Oligonucleotides, their manufacturing methods, and applications
Chemical modifications at specific positions of the siRNA antisense strand reduce off-target effects while maintaining on-target activity, improving the safety and efficacy of siRNA drugs.
Patent Information
- Application Number
- JP2025561346
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-29
- Filing Date
- 2024-02-27
- Publication Date
- 2026-04-23
AI Technical Summary
Existing siRNA drugs exhibit off-target effects due to incomplete pairing of the seed region with target mRNA, leading to unpredictable toxic side effects, while conventional chemical modifications to reduce off-target toxicity often compromise on-target activity.
Introduce chemical modifications represented by formula (II) or its tautomers at specific nucleotide positions outside the terminal of the siRNA antisense strand, specifically at positions 2 to 8, using structures like Ago, Ggo, Cgo, Ugo, Ggs, and Tgo, to minimize off-target effects while maintaining on-target activity.
The modifications significantly reduce off-target effects of siRNA while preserving on-target activity, enhancing the safety and efficacy of siRNA as a pharmaceutical drug.
Smart Images

Figure 2026513376000001_ABST
Abstract
Description
[Technical Field]
[0001] This invention belongs to the field of biopharmaceutical technology, and more specifically, relates to oligonucleotides, methods for producing the same, and applications. Background technology
[0002] siRNA holds significant potential for drug development. However, in vivo applications of siRNA often exhibit varying degrees of off-target effects. siRNA can target non-target genes, and off-target effects similar to those of the microRNA pathway are a major cause of siRNA off-target behavior. Specifically, this is the suppressive activity against mRNA resulting from the complete or incomplete pairing of the seed region (positions 2-8 at the 5' end) of the siRNA antisense strand (also called the AS strand) with the target mRNA. The off-target effect of a single siRNA molecule can affect multiple mRNAs. Therefore, unpredictable toxic side effects can occur, which is a major cause of siRNA-mediated toxic side effects.
[0003] To reduce off-target toxicity and improve safety of siRNA drugs, chemical modification of specific sites in the seed region of the antisense strand of siRNA drugs can reduce off-target toxicity of small molecule nucleic acid drugs. By introducing chemical modifications, the strength of the interaction between the seed region and the target gene can be adjusted, and efforts can be made to reduce off-target effects while ensuring that the silencing effect of the target mRNA is not affected (Mark K. Schlegel, Chirality Dependent Potency Enhancement and Structural Impact of Glycol Nucleic Acid Modification on siRNA. J. Am. Chem. Soc. 2017, 139, 8537-8546).
[0004] In conventional techniques, introducing chemical modifications to the 5' terminal seed region of the siRNA antisense strand, for example, by introducing GNA or UNA modifications to the 5' terminal seed region of the siRNA antisense strand, reduces off-target toxicity but simultaneously leads to a greater loss of on-target activity. Therefore, conventional techniques require a chemical modification method that can reduce the off-target effects of siRNA while minimizing the impact on the on-target activity of siRNA. [Overview of the project] [Problems that the invention aims to solve]
[0005] The object of the present invention is to provide oligonucleotides, methods for producing the same, and applications that can reduce the off-target effects of siRNA while simultaneously minimizing the impact on the on-target activity of siRNA.
[0006] To achieve the above objective, the present invention employs the following technical solutions. [Means for solving the problem]
[0007] A first aspect of the present invention provides an oligonucleotide, which is single-stranded or double-stranded, wherein each strand has 15 to 35 nucleotides, and the oligonucleotide includes a chemical modification represented by formula (II) or a tautomer modification thereof at at least one nucleotide position outside the terminal.
[0008] [ka] In the formula, B1 is a natural nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. R1, R2, and R3 are each independently selected from H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, and -O-alkylamino group. n is 1, 2, or 3. Here, the chemical modification represented by formula (II) is [ka] isn't it.
[0009] Preferably, B1 is a natural nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. R1, R2, and R3 are each independently selected from H, OH, or CH3. n is either 1 or 2.
[0010] According to some embodiments, the oligonucleotide is an siRNA comprising a sense strand and an antisense strand, each strand having 15 to 35 nucleotides, wherein the antisense strand includes a chemical modification or tautomer modification represented by formula (II-1), formula (II-2), (II-3), or (II-4) at at least one nucleotide position from position 2 to position 8 in its 5' region. [ka] In the formula, B1 and B2 are, respectively, a native nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. Preferably, B1 and B2 are modified or unmodified nucleic acid bases, respectively.
[0011] According to some preferred embodiments, the chemical modification is one of the following configurations Selected from the construction. [ka]
[0012] According to some preferred embodiments, the chemical modification is selected from the structures of Ago, Ggo, Cgo, Ugo, Ggs, and Tgo.
[0013] According to some embodiments, the chain includes a chemical modification or tautomer modification represented by formula (II), (II-1), (II-2), (II-3), or (II-4) at at least one nucleotide position between positions 5 and 8 of its 5' region.
[0014] Furthermore, the chain includes a chemical modification or tautomer modification indicated by (II), (II-1), (II-2), (II-3), or (II-4) at at least one nucleotide position at the 6th and 7th positions of its 5' region.
[0015] Furthermore, the chain is an antisense chain of a double-stranded oligonucleotide and includes a chemical modification or tautomer modification represented by Ago, Ggo, Cgo, Ugo, Ggs, or Tgo at at least one nucleotide position at positions 6 and 7 of its 5' region.
[0016] Furthermore, in addition to nucleotides comprising chemical modifications or tautomer modifications represented by formula (II), (II-1), (II-2), (II-3), or (II-4), the chain further comprises at least one other modified nucleotide.
[0017] Furthermore, the other modified nucleotides are independently selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-amino-modified nucleotides, and 2'-substituted amino-modified nucleotides.
[0018] Preferably, the other modified nucleotides are independently selected from 2'-F modified nucleotides, 2'-O-CH3 modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, and 2'-deoxy nucleotides.
[0019] More preferably, the other modified nucleotides are independently selected from 2'-F modified nucleotides and 2'-O-CH3 modified nucleotides.
[0020] Furthermore, the oligonucleotide is an siRNA, comprising a sense strand and an antisense strand, and the siRNA has at least one of the following characteristics. (i) The antisense chain contains 2, 3, 4, 5, or 6 2'-fluoromodifications. (ii) The antisense chain comprises one, two, three, or four phosphorothioate nucleotide interlinks. (iii) The sense chain contains two, three, four, or five 2'-fluoro modifications. (iv) The sense strand comprises one, two, three, or four phosphorothioate nucleotide interlinks.
[0021] Furthermore, the siRNA includes a double-stranded region having a length of 12 to 40 nucleotide pairs.
[0022] According to some specific embodiments, the sense chain of the oligonucleotide is 5'-UmsGmsAmCmAfAmGfAfAfUmCmCmUmCmAmCmAmUm-3', and the antisense chain is 5'-AmsUfsUmGmUm(Ggo)AmGmGmAmUmUmCmUfUmGfUmCmAmsAmsCm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-UmsGmsAmCmAfAmGfAfAfUmCmCmUmCmAmCmAmUm-3', and the antisense strand is 5'-AmsUfsUmGmUmGf(Ago)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3', and the antisense strand is 5'-UmsUfsUmGmAm(Ago)GmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3', and the antisense strand is 5'-UmsUfsUmGmAmAf(Ggo)UmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-GmsUmsGmUmGmCmAfCfUf UmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAf(Ggo)CfGfAmAmGmUmGfCmAfCmAmCmsUmsUm It is -3'. Or, The sense strand of the oligonucleotide is 5'-AmsCmsUmGmAmAmGfCfAfUmUmUmGmAmUmGmCmAmAm-3', and the antisense strand is 5'-UmsUfsGmCmAm(Ugo)CmAmAmAmUmGmCmUfUmCfAmGmUmsGmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-AmsCmsUmGmAmAmGfCfAfUmUmUmGmAmUmGmCmAmAm-3', and the antisense strand is 5'-UmsUfsGmCmAmUf(Cgo)AmAmAmUmGmCmUfUmCfAmGmUmsGmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-AmsUmAmAmCmUmCfAfCfUmAmUmAmAmUmUmAmCmUm-3', and the antisense strand is 5'-AmsGfsUmAmAm(Ugo)UmAmUmAmGmUmGmAfGmUfUmAmUmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-AmsUmAmAmCmUmCfAfCfUmAmUmAmAmUmUmAmCmUm-3', and the antisense strand is 5'-AmsGfsUmAmAmUf(Ugo)AmUmAmGmUmGmAfGmUfUmAmUmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmsAms-3', and the antisense strand is 5'-VPUmsGfsUmGmAm(Ago)GmCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAgoGmCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm-3'.
[0023] According to several other specific embodiments, the sense strand of the oligonucleotide is 5'- CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm -3', and the antisense chain is 5'-UmsUfsUmGmAmAf(Ggs)UmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'. Alternatively, The sense strand of the oligonucleotide is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAf(Ggs)CfGfAmAmGmUmGfCmAfCmAmCmsUmsUm-3'.
[0024] A second aspect of the present invention provides an siRNA conjugate comprising the above-mentioned single-stranded or double-stranded oligonucleotide and a conjugate group conjugated to the oligonucleotide.
[0025] Furthermore, the conjugate group is bonded to the 3' and / or 5' ends of the sense chain.
[0026] In some specific and preferred embodiments, the conjugate group is [ka] That is the case.
[0027] A third aspect of the present invention provides a pharmaceutical composition comprising the above-mentioned single-stranded or double-stranded oligonucleotide or siRNA conjugate, and a pharmaceutically acceptable carrier.
