Expression cassettes for target genes and their applications

The expression cassette with a structured design addresses low expression levels in gene therapy by optimizing elements for high and stable expression, achieving effective treatment of conditions like hereditary angioedema with reduced side effects.

JP2026513145APending Publication Date: 2026-04-23SUZHOU HEGUANG KEHUI BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
SUZHOU HEGUANG KEHUI BIOTECHNOLOGY CO LTD
Filing Date
2023-10-31
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Current gene therapy methods struggle to achieve high expression levels of target genes, such as C1-INH protein, in target cells, leading to difficulty in treating conditions like hereditary angioedema, with challenges including low titer, limited cell infection, instability, and immune reactions.

Method used

An expression cassette with a specific structure (Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8) is developed, comprising elements like HCR, DSE, TPL, eMlp, intron, and poly(A), optimized for high expression and stability, integrated into an AAV-based gene delivery system for targeted gene therapy.

Benefits of technology

The cassette achieves high and stable expression of target genes like serpinG1, reducing side effects and providing lifelong therapeutic benefits with a single dose, effectively treating conditions like hereditary angioedema.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026513145000004
    Figure 2026513145000004
  • Figure 2026513145000005
    Figure 2026513145000005
  • Figure 2026513145000006
    Figure 2026513145000006
Patent Text Reader

Abstract

The present invention provides an expression cassette for a target gene and its applications. Specifically, the present invention provides an expression cassette containing elements such as HCR, DSE, TPL, and eMlp, as well as nucleic acids encoding it, expression vectors, host cells, pharmaceutical compositions, gene delivery systems, and applications, and further provides a nucleic acid molecule encoding the C1-INH protein and its applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, it relates to an expression cassette of a target gene and its applications.

Background Art

[0002] Gene therapy is an effective method for treating genetic diseases. By introducing an exogenous normal gene (i.e., a target gene) into target cells, it corrects or compensates for diseases caused by defective genes and abnormal genes, thereby achieving the treatment purpose. Gene therapy is mainly used for treating diseases that pose a serious threat to human health, including genetic diseases (such as hemophilia, cystic fibrosis, familial hypercholesterolemia, hereditary angioedema, etc.), malignant tumors, cardiovascular diseases, infectious diseases (such as AIDS, rheumatoid arthritis, etc.).

[0003] When implementing gene therapy, it is very important to effectively express the target gene in target cells and obtain the expected expression effect. Taking hereditary angioedema as an example, it is caused by a deficiency of C1-INH protein. Usually, the content of C1-INH protein in blood reaches 160 μg / ml to 320 μg / ml. However, in previous clinical experiments, it has been shown that to obtain a therapeutic effect, the C1-INH in blood needs to reach at least 112 μg / ml. Such a high content is very difficult for current gene therapy methods. Therefore, there is an urgent need for an ideal expression cassette or expression vector that has various advantages such as high titer, can infect a large number of cells, is easy to prepare and has good reproducibility, can quantitatively enter target cells and be integrated into specific sites of the host chromosome, can exist stably in the form of episomes, and does not contain components that stimulate immune reactions, thereby improving the effect and success rate of gene therapy and reducing side effects.

[0004] Therefore, in the art, there is a need to develop an expression cassette that can effectively improve the expression level of the target gene.

Summary of the Invention

[0005] The objective of the present invention is to provide an expression cassette for a target gene that exhibits high expression levels and low side effects.

[0006] Another objective of the present invention is to provide a gene delivery system that exhibits long-term expression.

[0007] Another further object of the present invention is to provide a novel therapeutic method that has fewer side effects and can achieve lifetime benefits with a single dose. [Means for solving the problem]

[0008] A first aspect of the present invention provides an expression cassette having a structure represented by formula I from the 5' end to the 3' end, Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8(I) In the formula, each "-" independently represents a bond or nucleotide linkage sequence. Z1 is an HCR element, Z2 is a DSE element, Z3 is a TPL element, Z4 is an eMlp element, The Z5 is an Intron element, Z6 is either absent or a Kozak sequence. Z7 is a target gene, and Z8 is a poly(A) element.

[0009] In another preferred example, the sequence of Z1 is selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, or a combination thereof.

[0010] In another preferred example, the sequence of Z1 is as shown in SEQ ID NO:10.

[0011] In another preferred example, the sequence of the Z1 is as shown in SEQ ID NO:4.

[0012] In another preferred example, the sequence of the Z2 is as shown in SEQ ID NO:5.

[0013] In another preferred example, the sequence of the Z3 is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:11, or a combination thereof.

[0014] In another preferred example, the sequence of the Z3 is as shown in SEQ ID NO:11.

[0015] In another preferred example, the sequence of the Z3 is as shown in SEQ ID NO:6. <​​​​​​​​​​​​​​​​​​​​​​In another preferred example, the Z5 is a chimeric intron consisting of an SV40 intron segment and an HBB2 intron segment.

[0022] In another preferred example, the Z5 contains a sequence as shown in SEQ ID NO:12.

[0023] In another preferred example, the target gene is selected from the group consisting of a normal gene, an antisense gene, a suicide gene, or a combination thereof.

[0024] In another preferred example, the Z7 is selected from the group consisting of the serpinG1 gene, the FIX gene, PAH (phenylketonuria), the GBA1 gene (Gaucher disease), the GLA gene (Fabry disease), IDS (mucopolysaccharidosis type II), G6P (favism), GAA (Pompe disease), the luciferase gene, the CFTR gene (cystic fibrosis), the LDLR gene (familial hypercholesterolemia), the α-globin gene, the β-globin gene (thalassemia), the APC gene (familial adenomatous polyposis), the SLC26A4 gene, the GJB2 gene (congenital deafness), the TYR gene, the OCA2 gene, the TYRP1 gene, the SLC45A2 gene (vitiligo), or a combination thereof.

[0025] In another preferred example, the sequence of the Z7 is as shown in SEQ ID NO:1 or SEQ ID NO:2, and preferably, the sequence of the Z7 is as shown in SEQ ID NO:1.

[0026] In another preferred example, the Z8 is selected from the group consisting of bGH poly(A), short poly(A), SV40 poly(A), synthetic SPA51 poly(A), human β-globin poly(A), or a combination thereof.

[0027] In another preferred example, the Z8 is bGH poly(A).

[0028] In another preferred example, the sequence of Z8 is selected from the group consisting of SEQ ID NO:13, SEQ ID NO:14, or a combination thereof.

[0029] In another preferred example, the sequence of Z8 is as shown in SEQ ID NO:14.

[0030] In another preferred example, the sequence of Z8 is as shown in SEQ ID NO:13.

[0031] In another preferred example, the expression cassette has a nucleotide sequence such as that shown in SEQ ID NO:3 or SEQ ID NO:15.

[0032] In another preferred example, the nucleotide sequence of the expression cassette has at least 50% identity with the sequence shown in SEQ ID NO:3 or SEQ ID NO:15, and preferably at least 60%, 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0033] A second aspect of the present invention provides a nucleic acid molecule that encodes an expression cassette described in the first aspect of the present invention.

[0034] In another preferred example, the nucleic acid molecule may be RNA, DNA, or cDNA.

[0035] In another preferred example, the sequence of the nucleic acid molecule is as shown in SEQ ID NO:3.

[0036] In another preferred example, the sequence of the nucleic acid molecule has at least 50% identity with the sequence shown in SEQ ID NO:3, preferably at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0037] A third aspect of the present invention provides an expression vector comprising a nucleic acid molecule described in the second aspect of the present invention or an expression cassette described in the first aspect of the present invention.

[0038] In another preferred example, the expression vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof. Preferably, the expression vector includes, for example, a viral vector such as a lentivirus, adenovirus, AAV virus, retrovirus, or a combination thereof.

[0039] In another preferred example, the expression vector is an AAV vector.

