have a sugar mimetic, such as a cyclobutyl group moiety instead of pentofuranose sugar. Methods for producing modified RNA are common practices in the art, as described, for example, and such methods can be used to produce the specific modified CIDEB dsRNA agents, CIDEB antisense polynucleotides and / or CIDEB sense polynucleotides of the present invention.

[0125] In some embodiments, the CIDEB dsRNA agent, CIDEB antisense polynucleotide and / or CIDEB sense polynucleotide may include modifications or substitutions of nucleic acid bases (usually abbreviated as “bases” in the art). As used herein, “unmodified” or “natural” nucleic acid bases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleic acid bases include several other synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl derivatives and other alkyl derivatives of adenine and guanine, 2-propyl derivatives and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, and cytosine. and also include thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogens, 8-amino groups, 8-thiols, 8-thioalkyl groups, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogens, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.Other nucleic acid bases included in specific embodiments of the CIDEB dsRNA agent of the present invention are known in the art, see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, STand Lebleu, B., Ed., CRC Publishing, 1993. Methods for producing dsRNA, CIDEB antisense-strand polynucleotides, and / or CIDEB sense-strand polynucleotides containing nucleic acid base modifications and / or substitutions (e.g., those described herein) are common practice in the art, and such methods can be used to produce the specific modified CIDEB dsRNA agents, CIDEB sense polynucleotides, and / or CIDEB antisense polynucleotides of the present invention. Teachings for the synthesis of specific modified oligonucleotides can be found in the following U.S. patents: U.S.Pat. No. 5,218,105 describes polyamine-conjugated oligonucleotides; U.S.Pat. No. 5,541,307 describes oligonucleotides with skeletal modifications; U.S.Pat. No. 5,521,302 describes a process for producing oligonucleotides with chiral phosphorus links; U.S.Pat. No. 5,539,082 describes peptide nucleic acids; U.S.Pat. No. 5,554,746 describes oligonucleotides with a trilactam skeleton. USPat. No. 5,571,902 describes the synthesis methods and materials for oligonucleotides.USPat. No. 5,578,718 describes nucleosides having alkylthio groups, which can be used as linkers to other parts attached at any position on the nucleoside. USPat. No. 5,587,361 describes oligonucleotides with phosphorothioate linkages having high chiral purity. USPat. No. 5,506,351 describes the manufacturing process for 2'-O-alkylguanosine and related compounds, including 2,6-diaminopurine compounds. USPat. No. 5,587,469 describes oligonucleotides containing N-2 substituted purines. USPat. No. 5,587,470 describes oligonucleotides containing 3-deazapurine. USPat. No. 5,608,046 describes conjugated 4'-desmethyl nucleoside analogs. USPat. No. 5,610,289 describes oligonucleotide analogs with skeletal modifications. USPat. No. 6,262,241 describes methods for synthesizing 2'-fluoro-oligonucleotides and other related matters.

[0126] Certain embodiments of the CIDEB dsRNA agent, CIDEB antisense polynucleotide, and / or CIDEB sense polynucleotide of the present invention include RNA having one or more locked nucleic acids (LNAs) that are modified. A locked nucleic acid is a nucleotide having a modified ribose moiety that includes additional crosslinks linking the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. By adding locked nucleic acids to the CIDEB dsRNA agents, CIDEB antisense polynucleotides, and / or CIDEB sense polynucleotides of the present invention, serum stability can be increased and off-target effects can be reduced (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O. R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for producing dsRNA agents, CIDEB antisense polynucleotides, and / or CIDEB sense polynucleotides containing locked nucleic acids are common practice in the art, and such methods can be used to produce the specific modified CIDEB dsRNA agents of the present invention.

[0127] Specific embodiments of the CIDEB dsRNA compounds, sense polynucleotides and / or antisense polynucleotides of the present invention include 2'-O-methylnucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'-3'-seconucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides and 3'-OMe nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing vinyl phosphonates, nucleotides containing adenosine glycol nucleic acid (GNA), and thymidine glycol nucleic acid s-heteronucleotides. The compound comprises at least one modified nucleotide, including a nucleotide containing a nucleotide, a nucleotide containing 2-hydroxymethyltetrahydrofuran-5-phosphate, a nucleotide containing 2'-deoxythymidine-3'-phosphate, a nucleotide containing 2'-deoxyguanosine-3'-phosphate, a nucleotide containing 2'-deoxyadenosine-3'-phosphate, a nucleotide containing 2'-deoxycytidine-3'-phosphate, a nucleotide containing 2'-deoxyuridine-3'-phosphate, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecanamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a nucleotide-containing non-natural base. In some embodiments, the CIDEB dsRNA compound contains an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0128] Certain embodiments of the CIDEB dsRNA compounds of the present invention, specifically the 3' and 5' ends of sense polynucleotides and / or the 3' end of antisense polynucleotides, include at least one modified nucleotide, including debasalized nucleotides, ribitols, reverse nucleotides, reverse debasalized nucleotides, reverse 2'-OMe nucleotides, and reverse 2'-deoxynucleotides. It is known to those skilled in the art that stability can be enhanced by including debasalized or reverse debasalized nucleotides at the oligonucleotide ends (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the CIDEB dsRNA compounds include one or more reverse debasalized residues (invab) at the 3'-terminus or 5'-terminus, or both the 3'-terminus and 5'-terminus. Exemplary invab residues include, but are not limited to, the following: [ka]

[0129] Certain embodiments of the CIDEB dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide, include at least one modified nucleotide, including isomannoside nucleotide or isomannose nucleotide as described in the stereoisomers. Specific examples of isomannose nucleotide or stereoisomers of the above isomannose nucleotide include, but are not limited to, the following: [ka] The term "Olig" independently represents a polynucleotide portion. Exemplary isomannitol residues (imann) include, but are not limited to, the following: [Chemical]

[0130] In certain embodiments, the isomannoside nucleotides are further conjugated to one or more target groups or delivery molecules, such as a GalNAc moiety, for example.

[0131] Certain embodiments of the CIDEB dsRNA compounds, antisense polynucleotides of the present invention include at least one modified nucleotide comprising unlocked nucleic acid nucleotides (UNA) or / and glycol nucleic acid nucleotides (GNA). It is known to those skilled in the art that UNA and GNA are thermally labile chemical modifications and can significantly improve the off-target characteristics of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862-70).

[0132] The CIDEB dsRNA compounds, antisense polynucleotides of certain embodiments of the present invention further include a phosphate moiety. As used herein, the phosphate moiety refers to the phosphate group of a sugar moiety (e.g., ribose or deoxyribose or an analog thereof) linked to a nucleotide and includes phosphates or phosphate mimics. Nucleotides containing phosphate mimics can also be defined as phosphonic acid-modified nucleotides.

[0133] In some embodiments, the phosphonate mimetic is 5'-vinylphosphonate (VP). In exemplary embodiments, the vinylphosphonate disclosed herein has the following structure. [ka]

[0134] The vinyl phosphonates disclosed herein may be ligated to the antisense or sense strand of the dsRNA disclosed herein. In certain preferred embodiments, the vinyl phosphonate disclosed herein is optionally ligated to the 5' end of the antisense strand of the dsRNA.

[0135] In certain embodiments, the vinylphosphonate-modified nucleotides disclosed herein have the structure of formula (IV), [ka] Here, X is either O or S, R is hydrogen, hydroxyl group, fluoro or C 1-20 It is an alkoxy group (for example, a methoxy group or an n-hexadecyloxy group), R5' is =C(H)-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in the E or Z direction (for example, the E direction), and B is a nucleic acid base or a modified nucleic acid base, and B is optionally adenine, guanine, cytosine, thymine, or uracil.

[0136] In certain embodiments, R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction. In certain embodiments, R is a methoxy group and R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction. In certain embodiments, X is S, R is a methoxy group and R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction.

[0137] Vinyl phosphonate modification is also considered applicable to the dsRNAs, compositions, and methods disclosed herein. Exemplary vinyl phosphonate structures are shown below. [ka]

[0138] In certain embodiments, the vinyl phosphonate-modified nucleotide is VPu* and has the following structure. [ka]

[0139] In many cases, protecting groups are used in the process of producing the compounds of the present invention. As used herein, the term “protected” means that a designated portion has a protecting group to which it is attached. In some embodiments of the present invention, the compounds include one or more protecting groups. Multiple types of protecting groups can be used in the methods of the present invention. Generally, protecting groups can be attached to or removed from a chemical functional group in a molecule, causing the functional group to become inert under specific reaction conditions and without fundamentally affecting the rest of the molecule. Common protecting groups, particularly hydroxyl group protecting groups, are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd edition, John Wiley & Sons, New York, 1991).

[0140] As used herein, examples of protecting groups (e.g., hydroxyl group protecting groups) include methyl, ethyl, benzyl (Bn), phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc), methanesulfonate, toluenesulfonate, and trifluoromethanes. Sulfonate, benzoyl group, benzyl phosphate, p-phenylbenzoyl group, 4-methoxybenzyl group, monomethoxytrityl group, dimethoxytrityl chloride group, trimethoxytrityl group, 4-chlorophenylmethyl group, 4-nitrophenylmethyl group, 2,4-dinitrophenyl group, 4-acyloxyphenylmethyl group, 2-methylphenyl group, 2,6-dimethylphenyl group, 2-chlorophenyl group, 2,6-dichlorophenylmethyl group, diphenylmethyl group, trityl group, 4-methylthio-1-butyl group, S-acetylthioacetate (SAT A) 2-cyanoethyl group, 2-cyano group, 1-dimethylethyl group (CDM), 4-cyano-2-butenyl group, 2-(trimethylsilyl)ethyl group (TSE), 2-(phenylthio)ethyl group, 2-(triphenylsilyl)ethyl group, 2-(benzylsulfonyl)ethyl group, 2,2,2-trichloroethyl group, 2,2,2-tribromoethyl group, 2,3-dibromopropyl group, 2,2,2-trifluoroethyl group, phenylthio group, 2-chloro-4-tritylphenyl group, 2-bromophenyl group, 2-[N-isopropyl-N-(4-methoxybenzo This includes, but is not limited to, the yl)aminoethyl group, 4-(N-trifluoroacetamide)butyl group, 4-oxopentyl group, 4-tritylaminophenyl group, 4-benzylaminophenyl group, tetrahydropyranyl group, morpholino, trimethylsilyl group, triethylsilyl group, tert-butyldimethylsilyl group, tert-butyldiphenylsilyl group, triphenylsilyl group, triisopropylsilyl group, pivaloyloxymethyl group (POM), and 9-phenylxanthine-9-yl.

[0141] As used herein, examples of amino protecting groups include, but are not limited to, carbamate protecting groups such as 2-trimethylsilylethoxycarbonyl group (Teoc), 1-methyl-1-(4-biphenyl)ethoxycarbonyl group (Bpoc), tert-butoxycarbonyl group (BOC), allyloxycarbonyl group (Alloc), 9-fluorenyl-methoxycarbonyl group (Fmoc), and benzyloxycarbonyl group (Cbz); amide protecting groups such as formyl group, acetyl group, pivaloyl group, trihaloacetyl group, benzoyl group, and 2-nitrophenylsulfonyl group; and imide and cyclic imide protecting groups such as phthalimide group and dithiosuccinyl group. The compounds and methods of the present invention cover equivalents of these amino protecting groups.

[0142] Another modification of the RNA in a particular embodiment of the CIDEB dsRNA agent, CIDEB antisense polynucleotide, and / or CIDEB sense polynucleotide of the present invention comprises one or more ligands, parts, or conjugates that can be chemically ligated to the RNA, each of which enhances one or more characteristics of the CIDEB dsRNA agent, CIDEB antisense polynucleotide, and / or CIDEB sense polynucleotide. Non-limiting examples of characteristics that can be enhanced are the activity, cell distribution, delivery of the CIDEB dsRNA agent, the pharmacokinetic properties of the CIDEB dsRNA agent, and the cell uptake of the CIDEB dsRNA agent. In some embodiments of the present invention, the CIDEB dsRNA agent comprises one or more target groups or binding groups that are conjugated to the sense strand in a particular embodiment of the CIDEB dsRNA agent of the present invention. Non-limiting examples of target groups include compounds containing N-acetyl-galactosamine (GalNAc). The terms “target group,” “targeting agent,” “conjugate,” “target compound,” “delivery molecule,” “delivery compound,” and “target ligand” are interchangeable herein. In certain embodiments of the present invention, the CIDEB dsRNA agent includes a target compound conjugated to the 5'-terminus of the sense strand. In certain embodiments of the present invention, the CIDEB dsRNA agent includes a target compound conjugated to the 3'-terminus of the sense strand. In some embodiments of the present invention, the CIDEB dsRNA agent includes a target group containing GalNAc. In certain embodiments of the present invention, the CIDEB dsRNA agent does not include a target compound conjugated to either or both of the 3'-terminus and 5'-terminus of the sense strand. In certain embodiments of the present invention, the CIDEB dsRNA agent does not include a target compound containing GalNAc conjugated to either or both of the 5'-terminus and 3'-terminus of the sense strand.

[0143] Other targeting agents and binders are well known in the art, and for example, targeting agents and binders that can be used in specific embodiments of the present invention include, for example, lipid moieties such as cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556) and cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-trityl mercaptan (Manoharan et al., Ann. NYAcad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Fatty acid chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Phospholipids such as Res., 1990, 18:3777-3783, polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., J.This includes, but is not limited to, the following: (Pharmacol. Exp. Ther., 1996, 277:923-937).

[0144] Certain embodiments of compositions comprising a CIDEB dsRNA agent, a CIDEB antisense polynucleotide, and / or a CIDEB sense polynucleotide may include ligands that alter the distribution, targeting, etc., of the CIDEB dsRNA agent. In some embodiments of the CIDEB dsRNA agent-containing compositions of the present invention, the ligands increase affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cell or organ compartments), tissues, organs or regions), for example, compared to species lacking such ligands. Ligands that can be used in the compositions and / or methods of the present invention may be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. The ligands may further be recombinant or synthetic molecules such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycol oxidation) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, peptide-mimicking polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helix peptides.

[0145] Ligands included in the compositions and / or methods of the present invention may include target groups, non-limiting examples of which are cell or tissue targeting agents such as lectins, glycoproteins, lipids, or proteins that bind to specific cell types, such as renal cells or hepatocytes. The target groups may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.

[0146] Other examples of ligands include dyes, intercalators (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texafrin, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3- (Oleoyl)cholic acid, dimethoxytrityl chloride group or phenoxazine and peptide conjugate (e.g., Antenna peptide, Tat peptide), alkylating agent, phosphate, amino group, mercapto group, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino group, alkyl group, substituted alkyl group, radiolabeled substance, enzyme, hapten (e.g., biotin), transport / absorption enhancer (e.g., aspirin, vitamin E, folic acid), synthetic ribonuclease (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl group, HRP or AP.