[0028] A fourth aspect of the present invention is the single-stranded or double-stranded oligonucleotide described above, or the above A kit is provided containing an siRNA conjugate or the above-mentioned pharmaceutical composition.
[0029] A fifth aspect of the present invention provides a compound represented by the following formula (IV) or a tautomer therefor. [ka] In the formula, B1 is a natural nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. E is a leaving group, preferably MMTr or DMTr. Q is a phosphorus-containing active reactive group, preferably Q is [ka] That is the case.
[0030] According to some specific and preferred embodiments, the compound represented by formula (IV) or its tautomers is selected from any of the following structures. [ka]
[0031] A sixth aspect of the present invention provides a method for producing the single-stranded or double-stranded oligonucleotide or the siRNA conjugate described above, comprising the following steps. 1) A step of synthesizing the compound represented by formula (IV) above or its tautomers, 2) A step of synthesizing the oligonucleotide or siRNA conjugate using the compound from step 1) or a tautomer thereof.
[0032] A seventh aspect of the present invention provides a method for suppressing a target gene in a cell, comprising the step of introducing the single-stranded or double-stranded oligonucleotide or the siRNA conjugate into the cell.
[0033] According to some embodiments, target genes include, but are not limited to, PD-L1, HBV, AGT, PCSK9, APOC3, or LPA.
[0034] An eighth aspect of the present invention provides a method for reducing off-target activity by modifying the 2-8 position of the antisense chain of an siRNA, wherein a chemical modification represented by general formula (II), (II-1), (II-2), (II-3), or (II-4) or a tautomer modification thereof is introduced to the 2-8 position of the antisense chain of an siRNA molecule.
[0035] According to some specific embodiments, the chemical modification or tautomer represented by general formula (II), (II-1), (II-2), (II-3), or (II-4) is selected from any of the structures of the structural formulas described above.
[0036] Furthermore, the chemical modifications or tautomers represented by general formulas (II), (II-1), (II-2), (II-3), or (II-4) are selected from among the structures of Ago, Ggo, Cgo, Ugo, Ggs, and Tgo.
[0037] By employing the above-described technical solutions, the present invention has the following advantages compared to the prior art.
[0038] This invention reduces off-target effects of siRNA while minimizing its impact on on-target activity by introducing a special compound into the 5'-terminal seed region of the antisense strand of siRNA, thereby improving the safety of siRNA as a pharmaceutical drug. [Brief explanation of the drawing]
[0039] [Figure 1] Figure 1 shows the percentage of HBV DNA in the vehicle group. [Modes for carrying out the invention]
[0040] Specific Embodiments It should be noted that, unless otherwise defined, technical or scientific terms used in this application have the ordinary meanings understood by those skilled in the art. The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials, reagents, etc., used in the following examples are commercially available unless otherwise specified.
[0041] As used herein and in the appended claims, the singular forms "a," "an," "another," and "the" refer to multiple subjects unless the context explicitly indicates otherwise.
[0042] definition In the context of this invention, uppercase letters A, U, C, and G indicate the base composition of a nucleotide. Lowercase letter m indicates that the nucleotide to the left of m is a 2'-methoxy-modified nucleotide. Lowercase letter f indicates that the nucleotide to the left of f is a 2'-fluoro-modified nucleotide. Lowercase letter s indicates that the two nucleotides adjacent to the left and right of s are linked by a phosphorothioate group. The letter combination VP indicates that the nucleotide to the right of the letter combination VP is a vinyl phosphonate-modified nucleotide, as shown below. [ka]
[0043] As used herein, “natural nucleic acid bases” refers to nucleic acid bases that are not modified from their naturally occurring forms in RNA or DNA. Examples of “natural nucleic acid bases” include the purine nucleic acid bases adenine (A) and guanine (G), and the pyrimidine nucleic acid bases thymine (T), cytosine (C), and uracil (U). In addition to “natural nucleic acid bases,” many modified nucleic acid bases or modified nucleic acid base analogs known to those skilled in the art are used in the compounds described herein. Suitable for the object.
[0044] As used herein, “modified nucleic acid base” refers to a nucleic acid base that is structurally very similar to the parent nucleic acid base, such as 7-deazapurine, 5-methylcytosine, or G-clamp.
[0045] As used herein, a universal nucleic acid base is a base that can complementarily pair with at least two common bases, for example, hypoxanthine (whose nucleoside is inosine) can pair with any one of A, T, G, or C, with binding affinities I:C > I:A > I:G > I:T. Alternatively, for example, bromouridine (BrU) can pair with A or G. Optionally, the present invention may also select other universal bases that can complementarily pair with at least two common bases, such as 3-nitropyrrole, 5-nitroindole, or 7-azaindole.
[0046] As used herein, “seed region” refers to a region in the antisense strand of an RNAi reagent that recognizes a target mRNA and responds, for example, to the 2nd to 8th nucleotides from the 5' end of the antisense strand.
[0047] As used herein, "nucleotide position" refers to the position of a nucleotide in an oligonucleotide when counted from the 5' end. For example, nucleotide position 1 refers to the 5' end nucleotide of the oligonucleotide.
[0048] As used herein, “oligocyte” refers to a polymeric form of nucleotides ranging from 2 to 2500 nucleotides. Oligonucleotides can be single-stranded or double-stranded. In some embodiments, the oligonucleotide has 500 to 1500 nucleotides and is typically used, for example, in gene therapy. In some embodiments, the oligonucleotide is single-stranded or double-stranded and has 7 to 100 nucleotides. In some embodiments, the oligonucleotide is single-stranded or double-stranded and has 15 to 100 nucleotides. In another embodiment, the oligonucleotide is single-stranded or double-stranded and has 15 to 50 nucleotides and is typically, for example, a nucleic acid inhibitor. In yet another embodiment, the oligonucleotide is single-stranded or double-stranded and has 25 to 40 nucleotides and is typically, for example, a nucleic acid inhibitor. In yet another embodiment, the oligonucleotide is single-stranded or double-stranded and has 19 to 40 or 19 to 25 nucleotides, and is typically, for example, a double-stranded nucleic acid inhibitory molecule, forming a double helix having at least 18 to 25 base pairs. In another embodiment, the oligonucleotide is single-stranded and has 15 to 25 nucleotides, and is typically, for example, a single-stranded RNAi inhibitory molecule. Typically, as described herein, the oligonucleotide includes one or more phosphorus-containing internucleotide binding groups. In another embodiment, as described herein, the internucleotide binding group is a phosphoramidite group.
[0049] As used herein, "2'-fluoromodified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2' position of the ribose group of a nucleotide with fluorine, and having the structure shown in formula (7) below. [ka]
[0050] In this specification, "base" refers to a base such as A, U, G, C, or T.
[0051] Similarly, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, and 2'-substituted amino-modified nucleotides refer to nucleotides formed by the substitution of the hydroxyl group at the 2' position of the ribose group of the nucleotide with the corresponding group.
[0052] As used herein, “conjugation” refers to a combination of two or more chemical moieties, each having a specific function, that are covalently bonded to one another. Therefore, “conjugate” refers to a compound formed by the covalent bonding of these chemical moieties. Furthermore, “siRNA conjugate” refers to a compound formed by the covalent bonding of one or more chemical moieties, each having a specific function, to an siRNA.
[0053] In the context of the present invention, particularly when describing the methods for producing the siRNA, siRNA-containing composition, or siRNA conjugate of this application, unless otherwise specified, the nucleoside monomer refers to modified or unmodified nucleoside phosphoramidite monomers (RNA phosphoramidites are also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and order of nucleotides in the siRNA or siRNA conjugate to be produced. Phosphoramidite solid-phase synthesis is a method used in RNA synthesis that is known to those skilled in the art. All nucleoside monomers used in this application are commercially available.
[0054] In this invention, "non-terminal of oligonucleotide" refers to any position other than the first and last nucleotides of an oligonucleotide; in other words, any position other than the nucleotide at position 1 and the last nucleotide (5'-3' direction) of the oligonucleotide.
[0055] The siRNA of this application comprises a nucleotide group as a basic structural unit, and as is known to those skilled in the art, the nucleotide group comprises a phosphate group, a ribose group, and a base.
[0056] This invention improves the safety of siRNA as a pharmaceutical by chemically modifying the 5'-terminal seed region of the antisense chain of siRNA by introducing one of the compounds of this invention, thereby reducing off-target effects of siRNA while minimizing the impact on the on-target activity of siRNA.
[0057] Conventional techniques typically introduce GNA or UNA modifications to the 5'-terminal seed region of the siRNA antisense strand, which reduces off-target toxicity but also significantly decreases on-target activity.
[0058] Here, UNA is given by equation (3) and GNA is given by equation (4). [ka]
[0059] In formulas (3) and (4) above, R is selected from H, OH, or an alkoxy group (O-alkyl).
[0060] In the examples presented in this application (including in vitro and in vivo experiments), different siRNA sequences were designed for multiple targets, and the on-target and off-target activities of siRNA were compared when the chemical modifications of this application and GNA modifications were introduced at the same position in the 5' seed region of the siRNA antisense strand, which consisted of the same nucleotide sequence. The results showed that introducing both the chemical modifications of this application and GNA modifications reduced the off-target effects of siRNA and improved the pharmaceutical safety of siRNA. However, siRNA with the chemical modifications of this application exhibited better on-target activity than siRNA with GNA modification, indicating that the impact on the on-target activity of siRNA can be minimized by introducing the chemical modifications of this application.
[0061] This invention provides many chemical modifications, including Ago, Ggo, Cgo, Ugo, Cgs, and Ggs. Introducing any one of these chemical modifications to at least one nucleotide position between positions 2 and 8 in the 5' region of the antisense strand allows for the retention of nearly the same on-target activity as the original sequence while significantly reducing off-target activity.