[0040] In another preferred example, the expression vector is selected from the group consisting of pTomo lentiviral vector, plenti, pLVTH, pLJM1, pHCMV, pLBS.CAG, pHR, pLV, etc.

[0041] In another preferred example, the expression vector further includes a promoter, a transcription-enhancing element WPRE, a long-terminal repeat sequence LTR, and the like, selected from the group.

[0042] In another preferred example, the expression vector comprises one or more promoters, the promoters being operably ligated to the polynucleotide or fragment thereof, enhancers, introns, transcription termination signals, polyadenylation sequences, origins of replication, selective markers, nucleic acid restriction sites, and / or homologous recombination sites.

[0043] In another preferred example, the promoter is selected from the group consisting of the CB promoter, SV40 promoter, SOX9 promoter, ALB promoter, TBG promoter, ApoA1 promoter, TTR promoter, CAG promoter, AAT promoter, or a combination thereof.

[0044] In another preferred example, the intron is selected from the group consisting of SV40 introns, VH4 introns, U12 introns, Chi introns, RHD introns, or combinations thereof.

[0045] In another preferred example, the expression vector has the structure shown in formula II from the 5' end to the 3' end, A1-A2-A3(II) In the formula, each "-" independently represents a bond or nucleotide linkage sequence. A1 is an ITR-L sequence, A2 is an expression cassette according to the first aspect of the present invention, and A3 is an ITR-R sequence.

[0046] A fourth aspect of the present invention provides a host cell which contains an expression vector as described in the third aspect of the present invention, or which has a nucleic acid molecule as described in the second aspect of the present invention incorporated into its genome.

[0047] In another preferred example, the host cells include prokaryotic cells or eukaryotic cells.

[0048] In another preferred example, the host cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.

[0049] A fifth aspect of the present invention provides a gene delivery system comprising an expression cassette described in the first aspect of the present invention or a nucleic acid molecule described in the second aspect of the present invention, and an AAV capsid protein.

[0050] In another preferred example, the AAV capsid protein is either a naturally occurring AAV capsid protein or an artificially modified AAV capsid protein.

[0051] In another preferred example, the AAV includes, but is not limited to, the group AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV-DJ.

[0052] In another preferred example, the AAV capsid protein is the AAV8 capsid protein and has the amino acid sequence shown in SEQ ID NO:9.

[0053] A sixth aspect of the present invention provides the use of an expression cassette according to the first aspect of the present invention, a nucleic acid molecule according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention, a host cell according to the fourth aspect of the present invention, or a gene delivery system according to the fifth aspect of the present invention, for use in the preparation of a formulation or composition, wherein the formulation or composition is a gene therapy drug.

[0054] A seventh aspect of the present invention is: (i) an expression cassette according to the first aspect of the present invention, a nucleic acid molecule according to the second aspect of the present invention, an expression vector according to the third aspect of the present invention, a host cell according to the fourth aspect of the present invention, or a gene delivery system according to the fifth aspect of the present invention, as an active ingredient, and (ii) To provide a pharmaceutical composition comprising a pharmaceutically acceptable carrier, diluent, or excipient.

[0055] In another preferred example, component (i) accounts for 0.1 to 99.9 wt%, preferably 10 to 99.9 wt%, and more preferably 70 to 99 wt%, of the total weight of the pharmaceutical composition.

[0056] In another preferred example, the dosage form of the pharmaceutical composition is selected from the group consisting of lyophilized dosage forms and liquid dosage forms.

[0057] In another preferred example, the dosage form of the pharmaceutical composition is an injectable preparation.

[0058] In another preferred example, the method of administering the pharmaceutical composition includes intravenous injection.

[0059] In another preferred example, the pharmaceutical composition is in an injectable dosage form used for intravenous injection.

[0060] In another preferred example, the pharmaceutically acceptable carrier includes, but is not limited to, solvents, dispersions, coatings, antimicrobial or antifungal agents, isotonic agents, and absorption retarders.

[0061] In another preferred example, the pharmaceutically acceptable carrier is an injectable carrier, preferably comprising saline solution, which comprises, but is not limited to, buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, salt solution, polysorbate solution, or a combination thereof.

[0062] In another preferred example, the pharmaceutically acceptable carrier may further include, but is not limited to, additives such as stabilizers, preservatives, transfection promoters favorable to cell uptake, or combinations thereof.

[0063] In another preferred example, the pharmaceutical composition may be used alone or in combination in gene therapy applications.

[0064] In another preferred example, the combination includes combination with other gene therapy drugs.

[0065] An eighth aspect of the present invention provides a gene therapy method comprising the step of administering to a target subject of interest an expression vector according to the third aspect of the present invention, a gene delivery system according to the fifth aspect of the present invention, or a pharmaceutical composition according to the seventh aspect of the present invention.

[0066] In another preferred example, the method of administration is intravenous injection.

[0067] In another preferred example, the required subjects include humans and non-human mammals.

[0068] In another preferred example, the subject requiring this is a patient with hereditary angioedema or hemophilia.

[0069] In another preferred example, the dosage of the gene delivery system is 6E11vg / kg to 6E13vg / kg, preferably 2E12vg / kg to 4E13vg / kg, and more preferably 6E12vg / kg to 2E13vg / kg.

[0070] A ninth aspect of the present invention provides a nucleic acid molecule encoding the serpinG1 gene, the nucleotide sequence of which has at least 87% identity with the sequence shown in SEQ ID NO:1, preferably at least 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0071] A tenth aspect of the present invention provides an expression vector comprising a nucleic acid molecule described in the ninth aspect of the present invention.

[0072] In another preferred example, the expression vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof. Preferably, the expression vector includes, for example, a viral vector such as a lentivirus, adenovirus, AAV virus, retrovirus, or a combination thereof.

[0073] In another preferred example, the expression vector further includes a promoter, a transcription-enhancing element WPRE, a long-terminal repeat sequence LTR, and the like, selected from the group.

[0074] In another preferred example, the expression vector comprises one or more promoters, the promoters being operably ligated to the polynucleotide or fragment thereof, enhancers, introns, transcription termination signals, polyadenylation sequences, origins of replication, selective markers, nucleic acid restriction sites, and / or homologous recombination sites.

[0075] In another preferred example, the expression vector has a nucleotide sequence as shown in SEQ ID NO:3.

[0076] In another preferred example, the nucleotide sequence of the expression vector has at least 50% identity with the sequence shown in SEQ ID NO:3, preferably at least 60%, 70%, 80%, 90%, 95%, 99%, or 100% identity.

[0077] An eleventh aspect of the present invention provides a host cell which contains an expression vector as described in the tenth aspect of the present invention, or which has a nucleic acid molecule as described in the ninth aspect of the present invention incorporated into its genome.

[0078] A twelfth aspect of the present invention provides uses for a nucleic acid molecule according to the ninth aspect of the present invention, an expression vector according to the tenth aspect of the present invention, or a host cell according to the eleventh aspect of the present invention, which are used in the preparation of a formulation or composition, said formulation or composition, which are used to treat hereditary angioedema.

[0079] In another preferred example, the hereditary angioedema is of the C1-INH deficiency type.

[0080] In another preferred example, the hereditary angioedema includes type 1 HAE and type 2 HAE.

[0081] A thirteenth aspect of the present invention is: (i) a nucleic acid molecule as described in the ninth aspect of the present invention, an expression vector as described in the tenth aspect of the present invention, or a host cell as described in the eleventh aspect of the present invention, and (ii) To provide a pharmaceutical composition comprising a pharmaceutically acceptable carrier, diluent, or excipient.

[0082] In another preferred example, component (i) accounts for 0.1 to 99.9 wt%, preferably 10 to 99.9 wt%, and more preferably 70 to 99 wt%, of the total weight of the pharmaceutical composition.

[0083] In another preferred example, the dosage form of the pharmaceutical composition is selected from the group consisting of lyophilized dosage forms and liquid dosage forms.

[0084] In another preferred example, the dosage form of the pharmaceutical composition is an injectable preparation.