[0147] The ligands included in the compositions and / or methods of the present invention may be proteins such as glycoproteins or peptides, for example, molecules or antibodies that have a specific affinity for a colligand, and which bind to specific cell types such as cancer cells, endothelial cells, cardiomyocytes, or osteocytes. The ligands that can be used in embodiments of the compositions and / or methods of the present invention may also be hormones or hormone receptors. Useful ligands in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, or polyvalent fucose. Useful ligands in embodiments of the compositions and / or methods of the present invention may also be substances that increase the uptake of CIDEB dsRNA agents into cells by disrupting the cytoskeleton of cells, for example, by disrupting microtubules, microfilaments, and / or intermediate filaments of cells. Non-exclusive examples of this type of drug include taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanosine, and myoservin.

[0148] In some embodiments, ligands linked to the CIDEB dsRNA agent of the present invention are used as pharmacokinetic (PK) modifiers. Examples of PK modifiers that can be used in the compositions and methods of the present invention include, but are not limited to, lipophilic agents, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, oligonucleotides containing multiple phosphorothioate bonds, such as cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and aptamers that bind to serum proteins. Furthermore, short oligonucleotides containing multiple phosphorothioate bonds in their main chain, such as oligonucleotides with about 5, 10, 15, or 20 bases, can be used as ligands in the compositions and / or methods of the present invention because they are known to bind to serum proteins.

[0149] CIDEB dsRNA reagent composition In some embodiments of the present invention, the CIDEB dsRNA agent is in a composition. The composition of the present invention may optionally include one or more CIDEB dsRNA agents and one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. According to some embodiments of the methods of the present invention, a non-limiting example of a usable targeting agent is a reagent that introduces and / or enters the cells to be treated with the CIDEB dsRNA agent of the present invention. The selection of the targeting agent depends on factors such as the nature of the CIDEB-related disease or condition and the type of cells to be targeted. In non-limiting examples, in some embodiments of the present invention, the CIDEB dsRNA agent may need to target hepatocytes and / or intracellular hepatocytes. In some embodiments of the methods of the present invention, the therapeutic agent should be understood to include a CIDEB dsRNA agent having only a delivery agent without any additional adhesion elements, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, the CIDEB dsRNA agent may be attached to a delivery compound containing GalNAc and included in a composition containing a pharmaceutically acceptable carrier, and administered to cells or subjects without any detectable label or targeting agent linked to the CIDEB dsRNA reagent.

[0150] When the CIDEB dsRNA agent of the present invention is administered together with one or more delivery agents, targeting agents, labeling agents, etc., and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will be able to recognize, select, and use appropriate reagents for use in the methods of the present invention. Labeling agents can be used in specific methods of the present invention to determine the location of the CIDEB dsRNA agent in cells and tissues, and can be used to determine the location of a therapeutic composition containing the labeled CIDEB dsRNA agent in cells, tissues, or organs. Administered by the methods of the present invention. Procedures for linking and using labeling reagents such as enzyme labeling, dyes, and radiolabeling are well known in the art. In some embodiments of the compositions and methods of the present invention, it should be understood that the labeling agent is linked to one or both of the sense polynucleotides and antisense polynucleotides contained in the CIDEB dsRNA agent.

[0151] Delivery of CIDEB dsRNA reagents and CIDEB antisense polynucleotide reagents Certain embodiments of the methods of the present invention involve delivering a CIDEB dsRNA agent to cells. As used herein, the term “delivery” means promoting or influencing cellular uptake or absorption. Absorption or uptake of the CIDEB dsRNA agent can occur through independent diffusion or activation of cellular processes, or through the use of delivery agents, targeting agents, etc., which may be associated with the CIDEB dsRNA agent of the present invention. Delivery methods applicable to the methods of the present invention include, but are not limited to, in vivo delivery, injecting the CIDEB dsRNA agent into a tissue site or systemically. In some embodiments of the present invention, the CIDEB dsRNA agent is ligated to a delivery agent.

[0152] Non-limiting examples of methods that can be used to deliver CIDEB dsRNA agents to cells, tissues and / or subjects include CIDEB dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used to deliver therapeutic RNAi agents to treat a variety of diseases and conditions in the field, including, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, and pulmonary fibrosis. Detailed information on studies of various delivery methods can be found in publications such as Nikam, RR & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer AD & S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1;28(3):109-118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136:16958-16961, the contents of which are incorporated herein by reference.

[0153] Some embodiments of the present invention involve delivering the CIDEB dsRNA agent of the present invention to cells, tissues and / or subjects using lipid nanoparticles (LNPs). LNPs are typically used for in vivo delivery of CIDEB dsRNA reagents, including therapeutic CIDEB dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the CIDEB RNA agent is increased when it is delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNPs include cationic LNPs on which one or more CIDEB RNAi molecules of the present invention are loaded. LNPs containing CIDEB RNAi molecules are administered to a subject, and the LNPs and the CIDEB RNAi molecules attached to them are taken up by cells via endocytosis, and their presence leads to the release of RNAi-mediated RNAi-inducing molecules.

[0154] In embodiments of the present invention, another non-limiting example of a delivery agent that can be used to deliver the CIDEB dsRNA agent of the present invention to cells, tissues and / or subjects is a reagent containing GalNAc that is linked to the CIDEB dsRNA agent described below, and which delivers the CIDEB dsRNA agent to cells, tissues and / or subjects in the present invention. Specific examples of other GalNAc-containing delivery agents that can be used in specific embodiments of the methods and compositions of the present invention are disclosed in PCT application:WO2020191183A1 (all of which are incorporated herein by reference). A non-limiting example of a GalNAc target ligand that can be used to deliver the CIDEB dsRNA agent to cells in the compositions and methods of the present invention is a target ligand cluster. Examples of target ligand clusters proposed herein are referred to as phosphodiester-linked GalNAc ligands (GLOs) and phosphorothioate-linked GalNAc ligands (GLSs). In this specification, the term "GLX-n" can be used to represent a compound containing GalNAc that is linked thereto, which is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of them shown below, where the linkage position between the GalNAc target ligand and the RNAi agent of the present invention is located on the far right of each (" (As shown in "JPEG2026510329000046.jpg74"). It should be understood that any RNAi and dsRNA molecules of the present invention can attach to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16. The structures of GLO-1 to GLO-16 and GLS-1 to GLS-16 are shown below. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5]

[0155] In certain embodiments, the isomannose nucleotide is further conjugated to one or more GalNAc target ligands. Specific examples of isomannose nucleotides conjugated to GalNAc target ligands include, but are not limited to, the following: [ka] Here, each "Olig" term independently represents a polynucleotide portion.

[0156] In some embodiments of the present invention, in vivo delivery can be carried out by a β-dextran delivery system, the entirety of which is incorporated herein by reference, as described, for example, in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781. For example, CIDEB RNAi agents can be introduced into cells in vitro using methods known in the art, such as electroporation and lipofection. In certain embodiments of the methods of the present invention, CIDEB dsRNA is delivered without a targeting agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, to treat a CIDEB-related disease or condition such as liver disease in a subject, the CIDEB dsRNA of the present invention can be administered to a subject, and the pharmaceutical composition contains an RNAi agent but does not contain a targeting agent, such as a GalNAc targeting compound.

[0157] Except for specific delivery methods described herein, RNAi delivery methods, including but not limited to those described herein and those used in the art, should be understood to be usable in combination with the embodiments of CIDEB RNAi agents and therapeutic methods described herein.

[0158] The CIDEB dsRNA agents of the present invention can be administered to a subject in an amount and manner that effectively reduces the level and activity of CIDEB polypeptides in cells and / or subjects. In some embodiments of the methods of the present invention, one or more CIDEB dsRNA agents are administered to cells and / or subjects to treat diseases or conditions associated with CIDEB expression and activity. In some embodiments, the methods of the present invention include administering one or more CIDEB dsRNA agents to subjects requiring such treatment in order to alleviate diseases or conditions associated with CIDEB expression in the subjects. The CIDEB dsRNA agents or CIDEB antisense polynucleotide agents of the present invention may be administered to reduce CIDEB expression and / or activity in one or more types of in vitro, ex vivo, and in vivo cells.

[0159] In some embodiments of the present invention, CIDEB dsRNA agents or CIDEB antisense polynucleotide agents are delivered (e.g., introduced) to cells to reduce the level of CIDEB polypeptide in the cells and thereby reduce the activity of CIDEB polypeptide. Targeting agents and methods can be used to help deliver CIDEB dsRNA agents or CIDEB antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions and / or intracellular subcellular regions within a subject. CIDEB dsRNA agents can be administered alone or in combination with one or more other CIDEB dsRNA agents in certain methods of the present invention. In some embodiments, two, three, four or more independently selected CIDEB dsRNA agents are administered to the subject.

[0160] In certain embodiments of the present invention, a CIDEB dsRNA agent is administered to a subject in combination with one or more other therapeutic schemes used to treat a CIDEB-related disease or condition. Non-limiting examples of other therapeutic schemes include administration of one or more CIDEB antisense polynucleotides of the present invention, administration of non-CIDEB dsRNA therapeutic agents, and behavioral changes. Additional therapeutic schemes may be administered at one or more time points before, during, and after administration of the CIDEB dsRNA agent of the present invention. As used herein, “time zero” should be understood as the time at which the CIDEB dsRNA agent of the present invention is administered to the subject, such as within 5 minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero.Non-CIDEB dsRNA therapeutic agents include, but are not limited to, patatin-like phospholipase domain-containing 3 (PNPLA3) inhibitors, hydroxysteroid 17-β dehydrogenase 13 (HSD17B13) inhibitors, antibodies (e.g., anti-CIDEB antibodies), peptide inhibitors (e.g., CIDEB peptide inhibitors), cholesterol-lowering agents, lipid-lowering agents, hypoglycemic agents, HMG-CoA reductase inhibitors (e.g., atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, or simvastatin), triglyceride-lowering agents (e.g., fibrates, nicotinic acid, or fish oil), cholesterol absorption inhibitors (e.g., ezetimibe), MTP inhibitors, FXR agonists (e.g., obeticholic acid), and GLP-1 receptor agonists. (e.g., semaglutide), SGLT2 inhibitors (e.g., canagliflozin), DDP-IV inhibitors (e.g., Sitagliptin, Vildagliptin), THR-β agonists (e.g., Resmetirom), SCD1 inhibitors (e.g., Aramchol), PPARα / δ / γ agonists (e.g., Lanifbranor), Galectin-3 inhibitors (e.g., Belapectin), FGF21 analogs (e.g., Pegbelfermin), monoclonal antibody agonists of the β-Klotho / FGFR1c receptor complex (e.g., MK-3655), FASN inhibitors (e.g., TVB-2640), dual GIP and GLP-1 receptor agonists (e.g., tilzepatide, BI456906), HSP47 These include siRNA (e.g., BMS-986263), JNK inhibitors (e.g., CC-90001), antisense compounds targeting ApoB, and anti-inflammatory agents or any combination thereof. Non-limiting examples of behavioral changes include dietary plans, consultations, and exercise plans. These and other therapeutic agents and behavioral modifiers are known in the art and have been used to treat CIDEB disease or conditions in subjects, and can be administered to subjects in combination with one or more CIDEB3 dsRNA agents of the present invention to treat CIDEB disease or conditions.The CIDEB dsRNA agent of the present invention, administered to cells or subjects to treat CIDEB-related diseases or conditions, functions synergistically with one or more other therapeutic agents or activities, and can increase the efficacy of the said one or more therapeutic agents or activities, and / or increase the effectiveness of treating CIDEB-related diseases or conditions using the CIDEB dsRNA agent.

[0161] The therapeutic method of the present invention, comprising the administration of a CIDEB dsRNA agent, can be used before the onset of a CIDEB-related disease or condition and / or during the onset of a CIDEB-related disease or condition, at any point in time including the early, middle, and late stages of the disease or condition, and all time immediately before and after any of these stages. The method of the present invention can further be used to treat subjects who have previously been treated for a CIDEB-related disease or condition with one or more other therapeutic agents and / or treatments, wherein the other therapeutic agents and / or treatments have not been successful, have been minimally successful, and / or have not been successful again in treating the CIDEB-related disease or condition in the subject.

[0162] dsRNA encoded by the vector In certain embodiments of the present invention, a vector can be used to deliver a CIDEB dsRNA agent to cells. The CIDEB dsRNA agent transcription unit may be contained in a DNA or RNA vector. It is well known in the art that the manufacture and use of such vectors encoding genetic recombination are used to deliver sequences to cells and / or subjects. The vector can be used in the method of the present invention, thereby resulting in transient expression of CIDEB dsRNA for, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or longer, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or longer. The length of transient expression can be determined using a general method based on elements, which are, for example, a selected specific vector construct and target cells and / or tissues. Such genetic recombination can be introduced as a linear construct, a circular plasmid or a viral vector, and may be integrated or unintegrated vectors. Genetic recombination can also be constructed to allow inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0163] One or more strands of a CIDEB dsRNA agent can be transcribed from a promoter in an expression vector. When two individual strands are expressed to generate dsRNA, two individual expression vectors can be co-introduced into cells using means such as transfection or infection. In certain embodiments of the present invention, each individual strand of the CIDEB dsRNA agent is transcribed by a promoter contained in the same expression vector. In certain embodiments of the present invention, the CIDEB dsRNA agent is expressed as a reverse repeat polynucleotide linked by a linker polynucleotide sequence because the CIDEB dsRNA agent has a stem-loop structure.

[0164] Non-limiting examples of RNA expression vectors include DNA plasmids or viral vectors. Expression vectors that can be used in the embodiments of the present invention may be compatible with eukaryotic cells. Eukaryotic cell expression vectors are commonly used in the art and are available from many commercial sources. Delivery of the CIDEB dsRNA expression vector may be systemic, for example, by intravenous or intramuscular administration, by administering it to target cells transplanted from the subject and then reintroducing it into the subject's body, or by any other method that enables introduction into desired target cells.

[0165] Viral vector systems that may be included in embodiments of the method include, but are not limited to, (a) adenovirus vectors, (b) retroviral vectors including, but not limited to, lentivirus vectors, Moloney's mouse leukemia virus, etc., (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV 40 vectors, (f) polyomavirus vectors, (g) papillomavirus vectors, (h) picornavirus vectors, (i) poxvirus vectors such as, for example, orthopox, e.g., vaccinia virus vector or fowlpox, e.g., canarypox or fowlpox, etc., and (j) helper-dependent or enteric free adenoviruses. Constructs used for recombinant expression of CIDEB dsRNA agents may include regulatory elements such as promoters and enhancers, which can be selected to provide constitutive or regulatory / regulatory expression. The use of viral vector systems, promoters and enhancers, etc., is common in the art and can be used in combination with the methods and compositions described herein.