[0062] In one embodiment, the antisense strand includes a chemical modification or tautomer modification represented by formula (II), (II-1), (II-2), (II-3), or (II-4) defined above at at least one nucleotide position from position 5 to position 8 of its 5' region, Preferably, the antisense strand includes a chemical modification or tautomer modification represented by formulas (II), (II-1), (II-2), (II-3), and (II-4) defined above at at least one nucleotide position at positions 6 and 7 of its 5' region.
[0063] In the examples of this application (including in vitro and in vivo experiments), it was verified that including the above chemical modification at the 6th or 7th nucleotide position of the 5' terminal seed region of the siRNA antisense strand could reduce the off-target effects of siRNA while simultaneously minimizing the impact on on-target activity.
[0064] In a preferred embodiment of the present invention, in addition to nucleotides comprising chemical modifications or tautomer modifications represented by formulas (II), (II-1), (II-2), (II-3), and (II-4) defined above, at least one of the sense strand and / or antisense strand further comprises at least one other modified nucleotide. Preferably, in addition to the nucleotides containing the chemical modifications or tautomer modifications represented by the formulas (II), (II-1), (II-2), (II-3), and (II-4) defined above, the remaining nucleotides of the sense strand and / or antisense strand are other modified nucleotides.
[0065] In some embodiments, the other modified nucleotides are, independently of each other, 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, and 2'- Selected from deoxyribonucleotides, 2'-amino-modified nucleotides, and 2'-substituted amino-modified nucleotides.
[0066] Preferably, the other modified nucleotides are independently selected from 2'-F modified nucleotides, 2'-O-CH3 modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, and 2'-deoxy nucleotides. More preferably, the other modified nucleotides are independently selected from 2'-F modified nucleotides and 2'-O-CH3 modified nucleotides.
[0067] In some embodiments, the 2'-alkyl-modified nucleotide is a methoxy-modified nucleotide (2'-OMe) as shown in formula (8).
[0068] [ka] Here, Base refers to a base such as A, U, G, C, or T.
[0069] In some embodiments, the single-stranded or double-stranded oligonucleotide / siRNA described above has at least one of the following characteristics: (i) The antisense chain contains 2, 3, 4, 5, or 6 2'-fluoromodifications. (ii) The antisense chain comprises one, two, three, or four phosphorothioate nucleotide interlinks. (iv) The sense chain contains two, three, four, or five 2'-fluoro modifications. (v) The sense strand comprises one, two, three, or four phosphorothioate nucleotide interlinks, and its structure is represented by formula (1). [ka] (vi) The siRNA comprises at least four 2'-fluoro modifications. (vii) The siRNA includes a double-stranded region having a length of 12 to 40 nucleotide pairs.
[0070] 2. siRNA conjugate of the present invention The present invention provides an siRNA conjugate comprising the above-mentioned single-stranded or double-stranded oligonucleotide / siRNA and a conjugate group conjugated to the siRNA.
[0071] Preferably, the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, the single-stranded or double-stranded oligonucleotide / siRNA, the linker and the target The chemical groups are sequentially linked by covalent or noncovalent bonds.
[0072] In a preferred embodiment of the present invention, the conjugate group conjugated to the siRNA is TIN or FIN, where the synthesis of FIN should be referred to US2022 / 0008541A1.
[0073] 3. Pharmaceutical composition and kit of the present invention This application provides a pharmaceutical composition containing, as an active ingredient, a single-stranded or double-stranded oligonucleotide / siRNA or siRNA conjugate, and a pharmaceutically acceptable carrier.
[0074] The pharmaceutically acceptable carriers are carriers commonly used in the field of siRNA administration, such as magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene phosphate). It may be one or more selected from phosphate, PPEEA, and poly(2-dimethylaminoethyl methacrylate, PDMAEMA) and their derivatives.
[0075] There are no particular requirements regarding the content of single-stranded or double-stranded oligonucleotides / siRNAs or siRNA conjugates and pharmaceutically acceptable carriers in the pharmaceutical composition; the usual content of each component may suffice.
[0076] This disclosure provides a kit comprising the single-stranded or double-stranded oligonucleotide / siRNA described above, or the siRNA conjugate described above, or the pharmaceutical composition described above.
[0077] In some embodiments, the kits described herein may provide single-stranded or double-stranded oligonucleotides / siRNA or siRNA conjugates in a single container. In some embodiments, the kits described herein may include a container for providing pharmaceutically acceptable excipients. In some embodiments, the kits may further include other components such as stabilizers or preservatives. In some embodiments, the kits described herein may include at least one other therapeutic agent in a separate container from the container providing the single-stranded or double-stranded oligonucleotides / siRNA or siRNA conjugates described herein. In some embodiments, the kits may include instructions for mixing the single-stranded or double-stranded oligonucleotides / siRNA or siRNA conjugates with pharmaceutically acceptable carriers and / or excipients or other components (if any).
[0078] In the kit of the present application, the single-stranded or double-stranded oligonucleotides / siRNAs, siRNA conjugates and pharmaceutically acceptable carriers and / or excipients, and / or pharmaceutical compositions and / or pharmaceutically acceptable carriers and / or excipients can be provided in any form, for example, liquid, dry, or lyophilized form. In some embodiments, the single-stranded or double-stranded oligonucleotides / siRNAs, siRNA conjugates and pharmaceutically acceptable carriers and / or excipients, as well as the pharmaceutical compositions and pharmaceutically acceptable carriers and / or excipients, are substantially pure and / or sterile. In some embodiments, sterile water can be provided in the kit of the present application. .
[0079] The following describes the technical solutions provided by the present invention with reference to specific examples. The following examples are for illustrative purposes only and do not limit the scope of protection of the present invention.
[0080] Example 1: Preparation of Compound SA000001 1.1 Preparation of Intermediate 2 [ka]
[0081] Anhydrous diisopropylamine (16.2 g, 160.0 mmol, 22.6 mL, 2.0 equiv) was dissolved in 350 mL of anhydrous tetrahydrofuran, cooled to -70°C to -78°C, and n-butyllithium solution (2.5 M, 67.1 mL) was added dropwise under nitrogen purging protection (slowly, for at least 10 minutes). The reaction mixture was stirred at -70°C to -78°C for a further 30 minutes. Compound 1 (9.44 g, 79.9 mmol, 9.17 mL, 1.0 equiv) was dissolved in 175 mL of anhydrous tetrahydrofuran, cooled to -70°C to -78°C, and the solution obtained in the previous step was added dropwise under nitrogen purging protection (slowly, for at least 10 minutes). This reaction mixture was stirred at -70°C to -78°C for a further 30 minutes. While maintaining the previous temperature, hexamethylphosphoramide (26.1 g, 146 mmol, 25.6 mL, 1.82 equiv) and benzyl chloromethyl ether (17.5 g, 112 mmol, 15.5 mL, 1.4 equiv) were slowly added dropwise to the reaction mixture (the addition was done slowly, and the addition process took at least 10 minutes). After the addition was complete, the temperature was raised to 0°C and stirring was continued for 3 hours. The disappearance of compound 1 was confirmed by TLC and LC-MS. The reaction was quenched by adding 600 mL of saturated ammonium chloride solution in two stages, the mixture was extracted with 200 mL of methyl tert-butyl ether, the organic phase was collected, the organic phase was washed with saturated brine, the organic phase was dried with anhydrous sodium sulfate, filtered, the filtrate was concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1~1 / 1) to obtain light brown compound 2 (9.69 g, 40.7 mmol, yield 51%).
[0082] 1H NMR (400 MHz, CDCl3): δ 7.46-7.28 (m, 10H), 4.58-4.46 (m, 2H), 4.19-4.08 (m, 1H), 3.82-3.67 (m, 5H), 2.77 (q, J = 6.1 Hz, 1H), 1.24 (d, J = 6.5 Hz, 4H). LC-MS: C 13 H 18 O4, molecular weight 238.1, 239.1 (M+H).
[0083] 1.2 Preparation of Intermediate 3 [ka]
[0084] Compound 2 (14.7 g, 61.7 mmol, 1.0 equiv) was dissolved in 150 mL of dichloromethane and, under nitrogen protection at room temperature, was dissolved with imidazole (16.8 g, 247.0 mmol, 4.0 equiv) and tert-butyldimethyl. Chlorosilane (27.9 g, 185.0 mmol, 22.7 mL, 3.0 equiv) was added. The reaction mixture was stirred at room temperature for 1 hour, and the disappearance of compound 2 was confirmed by TLC and LC-MS. 100 mL of dichloromethane was added to the reaction mixture, and the mixture was washed twice with 400 mL of saturated brine. The organic phase was dried, filtered, and the organic phase was concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1 to 10 / 1) to obtain pale yellow oily compound 3 (12.0 g, 34.0 mmol, yield 55%).
[0085] 1H NMR (400 MHz, CDCl3): δ 7.40-7.25 (m, 5H), 4.52 (d, J = 2.4 Hz, 2H), 4.10 (t, J = 6.3 Hz, 1H), 3.75-3.65 (m, 4H), 3.59 (dd, J = 9.2, 5.3 Hz, 1H), 2.79 (dt, J = 8.4, 5.9 Hz, 1H), 1.17 (d, J = 6.2 Hz, 3H), 0.86 (s, 9H), 0.04 (d, J = 8.6 Hz, 6H). LC-MS: C 19 H 32 O4Si, molecular weight 352.1, 353.2 (M+H).