[0085] In another preferred example, the method of administering the pharmaceutical composition includes, but is not limited to, intravenous injection, oral administration, subcutaneous injection, intramuscular injection, and the like.

[0086] In another preferred example, the pharmaceutically acceptable carrier includes, but is not limited to, solvents, dispersions, coatings, antimicrobial or antifungal agents, isotonic agents, and absorption retarders.

[0087] In another preferred example, the pharmaceutically acceptable carrier is an injection vector, preferably comprising saline solution, which comprises, but is not limited to, buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, salt solution, polysorbate solution, or a combination thereof.

[0088] In another preferred example, the pharmaceutically acceptable carrier may further include, but is not limited to, additives such as stabilizers, preservatives, transfection promoters favorable to cell uptake, or combinations thereof.

[0089] In another preferred example, the pharmaceutical composition may be used alone or in combination in the treatment of hereditary angioedema.

[0090] In another preferred example, the combination includes combination with other drugs for the treatment of hereditary angioedema.

[0091] In another preferred example, other drugs for treating the hereditary angioedema include blood-derived C1 esterase inhibitors, recombinant human C1 esterase inhibitors, bradykinin receptor antagonists, plasma bradykinin-releasing enzyme inhibitors, danazol, tranexamic acid, or a combination thereof.

[0092] A fourteenth aspect of the present invention provides a method for treating hereditary angioedema, the method comprising administering to a subject requiring the treatment an expression vector described in the tenth aspect of the present invention or a pharmaceutical composition described in the thirteenth aspect of the present invention.

[0093] In another preferred example, the method of administration is intravenous injection.

[0094] In another preferred example, the required subjects include humans and non-human mammals.

[0095] In another preferred example, the expression vector is an AAV vector.

[0096] In another preferred example, the AAV vector dose is 6E11vg / kg to 6E13vg / kg, preferably 2E12vg / kg to 4E13vg / kg, and more preferably 6E12vg / kg to 2E13vg / kg. [Effects of the Invention]

[0097] It should be understood that, within the scope of the present invention, new or preferred technical solutions can be constructed by combining the above-described technical features of the present invention with the technical features specifically described below (e.g., in the examples). Due to space limitations, this will not be repeated here. [Brief explanation of the drawing]

[0098] [Figure 1] The results of a Western blot method using FLAG antibodies to detect the expression levels of codon-optimized A, B, C genes and WT genes are shown, where Figure 1A is the immunoblot diagram and Figure 1B is the grayscale ratio (relative protein content). [Figure 2] The results of a Western blotting method using SerpinG1 antibody to detect the expression levels of codon-optimized A, B, C genes and WT genes are shown, where Figure 2A shows the immunoblot diagram and Figure 2B shows the grayscale ratio (relative protein content). [Figure 3] This shows the structure of the Y602 expression cassette. [Figure 4] The C1-INH content in the plasma of KO / KO mice and control mice one week (left) and two weeks (right) after Y602 administration is shown. [Figure 5] This shows comparative data on the efficacy of Y602 and Y508 expression cassettes. [Figure 6] The structure of the GS1196-016 expression cassette is shown. [Figure 7] This shows the C1-INH activity in cynomolgus monkeys one week after injection of an AAV vector delivering GS1196-016. [Figure 8] This shows a comparison of C1-INH expression levels in mice mediated by the expression cassette of the present invention and other expression cassettes. [Modes for carrying out the invention]

[0099] Through extensive and thorough research and large-scale screening, the inventors have developed the first target gene expression cassette and established an AAV-based gene delivery system. By optimizing the codons of the serpinG1 gene, the inventors obtained a highly expressed nucleic acid molecule and, based on this, developed an expression vector, host cells, and applications that can further improve the in vivo and in vitro expression levels of the C1-INH protein. Based on the above nucleic acid molecule, expression cassette, and gene delivery system, the present invention aims to construct a therapeutic method with few side effects and a lifelong effect from a single dose. Based on this, the present invention has been completed.

[0100] term To facilitate understanding of this disclosure, we will first define certain terms. Unless otherwise specified herein, the following terms should have the meanings set forth below, as used in this invention.

[0101] As used herein, when used in relation to a specifically stated value, the term “about” means that the value may vary by no more than 1% from the stated value. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0102] As used herein, the terms “contain” or “include” may be open, semi-closed, or closed. In other words, the terms also include “basically consist of” or “consist of.”

[0103] As used herein, the term “treatment” means administering an internal or external therapeutic agent, comprising a gene delivery system, expression vector, or pharmaceutical composition provided by the present invention, to a patient. The patient has one or more disease symptoms, and the therapeutic agent is known to be effective against these symptoms. Typically, the patient is administered a therapeutically effective dose of the therapeutic agent that effectively alleviates one or more disease symptoms.

[0104] As used herein, the terms “optional” or “by option” mean that the events or circumstances described below may, but are not required to, occur.

[0105] Sequence identity is determined by comparing two sequences of the same length along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions where the same residues occur. This is usually expressed as a percentage. The measurement of sequence identity of nucleotide sequences is well known to those skilled in the art.

[0106] As used herein, “required subjects” means any mammal or non-mammalian. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cattle, horses, dogs, cats, pigs, goats, and sheep.

[0107] As used herein, the terms “AAV vector,” “recombinant AAV vector,” “recombinant adeno-associated virus vector,” “rAAV,” and “recombinant virus” refer to AAV virus particles that are interchangeable and modified to transport, transduce, and specifically express contained exogenous target genes at a target site, preferably the liver.

[0108] Expression cassette Typically, the expression cassette of the present invention has the structure shown in formula I from the 5' end to the 3' end, Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8(I) In the formula, each "-" independently represents a bond or nucleotide linkage sequence. Z1 is an HCR element, Z2 is a DSE element, Z3 is a TPL element, Z4 is an eMlp element, The Z5 is an Intron element, Z6 is either absent or a Kozak sequence. Z7 is a target gene, and Z8 is a poly(A) element.

[0109] It should be understood that the target gene in the expression cassette of the present invention, namely Z7, can be any interesting target gene, and that the expression cassette of the present invention can achieve the expression of any target gene.

[0110] Preferably, the expression cassette of the present invention is used to express the serpinG1 gene, FIX gene, PAH (phenylketonuria), GBA1 gene (Gaucher disease), GLA gene (Fabry disease), IDS (mucopolysaccharidosis type II), G6P (Fabism), GAA (Pompe disease), luciferase gene, CFTR gene (cystic fibrosis), LDLR gene (familial hypercholesterolemia), α-globin gene, β-globin gene (thalassemia), APC gene (familial adenomatous polyposis), SLC26A4 gene, GJB2 gene (congenital hearing loss), TYR gene, OCA2 gene, TYRP1 gene, SLC45A2 gene (albinism), or a combination thereof.

[0111] As used herein, the term “HCR element” refers to the human apolipoprotein liver regulatory region. In specific embodiments, the sequence of the HCR element used in the expression cassette of the present invention is selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, or a combination thereof.

[0112] As used herein, the term “DSE element” refers to a chimeric promoter. In specific embodiments, the sequence of the DSE element used in the expression cassette of the present invention is as shown in SEQ ID NO:5.

[0113] As used herein, the term “TPL element” refers to the triplet reader sequence of an adenovirus. Based on the teachings of the present invention, those skilled in the art can use wild-type TPL or further optimize the wild-type TPL sequence to obtain functionally enhanced mutant or chimeric TPL sequences. For example, in a specific embodiment, the TPL sequence used in the expression cassette of the present invention may be the wild-type TPL sequence SEQ ID NO: 6, or the chimeric TPL sequence SEQ ID NO: 11, which is formed by combining the wild-type TPL sequence and a β-globin intron segment. The chimeric TPL sequence can be combined with the wild-type TPL sequence by adding to the β-globin intron and its segment, and with other introns or its segments commonly used in the art (for example, see the term “intron”). Introns suitable for forming a chimeric TPL sequence in combination with the wild-type TPL sequence may be different complete introns or combinations thereof, combinations of different segments of different introns, or combinations of segments of a complete intron and other introns.