[0166] Specific embodiments of the present invention involve delivering a CIDEB dsRNA agent to cells using a viral vector. Many adenovirus-based delivery systems are commonly used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscles. Non-limiting examples of viral vectors that can be used in the methods of the present invention include AAV vectors, poxviruses such as vaccinia virus, modified Ankara virus (MVA), NYVAC, and fowlpox such as varicella or canarypox.

[0167] Certain embodiments of the present invention include a method for delivering a CIDEB dsRNA agent into cells using a vector, wherein such vector may be in a pharmaceutically acceptable carrier, which may, but is not necessarily, include a sustained-release matrix in which a gene delivery vector is embedded. In some embodiments, the vector for delivering CIDEB dsRNA can be generated by recombinant cells, and the pharmaceutical composition of the present invention may include one or more types of cells that generate an HSD17B13 dsRNA delivery system.

[0168] Pharmaceutical composition containing CIDEB dsRNA or ssRNA agent Specific embodiments of the present invention involve the use of a pharmaceutical composition comprising a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent and a pharmaceutically acceptable carrier. A pharmaceutical composition comprising a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent can be used in the methods of the present invention to reduce CIDEB gene expression and CIDEB activity in cells, and can be used to treat CIDEB-related diseases or conditions. Such pharmaceutical compositions can be prepared by delivery mode. Non-limiting examples of formulations used in delivery modes include compositions prepared for subcutaneous delivery, compositions prepared for systemic administration by parenteral delivery, compositions prepared for intravenous (IV) delivery, and compositions prepared for intrathecal delivery. The pharmaceutical compositions of the present invention can be administered to cells by one or more methods, including intratracheal, intranasal, epidermal, and transdermal, oral, or parenteral delivery, by inhalation or blowing of powder or aerosol formulations, for example, topically (e.g., by a transdermal patch), in the lung, or by a sprayer. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intracranial, intrathecal, or intraventricular administration, such as subcutaneous or intraparenchymal delivery via an implantation device. The CIDEB dsRNA or CIDEB antisense polynucleotides can also be delivered directly to target tissues, such as directly to the liver or directly to the kidneys. "Delivering" the "CIDEB dsRNA reagent" or the "CIDEB antisense polynucleotide reagent" to cells should be understood to cover, respectively, the direct delivery of the CIDEB dsRNA reagent or the CIDEB antisense polynucleotide reagent, the expression of the CIDEB dsRNA agent in cells from a coding vector delivered into cells, or any appropriate method for making the CIDEB dsRNA or CIDEB antisense polynucleotide reagent appear in cells. The manufacture and use of the formulations and the means for delivering the suppressor RNA are well known and commonly used in the art.

[0169] As used herein, “pharmaceutical composition” comprises a pharmacokinetically effective amount of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for use in administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term explicitly excludes cell culture media. For drugs intended for oral administration, a pharmaceutically acceptable carrier includes, but is not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If necessary, tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The drugs contained in the drug formulation are further described below.

[0170] As used herein, terms such as “pharmacologically effective dose,” “therapeutic effective dose,” and “effective dose” refer to the amount of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention that produces a desired pharmacological, therapeutic, or prophylactic outcome. For example, a given clinical treatment is considered effective if a measurable parameter associated with a disease or condition is reduced by at least 10%, and the therapeutically effective dose of the agent for treating the disease or condition is the amount that must reduce the parameter by at least 10%. For example, a therapeutically effective dose of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent can reduce CIDEB polypeptide levels by at least 10%.

[0171] Effective amount In some embodiments, the method of the present invention involves contacting cells with an effective amount of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent to reduce CIDEB gene expression in the contacted cells. Specific embodiments of the method of the present invention involve administering a subject a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent in an amount effective to reduce CIDEB gene expression in the subject and to treat a CIDEB-related disease or condition in the subject. The “effective amount” for reducing CIDEB expression and / or treating a CIDEB-related disease or condition is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent to treat a CIDEB-related disease or condition may be (i) an amount necessary to slow or stop the progression of the disease or condition, or (ii) an amount to reverse, alleviate or eliminate one or more symptoms of the disease or condition. In some embodiments of the present invention, the effective dose is the amount of a CIDEB dsRNA agent or CIDEB antisense polynucleotide agent that, when administered to a subject requiring treatment for a CIDEB-related disease or condition, produces a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the present invention, the effective dose is the amount of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention that, when combined with or used in combination with another therapeutic treatment for a CIDEB-related disease or condition, produces a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the present invention, the biological effect of treating a subject with the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention may be improvement and / or absolute elimination of symptoms caused by a CIDEB-related disease or condition. In some embodiments of the present invention, the biological effect is the complete elimination of a CIDEB-related disease or condition, as demonstrated, for example, by a diagnostic test showing that the subject does not have a CIDEB-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in CIDEB levels in the subject's liver after administration of the agent of the present invention.Other methods known in the art for evaluating the state of CIDEB-related diseases or conditions can be used to determine the effect of the agents and / or methods of the present invention on CIDEB-related diseases or conditions.

[0172] Typically, in clinical trials, the effective dose of a CIDEB dsRNA agent or CIDEB antisense polynucleotide agent that reduces the activity of CIDEB polypeptide to a level that treats CIDEB-related diseases or conditions is determined, thereby establishing the effective dose of the test group relative to the control group in blinded studies. In some embodiments, the effective dose is the amount that produces the desired response, for example, the amount that alleviates CIDEB-related diseases or conditions in cells, tissues, and / or subjects with the disease or condition. Therefore, the effective dose of a CIDEB dsRNA agent or CIDEB antisense polynucleotide agent that treats CIDEB-related diseases or conditions that can be treated by reducing the activity of CIDEB polypeptide may be less than the amount present in cells, tissues, and / or subjects when the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent is not administered, in which case the amount that reduces the activity of CIDEB polypeptide in the subject when administered may be less than the amount present in the cells, tissues, and / or subjects when the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent is not administered. In certain embodiments of the present invention, the level of CIDEB polypeptide activity and / or CIDEB gene expression present in cells, tissues, and / or subjects that have not yet been contacted with or administered the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention is referred to as the “control” level. In some embodiments of the method of the present invention, the control level of a subject is the pre-treatment level of the subject, in other words, the level in the subject before administration of the CIDEB agent may be the control level of the subject and is compared with the level of CIDEB polypeptide activity and / or CIDEB gene expression in the subject after administration of the siRNA to the subject. When treating a CIDEB-related disease or condition, the desired response may be the reduction or elimination of one or more symptoms of the disease or condition in the cells, tissues, and / or subjects. The reduction or elimination may be temporary or permanent. It should be understood that the state of a CIDEB-related disease or condition can be monitored using methods that determine CIDEB polypeptide activity, CIDEB gene expression, symptom assessment, clinical trials, etc. In some embodiments of the present invention, the desired response to the treatment of a CIDEB-related disease or condition is the delay of the onset of the disease or condition, or the prevention of the onset of the disease or condition.

[0173] The effective amount of a compound that reduces CIDEB polypeptide activity can be determined by evaluating the physiological effects on cells or subjects, such as a reduction in CIDEB-related disease or symptoms, after administration of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent. Measurements and / or symptom monitoring of subjects can be used to determine the efficacy of the CIDEB dsRNA reagent or CIDEB antisense polynucleotide agent of the present invention that can be administered to the pharmaceutical compound of the present invention, and to determine the presence or absence of a response to treatment. One non-limiting example is one or more tests of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) spectra known in the art. Another non-limiting example is the use of one or more liver function tests known in the art to determine the state of CIDEB-related liver disease or symptoms in subjects before and after treatment with the CIDEB dsRNA reagent of the present invention.

[0174] Some embodiments of the present invention include methods for determining the efficacy of a dsRNA agent or CIDEB antisense polynucleotide agent of the present invention administered to a subject, and for treating a CIDEB-related disease or disorder by evaluating and / or monitoring one or more "physiological features" of the CIDEB-related disease or disorder in the subject. Non-limiting examples of physiological features of a CIDEB-related disease or disorder include CIDEB mRNA levels, CIDEB protein levels, or cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) in plasma or tissue samples, and / or fat accumulation and / or lipid droplet dilation in the liver. Standard methods for determining such physiological features are known in the art and include, but are not limited to, blood tests, imaging studies, and health checkups.

[0175] It should be understood that the amount of CIDEB dsRNA or CIDEB antisense polynucleotide administered to a subject can be modified, at least in part, based on the subject's specific disease and / or disease state and / or specific physiological characteristics. The therapeutic dose can be modified, for example, by increasing or decreasing the amount of CIDEB-dsRNA or CIDEB antisense polynucleotide, by changing the composition in which the CIDEB dsRNA or CIDEB antisense polynucleotide is administered, by changing the route of administration, or by changing the timing of administration. The effective dose of CIDEB dsRNA or CIDEB antisense polynucleotide will be modified by changes in the specific disease being treated, the age and physical condition of the subject being treated, the severity of the disease, the duration of treatment, the nature of parallel treatment (if any), the specific route of administration, and other factors relating to the knowledge and expertise of the health physician. For example, the effective dose depends on the desired level of CIDEB polypeptide activity and / or CIDEB gene expression that effectively treats a CIDEB-related disease or condition. Those skilled in the art can empirically determine the effective dose of a particular CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention used in the method of the present invention without performing excessive experiments. Referring to the teachings provided herein, one can select from the various CIDEB dsRNA reagents or CIDEB antisense polynucleotide agents of the present invention and plan an effective prophylactic or therapeutic treatment scheme to effectively treat a particular subject, taking into account factors such as potency, relative bioavailability, patient body weight, severity of adverse side effects, and preferred mode of administration. As used in embodiments of the present invention, the effective dose of the CIDEB dsRNA reagent or CIDEB antisense polynucleotide agent of the present invention may be the amount that, when brought into contact with cells, produces a desired biological effect on the cells.

[0176] It should be recognized that CIDEB gene silencing can be determined by any appropriate measurement in any cell expressing CIDEB constitutively or through genomic modification. In some embodiments of the present invention, administration of the CIDEB dsRNA agent of the present invention reduces CIDEB gene expression by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the present invention, administration of the CIDEB dsRNA agent of the present invention reduces CIDEB gene expression by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0177] dose CIDEB dsRNA agents and CIDEB antisense polynucleotide agents are delivered in a pharmaceutical composition at a dose sufficient to suppress CIDEB gene expression. In certain embodiments of the present invention, the dose of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent is 0.01 to 200.0 milligrams / kilogram body weight of the recipient per day, and generally includes both extreme values, such as 1 to 50 mg / kilogram body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight per day. For example, CIDEB dsRNA drugs or CIDEB antisense polynucleotide drugs are available in doses of approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, and 1 mg / kg per unit of body weight. .8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8 mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8 mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / k g, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg It can be administered in doses of 1 / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, and 49mg / kg to 50mg / kg.

[0178] When determining the delivery dose and timing of the CIDEB dsRNA agent of the present invention, various factors can be considered. The absolute amount of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent delivered depends on various factors, including concurrent therapy, dose quantity, and parameters of the individual subject, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved by conventional experiments. In some embodiments, the maximum dose, i.e., the safest dose based on reasonable medical judgment, can be used.

[0179] In some embodiments, the method of the present invention may involve administering one, two, three, four, five, six, seven, eight, nine, ten or more doses of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent to a subject. In some cases, the pharmaceutical compound (e.g., comprising a CIDEB dsRNA agent or comprising a CIDEB antisense polynucleotide agent) can be administered to the subject at least daily, every other day, weekly, bi-weekly, monthly, etc. The dose may be once a day or more times, for example, two, three, four, five or more times within a 24-hour period. The pharmaceutical composition of the present invention can be administered once a day, or the CIDEB dsRNA reagent or CIDEB antisense polynucleotide agent can be administered in two, three or more subdoses at appropriate intervals throughout the day, or even by continuous infusion or delivery. The formulation is released over time. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention is administered to a subject once or more times a day, once or more times a week, once or more times a month, or once or more times a year.

[0180] In some embodiments, the methods of the present invention include administering the pharmaceutical compound alone, in combination with one or more other CIDEB dsRNA agents or CIDEB antisense polynucleotide agents, and / or in combination with other drug therapies or treatments or schemes administered to subjects with CIDEB-related diseases or conditions. The pharmaceutical compound can be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may contain a sterile, fixed amount of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent, the above amount being sufficient to reduce the activity of the CIDEB polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to a subject. The dose of the pharmaceutical composition containing the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent administered to a subject to reduce CIDEB protein activity can be selected according to different parameters, in particular, according to the method of administration used and the condition of the subject. Other factors include the required treatment time. If the subject's response to the initial dose is insufficient, a higher dose (or a higher dose that is effective via a different, more localized delivery route) may be used, within the patient's tolerance tolerance.

[0181] treatment By using the method of the present invention and a CIDEB dsRNA agent to suppress CIDEB expression, CIDEB-related diseases and conditions can be treated, and these diseases or conditions can be effectively treated by reducing the level and / or activity of the CIDEB polypeptide. Examples of diseases and conditions that can be treated using the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention and the therapeutic method of the present invention include, but are not limited to, hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, morbidity, hypertriglyceridemia, and cardiovascular diseases. Examples include, but are not limited to, aneurysms, angina pectoris, arrhythmias, atherosclerosis, cerebrovascular disease (stroke), coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia. These diseases and conditions may be referred to herein as "CIDEB-related diseases and conditions" and "CIDEB-induced and / or regulated diseases and conditions."

[0182] In certain embodiments of the present invention, a subject may be administered the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention at one or more time points before or after the diagnosis of a CIDEB-related disease or condition. In some embodiments of the present invention, a subject has or is at risk of developing a CIDEB-related disease or condition. A subject at risk of developing a CIDEB-related disease or condition is a subject whose likelihood of developing a CIDEB-related disease or condition is increased compared to a control risk of developing a CIDEB-related disease or condition. In some embodiments of the present invention, the risk level may be statistically significant compared to the control risk level. Subjects at risk include, for example, subjects with pre-existing diseases and / or genetic abnormalities that make them more susceptible to CIDEB-related diseases or conditions compared to a control subject without pre-existing diseases or genetic abnormalities, subjects with a family history and / or personal history of CIDEB-related diseases or conditions, and subjects who have previously received or are in the process of receiving treatment for a CIDEB-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to CIDEB-related diseases or conditions may be diseases and / or genetic abnormalities that have been previously identified as being associated with a higher likelihood of developing CIDEB-related diseases or conditions, if present.