[0086] 1.3 Preparation of Intermediate 4 [ka]
[0087] Compound 3 (11.1 g, 31.5 mmol, 1.0 equiv) was dissolved in tetrahydrofuran and cooled to -70°C to -60°C. Diisobutylaluminum hydride (1.0 M, 69.3 mL, 2.2 equiv) was added dropwise under nitrogen protection. The mixture was stirred at this temperature for a further 2 hours. The disappearance of compound 3 was confirmed by LC-MS, the temperature was raised to 0°C, 20 mL of ethyl acetate was added, and the reaction was quenched with 100 mL of potassium sodium tartrate solution. The mixture was stirred for a further 30 minutes. The mixture was washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, and then filtered and concentrated to obtain a pale yellow oily compound 4 (9.75 g, 30.0 mmol, 95% yield).
[0088] 11H NMR (400 MHz, CDCl3): δ 7.40 - 7.27 (m, 5H), 4.59 - 4.45 (m, 2H), 4.19 (dd, J = 6.2, 3.7 Hz, 1H), 4.01 (dd, J = 11.3, 4.0 Hz, 1H), 3.78 - 3.60 (m, 3H), 1.78 - 1.68 (m, 1H), 1.29 - 1.21 (m, 3H), 0.95 - 0.87 (m, 9H), 0.12 - 0.02 (m, 6H). LC-MS: C 18 H 32 O3Si, molecular weight 324.1, 325.2 (M+H).
[0089] [[ID=E10]]1.4 Preparation of Intermediate 5
Chemical Structure
[0090] Compound 4 (9.75 g, 30.0 mmol, 1.0 equiv) was dissolved in tetrahydrofuran, cooled to 0 °C, and p-toluenesulfonyl chloride (11.5 g, 60.1 mmol, 2.0 equiv) and methylimidazole (6.17 g, 75.1 mmol, 5.99 mL, 2.5 equiv) were added dropwise under nitrogen protection. After the addition was complete, the temperature was raised to room temperature and stirring was continued for 16 h. The disappearance of Compound 4 was confirmed by LC-MS. 20 mL of ethyl acetate was added to the reaction solution, and the reaction was quenched with 100 mL of potassium sodium tartrate solution under an ice bath, and stirring was continued for an additional 30 min. This mixture was washed with 100 mL of saturated brine and then dried over anhydrous sodium sulfate and filtered and concentrated to obtain a crude product of Compound 5 (13.7 g, 28.6 mmol, yield 95%) as a pale yellow oily substance.
[0091] 1 1H NMR (400 MHz, CDCl3): δ 7.89 - 7.68 (m, 2H), 7.42 - 7.17 (m, 10H), 4.47 - 4.33 (m, 2H), 4.23 (dd, J = 9.6, 5.1 Hz, 1H), 4.13-4.06 (m, 1H), 4.01-3.94 (m, 1H), 3.52-3.34 (m, 2H), 2.43 (s, 3H), 2.02-1.89 (m, 1H), 1.10 (d, J = 6.3 Hz, 3H), 0.81 (s, 8H), 0.04-0.05 (m, 6H). LC-MS: C 25 H 38 O5SSi, molecular weight 478.1, 479.2 (M+H).
[0092] 1.5 Preparation of Intermediate 6 [ka]
[0093] Under nitrogen protection, compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) and 35 mL of acetonitrile were added to a dry reaction flask, and the acetonitrile was evaporated at 35-40°C to remove water from compound 5. Under nitrogen protection, 80 mL of N,N-dimethylformamide, compound 5-1 (9H-purine-6-amine) (4.25 g, 31.5 mmol, 1.1 equiv), and potassium carbonate (3.96 g, 28.6 mmol, 1.0 equiv) were added to another clean, dry reaction flask, and the temperature was raised to 95-100°C and stirred for 30 minutes. At this temperature, a solution of compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) in N,N-dimethylformamide (60 mL) was added dropwise to the reaction mixture, and stirring was continued for 12 hours. The disappearance of compound 5 was confirmed by LC-MS, the reaction mixture was cooled to room temperature, 200 mL of ethyl acetate was added, and this mixed solution was washed sequentially with 200 mL of sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 to 10 / 1) to obtain a pale yellow oily compound 6 (6.2). g, 14.0 mmol, yield 49%) was obtained.
[0094] 1 H NMR(400 MHz, CDCl3): δ 8.37 (s, 1H), 7.75 (s, 1H), 7.39-7.24 (m, 6H), 5.66 (br, s, 2H), 4.47-4.34 (m, 3H), 4.21 (dd, J = 14.1, 8.8 Hz, 1H), 4.07 (dd, J = 6.2, 4.9 Hz, 1H), 3.42-3.34 (m, 2H), 2.10-1.96 (m, 1H), 1.19 (d, J = 6.4 Hz, 3H), 0.90 (s, 9H), 0.06 (d, J = 6.0Hz, 6H). LC-MS: C 23 H 35 N5O2Si, molecular weight 441.1, 442.3 (M+H).
[0095] 1.6 Preparation of Intermediate 7 [ka]
[0096] Palladium carbon (3.0 g, 10% purity) was dissolved in 25 mL of methanol at room temperature, and 25 mL of methanol solution of compound 6 (5.2 g, 11.8 mmol, 1.0 equiv) and trifluoroacetic acid (134.0 mg, 1.18 mmol, 87.2 μL) were added. The reaction mixture was stirred under a hydrogen pressure of 50 psi for 48 hours. The disappearance of compound 6 was confirmed by LC-MS. The reaction mixture was filtered and concentrated to obtain the crude product, a pale yellow oily compound 7 (3.9 g, 11.1 mmol).
[0097] 1H NMR (400 MHz, CDCl3): δ 8.21 (s, 1H), 8.12 (s, 1H), 4.50-4.36 (m, 1H), 4.33-4.22 (m, 1H), 4.15-4.02 (m, 1H), 3.53 (d, J = 5.9 Hz, 2H), 2.21-2.09 (m, 1H), 1.25 (d, J = 6.4 Hz, 3H), 0.88 (s, 9H), 0.05 (d, J= 3.1 Hz, 6H). LC-MS: C 16 H 29 N5O2Si, molecular weight 351.1, 352.2 (M+1).
[0098] 1.7 Preparation of Intermediate 8 [ka]
[0099] Compound 7 (3.9 g, 11.1 mmol, 1.0 equiv) was placed in a clean, dry reaction flask, 10 mL of pyridine was added under nitrogen protection, and the temperature was raised until the pyridine evaporated off. This procedure was repeated once more to remove water from compound 7. 28 mL of pyridine was added, and trimethylchlorosilane (4.8 g, 44.4 mmol, 5.63 mL, 4.0 equiv) was added under an ice bath. The temperature was raised to room temperature, and stirring was continued for 2 hours. The disappearance of compound 7 was confirmed by TLC. Benzoyl chloride (6.2 g, 44.4 mmol, 5.15 mL, 4.0 equiv) was added under an ice bath, and stirring was continued for 2 hours. The disappearance of the starting material was confirmed by TLC. mL of water and 90 mL of concentrated ammonia water were added dropwise, and stirring was continued for 30 minutes. The reaction mixture was extracted with 250 mL of ethyl acetate, the organic phase was washed with saturated brine, dried, filtered by suction, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (elution system: dichloromethane / methanol = 50 / 1 to 10 / 1) to obtain pale yellow oily compound 8 (4.0 g, 8.78 mmol, yield 79%).
[0100] 1H NMR (400 MHz, CDCl3): δ 9.22-8.90 (m, 1H), 8.79 (s, 1H), 8.07-8.04 (m, 2H), 8.03 (d, J = 1.4 Hz, 1H), 7.65-7.59 (m, 1H), 7.57-7.50 (m, 2H), 4.62-4.50 (m, 1H), 4.42 (dd, J = 14.3, 8.6 Hz, 1H), 4.24-4.09 (m, 1H), 4.05 (d, J = 6.3 Hz, 1H), 3.59-3.48 (m, 1H), 3.47-3.35 (m, 1H), 2.04-1.98 (m, 1H), 1.31 (d, J = 6.3 Hz, 3 H), 0.98-0.84 (m, 9H), 0.11 (d, J = 10.1 Hz, 5H). LC-MS: C 23 H 33 N5O3Si, molecular weight 455.2, 456.3 (M+H).
[0101] 1.8 Modulation of intermediate 9
change
[0102] Compound 8 (4.0 g, 8.78 mmol, 1.0 equiv) was placed in a clean, dry reaction flask, 10 mL of pyridine was added under nitrogen protection, and the temperature was raised until the pyridine evaporated off. This procedure was repeated once more to remove water from compound 8. 28 mL of pyridine was added, and 4,4'-dimethoxytrityl chloride (3.27 g, 9.66 mmol, 1.1 equiv) was added under an ice bath. The temperature was raised to room temperature and stirring was continued for 1 hour. The disappearance of compound 8 was confirmed by TLC. 150 mL of ethyl acetate was added to the reaction mixture, and it was washed with 200 mL of sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, the organic phase was filtered, and the filtrate was concentrated. The resulting crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1 to 0 / 1) to obtain a pale yellow oily compound 9 (5.91 g, 7.8 mmol, yield 88%).
[0103] 1 H NMR (400 MHz, CDCl3): δ 9.07 (br s, 1H), 8.82 (s, 1H), 8.04 (d, J = 7.1 Hz, 2H), 7.80 (s, 1H), 7.65-7.58 (m, 1H), 7.57-7.50 (m, 2H), 7.28-7.13 (m, 9H), 6.81-6.69 (m, 4H), 4.52-4.43 (m, 1H), 4.25 (dd, J = 14.2, 8.6 Hz, 1H), 4.07 (dd, J = 6.3, 4.2 Hz, 1H), 3.76 (d, J = 4.5 Hz, 6H), 3.22 (dd, J = 9.8, 5.4 Hz, 1H), 3.04 (dd, J = 9.8, 6.1 Hz, 1H), 2.34 (dd, J = 8.1, 4.5 Hz, 1H), 1.19 (d, J = 6.3 Hz, 3H), 0.90-0.77 (m, 9H), 0.07-0.09 (m, 6H). LC-MS: C 44 H 51 N5O5Si, molecular weight 757.3, 758.4 (M+H).