[0114] As used herein, the term “eMlp element” refers to the enhancer element of the adenovirus major late promoter. In specific embodiments, the sequence of the eMlp element used in the expression cassette of the present invention is as shown in SEQ ID NO:7.

[0115] As used herein, the term "Kozak sequence" refers to a nucleic acid sequence located after the 5' cap structure of eukaryotic mRNA, typically GCCACCAUGG (SEQ ID NO: 16), which binds to a translation initiation factor and mediates the initiation of mRNA translation including the 5' cap structure. Based on the teachings of the present invention, those skilled in the art can further optimize the Kozak sequence to enhance its function in the expression cassette of the present invention.

[0116] The term “intron” as used herein has meanings familiar to those skilled in the art. Those skilled in the art are familiar with the various introns that can be used in the expression cassette of the present invention. In specific embodiments, the introns of the present invention may be the β-globin intron, SV40 intron, HBB2 intron, VH4 intron, U12 intron, Chi intron, RHD intron, small bristles (SRB) gene intron, mouse microvirus (MVM) intron, etc., and exemplary intron sequences are provided in Lu et al., (2013) “Molecular Therapy” 21(5):954-63 and Lu et al., (2017) “Human Gene Therapy” 28(1):125-34, which are incorporated herein by reference. Those skilled in the art will also understand that the introns that can be used in the expression cassette of the present invention may be various introns or combinations thereof of segments (i.e., chimeric introns). In specific embodiments, the introns that can be used in the expression cassette of the present invention may be combinations of different complete introns, combinations of different segments of different introns, or combinations of segments of a complete intron and other introns.

[0117] Typically, the expression cassette of the present invention is expression cassette Y602 or expression cassette GS1196-016, having a nucleotide sequence such as that shown in SEQ ID NO:3 or SEQ ID NO:15.

[0118] The advantages of the expression cassette of the present invention are as follows: On the one hand, compared to general expression cassettes of the prior art in the art, the expression cassette of the present invention can achieve higher in vitro and / or in vivo expression levels; on the other hand, the inventors found through screening that the expression cassette of the present invention has unexpectedly superior effects compared to other expression cassettes constructed by the inventors in the same batch (e.g., Y508 expression cassette).

[0119] nucleic acid molecule The present invention provides a nucleic acid molecule encoding an expression cassette described in a first aspect of the present invention. The nucleic acid molecule of the present invention may be in DNA form or RNA form. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

[0120] The present invention further provides a nucleic acid molecule according to the ninth aspect of the present invention, wherein the nucleotide sequence has at least 87% identity with the sequence shown in SEQ ID NO:1, preferably at least 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0121] Once a relevant sequence is obtained, it can be obtained in large quantities using recombination. Typically, this is achieved by cloning it onto a carrier, then transforming it into cells, and then isolating the relevant sequence from host cells grown by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in this invention include biomolecules that exist in isolated forms.

[0122] Expression vector The present invention further relates to vectors comprising the above-mentioned suitable nucleic acid molecules and suitable promoters or control sequences. These vectors are used to transform suitable host cells so that they can express proteins.

[0123] host cell The host cell may be a prokaryotic cell such as a bacterial cell, a lower eukaryotic cell such as a yeast cell, or a higher eukaryotic cell such as a mammalian cell. Typical examples include bacterial cells such as Escherichia coli, Streptomyces, and Mycobacterium erythrorhizon, fungal cells such as yeast, insect cells of Drosophila S2 or Sf9, and animal cells such as CHO, COS7, and 293 cells. Transformation of host cells with recombinant nucleic acid molecules can be carried out using prior art well known to those skilled in the art.

[0124] Pharmaceutical preparations and compositions (pharmaceutical compositions) The present invention provides a formulation or composition (preferably a pharmaceutical composition) comprising (a) an expression cassette according to a first aspect of the present invention, a nucleic acid molecule according to a second aspect of the present invention, an expression vector according to a third aspect of the present invention, a host cell according to a fourth aspect of the present invention, or a gene delivery system according to a fifth aspect of the present invention as an active ingredient, and (b) a pharmaceutically acceptable carrier, diluent, or excipient.

[0125] The present invention further provides a formulation or composition (preferably a pharmaceutical composition) comprising (a) a nucleic acid molecule as described in the ninth aspect of the present invention, an expression vector as described in the tenth aspect of the present invention, or a host cell as described in the eleventh aspect of the present invention as an active ingredient, and (b) a pharmaceutically acceptable carrier, diluent, or excipient.

[0126] Typically, the formulations or compositions of the present invention are used for gene therapy, preferably for the treatment of hereditary angioedema or hemophilia.

[0127] To facilitate clinical application, the formulation or composition of the present invention can be contained in an injection device (e.g., a needle), and the injection device may contain a single dose of the pharmaceutical composition. The injection device can be stored in a drug box for easy storage and use. During transport, the microcontainer containing the drug suspension needs to be placed in dry ice. It should normally be stored in a refrigerator at -80°C.

[0128] The formulations or compositions described in the present invention may include instructions for use to facilitate use by those skilled in the art.

[0129] The formulations or compositions described in the present invention can be administered in a safe and effective amount, where "safe and effective amount" means an amount of active ingredient sufficient to significantly improve the condition or symptoms without causing serious side effects.

[0130] The safe and effective dose described in this invention may vary depending on the mode of administration and the severity of the disease being treated. The selection of a preferred safe and effective dose can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to, pharmacokinetic parameters of the drug such as tissue distribution, bioavailability, metabolism, and half-life, the severity of the disease the patient is trying to treat, the patient's weight, the patient's immune status, and the route of administration. For example, depending on the urgency of the treatment situation, the drug may be administered in several divided doses daily, or the dose may be proportionally reduced.

[0131] "Pharmacochemically acceptable carrier, diluent or excipient" means one or more compatible solid or liquid fillers or gels that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" means that each component in the formulation or composition can be mixed with the active ingredient of the present invention without significantly reducing the efficacy of the active ingredient.

[0132] The formulation or composition may be a liquid or solid, such as a powder, gel, or paste. Preferably, the composition is a liquid, and preferably an injectable liquid. Suitable excipients are known to those skilled in the art.

[0133] The formulation or composition may include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Appropriate aqueous and non-aqueous vectors, diluents, solvents or excipients include water, ethanol, polyols and appropriate mixtures.

[0134] Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives (e.g., sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween®), wetting agents (e.g., sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0135] Hereditary edema Hereditary angioedema (HAE), also known as C1 inhibitor deficiency, is characterized by a deficiency or functional defect in the C1 inhibitor. It is an autosomal dominant genetic disorder with an incidence of 1 in 10,000 to 1 in 50,000. Clinically, it manifests as recurrent and unpredictable cutaneous and submucosal edema. Laryngeal edema can be life-threatening due to suffocation. Currently, there is no cure for hereditary angioedema, but it is possible to prevent attacks and suppress the symptoms of acute attacks through medication and other methods.

[0136] However, treatment with small molecule drugs requires weekly or daily administration and is associated with many side effects, while treatment with inhibitors requires administration at the onset of the disease, which carries the risk of not being able to provide timely treatment and the problem of reduced patient compliance.

[0137] Treatment for hereditary edema In conventional treatments, the treatment of hereditary edema is divided into general treatment, acute attack treatment, and preventive treatment. Preventive treatment is further divided into short-term treatment and long-term sustained treatment, depending on the treatment cycle.

[0138] The conventional treatments described above typically involve the use of blood-derived C1 esterase inhibitors, recombinant human C1 esterase inhibitors, bradykinin receptor antagonists, plasma bradykinin-releasing enzyme inhibitors, and small molecule drugs or formulations such as danazol. While these can achieve some effectiveness in alleviating acute attacks and providing long-term prevention, problems such as frequent side effects, high administration frequency, inappropriate timing of treatment, and low patient compliance remain.