[0183] It should be understood that a subject may be administered a CIDEB dsRNA reagent or a CIDEB antisense polynucleotide agent based on the medical condition of the individual subject. For example, the healthcare provider to the subject can evaluate the CIDEB level measured in a sample obtained from the subject and determine the likelihood of reducing the subject's CIDEB level by administering the CIDEB dsRNA reagent or CIDEB antisense polynucleotide agent of the present invention. In such an example, even if the subject is not diagnosed with a CIDEB-related disease such as one disclosed herein, the CIDEB level is considered a physiological characteristic of CIDEB-related symptoms. The healthcare provider can monitor changes in the subject's CIDEB level and use this as a criterion for measuring the effectiveness of the administered CIDEB dsRNA reagent or CIDEB antisense polynucleotide agent of the present invention. In non-limiting examples, biological samples such as blood or serum samples can be obtained from a subject, and the subject's CIDEB levels can be measured in the sample. A CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent is administered to the subject, and blood or liver samples are obtained from the subject after administration. The CIDEB levels in these samples are measured, and the measurement results are compared with the measurement results of the subject's pre-administration sample. A reduction in the subject's CIDEB levels in the post-administration sample compared to the pre-administration level indicates the effectiveness of the administered CIDEB dsRNA agent or CIDEB antisense polynucleotide agent in reducing lipid levels in the subject.

[0184] Certain embodiments of the methods of the present invention include modulated therapy, which involves administering the subject a dsRNA agent or CIDEB antisense polynucleotide agent of the present invention, at least in part on an assessment of changes in one or more physiological characteristics of a CIDEB-related disease or condition induced by treating the subject. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or CIDEB antisense polynucleotide agent of the present invention can be determined and used to assist in modulating the amount of the dsRNA agent or CIDEB antisense polynucleotide agent of the present invention. The present invention is then administered to the subject. In one non-limiting example, the subject is administered a dsRNA agent or CIDEB antisense polynucleotide agent of the present invention, the subject's CIDEB level is measured after administration, and at least in part on the measured level, a larger amount of dsRNA is administered to increase the physiological effect of the administered reagent, for example, by reducing or further reducing the subject's CIDEB level, to determine the required reagent or CIDEB antisense polynucleotide reagent. In another non-limiting example, it is desirable that a subject be administered the dsRNA agent or CIDEB antisense polynucleotide agent of the present invention, the subject's CIDEB level be measured after administration, and that a relatively low amount of the dsRNA reagent or CIDEB antisense polynucleotide agent be administered to the subject, at least in part based on the measured level.

[0185] Therefore, some embodiments of the present invention include evaluating changes in one or more physiological characteristics caused by the subject's prior treatment in order to adjust the amount of the dsRNA agent or CIDEB antisense polynucleotide agent of the present invention administered to the subject later. Some embodiments of the method of the present invention include measuring the physiological characteristics of a CIDEB-related disease or condition one, two, three, four, five, six or more times to evaluate and / or monitor the effectiveness of the CIDEB dsRNA agent or CIDEB antisense polynucleotide reagent of the present invention administered, and optionally using the measurement results to adjust one or more of the dose, administration scheme and / or frequency of the dsRNA agent or CIDEB antisense polynucleotide reagent of the present invention to treat a CIDEB-related disease or condition in a subject. In some embodiments of the method of the present invention, desired results of administering an effective amount of the dsRNA agent or CIDEB antisense polynucleotide agent of the present invention to a subject include a reduction in the subject's CIDEB mRNA level, a reduction in the subject's CIDEB protein level, or cholesterol ester (CE), triglyceride (TG), cholesterol level, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) in plasma or tissue samples, as well as / or fat accumulation and / or lipid droplet dilation in the liver.

[0186] As used herein, the terms “treat,” “treated,” or “in treatment” may, when used in reference to a CIDEB-related disease or condition, refer to prophylactic treatment to reduce the likelihood of developing the CIDEB-related disease or condition in the subject, and may also refer to post-onset treatment of the CIDEB-related disease or condition in the subject to eliminate or reduce the level of the CIDEB-related disease or condition compared to a subject treated in which there is no reduction in the activity of the CIDEB polypeptide in the subject, to prevent the CIDEB-related disease or condition from becoming more late (e.g., more severe), and / or to delay the progression of the CIDEB-related disease or condition in the subject.

[0187] Certain embodiments of the agents, compositions, and methods of the present invention can be used to suppress CIDEB gene expression. The terms “suppression,” “silencing,” “reduction,” “downregulation,” and “knockdown,” as used herein to refer to CIDEB gene expression, refer to a reduction in CIDEB gene expression, measured by one or more of the levels of RNA transcribed from the CIDEB gene, the level of CIDEB activity expressed, or the level of CIDEB translated from mRNA, when cells, cell populations, tissues, organs, or subjects come into contact with (e.g., are treated with) the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention, compared to control levels of RNA transcribed from the CIDEB gene, the level of CIDEB activity expressed, or the level of CIDEB translated from mRNA, respectively. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not come into contact with (e.g., been treated with) the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention.

[0188] Method of administration Multiple routes of administration of CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be used in the methods of the present invention. The specific mode of delivery selected depends at least in part on the specific disease being treated and the dose required for therapeutic efficacy. Generally, the methods of the present invention can be carried out using any medically acceptable mode of administration, and refer to any mode that provides an effective therapeutic level for CIDEB-related diseases or conditions without causing clinically unacceptable side effects. In some embodiments of the present invention, CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be administered orally, intestinally, mucosally, subcutaneously and / or parenterally. The term "parenterally" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, transnasal (e.g., via a nasogastric tube), transdermal, transvaginal, transrectal, sublingual and inhalation. The routes of delivery of the present invention may include intrathecal, ventricular or intracranial. In some embodiments of the present invention, a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent is administered by placing it on a sustained-release matrix and placing the matrix in the body of a subject. In some embodiments of the present invention, a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent can be delivered to subject cells using nanoparticles coated with a delivery agent that targets specific cells or organelles. Various delivery methods, procedures, and reagents are known in the art. Other parts of this specification further provide non-limiting examples of delivery methods and delivery agents. In some embodiments of the present invention, the term “delivery” with respect to CIDEB dsRNA agents or CIDEB antisense polynucleotide agents means administering one or more “naked” CIDEB dsRNA agent or CIDEB antisense polynucleotide agent sequences to cells or subjects, and in certain embodiments of the present invention, “delivery” means administering to cells or subjects by transfection, delivering cells containing the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent to the subject, and delivering a vector encoding the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent into the subject’s body.The delivery of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent using transfection means may include administering the vector to cells and / or subjects.

[0189] In some methods of the present invention, one or more CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be administered in formulations, which can be administered in pharmaceutically acceptable solutions, which typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, suitable carriers, adjuvants, and optionally other therapeutic components. In some embodiments of the present invention, the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent is prepared with another therapeutic agent for co-administration. According to the methods of the present invention, the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent can be administered in a pharmaceutical composition. Generally, the pharmaceutical composition comprises the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the efficacy of the biological activity of the active ingredient (e.g., the ability of a CIDEB dsRNA agent or CIDEB antisense polynucleotide agent to suppress CIDEB gene expression) present in cells or subjects. Various methods for administering and delivering dsRNA agents or CIDEB antisense polynucleotide agents used for therapeutic purposes are known in the art and can be used in the methods of the present invention.

[0190] Pharmacopoeia-acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657 and are known to those skilled in the art in other patents. Such formulations typically include salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. While the salts described above are pharmaceutically acceptable when used in drugs, non-pharmaceutically acceptable salts are not excluded from the scope of the invention and can be suitably used in the preparation of such pharmaceutically acceptable salts. Such pharmacokinetic and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Furthermore, pharmaceutically acceptable salts can be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0191] Some embodiments of the methods of the present invention involve directly administering one or more CIDEB dsRNA agents or CIDEB antisense polynucleotide reagents to a tissue. In some embodiments, the tissue to which the compounds are administered is a tissue in which CIDEB-related disease or pathology is present or likely to appear, non-limiting examples of which are the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds proceed naturally, passing through the liver and kidneys, and some embodiments of the therapeutic methods of the present invention involve orally administering one or more CIDEB dsRNA agents to a subject. CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be administered alone or in combination with other therapeutic agents, in a single dose, or they can be administered in multiple doses. When administered in multiple doses, CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the initial (or first few) doses may be administered subcutaneously, and one or more additional doses may be administered orally and / or systemically.

[0192] In embodiments of the present invention where systemic administration of a CIDEB dsRNA agent or a CIDEB antisense polynucleotide agent is desired, the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent can be prepared for parenteral administration by injection (e.g., bolus injection or continuous infusion). The injectable formulation can exist in unit dosage form in ampoules or multi-dose containers, with or without the addition of preservatives. The CIDEB dsRNA agent formulation (also called a pharmaceutical composition) can take the form of a suspension, solution or emulsion in an oily or aqueous medium, and may contain preparing agents such as suspending agents, stabilizers and / or dispersants.

[0193] Parenteral formulations include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffering media. Parenteral carriers include sodium chloride solutions, ringer's dextrose, glucose and sodium chloride, Ringer's lactate solution, or fixative oils. Intravenous carriers include liquids and nutritional supplements, electrolyte supplements (e.g., those based on ringer's dextrose). Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present. Other forms of administration, such as intravenous administration, result in relatively low doses. If the subject's response to the initial dose is insufficient, higher doses (or higher doses that are effective through a different, more localized delivery route) may be used within the patient's tolerance tolerance. If necessary, multiple doses can be used daily to achieve appropriate systemic or local levels of one or more CIDEB dsRNA agents or CIDEB antisense polynucleotide agents, and to achieve appropriate reduction of CIDEB protein activity.

[0194] In other embodiments, the method of the present invention involves the use of a delivery vector, such as biocompatible microparticles, nanoparticles, or an implant in the body of a recipient (e.g., a subject) suitable for implantation. Exemplary biodegradable implants that can be used by the method are described in PCT disclosure number WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible biodegradable polymer matrix containing a biopolymer.

[0195] Both non-biodegradable and biodegradable polymer matrices can be used in the methods of the present invention to deliver one or more CIDEB dsRNA agents or CIDEB antisense polynucleotide reagents to a subject. In some examples, the matrix may be biodegradable. The matrix polymer may be natural or synthetic. Based on the period for which release is required, polymers can be selected, typically on the order of several hours to one year or more. Typically, release times of several hours to 3 to 12 months are used. The polymer is optionally in the form of a hydrogel capable of absorbing up to about 90% of its weight in water, and further optionally, crosslinked with polyvalent ions or other polymers.

[0196] In general, in some embodiments of the present invention, biodegradable implants can be used to deliver CIDEB dsRNA agents or CIDEB antisense polynucleotide agents by diffusion or degradation of a polymer matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver CIDEB dsRNA agents or CIDEB antisense polynucleotide reagents using methods known in the art. Bioadhesive polymers such as bioerosive hydrogels (see HSSawhney, CPPathak and JAHubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used for drugs to deliver CIDEB dsRNA agents or CIDEB antisense polynucleotides to treat CIDEB-related diseases or conditions. Another suitable delivery system may include delayed-release, delayed-release, or sustained-release delivery systems. Such systems can avoid repeated administration of CIDEB dsRNA agents or CIDEB antisense polynucleotide agents, thereby increasing convenience for subjects and medical professionals. Many types of release delivery systems are available and known to those skilled in the art. (See, for example, U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686, the respective teachings of which are incorporated herein by reference). Furthermore, pump-based hardware delivery systems, some of which are suitable for implantation, can be used.

[0197] The use of long-acting sustained-release implants can be applied to the prophylactic treatment of subjects and subjects at risk of developing recurrent CIDEB-related diseases or conditions. As used herein, long-acting release refers to constructing and positioning an implant to deliver therapeutic levels of CIDEB dsRNA or CIDEB antisense polynucleotide agents over periods of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or longer. Long-acting sustained-release implants are well known to those skilled in the art and include some of the release systems described above.

[0198] Therapeutic formulations of CIDEB dsRNA agents or CIDEB antisense polynucleotide agents can be prepared for storage by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions [Remington's Pharmaceutical Sciences, 21st edition, 2006]. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dose and concentration used and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., benzyldimethylstearylammonium chloride hydrate; hexamethonium; benzalkonium chloride, benzethonium chloride; phenol, butanol, or benzyl alcohol; alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); and low molecular weight (less than approximately 10 residues). Polypeptides; proteins such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0199] Cells, subjects, and controls The methods of the present invention can be used in combination with cells, tissues, organs and / or subjects. In some embodiments of the present invention, the subjects are humans or vertebrate mammals, including but not limited to primates such as dogs, cats, horses, cattle, goats, mice, rats and monkeys. Accordingly, the present invention can be used for the treatment of CIDEB-related diseases or conditions in human and non-human subjects. In some embodiments of the present invention, the subjects may be farm animals, zoo animals, livestock or non-livestock animals, and the methods of the present invention can be used in veterinary preventive and therapeutic schemes. In some embodiments of the present invention, the subjects are humans, and the methods of the present invention can be used in preventive and therapeutic schemes for humans.

[0200] Non-limiting examples of subjects to whom the present invention can be applied are subjects who have been diagnosed with, suspected of having, or are at risk of having a disease or condition associated with higher-than-desired CIDEB expression and / or activity, also known as “elevated CIDEB expression levels.” Non-limiting examples of diseases and conditions associated with higher-than-desired CIDEB expression and / or activity are described elsewhere in this specification. The methods of the present invention can be applied to subjects diagnosed with a disease or condition associated with higher-than-desired CIDEB expression and / or activity at the time of treatment, or subjects who are considered to have or be at risk of developing a disease or condition associated with higher-than-desired CIDEB expression and / or activity. In some embodiments of the present invention, the disease or condition associated with higher-than-desired CIDEB expression and / or activity levels is an acute disease or condition, and in certain embodiments of the present invention, the onset and / or reduction of activity of a disease or condition associated with higher-than-desired CIDEB levels is a chronic disease or condition.

[0201] In non-limiting examples, the CIDEB dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of having statin-resistant hypercholesterolemia, where the hypercholesterolemia is a disease requiring reduction of CIDEB expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to have or be at risk of developing the disease or condition.

[0202] In another non-limiting example, the CIDEB dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of having hyperlipidemia, where hyperlipidemia is a disease requiring reduction of CIDEB expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to have or be at risk of developing the disease or condition.

[0203] Cells to which the methods of the present invention can be applied include in vitro, in vivo, and ex vivo cells. The cells may be in a subject, in a culture, and / or in a suspension, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may also include liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In certain embodiments of the present invention, the cells to which the methods of the present invention can be applied are healthy, normal cells that are not known to be diseased cells. In certain embodiments of the present invention, the cells to which the methods and compositions of the present invention can be applied are liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In certain embodiments of the present invention, while control cells are normal cells, it should be understood that cells having a disease or disorder may be used as control cells in certain cases, for example, to compare the results of treated cells having a disease with untreated cells having the disease or disorder.