[0104] 1.9 Preparation of Intermediate 10 [ka]
[0105] Compound 9 (3.00 g, 3.96 mmol, 1.0 equiv) was dissolved in tetrahydrofuran, and pyridine hydrofluoride (2.26 g, 79.2 mmol, 2.1 mL, 20.0 equiv) and imidazole (10.8 g, 158.0 mmol, 40.0 equiv) were added under nitrogen protection and ice bath. The mixture was heated to room temperature and stirred for 2 hours. The disappearance of compound 9 was confirmed by LC-MS. 50 mL of ethyl acetate was added, washed with 100 mL of sodium bicarbonate solution and 50 mL of saturated saline solution, dried, filtered, and the filtrate was concentrated. The resulting crude product was eluted by silica gel column chromatography (gradient elution: petroleum ether / vinegar). The compound was separated and purified with ethyl acid (10 / 1 to 0 / 1) to obtain pale yellow oily compound 10 (2.44 g, 3.79 mmol, yield 96%).
[0106] 1 H NMR (400 MHz, DMSO-d6): δ 11.16 (br s, 1H), 8.70 (s, 1H), 8.33 (s, 1H), 8.05 (d, J = 7.4 Hz, 2H), 7.69-7.61 (m, 1H), 7.60-7.52 (m, 2H), 7.25-7.12 (m, 5H), 7.05 (t, J = 8.9 Hz, 4H), 6.78 (dd, J = 8.9, 3.1 Hz, 4H), 4.79 (d, J = 4.0 Hz, 1H), 4.51-4.28 (m, 2H), 3.81 (d, J= 4.0 Hz, 1H), 3.70 (s, 6H), 3.10 (dd, J = 9.8, 4.9 Hz, 1H), 2.89 (dd, J= 9.7, 5.1Hz, 1H), 2.37-2.23 (m, 1H), 1.03 (d, J = 6.3 Hz, 3H). LC-MS: C 38 H 37 N5O5, molecular weight 643.2, 644.2 (M+H).
[0107] 1.10 Synthesis of SA000001 [ka]
[0108] Compound 10 (1.5 g, 2.33 mmol, 1.0 equiv) was placed in a clean, dry reaction flask, and 4 mL of acetonitrile was added under nitrogen protection. The temperature was raised to 35-40°C to evaporate and remove the acetonitrile. This procedure was repeated once more to remove water from compound 10. 15 mL of anhydrous dichloromethane was added to the reaction flask at room temperature. Compound 11-1 (1.05 g, 3.5 mmol, 1.11 mL, 1.5 equiv) and 4,5-dicyanoimidazole (358 mg, 3.03 mmol, 1.3 equiv) were then added, and the mixture was stirred at room temperature for 1 hour. The disappearance of compound 10 was confirmed by TLC. 30 mL of dichloromethane was added, washed with sodium bicarbonate solution (50 mL x 2) and saturated saline solution (50 mL), dried the organic phase, filtered, and concentrated the filtrate. The resulting crude product was dissolved in 50 mL of methyl tert-butyl ether, and 100 mL of 1% aqueous sodium hydroxide solution was added. The mixture was stirred for 30 minutes. The organic phase was collected by stratification, washed with saturated saline solution, dried, filtered and concentrated, and the crude product was purified using a C18 reversed-phase column to obtain the pale yellow product SA000001 (1.1 g, 1.3 mmol, yield 56%).
[0109] 1H NMR (400 MHz, CD3CN): δ 9.33 (br s, 1H), 8.61 (br s, 1H), 7.99 (d, J = 11.0 Hz, 3H), 7.67-7.60 (m, 1H), 7.59-7.49 (m, 2H), 7.32-6.99 (m, 9H), 6.75 (td, J = 9.2, 6.5 Hz, 4H), 4.50-4.38 (m, 1H), 4.36-4.13 (m, 2H), 3.72 (dd, J = 4.8, 1.5 Hz, 6H), 3.66-3.45 (m, 3H), 3.25 (td, J = 9.6, 5.4 Hz, 1H), 3.01 (ddd, J = 17.9, 10.0, 5.8 Hz, 1H), 2.62 (t, J = 5.9 Hz, 1H), 2.53 (t, J = 5.9 Hz, 1H), 1.32-1.22 (m, 4H), 1.17–1.05 (m, 12H). 31 P NMR (DMSO-d6, 162 MHz): δ ppm 147.7, 146.8. LC-MS: C 47 H 54 N7O6P, molecular weight 843.3, 844.5 (M+H).
[0110] Example 2 Preparation of compound SA000014 2.1 Synthesis of compound 1-2
change
[0111] Under argon protection at -78°C, a 2.5 M, 355.5 mL, 2.1 equiv solution of butyllithium in tetrahydrofuran was slowly added dropwise to a 1.85 L solution of DIEA (85.7 g, 846.5 mmol, 119.6 mL, 2.0 equiv) in tetrahydrofuran. After the addition was complete, stirring was continued at -78°C for 1 hour. Then, a 910.0 mL solution of compound 1-1 (commercially available, purchased from Adamas) (50.0 g, 423.3 mmol, 48.6 mL, 1.0 equiv) in tetrahydrofuran was slowly added dropwise to the reaction mixture, and stirring was continued for another 1 hour. Subsequently, HMPA (128.0 g, 714.3 mmol, 125.0 mL, 1.69 equiv) and benzyl chloromethyl ether (92.8 g, 592.6 mmol, 81.8 mL, 1.4 equiv) were slowly added dropwise to the reaction mixture. The reaction mixture was then slowly heated to 0°C and stirred for 3 hours. After the reaction was complete, the reaction mixture was extracted three times with ethyl acetate, the organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 30:1~19:1) to obtain yellow oily compounds 1-2 (54.0 g, reaction yield 54%).
[0112] Compounds 1-2 1 H NMR data: (400 MHz, CDCl3) δ7.37-7.27 (m, 5H), 4.53-4.52 (m, 2H), 4.14 (s, 1H), 3.77-3.72 (m, 6H), 2.78-2.74 (m, 1H), 1.24-1.23 (d, J = 6.4Hz, 4H). Mass spectrometry identification of compound 1-2 (C 13 H 18 O4, molecular weight 238.1, [M+H] = 239.2).
[0113] 2.2 Synthesis of Compounds 1-3 [ka]
[0114] Under room temperature conditions, compound 1-2 (51.0 g, 214.0 mmol) was dissolved in dichloromethane (510.0 mL). Then, imidazole (36.4 g, 535.1 mmol, 2.5 equiv) and tert-butyldimethylchlorosilane (48.4 g, 321.0 mmol, 39.5 mL, 1.5 equiv) were slowly added to the reaction mixture, and stirring was continued for 4 hours. After the reaction was complete, the reaction mixture was extracted three times with saturated sodium bicarbonate solution and dichloromethane. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 150:1~120:1) to obtain colorless oily compound 1-3 (61.9 g, reaction yield 82%).
[0115] Compounds 1-3 1 H NMR data: (400 MHz, CDCl3) δ7.34-7.27 (m, 5H), 4.55-4.48 (m, 2H), 4.13-4.07 (m, 1H), 3.72-3.67 (m, 4H), 3.60-3.57 (m, 1H), 2.80-2.77 (m, 1H), 1.17-1.59 (d, J = 6.0 Hz, 4H), 0.86 (s, 9H), 0.05-0.03 (d, J = 8.8 Hz, 6H). Mass spectrometry identification of compounds 1-3 (C 19 H 32 O4Si, molecular weight 352.1, [M+H] = 353.2).
[0116] 2.3 Synthesis of Compounds 1-4 [ka]
[0117] Compounds 1-3 (60.0 g, 170.2 mmol) were dissolved in tetrahydrofuran (600.0 mL) under -78°C conditions. Then, diisobutylaluminum hydride (1.0 M, 425.5 mL, 2.50 equiv) was slowly added to the reaction mixture, and stirring was continued for 2 hours under -78°C conditions. After the reaction was complete, the reaction mixture was extracted three times with saturated ammonium chloride solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 50:1~20:1) to obtain colorless oily compound 1-4 (21.5 g, reaction yield 39%).
[0118] Compounds 1-4 1 H NMR data: (400 MHz, CDCl3) δ7.28-7.19 (m, 5H), 4.46-4.44 (m, 2H), 4.13-4.10 (m, 1H), 3.95-3.91 (m, 1H), 3.67-3.55 (m, 3H), 3.03-3.01 (m, 1H), 1.70-1.63 (m, 1H), 1.17-1.09 (m, 3H), 0.83-0.78 (m, 9H), 0.02 (d, J = 5.2 Hz, 6H). Mass spectrometry identification of compounds 1-4 (C 18 H 32 O3Si, molecular weight 324.1, [M+H] = 325.2).