[0139] Specifically, for example, the first-line treatments for hereditary angioedema are small molecule drugs and C1 / Kallikrein inhibitors, and treatment methods mainly consist of on-demand therapy and preventive therapy. However, treatment with small molecule drugs requires weekly or daily administration and is associated with more side effects, while treatment with inhibitors requires medication at the onset of the disease, posing risks of not being able to provide timely treatment and problems with reduced patient compliance.

[0140] The present invention provides a novel therapeutic method with fewer side effects and a lifelong effect from a single dose. Typically, the present invention allows for the specific expression of the expression cassette using an AAV-based gene delivery system, where the target gene in the expression cassette is the serpinG1 gene, and the expression cassette and gene delivery system can treat hereditary angioedema by highly expressing the C1-INH protein in the target population.

[0141] C1-INH Hereditary angioedema (HAE) can be classified into C1-INH deficiency type and non-C1-INH deficiency type.

[0142] C1-INH deficiency is caused by mutations in the C1-INH gene and can be clinically classified into type 1 and type 2, distinguished by laboratory C1-INH concentrations.

[0143] Type 1 HAE: Laboratory tests reveal decreased C4 and C1-INH levels, indicating type 1 HAE. This is the most common type of HAE in China.

[0144] Type 2 HAE: Laboratory tests revealed decreased C4 concentration and normal or increased C1-INH concentration, but impaired C1-INH function, thus indicating type 2 HAE.

[0145] Non-C1-INH deficiency is associated with gene mutations such as F12, ANGPTI, and PLG.

[0146] In the present invention, the nucleic acid molecules, expression cassettes, gene delivery systems, formulations, or compositions of the present invention are mainly used for the treatment of C1-INH-deficient HAE, including type 1 HAE and type 2 HAE, and can produce therapeutic effects that correspond to the decrease in C1-INH concentration and reduced function in the patient's body.

[0147] serpinG1 gene The serpinG1 gene is the coding gene for the C1-INH protein. In this invention, codon optimization is performed based on the wild-type serpinG1 gene to obtain serping1 optiA, serping1 optiB, and serping1 optiC genes, which are called genes A, B, and C, respectively.

[0148] Preferably, the nucleic acid molecule of the present invention is the B gene shown in SEQ ID NO:1, or a nucleic acid molecule having at least 87% identity with the sequence shown in SEQ ID NO:1, preferably at least 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0149] Hemophilia and the FIX gene Hemophilia is an X-linked recessive hemorrhagic disorder. Clinically, it is divided into two types: hemophilia A (factor VIII deficiency) and hemophilia B (factor IX deficiency), both caused by mutations in the factor VIII (FVIII) and factor IX (FIX) genes, respectively. In the male population, the incidence of hemophilia A is approximately 1 in 5,000, and the incidence of hemophilia B is approximately 1 in 25,000. Among all male hemophilia patients, hemophilia A accounts for approximately 80% to 85%, and hemophilia B accounts for approximately 15% to 20%. Hemophilia is extremely rare in women.

[0150] Coagulation factor IX (FIX) is a crucial coagulation factor in the coagulation process. It is activated in the early stages of coagulation by tissue factor and activated coagulation factor VII (TF / FVIIa). The activated FIX then immediately forms a tetrameric complex with TF / FVIIa and tissue factor pathway inhibitor (TFPI), thereby inhibiting the activation effects of coagulation factor X (FX) and FIX. However, with the assistance of activated coagulation factor VIII (FVIIIa), FXa produced by activated FIX (FIXa) is key to maintaining the coagulation process and ultimately achieving hemostasis, thus playing an irreplaceable and vital role in the hemostatic process. The FIX coding gene (F9) is located on the characteristic arm of the X chromosome (Xq27.1-q27.2) and consists of eight exons and seven introns. This gene mutation is the fundamental range of hemophilia B.

[0151] Adeno-related viruses Currently, many viral vectors, including adenoviruses, retroviruses, lentiviruses, and adeno-associated viruses (AAVs), are used in gene therapy, and among these, AAVs with low immunogenicity are now widely recognized.

[0152] Adeno-associated viruses, also known as adeno-related viruses, belong to the Dependvirus genus of the Parvoviridae family. They are the simplest single-stranded DNA defect viruses discovered to date, requiring a helper virus (usually an adenovirus) to participate in replication. AAVs can infect a variety of cells and can be site-specifically and stably integrated into the genome of infected cells. They can infect a wide range of cells without affecting cell growth, morphology, or differentiation, and do not appear to be involved in human pathology.

[0153] AAVs are characterized by their high safety, high infectivity, and ability to mediate long-term gene expression. Although AAVs have low immunogenicity, clinically, systemic administration of AAVs is often reported to induce severe immune responses, mainly due to the high doses used.

[0154] The expression cassette provided by the present invention can improve the expression level of target genes through creative design, and therefore, by constructing an AAV vector containing the expression cassette of the present invention, the dosage of the AAV vector can be reduced, thereby reducing the side effects caused by the administration of high doses of AAV vector, taking into account the advantages of long-term expression and topical administration of the AAV vector.

[0155] Gene delivery system In this invention, an AAV-based gene delivery system is established, where AAV is an artificially modified recombinant adeno-associated virus vector. Each end of the AAV contains an inverse terminal repeat (ITR) region of approximately 145 bases, which functions as an origin for viral replication and plays a crucial role in viral packaging. The remainder of the genome is divided into two important regions with capsidation functions: the left side of the genome containing the rep gene related to viral replication and viral gene expression, and the right side of the genome containing the cap gene encoding the viral capsid protein. Recombinant adeno-associated virus vectors (rAAV) are derived from non-pathogenic wild-type adeno-associated viruses and are considered one of the most promising gene delivery vectors due to their high safety, broad range of host cells (dividing and non-dividing cells), low immunogenicity, and long-lasting expression of foreign genes in the body. They are widely used worldwide in gene therapy and vaccine research. After more than 10 years of research, the biological characteristics of recombinant adenoviruses have been deeply understood, and a large amount of data has been accumulated, particularly regarding their application in various cells, tissues, and in vivo experiments. In medical research, rAAV is used in gene therapy research for various diseases (including in vivo and in vitro experiments), and at the same time, as a distinctive gene transfer vector, it is widely used in gene function research, disease model construction, and the preparation of gene knockout mice.

[0156] The AAV capsid protein determines the tissue cell specificity of the AAV. In the present invention, the applicable AAV capsid protein is not particularly limited. The AAV capsid protein may be a native AAV capsid protein or an artificially modified AAV capsid protein. The AAV capsid protein may contain AAVs selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV-DJ. Preferably, the AAV capsid protein of the present invention is an AAV8-like capsid protein and may have an amino acid sequence such as that shown in SEQ ID NO:9.

[0157] AAV vectors can be prepared using standard methods in the art. Any serotype of adeno-associated virus is suitable. Methods for purifying the vectors are described, for example, in U.S. Patents 6,566,118, 6,989,264 and 6,995,006, the disclosures of which are incorporated herein by reference in their entirety. Preparation of hybrid vectors is described, for example, in PCT application number PCT / US2005 / 027091, the disclosures of which are incorporated herein by reference in their entirety. The use of AAV-derived vectors for in vitro and in vivo gene transfer is described (see, for example, International Patent Application Publications WO91 / 18088 and WO93 / 09239, U.S. Patents 4,797,368, 6,596,535 and 5,139,941, and European Patent No. 0488528, the disclosures of which are incorporated herein by reference in their entirety). These patent publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced with the gene of interest for in vitro (entering cultured cells) or in vivo (entering directly into a living organism) delivery of the gene of interest, as well as the uses of these constructs.