[0204] According to the method of the present invention, the CIDEB polypeptide activity level can be measured and compared to a control level of CIDEB polypeptide activity. The control may be a predetermined value that can take various forms. It may be a single cutoff value such as the median or mean. It can be established based on comparison groups, such as a group having normal levels of CIDEB polypeptide and / or CIDEB polypeptide activity, and a group having increased levels of CIDEB polypeptide and / or CIDEB polypeptide activity. Other non-limiting examples of comparison groups may be a group having one or more symptoms of a CIDEB-related disease or condition, or diagnosed with a CIDEB-related disease or condition, a group not having one or more symptoms of such disease or condition, or not diagnosed with such disease or condition, a group of subjects treated with the siRNA of the present invention, or a group of subjects not treated with the siRNA of the present invention. Typically, the control may be based on clearly healthy normal individuals or clearly healthy cells in an appropriate age group. It should be understood that, in addition to a predetermined value, the control according to the present invention may also be a sample of material tested in parallel with the experimental material. Examples include samples from a control group, or manufactured control samples tested in parallel with experimental samples. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted or treated with the CIDEB dsRNA agent of the present invention, in which case the control level of CIDEB polypeptide and / or CIDEB polypeptide activity can be compared to the level of CIDEB polypeptide and / or CIDEB polypeptide activity in cells or subjects that have been contacted with the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention.

[0205] In some embodiments of the present invention, the level of CIDEB polypeptide is measured, and the subject may be at a control level, and the CIDEB polypeptide level measured at different time points in the same subject is compared to it. In non-limiting examples, the CIDEB level is measured in a biological sample obtained from a subject that has not been treated with the CIDEB agent of the present invention. In some embodiments, the biological sample is a serum sample. In some embodiments, the biological sample is a liver sample. The CIDEB polypeptide level measured in a sample obtained from a subject can be used as a baseline or control value for the subject. In the therapeutic method of the present invention, after administering the CIDEB dsRNA agent to a subject once or more times, one or more other serum samples can be obtained from the subject, and the CIDEB polypeptide level in one or more subsequent samples can be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of CIDEB-related disease or condition in the subject. For example, if the level of CIDEB polypeptide in a baseline sample obtained from a subject is higher than the level in a sample obtained from the same subject after administering the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention to the subject, it indicates regression of a CIDEB-related disease or condition and demonstrates the efficacy of the administered CIDEB dsRNA agent of the present invention in treating a CIDEB-related disease or condition.

[0206] In some embodiments of the present invention, one or more values ​​at the level of CIDEB polypeptide and / or CIDEB polypeptide activity determined for a subject can then be used as a control value for comparing the levels of CIDEB polypeptide and / or CIDEB activity in the same subject, thereby enabling the evaluation of changes in "baseline" CIDEB polypeptide activity in the subject. Therefore, the initial CIDEB polypeptide level and / or initial CIDEB polypeptide activity level is present in and / or determined in the subject, and the methods and compounds of the present invention can be used to reduce the level of CIDEB polypeptide and / or CIDEB polypeptide activity in the subject, with the initial level being used as a control level for that subject.

[0207] The CIDEB dsRNA reagent and / or CIDEB antisense polynucleotide agent of the present invention can be administered to a subject using the method of the present invention. The efficacy of the administration and treatment of the present invention can be evaluated when the level of CIDEB polypeptide in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of CIDEB polypeptide in the serum sample obtained from the subject at a previous point in time, or to a non-contact control level (e.g., the level of CIDEB polypeptide in a control serum sample). It should be understood that both the CIDEB polypeptide level and the CIDEB polypeptide activity level correlate with the CIDEB gene expression level. A particular embodiment of the method of the present invention involves administering an amount of the CIDEB dsRNA and / or CIDEB antisense agent of the present invention to a subject in a quantity that effectively suppresses CIDEB gene expression, thereby reducing the CIDEB polypeptide level and the CIDEB polypeptide activity level in the subject.

[0208] Some embodiments of the present invention involve measuring the presence, absence, and / or amount (also referred to herein as level) of CIDEB polypeptide in one or more biological samples obtained from one or more subjects. Such measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to measure the level of CIDEB polypeptide in biological samples obtained from subjects that have been previously treated with the CIDEB dsRNA agent and / or CIDEB antisense agent of the present invention. If the CIDEB polypeptide level measured in a serum sample of a treated subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-treatment level of CIDEB polypeptide measured in the subject, or compared to the level in a non-contact control biological sample, it indicates the level of efficacy of the treatment administered to the subject.

[0209] In some embodiments of the present invention, the physiological characteristics of a CIDEB-related disease or condition determined for a subject may be determined in contrast to physiological characteristics determined for the same subject at different time points. In non-limiting examples, physiological characteristics may include, for example, CIDEB mRNA levels, CIDEB protein levels, or lipid levels, triglycerides, cholesterol levels, free fatty acid levels in plasma or tissue samples, or liver fat levels and / or lipid droplet levels measured in biological samples (e.g., liver or serum samples) obtained from subjects not treated with the CIDEB agent of the present invention. CIDEB mRNA levels (and / or other physiological characteristics of the CIDEB disease or condition) measured in samples obtained from subjects can be used as a baseline or control value for the subject. In the therapeutic method of the present invention, after administering a CIDEB dsRNA agent to a subject once or more times, one or more separate liver or serum samples can be obtained from the subject, and the CIDEB mRNA levels and / or CIDEB protein levels in the subsequent samples are measured and compared to the control / baseline levels and / or ratios, respectively, of the subject. Such comparisons can be used to assess the onset, progression, or regression of CIDEB-related disease or condition in the subject. For example, if the CIDEB mRNA level in a baseline sample obtained from a subject after administration of the CIDEB dsRNA agent or CIDEB antisense polynucleotide agent of the present invention is higher than the CIDEB mRNA level measured in a sample obtained from the same subject, it indicates a regression in the description of CIDEB-related disease or condition and demonstrates the efficacy of the administered CIDEB dsRNA agent of the present invention in treating CIDEB-related disease or condition.

[0210] In some embodiments of the present invention, values ​​of one or more physiological characteristics of a CIDEB-related disease or condition measured in a subject can be used as a control value and subsequently used for comparison of the physiological characteristics of the same subject, thereby enabling the evaluation of changes in the "baseline" physiological characteristics from the subject. Therefore, if an initial physiological characteristic is present and / or measurable in a subject, and the method and compounds of the present invention can be used to reduce CIDEB polypeptide levels and / or CIDEB polypeptide activity in the subject, where the initial physiological characteristic is measured and used as a control for the subject.

[0211] Using the method of the present invention, CIDEB dsRNA and / or CIDEB antisense polynucleotide agents of the present invention can be administered to a subject in an effective amount to treat CIDEB disease or pathology. The efficacy of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of CIDEB disease or pathology. In non-limiting examples, the CIDEB mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous point in time, or compared to uncontacted control levels (e.g., CIDEB mRNA levels in a control serum sample). It should be understood that CIDEB mRNA levels, CIDEB protein levels, or lipid levels, triglycerides, cholesterol levels, free fatty acid levels in plasma or tissue samples, or fat levels and / or lipid droplet levels in the liver all correlate with CIDEB gene expression levels. Specific embodiments of the method of the present invention involve administering the CIDEB dsRNA and / or CIDEB antisense agent of the present invention to a subject in an amount that effectively suppresses CIDEB gene expression and thereby reduces CIDEB mRNA levels and CIDEB protein levels in the subject, or otherwise positively influencing the physiological characteristics of a CIDEB-related disease or condition in the subject.

[0212] Some embodiments of the present invention include determining the presence, absence, and / or alteration of the physiological characteristics of a CIDEB-related disease or condition using methods including, but not limited to, (1) evaluating the physiological characteristics of one or more biological samples obtained from one or more subjects, (2) imaging the subjects (e.g., obtaining liver images), and (3) performing a health examination on the subjects. Such measurements can be used to evaluate the effectiveness of the therapeutic methods of the present invention.

[0213] Reagent kit A reagent kit comprising one or more CIDEB dsRNA agents and / or CIDEB antisense polynucleotide reagents, and instructions for use in the method of the present invention, is also within the scope of the present invention. The reagent kit of the present invention may contain one or more CIDEB dsRNA agents, CIDEB sense polynucleotides, and CIDEB antisense polynucleotide agents that can be used to treat CIDEB-related diseases or conditions. A reagent kit comprising one or more CIDEB dsRNA agents, CIDEB sense polynucleotides, and CIDEB antisense polynucleotide reagents can be manufactured and used in the therapeutic method of the present invention. The components of the reagent kit of the present invention can be packaged in an aqueous medium or in a lyophilized form. The reagent kit of the present invention may include a carrier, which is separated to tightly and exclusively house one or more container devices or a series of container devices (e.g., test tubes, vials, flasks, bottles, syringes, etc.) therein. The first container device or series of container devices may contain one or more compounds, for example, a CIDEB dsRNA agent and / or a CIDEB sense or antisense polynucleotide reagent. The second container device or series of container devices may include a targeting agent, a labeling agent, a delivery agent, etc., and in one embodiment of the therapeutic method of the present invention, it may be included as part of the administered CIDEB dsRNA agent and / or CIDEB antisense polynucleotide.

[0214] The reagent kit of the present invention may further include an instruction manual. The instruction manual is usually in written form and provides instructions for carrying out treatment with the reagent kit and for making decisions based on such treatment.

[0215] The following examples are provided to illustrate specific examples of carrying out the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention can be applied to a variety of compositions and methods. [Examples]

[0216] Specific examples Example 1. Production of intermediate-A and intermediate-B.

[0217] As shown in Procedure 1 below, intermediate A was synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl trifluoromethanesulfonate (TMSOTf) in dichloromethane (DCM). Subsequently, it was glycosylated with Cbz-protected 2-(2-aminoethoxy)ethane-1-ol to obtain compound II. The Cbz protecting group was removed by hydrogenation to obtain intermediate A, which is the trifluoroacetic acid (TFA) salt. Intermediate B was synthesized based on the same procedure, except that Cbz-protected 2-(2-(2-aminoethoxy)ethoxy)ethane-1-ol was used as the starting material.

[0218] [ka] Plan 1 TMSOTf (17.1 g, 77.2 mmol) was added to a solution of compound I (20.0 g, 51.4 mmol) in 100 mL of 1,2-dichloroethane (DCE). The resulting reaction solution was stirred at 60°C for 2 hours, and then at 25°C for 1 hour. Cbz-protected 2-(2-aminoethoxy)ethane-1-ol (13.5 g, 56.5 mmol) in 100 mL of DCE dried with 4 Å powder molecular sieves (10 g) was added dropwise to the reaction solution at 0°C under an N2 atmosphere. The resulting reaction mixture was stirred at 25°C under an N2 atmosphere for 16 hours. The reaction mixture was filtered and washed with saturated NaHCO3 (200 mL), water (200 mL), and saturated saline solution (200 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the crude product, which was polished with 2-methyltetrahydrofuran / heptane (5 / 3, v / v, 1.80 L) for 2 hours. The resulting mixture was filtered and dried to obtain compound II (15.0 g, yield 50.3%), a white solid.

[0219] 10% Pd / C (1.50 g) was carefully added to a dry, argon-purged hydrogenation bottle, followed by the addition of 10 mL of tetrahydrofuran (THF), and then a solution of compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed, purged three times with H2, and stirred at 25°C for 3 hours in an H2 (45 psi) atmosphere. Thin-layer chromatography (TLC, in a solvent of DCM:MeOH = 10:1) showed that compound II was completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. This process was repeated three times to obtain intermediate A (14.0 g, 96.5% yield), a foamy white solid. 1H NMR (400 MHz DMSO-d6): δ ppm 7.90 (d, J = 9.29 Hz, 1 H), 7.78 (br s, 3 H), 5.23 (d, J = 3.26 Hz, 1 H), 4.98 (dd, J = 11.29, 3.26 Hz, 1 H), 4.56 (d, J = 8.53 Hz, 1 H), 3.98 - 4.07 (m, 3 H), 3.79 - 3.93 (m, 2 H), 3.55 - 3.66 (m, 5 H), 2.98 (br d, J = 4.77 Hz, 2 H), 2.11 (s, 3 H), 2.00 (s, 3 H), 1.90 (s, 3 H), 1.76 (s, 3 H).

[0220] Intermediate B was synthesized using a procedure similar to that used for the synthesis of intermediate A. 1 H NMR (400 MHz DMSO-d6): δ ppm 7.90 (br d, J = 9.03 Hz, 4 H), 5.21 (d, J = 3.51 Hz, 1 H), 4.97 (dd, J = 11.1 Hz, 1 H), 4.54 (d, J = 8.53 Hz, 1 H), 3.98 - 4.06 (m, 3 H), 3.88 (dt, J = 10.9 Hz, 1 H), 3.76 - 3.83 (m, 1 H), 3.49 - 3.61 (m, 9 H), 2.97 (br s, 2 H), 2.10 (s, 3 H), 1.99 (s, 3 H), 1.88 (s, 3 H), 1.78 (s, 3 H). Mass calc. for C 20 H 34 N2O 11 : 478.22; found: 479.3 (M+H + ).

[0221] Example 2. Synthesis of GalNAc ligand cluster phosphoramidites GLPA1, GLPA2, and GLPA15.

[0222] GLPA1 and GLPA2 were prepared according to the following plan 2. Starting with benzyl-protected propane-1,3-diamine, it was alkylated with tert-butyl 2-bromoacetate to obtain triester compound I. The benzyl protecting group was removed by hydrogenation to obtain secondary amine compound II. Compound III was obtained by coupling the amide with 6-hydroxyhexanoic acid. Next, after treatment with HCl in dioxane, the tert-butyl protecting group was removed to produce triacid compound IV. Compound Va or Vb was obtained by amide coupling between triacid compound IV and intermediate A or intermediate B. Phosphoramidite GLPA1 or GLPA2 was synthesized by phosphorylating compound Va or Vb with 2-cyanoethyl N,N-diisopropyl chlorophosphoramidite and a catalytic amount of 1H-tetrazole.

[0223] [ka] Plan 2 To a solution of N-benzyl-1,3-propylenediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL), tert-butyl bromoacetate (23.7 g, 121 mmol) was added, followed by the dropwise addition of diisopropylethylamine (DIEA, 23.61 g, 182 mmol). The resulting reaction mixture was stirred at 25°C to 30°C for 16 hours. LC-MS showed that the N-benzyl-1,3-propylenediamine had been completely consumed. The reaction mixture was diluted with H2O (500 mL) and extracted with ethyl acetate (500 mL x 2). The combined organic matter was washed with saturated brine (1 L), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the crude product, which was purified by silica gel column chromatography (with a gradient of petroleum ether:ethyl acetate at a ratio of 20:1 to 5:1). Compound I (12.1 g, 78.4% yield), a colorless oily substance, was obtained. 1H NMR (400 MHz, CDCl3): δ ppm 7.26 - 7.40 (m, 5 H), 3.79 (s, 2 H), 3.43 (s, 4 H), 3.21 (s, 2 H), 2.72 (dt, J = 16.9, 7.34 Hz, 4 H), 1.70 (quin, J = 7.2Hz, 2H), 1.44 - 1.50 (m, 27H).