[0119] 2.4 Synthesis of Compounds 1-5 [ka]
[0120] Under room temperature and nitrogen conditions, compounds 1-4 (5.5 g, 16.9 mmol), 2-amino-6-chloropurine (4.3 g, 25.4 mmol, 1.5 equiv), and triphenylphosphine (6.8 g, 25.9 mmol, 1.53 equiv) were dissolved in tetrahydrofuran (93.0 mL). Then, under ice water conditions, diisopropyl azodicarboxylate (5.4 g, 26.6 mmol, 5.16 mL, 1.57 equiv) was slowly added to the reaction mixture. After the addition was complete, the reaction mixture was stirred for a further 5 hours under room temperature conditions. After the reaction was complete, the reaction mixture was extracted three times with saturated ammonium chloride solution and ethyl acetate, and the organic phases were combined and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1~3:1) to obtain yellow oily compound 1-5 (7.6 g, reaction yield 95%).
[0121] Compounds 1-5 1 H NMR data: (400 MHz, CDCl3) δ 7.51 (s, 1H), 7.16-7.08 (m, 5H), 4.99 (s, 2H), 4.83-4.77 (m, 7H), 4.26-4.12 (m, 2H), 3.97-3.85 (m, 3H), 3.67-3.55 (m, 3H), 3.23-3.09 (m, 2H), 2.05-2.00 (m, 1H), 1.87 (s, 2H), 1.09 (d, J = 6.4 Hz, 19H), 1.01 (d, J = 6.4 Hz, 3H), 0.74-0.70 (m, 9H), 0.01 (d, J = 14.0 Hz, 6H). Mass spectrometry identification of compounds 1-5 (C 23 H 34 ClN5O2Si, molecular weight 475.1, [M+H] = 476.2).
[0122] 2.5 Synthesis of Compounds 1-6 [ka]
[0123] Under room temperature conditions, compound 1-5 (11.0 g, 23.1 mmol) was dissolved in pyridine (110.0 mL), and isobutyryl chloride (3.69 g, 34.66 mmol, 3.63 mL, 1.5 equiv) was slowly added to the reaction mixture. The reaction mixture was then stirred for a further 3 hours under room temperature conditions. After the reaction was complete, the pyridine solvent was removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the crude product, a light brown oily compound 1-6 (22.0 g), was used directly in the next reaction.
[0124] Mass spectrometry identification of compounds 1-6 (C 27 H 40 ClN5O3Si, molecular weight 545.1, [M+H] = 546.3).
[0125] 2.6 Synthesis of Compounds 1-7 [ka]
[0126] Under room temperature conditions, compound 1-6 (10.0 g, 18.3 mmol) was dissolved in trifluoroacetic acid (111.1 mL) and water (35.0 mL), and the reaction mixture was stirred at 35°C for 12 hours. After the reaction was complete, water and trifluoroacetic acid were removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol 100:1~25:1) to obtain white solid compound 1-7 (4.8 g, reaction yield 27%).
[0127] Compounds 1-7 1H NMR data: (400 MHz, CDCl3) δ 12.0 (s, 1H), 11.6 (s, 1H), 7.91 (s, 1H), 7.28-7.18 (m, 5H), 4.80 (d, J = 4.40 Hz, 1H), 4.35-4.23 (m, 3H), 4.15-4.09 (m, 1H), 3.77-3.73 (m, 1H), 3.32-3.27 (m, 2H), 3.23-3.09 (m, 2H), 2.83-2.76 (m, 1H), 2.18-2.15(m, 1H), 1.13-1.10 (m, 9H). Mass spectrometry identification of compounds 1-7 (C 21 H 27 N5O4, molecular weight 413.1, [M+H] = 414.2).
[0128] 2.7 Synthesis of Compounds 1-8 [ka]
[0129] Compounds 1-7 (4.3 g, 10.4 mmol) were dissolved in methanol (43.0 mL) at room temperature under hydrogen (50 psi) conditions. Trifluoroacetic acid (592.9 mg, 5.2 mmol, 0.38 mL, 0.5 equiv) and palladium-carbon (2.69 g, 2.53 mmol, 2.43 equiv) were added to the reaction system, respectively. The reaction mixture was then stirred at 30°C for 16 hours. After the reaction was complete, the palladium-carbon was removed by filtration, and the remaining system was distilled under reduced pressure to obtain the crude product, white solid compound 1-8 (3.0 g, reaction yield 87%).
[0130] Compounds 1-8 1H NMR data: (400 MHz, DMSO-d6) δ 12.1 (s, 1H), 11.6 (s, 1H), 7.95 (s, 1H), 4.26-4.05 (m, 2H), 3.74-3.71 (m, 1H), 3.29 (d, J = 4.8 Hz, 2H), 2.82-2.75 (m, 1H), 1.94-1.90 (m, 1H), 1.13-1.10 (m, 9H). Mass spectrometry identification of compounds 1-8 (C 14 H 21 N5O4, molecular weight 323.1, [M+H] = 324.2).
[0131] 2.8 Synthesis of Compounds 1-9 [ka]
[0132] Compound 1-8 (3.0 g, 9.28 mmol) was dissolved in pyridine (30.0 mL) under room temperature conditions, and 4,4'-dimethoxytrityl chloride (3.46 g, 10.2 mmol, 1.1 equiv) was added to the reaction system under ice water bath conditions. The reaction mixture was then stirred at 15°C for 2 hours. After the reaction was complete, the solvent pyridine was removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 3:1~0:1) to obtain white solid compound 1-9 (3.5 g, reaction yield 59%).
[0133] Compounds 1-9 1H NMR data: (400 MHz, DMSO-d6) δ 12.0 (s, 1H), 11.5 (s, 1H), 7.87 (s, 1H), 7.22-7.14 (m, 5H), 7.04 (t, J = 8.8 Hz, 4H), 6.78-6.74 (m, 4H), 4.75 (d, J = 3.6 Hz, 1H), 4.25-4.21 (m, 1H), 4.09-4.01 (m, 1H), 3.71 (d, J= 1.2 Hz, 1H), 3.07-3.04 (m, 1H), 2.24-2.22 (m, 1H), 1.13-1.06 (m, 9H). Mass spectrometry identification of compounds 1-9 (C 35 H 39 N5O6, molecular weight 625.1, [M+H] = 626.4).
[0134] 2.9 Synthesis of compound SA000014 [ka]
[0135] Compounds 1-9 (3.0 g, 4.79 mmol) were dissolved in dry acetonitrile (4.0 mL) at room temperature under nitrogen conditions, and the acetonitrile was removed by vacuum distillation. This process was repeated three times. The remaining system was dissolved in dichloromethane (30.0 mL), and 4,5-dicyanoimidazole (736.1 mg, 6.23 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.17 g, 7.19 mmol, 2.28 mL, 1.5 equiv) were added to the reaction system, respectively. The reaction mixture was then stirred at 15°C for 1 hour. After the reaction was complete, the reaction mixture was dissolved in dichloromethane (12.0 mL) and 1% sodium hydroxide solution (40.0 mL), and stirred for a further 0.5 hours at 15°C. The crude reaction product was purified using a C18 reversed-phase column to obtain the white solid compound SA000014 (2.2 g, reaction yield 53%).
[0136] Compound SA000014 1H NMR data: (400 MHz, CD3CN) δ11.86 (s, 1H), 9.58 (s, 1H), 7.58-7.54 (m, 1H), 7.29-7.15 (m, 9H), 6.76 (s, 4H), 4.24-4.05 (m, 3H), 3.73-3.52 (m, 10H), 3.24-3.22 (m, 1H), 3.02-2.94 (m, 1H), 2.86-2.72 (m, 4H), 1.25-1.03 (m, 23H). 31 P NMR data: (400 MHz, CD3CN) δ 147.6, 146.8. Mass spectrometry identification of compound SA000014 (C 44 H 56 N7O7P, molecular weight 825.1, [M+H] = 826.5).
[0137] Example 3: Preparation of compound SA000015 3.1 Synthesis of Compound C-1 [ka]
[0138] Under room temperature conditions, compound 3-2 (8.5 g, 20.3 mmol, prepared in Example 5) and 1,2,4-triazole (19.5 g, 282.0 mmol, 13.9 equiv) were dissolved in pyridine (128.0 mL). Then, under ice water bath conditions, 4-chlorophenyl dichlorophosphate (56.9 mmol, 9.25 mL, 2.8 equiv) was added dropwise to the reaction system. The reaction mixture was stirred at 30°C for 16 hours. After the reaction was complete, the solvent pyridine was removed by vacuum distillation, and the remaining system was extracted three times with water and ethyl acetate. The organic phases were combined and concentrated to obtain a yellow, oily crude product compound C-1 (9.5 g), which was used directly in the next reaction. Mass spectrometry identification of compound C-1 (C 24 H 35 N5O3Si, molecular weight 469.1, [M+H] = 470.3).
[0139] 3.2 Synthesis of Compound C-2 [ka]
[0140] Under room temperature conditions, compound C-1 (9.5 g, 20.2 mmol) was dissolved in 1,4-dioxane (95.0 mL), and then aqueous ammonia (1.38 mol, 212.1 mL, 25% purity, 68.0 equiv) was added to the reaction system. The reaction mixture was then prepared in 30 ml. o The mixture was stirred for 16 hours under C conditions. After the reaction was complete, the solvent was removed by vacuum distillation, and the remaining system was extracted three times with water and dichloromethane. The organic phases were combined and concentrated to obtain a yellow solid crude product compound C-2 (8.5 g), which was used directly in the next reaction.
[0141] Mass spectrometry identification of compound C-2 (C 22 H 35 N3O3Si, molecular weight 417.1, [M+H] = 418.2).
[0142] 3.3 Synthesis of Compound C-3 [ka]
[0143] Under room temperature conditions, compound C-2 (8.5 g, 20.2 mmol) was dissolved in N,N-dimethylformamide (85.0 mL), and then acetic anhydride (3.1 g, 30.4 mmol, 2.85 mL, 1.5 equiv) was slowly added to the reaction system. The reaction mixture was stirred at 30°C for 3 hours. After the reaction was complete, the solvent was removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol 1:0 to 100:1) to obtain the yellow solid compound C-3 (4.2 g, reaction yield 43%).