[0158] In a specific embodiment, the production of an AAV vector requires a DNA plasmid containing ITR-L, a recombinant target genome, and ITR-R, where ITR-L and ITR-R are located on opposite sides of the recombinant genome, respectively. The DNA plasmid, a plasmid encoding the AAV cap / rep gene, and a helper gene provided by an adenovirus or herpesvirus can be simultaneously introduced into a suitable host cell using known techniques such as transfection to produce an AAV viral vector. The DNA plasmid is expressed in the host cell and packaged into viral particles.

[0159] treatment The therapeutic methods of the present invention can typically be administered using various methods of administration, such as administering various expression vectors (e.g., DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof), host cells, formulations, or compositions containing the expression cassette of the present invention to the target subject.

[0160] For example, the present invention provides a gene therapy method described in the eighth aspect of the present invention, or a method for treating hereditary angioedema described in the fourteenth aspect of the present invention.

[0161] Typically, the present invention allows for the specific expression of the expression cassette using an AAV-based gene delivery system (i.e., an AAV vector). In the above therapeutic approach, on the one hand, the special design of the expression cassette enhances the expression level of the target gene (protein), thereby reducing the dose of the corresponding expression vector and decreasing side effects, and on the other hand, a gene delivery system using a local administration method can effectively avoid side effects caused by systemic administration.

[0162] Typically, the treatment method of the present invention is a gene therapy method, and the target genes used in gene therapy can be classified into three categories: normal genes, antisense genes, and suicide genes.

[0163] Normal genes are isolated from healthy individuals and can be used to replace diseased genes through homologous recombination, or their expression products can be used to compensate for the physiological function of diseased genes. These genes are commonly used to treat various genetically defective disorders, such as hemophilia, thalassemia, and hereditary angioedema.

[0164] Antisense genes are primarily used to treat acquired molecular diseases by blocking their expression, either by expressing their in vivo product (RNA), being complementary to genes encoding viral activators, or being complementary to tumor gene mRNA. Examples of antisense genes include antisense BL-2 oligonucleotides, antisense MYC fragments, and antisense RNAs of HIV-1 genome gene fragments (e.g., pol, env, vif genes).

[0165] Suicide genes are a type of gene that encodes enzyme proteins capable of killing cancer cells. They are found in viruses, bacteria, and fungi and can convert harmless cellular metabolites into toxic chemicals. Examples of suicide genes include the HSV-tk gene, the CD gene, or suicide gene prodrug systems such as the gpt-6-TX system and the P450 2BI-CPA system.

[0166] Furthermore, gene therapies for tumors mainly include tumor inhibitor gene therapies (antisense BL-2 oligonucleotides, antisense MYC fragments), gene-modified tumor vaccines, immunogene therapies (tumor cytokine gene therapy, tumor MHC gene therapy, tumor antigen target gene therapy (e.g., TSA gene or TAA gene), tumor costimulatory molecule gene therapy (e.g., B7-1 (CD80), B7-2 (CD86), ICAM-1 (CD54)), etc.), and suicide gene therapy.

[0167] All types of target genes for various therapeutic purposes and treatments are included within the scope of this invention.

[0168] The main advantages of this invention are as follows:

[0169] 1. The expression cassette of the present invention, through its creative design, can improve the expression of target genes both in vitro and in vivo, thereby helping to reduce the economic and time costs of industrial production. Furthermore, based on the high expression of the target protein, the dosage of related drugs, including the expression cassette of the present invention, can be reduced, thereby reducing the occurrence of side effects.

[0170] 2. The treatment method provided by the present invention can reduce side effects with local administration and relatively low doses, while its long-lasting effect means that the effect can be obtained with a single dose, and the benefits can be obtained throughout one's life.

[0171] 3. The nucleic acid molecule of the present invention can improve the expression level of the serpinG1 gene, thus contributing to a reduction in production costs and a reduction in the dosage of the nucleic acid molecule of the present invention.

[0172] The present invention will be further described below in conjunction with specific examples. These examples are used solely to illustrate the present invention and should not be used to limit its scope. In the following examples, experimental methods that do not specify conditions typically follow conventional conditions, such as those described in Sambrook et al., Molecular Cloning: An Experimental Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or conditions proposed by the manufacturer. Unless otherwise specified, percentages and parts are calculated as weight percentages and weight parts.

[0173] Sequence information Serpin G1 codon-optimized sequence (SEQ ID NO:1): serpinG1 wild-type sequence (SEQ ID NO:2): Y602 expression cassette sequence (SEQ ID NO:3): HCR sequence (SEQ ID NO:4): CCGTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTCCCTGCCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACCTCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGAGGTTGTCCTGGCGTGGTTTAGGTAGTGTGAGAGGG DSE sequence (SEQ ID NO:5): AGGACGCCGCTGTTTACTGAGCTGGGCACAATGACCTTTGGCGAGCTGGACAGAGGGCCGGGCGCAGACGGGCAGGCGGGTGGGCAGCTCGGCGCTGACCTTTGCCCTTAGTCCCTGTTTGCTCCTCCGATAACCGGGGTGACTTTGGTTAATCATTAACCAGCAACCACCCCCGTCGTCCCTGCGGGTCCACAGCTTAAATACGAACTCGAACGGGGCTCTGTCTCCTTAGC TPL sequence (SEQ ID NO:6): GGGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGAGTCCGCATCGACCGGATCGGAAAACCTCTCGAGAAAGGCGTCTAACCAGTCACAGTCGCA eMLP sequence (SEQ ID NO:7): AGGTAGGCTGAGCACCGTTGGCGGGCGGCAGCGGTGGCGGTCGGGGTTGTTTCTGGCGGAGGTGCTGCTGATGATGTAATTAAAGTAGGCGGTCTTGAGACGGCGGATGGTCGAGGTGAGGTGTGGCAGGCTTGAGATCCAGCTGTTGGGGTGAGTACTCC CTCTCAAAAGCGGGCATTACTTCTGCGCTAAGATTGTCAGTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCAGAGGTCCACTCCCAGGTCCAAGTTTAAACT SV40 intron sequence (SEQ ID NO:8): CTCTAAGGTAAAATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTCTCTCTTTTAGATTCCAACCTTTGGAACTGA AAV8's cap sequence (SEQ ID NO:9): * HCR2 sequence (SEQ ID NO:10): AGGCTCAGAGGCACACAGGAGTTCTGGGCTCACCCTGCCCCCCTTCCAACCCCTCAGTTCCCATCCTCCAGCAGCTGTTTGTGTGCTCCTCTGAAGTCCACACTGAACAAACTTCAGCCTACTCATGTCCCTAAAATGGGCAAACATTGCAAGCAGCAAACAGCAAACACACAGCCCTCCTGCTGCTGACCTTGGAGCTGGGGCAGAGGTCAGAGACCTCTCTGGGCCCATGCCACCTCCAACATCCACTCGACCCCTTGGAATTTCGGTGGAGAGGAGCAGGTTGTCCTGGCGTGGTTTAGGTAGTGTGAGAGGG TPL2 sequence (SEQ ID NO:11): GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGGGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGAGTCCGCATCGACCGGAATCGGAAAACCTTCTCGAGAAAGGCGTCTAACCAGTCCAGTCCA HBB2 intron segment sequence (SEQ ID NO:12): GTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCA PA3 poly(A) sequence (SEQ ID NO:13): TTGCATGTTAATCAATAAAACCGGTTGATTCGTTTCAGTTGAACTTTGGTCTCCTGTGCTTATCTTATCGGTTTCCATAGCAACTGGTTTACACATTA BGH poly(A) sequence (SEQ ID NO:14): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGGGGTGGGCTCTATGG GS1196-016 expression cassette sequence (SEQ ID NO:15): Kozak sequence (SEQ ID NO: 16): GCCACCAUGG Materials, reagents, and consumables This mainly includes HEK 293T cells, DMEM medium, C57-serpinG1- / -, and a human Serpin G1 ELISA Kit (catalog number EK1667, Wuhan BOSTER). Unless otherwise specified, all other materials, reagents, and consumables used are commercially available.