[0224] The dry hydrogenated bottle was purged three times with argon gas. Pd / C (200 mg, 10%) was added, followed by MeOH (5 mL), and then a solution of compound I (1.00 g, 1.97 mmol) in MeOH (5 mL) was added. The reaction mixture was degassed under vacuum and refilled with H2. This process was repeated three times. The mixture was stirred at 25°C for 12 hours in an H2 (15 psi) atmosphere. LC-MS showed that compound I was completely consumed. The reaction mixture was filtered under reduced pressure in an N2 atmosphere. The filtrate was concentrated under reduced pressure to obtain compound II (655 mg, 79.7% yield), a yellow oily substance, which could be used in the next step without further purification. 1 H NMR (400 MHz, CDCl3): δ ppm 3.44 (s, 4 H), 3.31 (s, 2 H), 2.78 (t, J = 7.1 Hz, 2 H), 2.68 (t, J = 6.9 Hz, 2 H), 1.88 (br s, 1 H), 1.69 (quin, J = 7.03 Hz, 2H), 1.44 - 1.50 (s, 27H).

[0225] Compound II (655 mg, 1.57 mmol), 6-hydroxyhexanoic acid (249 mg, 1.89 mmol), DIEA (1.02 g, 7.86 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 904 mg, 4.72 mmol), and 1-hydroxybenzotriazole (HOBt, 637 mg, 4.72 mmol) were mixed in DMF (6 mL). The mixture was degassed, purged three times with N2, and then stirred at 25°C for 3 hours under an N2 atmosphere. LC-MS showed the desired product. The reaction mixture was diluted with H2O (10 mL) and extracted with 20 mL of siRNA (10 mL x 2). The organic compounds were combined, washed with saturated brine (20 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain the crude product. This was purified by silica gel column chromatography (with a gradient of petroleum ether:ethyl acetate at a ratio of 5:1 to 1:1) to obtain compound III (650 mg, yield 77.8%), a yellow oily substance. 1 H NMR (400 MHz, CDCl3): δ ppm 3.90 - 3.95 (s, 2 H), 3.63 (t, J = 6.40 Hz, 2 H), 3.38 - 3.45 (m, 6 H), 2.72 (t, J = 6.65 Hz, 2 H), 2.40 (t, J = 7.28 Hz, 2 H), 1.55 - 1.75 (m, 8 H), 1.44 (s, 27 H).C 27 H 50 Calculated mass of N2O8: 530.36; Measured mass: 531.3 (M+H + ).

[0226] Compound III (5.5 g, 10.3 mmol) was mixed with HCl / dioxane (2 M, 55 mL) and stirred at 25°C for 3 hours. LC-MS showed that Compound III was completely consumed. The reaction mixture was filtered, washed with  (50 mL), and dried under reduced pressure to obtain the crude product. This was dissolved in CH3CN (50 mL) and volatile matter was removed under vacuum. This process was repeated three times to obtain Compound IV (2.05 g, 54.5% yield), a white solid. 1H NMR (400 MHz, D2O): δ ppm 4.21 (s, 1 H), 4.07 (d, J = 4.5 Hz, 4 H), 3.99 (s, 1 H), 3.45 - 3.52 (m, 3 H), 3.42 (t, J = 6.5 Hz, 1 H), 3.32 - 3.38 (m, 1 H), 3.24 - 3.31 (m, 1 H), 2.37 (t, J = 7.4 Hz, 1 H), 2.24 (t, J = 7.4 Hz, 1 H), 1.99 (dt, J = 15.5, 7.53 Hz, 1 H), 1.85 - 1.94 (m, 1 H), 1.85 - 1.94 (m, 1 H), 1.39 - 1.56 (m, 4H), 1.19 - 1.31 (m, 2H).

[0227] Compound IV (500 mg, 1.05 mmol), intermediate A (2.02 g, 3.67 mmol), DIEA (813 mg, 6.30 mmol), EDCI (704 mg, 3.67 mmol), and HOBt (496 mg, 3.67 mmol) were degassed in DMF (10 mL), purged three times with N2, and then stirred in an N2 atmosphere at 25°C for 3 hours. LC-MS showed the desired product. The reaction mixture was quenched by adding H2O (10 mL) and extracted with DCM (10 mL x 2). The combined organic matter was extracted with 10% citric acid (20 mL). The aqueous phase was neutralized with saturated NaHCO3 solution and re-extracted with DCM (10 mL x 2). The organic matter was dried with sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound Va (570 mg, 0.281 mmol, yield 26.8%), which was a white solid. 1H NMR: (400 MHz, CDCl3) ppm δ 7.84 - 8.12 (m, 3 H), 6.85 - 7.15 (m, 2 H), 6.66 - 6.81 (m, 1 H), 5.36 (br d, J = 2.7 Hz, 3 H), 5.11 - 5.27 (m, 3 H), 4.63 - 4.85 (m, 3 H), 3.90 - 4.25 (m, 18 H), 3.37 - 3.75 (m, 28 H), 3.15 - 3.28 (m, 4 H), 2.64 (br d, J = 6.53 Hz, 2 H), 2.30 - 2.46 (m, 2 H), 2.13 - 2.18 (m, 9 H), 2.05 (s, 9 H), 1.94 - 2.03 (m, 18 H), 1.68 (br s, 2 H), 1.45 (br s, 2 H), 1.12 (br t, J = 7.0 Hz, 2 H)。

[0228] At ambient temperature and in N2, compound Va (260 mg, 0.161 mmol) was dissolved in anhydrous DCM (5 mL) and diisopropylammonium tetrazolate (30.3 mg, 0.177 mmol) was added, followed by the dropwise addition of 3-bis(diisopropylamino)phosphonooxypropionitrile (194 mg, 0.645 mmol). The reaction mixture was stirred at 20°C to 25°C for 2 hours. LC-MS showed that compound Va was completely consumed. After cooling to -20°C, the reaction mixture was added at 0°C to a stirred saline / saturated NaHCO3 aqueous solution (1:1, 5 mL). After stirring for 1 minute, DCM (5 mL) was added. The layers were separated. The organic matter was washed with saline / saturated NaHCO3 aqueous solution (1:1, 5 mL), dried over Na2SO4, filtered, and concentrated to approximately 1 mL. The residue solution was added dropwise to 20 mL of methyl tert-butyl ether (MTBE) while stirring. This precipitated a white solid. The mixture was centrifuged and the solid was collected. The solid was redissolved in 1 mL of DCM and precipitated by adding MTBE (20 mL). The solid was separated again by centrifugation. The collected solid was dissolved in anhydrous CH3CN. Volatile matter was removed. This process was repeated two more times to obtain the white solid GalNAc ligand phosphoramidite compound GLPA1 (153 mg, 84.4 μmol). 1 H NMR (400 MHz, CDCl3): ppm δ 7.71 - 8.06 (m, 2 H), 6.60 - 7.06 (m, 3 H), 5.37 (br d, J = 3.0 Hz, 3 H), 5.18 - 5.32 (m, 3 H), 4.70 - 4.86 (m, 3 2.07 (s, 9 H), 1.96 - 2.03 (m, 18 H), 1.65 (br s, 4 H), 1.44 (br d, J = 7.28 Hz, 2 H), 1.14 - 1.24 (m, 12 H). 31P NMR (CDCl3): ppm δ 147.15.

[0229] The GalNAc ligand phosphoramidite compound GLPA2 was synthesized using the same procedure, except that intermediate B was used. 1 H NMR (400 MHz, CDCl3): ppm δ 7.94 - 8.18 (m, 1 H), 7.69 (br s, 1 H), 6.66 - 7.10 (m, 3 H), 5.35 (d, J = 3.5 Hz, 3 H), 5.07 - 5.25 (m, 3 H), 4.76 - 4.86 (m, 3 H), 4.01 - 4.31 (m, 10 H), 3.91 - 4.01 (m, 8 H), 3.74 - 3.86 (m, 4 H), 3.52 - 3.71 (m, 30 H), 3.42 - 3.50 (m, 6 H), 3.15 - 3.25 (m, 4H), 2.52 - 2.70 (m, 4 H), 2.22 - 2.45 (m, 2 H), 2.15 - 2.22 (s, 9 H), 2.06 (s, 9 H), 1.95 - 2.03 (m, 18 H), 1.77 (br s, 2 H), 1.58 - 1.66 (m, 4 H), 1.40 (m, 2 H), 1.08 - 1.24 (m, 12 H). 31 P NMR (CDCl3): ppm δ 147.12.

[0230] GLPA15 was manufactured according to Plan 3 below.

[0231] [ka] Plan 3 Starting with secondary amine compound I (compound II in plan 2), Cbz protection was introduced to obtain compound II. The tert-butyl group of compound II was removed by acid treatment to obtain triacid compound III. Compound III and intermediate A were amide-coupled to obtain compound IV. The Cbz protecting group of compound IV was removed by hydrogenation to obtain secondary amine compound V, which was reacted with glutaric anhydride to obtain carboxyl compound VI. Compound VI and piperidine-4-ol were reacted under amide coupling conditions to obtain compound VII. By treating compound VII with 2-cyanoethyl N,N-diisopropyl chlorophosphoramidite and a catalytic amount of 1H-tetrazole, the phosphoramidite compound GLPA15 was synthesized. 1 H NMR (400 MHz in DMSO-d6): δ ppm 8.05 (br d, J = 6.50 Hz, 2 H), 7.81 (br d, J=9.01 Hz, 3 H), 5.22 (d, J=3.25 Hz, 3 H), 4.98 (dd, J=11.26, 3.25 Hz, 3 H), 4.55 (br d, J=8.50 Hz, 3 H), 4.03 (s, 9 H), 3.64 - 3.97 (m, 12 H), 3.55 - 3.63 (m, 6 H), 3.50 (br s, 5 H), 3.40 (br d, J=6.13 Hz, 6 H), 3.17 - 3.30 (m, 9 H), 3.07 (br d, J=14.26 Hz, 4 H), 2.76 (t, J=5.82 Hz, 2 H), 2.18 - 2.47 (m, 6 H), 2.10 (s, 9 H), 1.99 (s, 9 H), 1.89 (s, 9 H), 1.78 (s, 9 31P NMR (DMSO-d6): ppm δ 145.25.

[0232] In a particular study, a method for ligating a target group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of a sense strand involved using GalNAc phosphoramidite (GLPA1) in the final coupling step of solid-phase synthesis in a synthetic process, the synthetic process being, for example, a process used for extending oligonucleotide chains to add a nucleotide to the 5' end of a sense strand.

[0233] In some studies, the method of linking a target group containing GalNAc to the 3' end of a sense chain involves using a solid support (CPG) containing GLO-n. In some studies, the method of linking a target group containing GalNAc to the 3' end of a sense chain involves linking the GalNAc target group to a CPG solid support by an ester bond, and using the resulting CPG containing the linked GalNAc target group during the synthesis of the sense chain, thereby linking the GalNAc target group to the 3' end of the sense chain.

[0234] Example 3. Phosphoramidite Compound 2 [ka] 4,4'-dimethoxytriphenylchloromethane (DMTrCl, 232 g, 684 mmol, 1.0 equivalent) in pyridine (400 mL) was added to a pyridine (600 mL) solution of compound A (isomannitol, 100 g, 684 mmol, 1.0 equivalent), and the mixture was stirred at 25°C for 16 hours. LC-MS showed that compound A was completely consumed and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with dichloromethane (500 mL x 2), washed with saline solution (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1~50 / 1, 0.1% Et3N) to obtain a yellow solid of compound B (150 g, yield 48.9%). 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).

[0235] At N2 atmospheric pressure, 2H-tetrazole (0.45 M, 436 mL, 1.1 equivalents) was added dropwise to a solution of compound B (80.0 g, 178 mmol, 1.0 equivalent) in dichloromethane (5.0 mL) at 25°C. Then, a solution of compound C (2-cyanoethyldiisopropyl chlorophosphoramidite, 80.6 g, 267 mmol, 85.0 mL, 1.5 equivalents) in dichloromethane (200 mL) was added dropwise. The reaction mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and injected into ice-cold NaHCO3 (500 mL). The mixture was extracted with dichloromethane (500 mL x 3), and the combined organic layer was washed with NaHCO3 / saline solution = 1:1 (300 mL / 300 mL). The mixture was dried over Na2SO4 and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain isomannitol phosphoramidite compound 2 (77 g, 119 mmol, yield 66.5%), which was a white solid. 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48 - 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).

[0236] Phosphoramidite compound 1 [ka] At 0-5°C and N2 atmospheric pressure, compound D (607 mg, 3.34 mmol, 3.0 equivalents) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equivalents) were added to a 5.0 mL solution of compound B (500 mg, 1.11 mmol, 1.0 equivalent) in DCM, and the mixture was stirred at 25°C for 1.0 hour. LC-MS showed that compound B was completely consumed, and LC-MS showed several novel peaks, detecting approximately 70.9% of the required compound. The resulting reaction mixture was cooled to -20°C and injected into a cold (0-5°C) saturated NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL x 2), and the combined organic layer was washed with cold (0-5°C) saturated NaHCO3 / saline solution = 1:1 (5.0 mL / 5.0 mL). The mixture was dried over Na2SO4 and concentrated under vacuum to obtain the residue (approximately 5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to obtain compound 1 (280 mg, 471 μmol, yield 42.3%), which was a white solid. 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1 H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12 H), 1.07 (br s, 3 H).

[0237] Other phosphoramidites can be produced by the procedures and / or existing techniques described herein, for example, US426,220 and WO02 / 36743.

[0238] Example 4. Production of a solid support containing the phosphoramidite monomer of the present invention [ka] [ka] This represents the carrier portion of the highly porous aminomethyl polyethylene resin. A 50L glass vessel was placed under the protection of nitrogen gas, and dichloromethane (19.50 kg) was added to the glass vessel and stirring was started. The temperature was controlled to 20-30°C, DMTr-imann (1.47 kg) was added to the glass vessel, and triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg), and succinic anhydride (1.34 kg) were added to the reaction vessel. The system was kept warm at 20-30°C and reacted for 18 hours, after which a sample was taken and the reaction was terminated. Saturated sodium bicarbonate solution (22.50 kg) was added to the completed system, stirred for 10-20 minutes, and then allowed to stand until the layers separated. The lower organic phase was transferred, the upper aqueous phase was extracted twice with dichloromethane, the organic phases were combined, dried with anhydrous sodium sulfate, the filtrate was filtered, and the mixture was transferred again and rotated distillation was performed to concentrate until no fraction remained, forming 1.83 kg of off-white solid from a gray solid.