[0144] Compound C-3 1H NMR data: (400 MHz, DMSO-d6) δ 10.7 (s, 1H), 7.79 (d, J = 7.2 Hz, 1H), 7.29 (m, 5H), 7.08 (d, J = 7.2 Hz, 1H), 4.36 (d, J = 1.2 Hz, 2H), 4.05-3.99 (m, 2H), 3.72-3.67 (m, 1H), 3.39 (dd, J = 6.4 Hz, 2H), 2.15-2.08 (m, 1H), 2.08 (s, 3H), 1.15 (d, J = 6.4 Hz, 3H), 0.85 (s, 9H), 0.02 (d, J = 6.8 Hz, 6H). Mass spectrometry identification of compound C-3 (C 24 H 37 N3O4Si, molecular weight 459.1, [M+H] = 460.2).
[0145] 3.4 Synthesis of Compound C-4 [ka]
[0146] Compound C-3 (4.3 g, 9.35 mmol) was dissolved in dichloromethane (46.0 mL) under conditions of -78°C, and then boron trichloride (1.0 M DCM solution, 46.8 mL, 5.0 equiv) was slowly added to the reaction system. The reaction mixture was then stirred under conditions of -78°C for 4 hours. After the reaction was complete, the reaction was quenched with triethylamine (40.0 mL) and methanol (88.0 mL), the remaining system was extracted three times with water and dichloromethane, the organic phases were combined and concentrated, and the resulting crude product was purified by C18 reversed-phase column chromatography to obtain the white solid compound C-4 (0.96 g, reaction yield 40%).
[0147] Compound C-4 1H NMR data: (400 MHz, DMSO-d6) δ 10.7 (s, 1H), 8.01 (d, J = 7.2 Hz, 1H), 7.12 (d, J = 7.2 Hz, 1H), 4.60 (d, J = 4.8 Hz, 2H), 4.53-4.50 (m, 1H), 4.00-3.99 (m, 1H), 3.75-3.70 (m, 2H), 3.37-3.32 (m, 2H), 2.08 (s, 3H), 1.81-1.77 (m, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound C-4 (C 11 H 17 N3O4, molecular weight 255.1, [M+H] = 256.2).
[0148] 3.5 Synthesis of Compound C-5 [ka]
[0149] Compound C-4 (1.5 g, 5.88 mmol) was dissolved in pyridine (10.0 mL) under room temperature conditions, and 4,4'-dimethoxytrityl chloride (2.4 g, 7.05 mmol, 1.2 equiv) was added to the reaction system under ice water bath conditions. The reaction mixture was then stirred at room temperature for 4 hours. After the reaction was complete, the solvent pyridine was removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain white solid compound C-5 (0.7 g, reaction yield 70%).
[0150] Compound C-5 1H NMR data: (400 MHz, CDCl3) δ 9.71 (s, 1H), 7.39 (d, J = 7.3 Hz, 3H), 7.35-7.21 (m, 7H), 7.06 (d, J= 7.1 Hz, 1H), 6.85 (d, J = 8.8 Hz, 4H), 4.71 (d, J = 3.3 Hz, 1H), 4.43 (dd, J = 13.8, 4.5 Hz, 1H), 4.23-3.99 (m, 2H), 3.80 (s, 6H), 3.50-3.38 (m, 1H), 3.31 (dd, J = 10.0, 4.1 Hz, 1H), 2.69 (t, J = 9.4 Hz, 1H), 2.21 (s, 3H), 1.08 (d, J = 6.1 Hz, 3H). Mass spectrometry identification of compound C-5 (C 32 H 35 N3O6, molecular weight 557.1, [M+H] = 558.4).
[0151] 3.6 Synthesis of compound SA000015 [ka]
[0152] Compound C-5 (2.0 g, 3.59 mmol) was dissolved in dichloromethane (20.0 mL) at room temperature under nitrogen conditions, and 4,5-dicyanoimidazole (466.0 mg, 3.95 mmol, 1.1 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.4 g, 4.66 mmol, 1.48 mmol) were added to the reaction system. (mL, 1.3 equiv) was added. The reaction mixture was then stirred at room temperature for 2 hours. After the reaction was complete, the reaction mixture was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and stirred for a further 0.5 hours at room temperature. The remaining system was extracted three times with saturated sodium bicarbonate solution and dichloromethane, the organic phases were combined and concentrated, and the resulting crude product was purified by C18 reversed-phase column chromatography to obtain the white solid compound SA000015 (1.5 g, reaction yield 55%).
[0153] Compound SA000015 1 H NMR data: (400 MHz, CD3CN) δ 9.15 (s, 1H), 7.50-7.18 (m, 11H), 6.84-6.80 (m, 4H), 4.22-4.08 (m, 2H), 3.75-3.22 (m, 11H), 3.23-3.22 (m, 2H), 2.62-2.51 (m, 2H), 2.38-2.35 (m, 1H), 2.12 (s, 3H), 1.022-1.07 (m, 15H). 31 P NMR data: (400 MHz, CD3CN) δ 147.5, 146.7. Mass spectrometry identification of compound SA000015 (C 41 H 52 N5O7P, molecular weight 757.1, [M+H] = 758.5).
[0154] Example 4: Preparation of compound SA000016 4.1 Synthesis of Compound 3-1 [ka]
[0155] Under ice bath conditions, compounds 1-4 (9.99 g, 30.8 mmol), compound U-1 (commercially available, purchased from Shanghai Haohong Biomedical Technology Co., Ltd.) (9.33 g, 43.1 mmol, 1.4 equiv), and triphenylphosphine (16.6 g, 63.2 mmol, 2.0 equiv) were dissolved in dry tetrahydrofuran (350.0 mL), and then diisopropyl azodicarboxylate (13.1 g, 64.7 mmol) was added to the reaction system. 12.6 mL, 2.1 equiv) was added dropwise. Then, the reaction mixture was stirred at room temperature for 2 hours. After the reaction was completed, the reaction mixture was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The combined organic phases were concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate from 10:1 to 8:1) to obtain white solid compound 3-1 (16.1 g, reaction yield 99%). Obtained.
[0156] For compound 3-1 1 1H NMR data: (400 MHz, DMSO-d6) δ 7.89-7.74 (m, 4H), 7.56-7.53 (m, 2H), 7.33-7.29 (m, 5H), 5.80-5.73 (m, 1H), 4.46-4.38 (m, 2H), 4.00-3.91 (m, 2H), 3.60-3.50 (m, 1H), 3.49-3.43 (m, 2H) 2.17-1.98 (m, 1H), 1.13 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H). Mass spectrometry identification of compound 3-1 (C 29 H 38 N2O5Si, molecular weight 522.1, [M+H] = 523.2).
[0157] 4.2 Synthesis of compound 3-2
Chemical formula
[0158] Compound 3-1 (8.05 g, 15.4 mmol) was dissolved in methanol (160.0 mL) at room temperature, and then sodium methoxide (2.77 g, 15.4 mmol, 30% purity, 1.0 equiv) was slowly added to the reaction system. The reaction mixture was then stirred at room temperature for 12 hours. After the reaction was complete, the solvent methanol was removed by vacuum distillation, and the remaining system was extracted three times with 1 M hydrochloric acid solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 0:1) to obtain white solid compound 3-2 (6.1 g, reaction yield 94%).
[0159] Compound 3-2 1 H NMR data: (400 MHz, DMSO-d6) δ 11.1 (s, 1H), 7.48 (d, J = 8.0 Hz, 1H), 7.30-7.24 (m, 5H), 5.47-5.44 (m, 1H), 4.45-4.35 (m, 2H), 3.98-3.94 (m, 1H), 3.79-3.78 (m, 1H), 3.63-3.57 (m, 1H), 3.38-3.35 (m, 2H), 2.04-1.95 (m, 1H), 1.10 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H). Mass spectrometry identification of compound 3-2 (C 22 H 34 N2O4Si, molecular weight 418.1, [M+H] = 418.2).
[0160] 4.3 Synthesis of Compound 3-3 [ka]
[0161] Compound 3-2 (4.0 g, 9.56 mmol) was dissolved in dichloromethane (30.0 mL) under conditions of -70°C, and then boron trichloride (1.0 M DCM solution, 66.9 mL, 7.0 equiv) was slowly added to the reaction system. The reaction mixture was then stirred under conditions of -70°C for 3 hours. After the reaction was complete, the reaction was quenched with triethylamine (5.0 mL) and methanol (30.0 mL), the remaining system was extracted three times with water and dichloromethane, the organic phases were combined and concentrated, and the resulting crude product was purified by C18 reversed-phase column chromatography to obtain white solid compound 3-3 (0.7 g, reaction yield 33%).
[0162] Compound 3-3 1 H NMR data: (400 MHz, DMSO-d6) δ 7.54 (d, J = 8.0 Hz, 1H), 5.51 (d, J= 7.6 Hz, 1H), 3.88-3.84 (m, 1H), 3.72-3.70 (m, 1H), 3.61-3.59 (m, 2H), 1.75-1.68 (m, 1H), 1.09 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound 3-3 (C9H 14 N2O4, molecular weight 214.1, [M+H] = 215.2).
[0163] 4.4 Synthesis of Compounds 3-4 [ka]
[0164] Compound 3-1 (0.4 g, 1.87 mmol) was dissolved in pyridine (4.0 mL) under room temperature conditions, and 4,4'-dimethoxytrityl chloride (949.0 mg, 2.8 mmol, 1.5 equiv) was added to the reaction system under ice water bath conditions. The reaction mixture was then stirred at room temperature for 2 hours. After the reaction was complete, the solvent pyridine was removed by vacuum distillation, and the remaining system was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain white solid compound 3-4 (0.7 g, reaction yield 70%).