[0174] Example 1. In vitro screening experiment of serpinG1 codon optimization 1. Vector Construction: After codon optimization of the wild-type (WT) serpinG1 gene, the inventors obtained three versions, labeled A, B, and C respectively. The four genes, including genes A, B, and C and the wild-type serpinG1 gene (SEQ ID NO:2), were constructed on pcDNA3.1 skeletal vectors by seamless cloning to obtain four expression vectors with FLAG markings: pcDNA3.1-serping1 optiA-3xFLAG-BGHpa, pcDNA3.1-serping1 optiB-3xFLAG-BGHpa, pcDNA3.1-serping1 optiC-3xFLAG-BGHpa, and pcDNA3.1-serping1 wt-3xFLAG-BGHpa.

[0175] 2. Expression of Serping1 and codon-optimized serping1 genes in cells: Expression tests will be performed using HEK 293T cells to examine the expression levels of codon-optimized and wild-type genes.

[0176] 293T cells were plated into a 6-well cell culture plate, and when the cell density reached 80%-90%, the four expression plasmids described above were transfected into the cells. After 48 hours, the cells were collected, total intracellular protein was extracted, and quantified using the BCA protein concentration measurement kit (catalog number 20201ES76, Shanghai Yisheng Biotechnology Co., Ltd.). Western blotting was then performed, and the expression levels of each gene were detected using FLAG antibody (Monoclonal ANTI-FLAG® M2-Peroxidase (HRP) antibody, sigma) and Serpin G1 antibody (SERPING1 Antibody (OAAN00490), Aviva Systems Biology).

[0177] As shown in Figure 1 and Table 1, the results of a Western blotting method using FLAG antibodies to detect the expression levels of codon-optimized A, B, C genes and WT genes are shown.

[0178] TIFF2026513145000001.tif143170

[0179] According to the results in Figures 1A, 1B, and Table 1, the expression levels of the codon-optimized B and C genes were superior to those of the wild-type serpinG1 gene. Of these, the expression level of the B gene was the most superior, reaching approximately 1.53 times that of the wild-type gene, and the expression level of the C gene reached approximately 1.39 times that of the wild-type gene. The expression level of the codon-optimized A gene was lower than that of the wild-type serpinG1 gene.

[0180] As shown in Figure 2 and Table 2, the results of a Western blotting method using the SerpinG1 antibody to detect the expression levels of codon-optimized A, B, C genes and WT genes are shown.

[0181] TIFF2026513145000002.tif162170

[0182] As shown in Figures 2A, 2B and Table 2, the expression levels of the codon-optimized A, B, and C genes are superior to those of the wild-type serpinG1 gene. Of these, the expression level of gene B is the most superior, reaching approximately 1.30 times that of the wild-type gene, while the expression levels of genes A and C are only slightly higher than those of the wild type.

[0183] All of the above results indicate that the expression level of the codon-optimized B gene (SEQ ID NO:1) is the highest, potentially reaching approximately 1.53 times that of the wild-type serpinG1 gene.

[0184] Example 2. Detection of the expression level of a seping1 gene-containing AAV expression vector in model mice. 1. Construction of the Y602 expression cassette: The serpinG1 gene fragment (selecting the codon-optimized B gene showing the highest expression level), the poly(A) fragment (PA3), and various regulatory elements (including HCR, DSE, TPL, eMlp, and sv40 introns, and optionally further including Kozak sequences) are combined by a seamless cloning method to obtain an expression cassette (5'-HCR-DSE-TPL-eMlp-sv40 intron-serping1-PA3-3'), i.e., the Y602 expression cassette.

[0185] As shown in Figure 3, the structure of the Y602 expression cassette is shown.

[0186] 2. Packaging of AAV vectors: HEK293 cells in 4 × 10⁶ cells. 6Inoculate a plate of 10% FBS-containing DMEM medium at a concentration of / 100ml diameter and culture overnight at 37°C in a humid environment with 5% CO2. The following day, construct an AAV packaging plasmid containing a Y602 expression cassette and two terminally reversed repeat sequences (ITRs), and prepare a PEI transfection mixture containing the nucleic acid molecule of this application (SEQ ID NO:1) or the nucleic acid molecule of the comparative example, AAV8 capsid protein, and helper plasmid. Then, add the transfection mixture to the cell medium and transfect for 6 hours, replace the medium with 10% FBS-containing DMEM, harvest the cells 72 hours after transfection to obtain a crude extract containing recombinant virus (recombinant AAV vector). Resuspend in a buffer (pH=8) containing 100mM sodium chloride, 2mM magnesium chloride, and 10mM Tris, and store at -80°C.

[0187] 3. Purification and quantitative analysis of AAV vectors: The HEK-293 cells obtained in the previous step were subjected to three freeze-thaw cycles, treated with 50 U / mL of benzonase at 37°C for 30 minutes to remove unpackaged DNA, and then centrifuged at 3000 g for 10 minutes to precipitate the cells. The supernatant was then transferred to ultra-rapid centrifugation.

[0188] Equipped with an iodixanol centrifugation system, four gradient iodixanol solutions are sequentially added to a 33 ml Optiseal tube (Beckman) using a 10 ml syringe in the order of 17%, 25%, 40%, and 60%. 6 ml of 17%, 6 ml of 25%, 5 ml of 40%, and 4 ml of 60% solutions are slowly added to the Optiseal tube from the bottom. After addition is complete, the sample name is marked on the top of the Optiseal tube, and a line is drawn at the boundary between 40% and 60%. Then, using a test tube, the supernatant is carefully added to a centrifuge tube and centrifuged at 53000 g at 14°C for 2 hours and 40 minutes.

[0189] Insert the needle of a 5 ml syringe into the Optiseal tube along the pre-marked horizontal line (the boundary between 40% and 60%), and draw the 40% portion of the solution (approximately 2-3 ml) into a new 15 ml tube. Add the virus solution to an equilibrated 100 K centrifuge filter and add 1 × PBS (10 -4 Add F188) up to the approximately 50 ml line and centrifuge at 3500 rpm for 10 minutes. Discard the waste liquid and 1 × PBS (10 -4 Refill with F188) and centrifuge at 3500 rpm for 10 minutes. Repeat the washing process three times.

[0190] 300-500 μl of 1×PBS (10 -4 Add F188) and collect the purified virus (i.e., the recombinant AAV vector after purification). Aspirate into a 1.5 ml EP tube. Then, perform qPCR quantitative analysis of the purified AAV vector genome using the kit according to the instructions and measure the titer of the virus stock solution.

[0191] 4. Expression and detection of AAV vector in mice: The obtained recombinant AAV vector was expressed at a dose of 6E12vg / kg in serping1 model mice (serpinG1 defective mice serping1). - / - and normal control (i.e., non-defective) mouse serping1 + / + The drug (including) is injected intraveinally into the tail vein, and the C1-INH content in the serum is detected one and two weeks after injection using the Human Serpin G1 ELISA Kit (catalog number EK1667, Wuhan BOSTER).

[0192] As shown in Figure 4, the C1-INH content in serping1 model mice one and two weeks after AAV vector injection is shown. Here, saline injection is used as a control, and it can be seen that a significantly high level of C1-INH content was detected in mouse plasma after AAV vector injection, and that C1-INH expression persisted over time.

[0193] As shown in Figure 5 and Table 3, the in vivo expression effect (i.e., only the expression cassette was replaced, and other experimental steps were the same) of the Y602 expression cassette and the Y508 expression cassette (LP1-SERPING1-PA3, another expression cassette constructed by the inventors in the same batch) is shown. Based on the difference in C1-INH content, a significant difference was found in the corresponding C1-INH content between the Y602 expression cassette and the Y508 expression cassette (p<0.01), and the expression level of the Y602 expression cassette can reach approximately 3 times on average and up to approximately 4 times that of the Y508 expression cassette.