[0239] N,N-dimethylformamide (23.50 kg) was added to a 100 L glass vessel and stirring was started. The temperature was controlled to 20-30°C and, under nitrogen gas protection, the product from the previous step, O-benzotriazole-tetramethyluronium hexafluorophosphate (0.33 kg), was added to the 100 L glass vessel via a solid input hopper, followed by the addition of N,N-diisopropylethylamine (0.13 kg). After the addition was complete, the mixture was stirred for 10-30 minutes and then discharged into a 50 L galvanized barrel for use. 3.25 kg of highly porous aminomethyl resin (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., lot number HA2X1209, loading amount 0.48 mmol / g) was added to the 100 L solid-phase synthesis vessel via a solid input hopper. The temperature was controlled to 20-30°C, and 21.00 kg of N,N-dimethylformamide and the reaction solution prepared for use in the galvanized barrel from the previous step were added to the solid-phase synthesis vessel. The system was reacted at a constant temperature, and the reaction was monitored until the solid loading amount reached ≥250 μmol / g. UV light was used to detect the loading amount. The system was filtered under pressure with nitrogen gas, and the filtered cake was rinsed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), leaving the filtered cake in the vessel. CAP.A (50% acetonitrile and 50% anhydride acetate, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were added to an 80 L glass vessel, stirred for 3 to 8 minutes, and then prepared for use. This operation was repeated three times for capping, and acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis vessel. Nitrogen gas was bubbled through for 10 to 30 minutes, and then pressure filtered. This process was repeated four times, and the filtered cake was purged with nitrogen gas in a solid-phase synthesis vessel for 2-4 hours. Then it was transferred to a 50L filter press tank, and the temperature was controlled to 15-30°C while drying continued. After drying, a yellow to white solid product weighing 3.516 kg was obtained.

[0240] Example 5. Synthesis of CIDEB RNAi agent.

[0241] The CIDEB RNAi reagent double-stranded compounds shown in Tables 2-3 above were synthesized according to the following general procedure.

[0242] siRNA sense and antisense chain sequences were synthesized in an oligonucleotide synthesizer using a mature solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain extension was achieved by a four-step cycle consisting of deprotection, condensation, capping, and oxidation or sulfidation steps for the addition of each nucleotide. Synthesis was performed on a solid support made from pore-controlled glass (CPG, 1000A). Monomer phosphoramidites can be purchased from commercial sources or may be the phosphoramidite compounds of Example 3 and WO2016 / 028649. The phosphoramidite compounds herein can be ligated at the 3' end as monomer phosphoramidites and further ligated to a CPG solid support. When ligated at the 5' end, the phosphoramidite compound can be used in the final coupling reaction and may be further conjugated to a target ligand as needed.

[0243] Phosphoramidites containing GalNAc ligand clusters were synthesized according to the procedures of Examples 1 and 2 of this specification (GLPA1, GLPA2, and GLPA15 are non-limiting examples). siRNAs used for in vitro screening (Table 2) were synthesized on a 2 μmol scale, while siRNAs used for in vivo testing (Table 3) were synthesized on a 5 μmol scale or larger. When the GalNAc ligand (GLO-0 is a non-limiting example) was ligated to the 3' end of the sense strand, a CPG solid support was used to ligate the GalNAc ligand. When the GalNAc ligand (GLS-5 or GLS-15 as non-limiting examples) was ligated to the 5' end of the sense strand, the GalNAc phosphoramidite (GLPA1, GLPA2, or GLPA15 as non-limiting examples) was used in the final coupling reaction.

[0244] The sense and antisense chains were synthesized by a four-step solid-phase synthesis method, the detailed steps of which include using a 3% trichloroacetic acid (TCA) in dichloromethane solution or a 10% dichloroacetic acid (DCA) in toluene solution for deprotection of the 4,4'-dimethoxytrityl protecting group (DMT). In the coupling step, 5-ethylthio-1H-tetrazole was used as an activator. The chains were capped with capping agent A (acetonitrile solution of acetic anhydride) / capping agent B (pyridine / NMI / acetonitrile solution) (v / v, 1:1). A Py / H2O solution of I2 and a pyridine / MeCN solution of phenylacetyl disulfide (PADS) or a pyridine solution of xanthine hydride (DDTT) were used for oxidation and sulfidation reactions, respectively.

[0245] After the final solid-phase synthesis step, the oligomers bound to the solid support were cleaved, and the protecting groups were removed by treatment with a 1:1 volume 40 wt.% methylamine solution and a 28% ammonium hydroxide solution. The oligomers bound to the solid support containing the phosphonate mimetic were treated with MeCN:TMSI:pyridine = 50:2:2 (v / v / v) before cleavage and protection, if necessary. The crude mixture was concentrated to synthesize siRNA for use in in vitro screening. The remaining solid was dissolved in 1.0 M NaOAc, and the single-stranded product as a sodium salt was precipitated by adding ice-cold EtOH, which could then be used for annealing without further purification. To synthesize siRNA for use in vivo testing, the crude single-stranded product was further purified by ion-pairing reversed-phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC was converted to a sodium salt by dissolving in 1.0 M NaOAc, and precipitated by adding ice-cold EtOH. The annealing of equimolarly complementary sense and antisense oligonucleotides was carried out in water to form a double-stranded siRNA product, which was then freeze-dried to obtain a fluffy white solid.

[0246] Example 6. In vitro screening of CIDEB double-stranded siRNA. Huh7 cells were digested with trypsin to the appropriate density and mixed with a complex of psiCHECK™-2 vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019), then inoculated into 96-well plates. According to the manufacturer's recommendations, the cells were transfected with test siRNA or control siRNA simultaneously with inoculation using Lipofectamine RNAiMax (Invitrogen-13778-150). siRNA was tested three times at two concentrations (1 nM and 10 nM).

[0247] Day 1: psiCHECK(TM)-2 vector transfection (1 plate) (1) 2.5 μg of psiCHECK(TM)-2 vector plasmid was transferred to an Eppendorf tube without RNASE (solution mixture #1). (2) Trypsin was added to one flask to dissociate the Huh7 cells, and the cells were counted using a Vi-Cell counter to adjust the cell density to 1*10^5 / ml. (3) 7.5 μL of Lipofectamine 2000 (Invitrogen-11668-019) was transferred to solution mix #1 tube and mixed uniformly.

[0248] (4) Add the solution from step 3 to the cell suspension, mix uniformly, and dispense the suspension into 96-well plates (100 μl / well). Day 2, siRNA transfection (1) Lipofectamine® RNAiMAX reagent was diluted in Opti-MEM® medium.

[0249] (2) Diluting the siRNA with RNA-free water prepared a 12× stock solution.

[0250] (3) Equivolute diluted RNAiMax and siRNA were mixed. The mixture was incubated at RT for 15 minutes to form a complex.

[0251] (4) Mix 45 μl / well of the compound Lipofectamine® RNAiMAX (Opti-MEM) and add it to 225 μl / well of fresh DMEM medium. Discard the supernatant from the measurement plate and add 120 μl / well of the compound mixture to a 96-well plate.

[0252] (5) The control well without the compound is defined as a cell that has been transfected with the psiCHECK™-2 vector but has not been treated with siRNA, and the blank control is a well with only cells.

[0253] Day 3: Measurement of Dual-Glo® luciferase. (1) The reagent was added to the measurement plate and left for 10 minutes to induce cell lysis.

[0254] (2) 100 μl of cell lysate was transferred to a plate, and then firefly luminescence was measured.

[0255] (3) 50 μl of Dual-Glo® Stop&Glo® Reagent was added to the measurement plate and mixed, and after waiting for 10 minutes, Renilla luminescence was measured.

[0256] (4) The relative expression was calculated. Data Analysis Sample well ratio = (Renilla luminescent sample - background blank) / ((fluorescent sample - background blank)) Ratio of control well without compound = (Control Renilla emission - background blank) / (Control fluorescence emission - background blank) % inhibition rate = 100 - (sample well ratio / average ratio of control wells without compound) × 100%

[0257] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4]

[0258] Example 7: In vivo study of CIDEB double-stranded siRNA. On day 1, female C57BL / 6J mice (4 mice per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human CIDEB and luciferase genes. On day 8, mice were subcutaneously administered 2 mg / kg or 3 mg / kg of CIDEB siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, and on days 15, 22, and finally on day 29. Plasma samples were isolated, and luciferase activity in the plasma samples was measured according to the manufacturer's recommended procedure. Since human CIDEB expression levels correlate with luciferase expression levels, the percentage of remaining CIDEB was calculated by comparing luciferase activity in siRNA-treated samples before and after treatment, and standardized by the change in luciferase activity in control samples over the same period.

[0259] [Table 7]

[0260] [Table 8]

[0261] [Table 9]

[0262] [Table 10]

[0263] [Table 11]

[0264] [Table 12]

[0265] Example 8: In vivo study of CIDEB siRNA double-stranded bodies in an NHP disease model. Eighteen healthy male cynomolgus monkeys (2-6 years old, 2-6 kg) were selected and randomly divided into six groups of three monkeys each. On day 0, each group received a single subcutaneous injection of one test substance at a dose of 4 mg / kg. After an overnight fast, liver biopsy samples were collected on day -7 (pre-administration), day 28, day 56, and day 126 after administration. CIDEB mRNA expression in the liver biopsy samples was measured by QPCR, as described elsewhere. The remaining percentage of CIDEB mRNA in each group (standardized to baseline value on day -7) is shown in Table 11.

[0266] [Table 13]

[0267] isomorphic While several embodiments of the present invention have been described and illustrated with examples in this specification, those skilled in the art will readily conceive of several other methods and / or structures to perform the functions described herein and / or to obtain the results and / or one or more advantages described herein, and each of such variations and / or modifications will be considered to fall within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and configurations described herein are illustrative, and that actual parameters, dimensions, materials and / or configurations will depend on one or more specific applications taught by the present invention. Those skilled in the art will recognize many equivalent forms of the specific embodiments of the present invention described herein, or can determine them simply by using ordinary experimentation. Accordingly, it should be understood that the above embodiments are presented only as examples and fall within the scope of the appended claims and their equivalent forms, and that the present invention may be carried out in ways different from those specifically described and claimed. The present invention relates to each of the individual features, systems, articles, materials and / or methods described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods is included within the scope of the present invention, provided that they are not inconsistent with each other.

[0268] All definitions defined and used herein should be understood to take precedence over dictionary definitions, documentary definitions incorporated by citation, and / or the ordinary meanings of the terms defined.

[0269] Unless explicitly stated otherwise, nouns without quantifiers used herein and in the claims should be understood as “at least one / kind.”

[0270] As used herein and in the claims, the “and / or” phrase means “one or two” of the elements thus combined; that is, the elements may exist together in some cases and separately in other cases. Unless expressly otherwise specified, other elements may exist at will, whether related to or unrelated to the elements explicitly identified by the “and / or” phrase.

[0271] All references, patents and patent applications, and publications cited or referenced herein are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprises at least 15 consecutive nucleotides having a difference of 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 2, and the sense strand and the antisense strand are partially, basically, or completely complementary to each other.

2. The dsRNA agent according to claim 1, wherein the sense strand comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of nucleotides 151-180, 167-190, 298-341, 393-413, 455-475, 519-544, 584-626, 820-876, or 1177-1202 of the nucleotide sequence of SEQ ID NO:

1.

3. The sense strand consists of nucleotides 147-177, 146-176, 149-179, 150-180, 152-182, 155-185, 162-192, 163-193, 164-194, 165-195, 293-323, 313-343, 316-346, 388-418, 450-480, 514-544, 519-549, 579-609, 581-611, 586-616, 588-618, 591-621, 59 The dsRNA agent according to claim 1, comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of 3-623, 594-624, 601-631, 815-845, 819-849, 822-852, 823-853, 825-855, 827-857, 832-862, 833-863, 834-864, 851-881, 1172-1202, 1176-1206, or 1177-1207.

4. The sense strand consists of nucleotides 151-171, 152-172, 154-174, 155-175, 157-177, 160-180, 167-187, 168-188, 169-189, 170-190, 298-318, 318-338, 321-341, 393-413, 455-475, 519-539, 524-544, 584-604, 586-606, 591-611, 593-613, 596-616, 59 The dsRNA agent according to claim 1, comprising at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one nucleotide sequence of 8-618, 599-619, 606-626, 820-840, 824-844, 827-847, 828-848, 830-850, 832-852, 837-857, 838-858, 839-859, 856-876, 1177-1197, 1181-1201, or 1182-1202.

5. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprises a region complementary to the CIDEB RNA transcript at nucleotide positions 2 to 18, the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1 to 3, and optionally comprises a target ligand.

6. The dsRNA agent according to claim 5, wherein the region complementary to the CIDEB RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides and differs from one of the antisense sequences listed in Tables 1 to 3 by three or fewer nucleotides.

7. The dsRNA agent according to any one of claims 1 to 5, wherein the antisense strand of the dsRNA is basically or completely complementary to any one of the target regions of Sequence ID No. 1 listed in Table 1, and preferably the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3.

8. The sense strand sequence is at least fundamentally complementary or completely complementary to the antisense strand sequence in the dsRNA agent, and preferably the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1 to 3, according to any one of claims 1 to 5.

9. The dsRNA agent according to any one of claims 1 to 8, wherein the dsRNA agent includes a sequence listed as a double-stranded sequence in any one of Tables 1 to 3.

10. The dsRNA agent according to any one of claims 1 to 7, wherein the dsRNA agent comprises at least one modified nucleotide.

11. The dsRNA agent according to any one of claims 1 to 7, wherein all or substantially all nucleotides of the sense strand and / or the antisense strand are modified nucleotides.

12. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, where the sense strand is complementary to the antisense strand, and the antisense strand includes a region that is partially complementary to the mRNA encoding CIDEB, each strand having a length of approximately 15 to approximately 30 nucleotides, and the sense strand sequence is shown by formula (I). 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I) Here, Each N′ F This represents a 2'-fluoromodified nucleotide, Each N′ N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N' N6 This independently represents a modified or unmodified nucleotide. Each N′ L This symbol independently represents modified or unmodified nucleotides, but does not represent 2'-fluoromodified nucleotides. m' and n' are each independent integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

13. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, where the sense strand is complementary to the antisense strand, the antisense strand includes a region that is partially complementary to the mRNA encoding CIDEB, each strand having a length of approximately 18 to approximately 30 nucleotides, and the antisense strand sequence is shown by formula (II). 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ (A) Here, Each N F This represents a 2'-fluoromodified nucleotide, Each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 This independently represents a modified or unmodified nucleotide. Each N L This symbol independently represents modified or unmodified nucleotides, but does not represent 2'-fluoromodified nucleotides. n is an integer between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

14. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, the antisense strand including a region partially complementary to the mRNA encoding CIDEB, each strand having a length of approximately 18 to approximately 30 nucleotides, and the antisense strand sequence being represented by formula (II'), 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (II') Here, Each N F This represents a 2'-fluoromodified nucleotide, Each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N z This independently represents a modified or unmodified nucleotide. Each N L This symbol independently represents modified or unmodified nucleotides, but does not represent 2'-fluoromodified nucleotides. n is an integer between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

15. N Z is a vinylphosphonate-modified nucleotide, preferably, N Z is VPu*, and the structure 【Chemistry 1】 A dsRNA agent according to claim 14, having the following characteristics.

16. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a dsRNA double-stranded body, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the mRNA encoding CIDEB, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA double-stranded body is represented by formula (III). Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' (III) Here, Each chain independently consists of approximately 17 to 30 nucleotides. Each N F and N' F This independently represents a 2'-fluoromodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , and N' N6 Each represents a modified or unmodified nucleotide independently. Each N L and N' L This independently represents modified or unmodified nucleotides, but not 2'-fluoromodified nucleotides. Furthermore, m', n', and n are each independent integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

17. A double-stranded ribonucleic acid (dsRNA) agent for suppressing the expression of dffa-like effector b (CIDEB) that induces cell death, wherein the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a dsRNA double-stranded body, the sense strand is complementary to the antisense strand, the antisense strand includes a region complementary to the mRNA encoding CIDEB, the complementary region includes at least 15 consecutive nucleotides, and the dsRNA double-stranded body is represented by formula (III'). Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense chain: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5' (III') Here, Each chain independently consists of approximately 17 to 30 nucleotides. Each N F and N' F This independently represents a 2'-fluoromodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 , N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N z Each represents a modified or unmodified nucleotide independently. Each N L and N' L This independently represents modified or unmodified nucleotides, but not 2'-fluoromodified nucleotides. Furthermore, m', n', and n are each independent integers between 0 and 7. Double-stranded ribonucleic acid (dsRNA) agent.

18. N Z is a vinylphosphonate-modified nucleotide, preferably N Z It is a VPu* and structure 【Chemistry 2】 A dsRNA agent according to claim 17, having the following characteristics.

19. The dsRNA agent according to any one of claims 10 to 18, wherein the one or more modified nucleotides are independently selected from 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seconucleotide mimetic, locked nucleotide, ring-open nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, reverse nucleotide, reverse debasalized nucleotide, isomannoside nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, 5'-phosphorothioate group-containing nucleotide, 5'-phosphate modified nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphoramidate, or a nucleotide-containing non-natural base.

20. A dsRNA agent according to any one of claims 10 to 19, comprising an E-vinylphosphonate nucleotide at the 5' end of the guide strand.

21. The dsRNA agent according to any one of claims 1 to 20, wherein the dsRNA agent comprises at least one phosphorothioate nucleotide bond.

22. The dsRNA agent according to any one of claims 1 to 21, wherein the sense strand comprises at least one phosphorothioate nucleotide bond, preferably at least one phosphorothioate (PS) bond introduced at the 5'-terminus, 3'-terminus, or both ends of the sense strand.

23. The dsRNA agent according to any one of claims 1 to 21, wherein the antisense strand comprises at least one phosphorothioate nucleotide bond, and preferably, at least one phosphorothioate (PS) bond is introduced at the 5'-terminus, 3'-terminus, or both ends of the antisense strand.

24. The sense strand comprises one, two, three, four, five, or six phosphorothioate nucleotide interbonds, preferably, one, two, three, four, five, or six phosphorothioate (PS) bonds are introduced at the 5'-terminus, 3'-terminus, or both ends of the sense strand, according to any one of claims 1 to 23.

25. The dsRNA agent according to any one of claims 1 to 23, wherein the antisense strand comprises one, two, three, four, five, or six phosphorothioate nucleotide interbonds, and preferably, one, two, three, four, five, or six phosphorothioate (PS) bonds are introduced at the 5'-terminus, 3'-terminus, or both ends of the antisense strand.

26. The dsRNA agent according to any one of claims 1 to 25, wherein the modified sense strand is modified in the mode shown in formula (I) of claim 12.

27. The dsRNA agent according to any one of claims 1 to 25, wherein the modified antisense strand is modified in the mode shown in formula (II) of claim 13 or formula (II') of claim 14.

28. The dsRNA agent according to any one of claims 1 to 27, wherein the modified sense strand is one of the modified sense strand sequences listed in Tables 2 to 3.

29. The dsRNA agent according to any one of claims 1 to 27, wherein the modified antisense strand is one of the modified antisense strand sequences listed in Tables 2 to 3.

30. The dsRNA agent according to any one of claims 1 to 29, wherein the sense strand is complementary or basically complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.

31. The dsRNA agent according to any one of claims 1 to 29, wherein the length of the complementary region is 19 to 21 nucleotides.

32. A dsRNA agent according to any one of claims 1 to 29, wherein each chain has a length of 30 or fewer nucleotides.

33. A dsRNA agent according to any one of claims 1 to 29, wherein each chain has a length of 25 nucleotides or less.

34. A dsRNA agent according to any one of claims 1 to 29, wherein each chain has a length of 23 or fewer nucleotides.

35. The dsRNA agent according to any one of claims 1 to 34, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more target groups or binding groups.

36. The dsRNA agent according to claim 35, wherein one or more target groups or binding groups are conjugated to the sense strand.

37. The dsRNA agent according to claim 35 or 36, wherein the target group or binding group comprises N-acetyl-galactosamine (GalNAc).

38. The dsRNA agent according to claim 35 or 36, wherein the target group has the structure shown below. Table 1-1 Table 1-2 Table 1-3 Table 1-4 Table 1-5

39. The dsRNA agent according to any one of claims 1 to 38, wherein the dsRNA agent comprises a target group conjugated to the 5'-terminus of the sense strand.

40. The dsRNA agent according to any one of claims 1 to 38, wherein the dsRNA agent comprises a target group conjugated to the 3'-terminus of the sense strand.

41. The dsRNA agent according to any one of claims 1 to 38, wherein the antisense strand includes one reverse debase residue at its 3'-terminus.

42. The dsRNA agent according to any one of claims 1 to 38, wherein the sense strand comprises one or two reverse debase residues or imann residues at its 3' and / or 5' ends.

43. The dsRNA agent according to any one of claims 1 to 42, wherein the dsRNA agent has two blunt ends.

44. A dsRNA agent according to any one of claims 1 to 42, wherein at least one strand contains the 3' overhang of at least one nucleotide.

45. A dsRNA agent according to any one of claims 1 to 42, wherein at least one strand contains the 3' overhanging ends of at least two nucleotides.

46. A composition comprising a dsRNA agent according to any one of claims 1 to 45.

47. The composition according to claim 46, further comprising a pharmaceutically acceptable carrier.

48. The composition according to claim 47, further comprising one or more other therapeutic agents.

49. The composition according to claim 48, wherein the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe or vial.

50. The composition according to any one of claims 46 to 49, wherein the composition is prepared for use by subcutaneous or intravenous (IV) administration.

51. A cell comprising a dsRNA agent according to any one of claims 1 to 45, wherein the cell is optionally a mammalian cell and optionally a human cell.

52. A method for suppressing CIDEB gene expression in cells, wherein the method is (i) To produce cells containing an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 45 or a composition according to any one of claims 46 to 50. including, method.

53. (ii) The expression of the CIDEB gene in the cells is suppressed by maintaining the cells produced according to claim 52(i) for a time sufficient to obtain degradation of the mRNA transcript of the CIDEB gene. This also includes, The method according to claim 52.

54. The method according to claim 52, wherein the cells are located within the body of the subject, and the dsRNA agent is administered subcutaneously to the subject.

55. The method according to claim 52, wherein the cells are located in the body of the subject, and the dsRNA agent is administered to the subject by IV administration.

56. The method further includes evaluating the suppression of the CIDEB gene after administering a dsRNA agent to the subject, wherein the means used for evaluation are: (i) to determine one or more physiological characteristics of a disease or condition related to CIDEB in the subject, (ii) Compare the determined physiological characteristics with the baseline physiological characteristics of CIDEB-related disease or condition prior to treatment and / or the control physiological characteristics of CIDEB-related disease or condition. Includes, Here, the comparison indicates one or more of the presence or absence of suppression of CIDEB gene expression in the subject. The method according to claim 54 or 55.

57. The method according to claim 56, wherein the determined physiological features are one or more of the following in the subject: CIDEB mRNA level, CIDEB protein level, or cholesterol ester (CE), triglyceride (TG), cholesterol level, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT) or aspartate aminotransferase (AST), and / or fat level or fat droplet level in the liver.

58. The method according to claim 57, wherein one or more levels of CIDEB mRNA, CIDEB protein, etc., in the subject are reduced, and / or one or more levels of cholesterol ester (CE), triglyceride (TG), cholesterol, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) in plasma or tissue samples are reduced, and a decrease in fat accumulation in the liver and / or a decrease in lipid droplet dilation indicates a decrease in CIDEB gene expression in the subject.

59. A method for suppressing CIDEB gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 45 or a composition according to any one of claims 46 to 50.

60. The method according to claim 59, wherein the dsRNA agent is administered subcutaneously to the subject.

61. The method according to claim 59, wherein the dsRNA agent is administered to the subject by intravenous administration.

62. The method further includes evaluating the suppression of the CIDEB gene after administering the dsRNA agent, wherein the means used for evaluation are: (i) to determine one or more physiological characteristics of a disease or condition related to CIDEB in the subject, (ii) Compare the determined physiological characteristics with the baseline physiological characteristics of CIDEB-related disease or condition prior to treatment and / or the control physiological characteristics of CIDEB-related disease or condition. Includes, Here, the comparison indicates one or more of the presence or absence of suppression of CIDEB gene expression in the subject. The method according to any one of claims 59 to 61.

63. The method according to claim 62, wherein the determined physiological features are one or more CIDEB mRNA levels, CIDEB protein levels, or cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) levels in plasma or tissue samples, or fat levels and / or fat droplet levels in the liver.

64. The method according to claim 63, wherein one or more CIDEB mRNA levels and CIDEB protein levels are reduced in the subject, and / or one or more cholesterol ester (CE), triglyceride levels (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) levels are reduced in plasma or tissue samples, and a decrease in fat accumulation in the liver and / or a decrease in lipid droplet dilation indicates a decrease in CIDEB gene expression in the subject.

65. A method for treating a disease or condition associated with the presence of the CIDEB protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 45, or a composition according to any one of claims 46 to 50, in order to suppress CIDEB gene expression.

66. The method according to claim 65, wherein the disease or condition is one or more of the following: hepatitis, hepatic fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), drug-induced liver injury, simple steatosis, fatty liver disease, parenchymal liver disease, viral hepatitis, hepatocellular carcinoma, hepatocyte necrosis, obesity, excess fat, hypertriglyceridemia, aneurysm, angina pectoris, arrhythmia, atherosclerosis, cerebrovascular disease, stroke, coronary artery disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

67. The method according to claim 65, further comprising administering another treatment plan to the subject.

68. The method according to claim 67, wherein the alternative treatment method comprises administering one or more CIDEB antisense polynucleotides of the present invention to the subject, administering a non-CIDEB dsRNA therapeutic agent to the subject, and a behavioral change in the subject.

69. The non-CIDEB dsRNA therapeutic agents include: a patatin-like phospholipase domain 3 (PNPLA3) inhibitor, a hydroxysteroid 17-β-dehydrogenase 13 (HSD17B13) inhibitor, an antibody (e.g., an anti-CIDEB antibody), a peptide inhibitor (e.g., a CIDEB peptide inhibitor), a cholesterol-lowering agent, a lipid-lowering agent, a blood glucose-lowering agent, an HMG-CoA reductase inhibitor (e.g., atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, or simvastatin), a triglyceride cholesterol-lowering agent (e.g., fibrates, nicotinic acid, or fish oil), a cholesterol absorption inhibitor (e.g., ezetimibe), an MTP inhibitor, an FXR agonist (e.g., obeticholic acid), a GLP-1 receptor agonist ( For example, semaglutide), SGLT2 inhibitors (e.g., canagliflozin), DDP-IV inhibitors (e.g., Sitagliptin, Vildagliptin), THR-β agonists (e.g., Resmetirom), SCD1 inhibitors (e.g., Aramchol), PPARα / δ / γ agonists (e.g., Lanifbranor), Galectin-3 inhibitors (e.g., Belapectin), FGF21 analogs (e.g., Pegbelfermin), monoclonal antibody agonists of the β-Klotho / FGFR1c receptor complex (e.g., MK-3655), FASN inhibitors (e.g., TVB-2640), dual GIP and GLP-1 receptor agonists (e.g., tilzepatide, BI456906), HSP47 The method according to claim 68, wherein the agent is one or more of the following: siRNA (e.g., BMS-986263), a JNK inhibitor (e.g., CC-90001), an antisense compound targeting ApoB, and an anti-inflammatory agent, or any combination thereof.

70. The method according to any one of claims 65 to 69, wherein the dsRNA agent is administered subcutaneously to the subject.

71. The method according to claims 65 to 69, wherein the dsRNA agent is administered to the subject by IV.

72. The method according to any one of claims 65 to 69, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

73. A method for determining the effectiveness of the aforementioned treatment in the subject is: (i) to determine one or more physiological characteristics of a disease or condition related to CIDEB in the subject, (ii) Compare the determined physiological characteristics with the baseline physiological characteristics of CIDEB-related disease or condition before treatment. Includes, Here, the comparison indicates one or more of the presence, absence, and level of efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject. The method according to claim 72.

74. The method according to claim 73, wherein the determined physiological features are CIDEB mRNA levels, CIDEB protein levels, or cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT) or aspartate aminotransferase (AST) levels in a plasma or tissue sample, or fat levels and / or fat droplet levels in the liver.

75. The method according to claim 73, wherein one or more CIDEB mRNA levels and CIDEB protein levels are reduced in the subject, and / or one or more cholesterol ester (CE), triglyceride (TG), cholesterol levels, low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), lipoprotein (a), alanine aminotransferase (ALT), or aspartate aminotransferase (AST) levels are reduced in plasma or tissue samples, and a decrease in fat accumulation in the liver and / or a decrease in lipid droplet dilation indicates the presence of efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.

76. A method for reducing the level of CIDEB protein in a subject compared to a baseline level of CIDEB protein in the subject before treatment, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 45, or a composition according to any one of claims 46 to 50, in order to reduce the level of CIDEB gene expression.

77. The method according to claim 76, wherein the dsRNA agent is administered to the subject subcutaneously or by IV.

78. A method for altering the physiological characteristics of a CIDEB-related disease or condition in a subject compared to baseline physiological characteristics of the subject before treatment, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1 to 45 or a composition according to any one of claims 46 to 50 in order to alter the physiological characteristics of the CIDEB-related disease or condition in the subject.

79. The method according to claim 78, wherein the dsRNA agent is administered to the subject subcutaneously or by IV.

80. The method according to claim 78, wherein the physiological characteristics are one or more of the following in the subject: CIDEB mRNA level, CIDEB protein level, or cholesterol ester (CE), triglyceride (TG), cholesterol level, low-density lipoprotein cholesterol (LDL-C), or more.