[0194] TIFF2026513145000003.tif53170

[0195] The above results indicate that the Y602 expression cassette is highly and sustainably expressed in vivo and has significantly superior expression capacity compared to other expression cassettes constructed by the inventors in the same batch (e.g., the Y508 expression cassette). After screening, the preferred expression cassette of the present invention is the Y602 expression cassette.

[0196] Example 3. Detection of expression of a seping1 gene-containing AAV expression vector in cynomolgus monkeys 1. Construction of the GS1196-016 expression cassette: The present invention is further optimized based on Y602 and combines a serpinG1 gene fragment (selecting the codon-optimized B gene showing the highest expression level), a poly(A) fragment (BGH), and various regulatory elements (including HCR2, DSE, TPL2, eMlp, and HBB2 introns, and optionally further including Kozak sequences) by a seamless cloning method to obtain an expression cassette (5'-HCR2-DSE-TPL2-eMlp-HBB2 intron-serping1-BGH-3'), i.e., the GS1196-016 expression cassette.

[0197] As shown in Figure 6, the structure of the GS1196-016 expression cassette is shown. 2. Packaging and quantification of the AAV vector. In this example, the virus packaging and quantification method from Example 2 is used.

[0198] 3. Expression and detection of AAV vectors in cynomolgus monkeys (non-human primates (NHP) model): Two male cynomolgus monkeys were selected as the experimental group, and 1 × 10⁻⁶ 13 GS1196-016 is administered as a single intravenous injection according to vg / kg, with the administration time recorded as day 0. Plasma is collected on day 7 and the activity of C1-INH is tested.

[0199] As shown in Figure 7, the C1-INH activity in cynomolgus monkeys one week after injection of the AAV vector is clearly detected in the plasma of cynomolgus monkeys after injection of the AAV vector, reaching or exceeding clinically effective levels. Therefore, the GS1196-016 expression cassette can also be used as a preferred expression cassette in this application.

[0200] Comparative Experiment: Comparison of the expression cassette of the present invention with an expression cassette that mediates the expression of the same protein in mice. This example uses the AAV vector construction method and the virus packaging and quantification method of Example 2, and replaces the GS1196-016 expression cassette in the center of the ITR with another expression cassette of the prior art, such as a preferred expression cassette of, for example, Prior Art-1 (selected from CN114829391A, with an expression cassette structure of 5'-ApoE / HCR enhancer-hAAT promoter-hhI, hAAT / hemoglobin intron-serping1-wt-hGH PA-3') or Prior Art-2 (selected from US20230043051A1, with an expression cassette structure of 5'-3xCRM8-hTTR-MVM intron-serping1 HA06-wpre3-hBHG-3'), and packages them as AAV8 viruses, with each AAV virus being 1 × 10⁶ 12 Four mice were administered intravenously at a dose of vg / kg, with the administration time recorded as day 0. Plasma samples were collected on day 0 and day 7, and the activity of C1-INH was tested.

[0201] As shown in Figure 8, the results demonstrate that C1-INH expressed in mice via the expression cassette of the present invention is significantly superior to that expressed by other expression cassettes.

[0202] All documents referenced in this invention are cited as references in this application, as if each document were cited individually. Furthermore, after reading the above teachings of this invention, persons skilled in the art can make various changes or modifications to the invention, and these equivalent forms are also included within the scope defined by the claims appended to this application.

Claims

1. It is an expression cassette, The expression cassette has the structure shown in formula I from the 5' end to the 3' end, Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8 (I) In the formula, each "-" independently represents a bond or nucleotide linkage sequence. Z1 is an HCR element, Z2 is a DSE element, Z3 is a TPL element, Z4 is an eMlp element, The Z5 is an Intron, Z6 is either none or a Kozak sequence. Z7 is a target gene, and Z8 is an expression cassette characterized by being a poly(A) element.

2. The expression cassette according to claim 1, characterized in that the target gene is selected from the group consisting of the serpinG1 gene, FIX gene, PAH (phenylketonuria), GBA1 gene (Gaucher disease), GLA gene (Fabry disease), IDS (mucopolysaccharidosis type II), G6P (Fabism), GAA (Pompe disease), luciferase gene, CFTR gene (cystic fibrosis), LDLR gene (familial hypercholesterolemia), α-globin gene, β-globin gene (thalassemia), APC gene (familial multiple adenomatous polyposis), SLC26A4 gene, GJB2 gene (congenital hearing loss), TYR gene, OCA2 gene, TYRP1 gene, SLC45A2 gene (albinism), or a combination thereof.

3. The expression cassette according to claim 1, characterized in that the expression cassette has a nucleotide sequence as shown in SEQ ID NO: 3 or SEQ ID NO:

15.

4. nucleic acid molecules, The nucleic acid molecule is characterized in that it encodes an expression cassette according to any one of claims 1 to 3.

5. An expression vector, The expression vector is characterized in that it comprises the nucleic acid molecule described in claim 4 or the expression cassette described in any one of claims 1 to 3.

6. It is a host cell, The host cell is characterized in that it contains the expression vector described in claim 5, or has the nucleic acid molecule described in claim 4 incorporated into its genome.

7. A gene delivery system, A gene delivery system characterized by comprising an expression cassette according to any one of claims 1 to 3 or a nucleic acid molecule according to claim 4, and an AAV capsid protein.

8. The use of an expression cassette according to any one of claims 1 to 3, a nucleic acid molecule according to claim 4, an expression vector according to claim 5, a host cell according to claim 6, or a gene delivery system according to claim 7, The use of an expression cassette according to any one of claims 1 to 3, a nucleic acid molecule according to claim 4, an expression vector according to claim 5, a host cell according to claim 6, or a gene delivery system according to claim 7, which is used in the preparation of a formulation or composition, wherein the formulation or composition is a gene therapy drug.

9. A pharmaceutical composition, (i) an expression cassette according to any one of claims 1 to 3, a nucleic acid molecule according to claim 4, an expression vector according to claim 5, a host cell according to claim 6, or a gene delivery system according to claim 7 as an active ingredient, (ii) A pharmaceutically acceptable carrier, diluent or excipient, A pharmaceutical composition characterized by containing the following:

10. It is a gene therapy method, The gene therapy method is characterized by comprising the step of administering a therapeutically effective amount of the expression vector described in claim 5, the gene delivery system described in claim 7, or the pharmaceutical composition described in claim 9 to a target subject.

11. A nucleic acid molecule that codes for the serpinG1 gene, A nucleic acid molecule encoding the serpinG1 gene, characterized in that its nucleotide sequence has at least 87% identity with the sequence shown in SEQ ID NO:1, and preferably at least 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

12. An expression vector, The expression vector is characterized by comprising the nucleic acid molecule described in claim 11.

13. It is a host cell, The host cell is characterized in that it contains the expression vector described in claim 12, or has the nucleic acid molecule described in claim 11 incorporated into its genome.

14. The use of a nucleic acid molecule according to claim 11, an expression vector according to claim 12, or a host cell according to claim 13, The use of a nucleic acid molecule according to claim 11, an expression vector according to claim 12, or a host cell according to claim 13, which is used in the preparation of a formulation or composition, wherein the formulation or composition is used to treat hereditary angioedema.

15. A pharmaceutical composition, (i) A nucleic acid molecule according to claim 11, an expression vector according to claim 12, or a host cell according to claim 13, which is an active ingredient. (ii) A pharmaceutically acceptable carrier, diluent or excipient, A pharmaceutical composition characterized by containing the following:

Citation Information

Patent Citations

  • Gene expression unit

    JP2002034559A

  • Compositions and methods for enhancing gene expression

    JP2020513792A

  • Gene therapy for CNS degeneration

    WO2019210325A1

  • Compositions and methods for treating hereditary angioedema

    WO2022165027A2