[0165] Compounds 3-4 1 H NMR data: (400 MHz, DMSO-d6) δ 11.3 (s, 1H), 7.37 (d, J = 8.0 Hz, 1H), 7.33-7.29 (m, 4H), 7.20-7.17 (m, 5H), 6.86-6.83 (m, 4H), 5.40 (d, J = 8.0 Hz, 1H), 4.61 (d, J = 4.8 Hz, 2H), 3.83-3.79 (m, 2H), 3.72 (s, 6H), 3.71-3.68 (m, 1H), 3.08-2.90 (m, 2H), 1.90 (s, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compounds 3-4 (C 30 H 32 N2O6, molecular weight 516.1, [M+H] = 517.4).
[0166] 4.5 Synthesis of Compound SA000016 [ka]
[0167] Under room temperature and nitrogen conditions, compound 3-4 (1.2 g, 2.32 mmol) was dissolved in dichloromethane (12.0 mL), and 4,5-dicyanoimidazole (357.0 mg, 3.02 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.05 g, 3.48 mmol, 1.5 equiv) were added to the reaction system respectively. Then, the reaction solution was stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and further stirred at room temperature for 0.5 hours. The remaining system was extracted 3 times with ethyl acetate, the organic phases were combined and concentrated, and the obtained crude product was purified by a C18 reverse-phase column to obtain white solid compound SA000016 (1.2 g, reaction yield 71%).
[0168] For compound SA000016 1 1H NMR data: (400 MHz, CD3CN) δ 9.39 (s, 1H), 7.39 - 7.24 (m, 10H), 6.85 - 6.81 (m, 4H), 5.43 - 5.39 (m, 1H), 4.21 - 4.18 (m, 1H), 3.86 - 3.77 (m, 1H), 3.75 (s, 6H), 3.56 - 3.53 (m, 5H), 3.28 - 3.05 (m, 2H), 2.62 - 2.61 (m, 2H), 2.22 - 2.19 (m, 2H), 1.22 - 1.07 (m, 15H). 31 31P NMR data: (400 MHz, CD3CN) δ147.6, 146.5. Mass spectrometry identification of compound SA000016 (C 39 H 49 N4O7P, molecular weight 716.1, [M + H] = 717.5).
[0169] Synthesis of 4.6 Tgo monomer
Chemical formula
[0170] White solid Tgo (4.8 g, 6.6 mmol, 74% yield) was prepared according to the synthesis method for Ugo in Example. Molecular formula of compound Tgo: C 40 H 51 O7N4P, molecular weight: 730.3, 753.4 (M+Na) detected by LC-MS. 1 H NMR (400 MHz, DMSO-d6): δ 11.75 (d, J = 215.2 Hz, 1H), 7.90 (d, J= 4.6 Hz, 1H), 7.23 - 7.22 (m, 4H), 7.20 - 7.14 (m, 1H), 7.09 (td, J = 7.1, 3.5 Hz, 4H), 7.23 - 7.22 (m, 4H), 4.23 (dd, J = 13.9, 5.2 Hz, 1H), 4.14 - 3.99 (m, 2H), 3.71 (s, 6H), 3.59 - 3.53 (m, 1H), 3.51 - 3.43 (m, 2H), 3.13 (td, J = 9.4, 5.5 Hz, 1H), 3.05 - 2.93 (m, 1H), 2.82 (dt, J = 13.5, 6.8 Hz, 1H), 2.73 (t, J = 5.9 Hz, 1H), 2.65 (t, J = 5.8 Hz, 1H), 1.26 - 0.98 (m, 19H). 31 P NMR (162 MHz, DMSO-d6): δ 147.0, 146.6.
[0171] Example 5 Preparation of compound SA000068(Ggs) 5.1 Preparation of Intermediate 1-2 [ka]
[0172] Compound 1-1 (45.7 mmol, 10.9 g) was placed in a clean and dry reaction flask, 110 mL of methanol was added, and palladium carbon (wet, 10% Pd / C) (22%wt, 2.4 g) was added under hydrogen at room temperature. Then, stirring was continued at room temperature for 16 hours. After the reaction, it was filtered to remove palladium carbon, and the filtrate was concentrated to obtain the crude product, an oily compound 1-2 (6.8 g, 45.7 mmol, 100% yield), which was directly used in the next reaction without purification. Molecular formula of compound 1-2: C6H 12 O4, molecular weight: 148.07, LC-MS measured value: 149.2 (M+H).
[0173] Preparation of Intermediate 1-3
Chemical Structure
[0174] Compound 1-2 (45.7 mmol, 6.8 g) was placed in a clean and dry reaction flask, 70 mL of acetonitrile and imidazole (6.0 equiv, 274.2 mmol, 18.6 g) were added, and TBSCl (3.0 equiv, 137.1 mmol, 20.6 g) was slowly added in several portions under an ice-water bath. Then, stirring was continued at room temperature for 16 hours. After the reaction, it was concentrated to remove most of the solvent, 200 mL of ethyl acetate was added to dissolve it, washed with 200 mL of water, dried, and the concentrated crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0 - 100 / 5) to obtain a pale yellow oily compound 1-3 (15.8 g, 41.9 mmol, yield). Molecular formula of compound 1-3: C 18 H 40 O4Si2, molecular weight: 376.25, LC-MS measured value: 377.3 (M+H).
[0175] Preparation of Intermediate 1-4
Chemical Structure
[0176] Under argon protection, compounds 1-3 (41.9 mmol, 15.8 g) were placed in a clean, dry reaction flask, dissolved in 158 mL of tetrahydrofuran, cooled to -78°C, and DIBAL-H (2.2 equiv, 92.3 mmol, 92.3 mL) was added dropwise while controlling the temperature to below -60°C. The reaction was continued at a controlled temperature of -70°C to -60°C until completion. The reaction was quenched by adding saturated ammonium chloride dropwise, 100 mL of ethyl acetate and 200 mL of potassium sodium tartrate solution were added, and the mixture was stirred for 30 minutes. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0 - 50 / 50) to obtain pale yellow oily compound 1-4 (13.1 g, 37.4 mmol, 89% yield). Molecular formulas of compounds 1-4: C 17 H 40 O3Si2, Molecular weight: 348.25, LC-MS measured value: 349.3 (M+H).
[0177] 5.4 Preparation of Intermediates 1-5 [ka]
[0178] Compound 1-4 (37.3 mmol, 13.0 g) was placed in a clean, dry reaction flask, 130 mL of tetrahydrofuran was added, and the purine intermediate (1.1 equiv, 41.0 mmol, 22.6 g) and triphenylphosphine (1.5 equiv, 55.9 mmol, 11.3 g) were added at room temperature. The mixture was cooled to below 0°C, and DIPAD (1.5 equiv, 55.9 mmol, 14.7 g) was added dropwise. The mixture was then stirred at room temperature for 2 hours. After the reaction, the reaction mixture was concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0 - 30 / 70) to obtain pale yellow oily compound 1-5 (32.3 g, 36.6 mmol, 98% yield). Molecular formulas of compounds 1-5: C 42 H 76 N6O 10 Si2, Molecular weight: 880.52, LC-MS measured value: 881.7 (M+H).
[0179] 5.5 Preparation of Intermediate 1-6 [ka]
[0180] Compounds 1-5 (25.0 mmol, 22.0 g) were placed in a clean, dry reaction flask, and 66 mL of trifluoroacetic acid and 22 mL of water were added. The mixture was stirred at room temperature for 2 hours. The mixture was concentrated to remove the solvent, and 30 mL of acetonitrile and 30 mL of water were added. The mixture was stirred for 2 hours, filtered, and dried to obtain the target product 1-6, a white solid (6.3 g, 17.2 mmol, 69% yield). Molecular formula of compound 1-6: C 10 H 16 N6O2, Molecular weight: 252.13, LC-MS measured value: 253.2 (M+H).
[0181] 5.6 Preparation of Intermediates 1-7 [ka]
[0182] Compound 1-6 (17.2 mmol, 6.3 g) is dissolved in 120 mL of water, heated to 50°C, and 30 mL of aqueous solution of sodium nitrite (3.0 equiv, 51.6 mmol, 3.56 g) is added dropwise to the mixture, followed by acetic acid (7.0 Equiv (120.4 mmol, 7.2 g) was added dropwise, and the mixture was stirred for 10 minutes while maintaining the temperature. After cooling, aqueous ammonia was added dropwise to adjust the pH to 8. The mixture was concentrated, and the resulting crude product was purified by C18 reverse-phase column chromatography to obtain white solids 1-7 (4.2 g, 16.6 mmol, 66% yield). Molecular formulas of compounds 1-7: C 10 H 15 N5O3, molecular weight: 253.12, LC-MS actual value: 254.2 (M+H).
[0183] 5.7 Preparation of Intermediates 1-8 [ka]
[0184] Compound 1-7 (25.3 mmol, 6.4 g) was placed in a clean, dry reaction flask, and 128 mL of methanol and N,N-dimethylformamide dimethylacetal (3.0 equiv, 75.9 mmol, 9.1 g) were added. The mixture was stirred overnight at room temperature. After the reaction, the mixture was directly concentrated to obtain a grayish-white powder 1-8 (7.6 g, 24.6 mmol, 98% yield), which was added directly to the next reaction without purification. Molecular formulas of compounds 1-8: C 13 H 20 N6O3, Molecular weight: 308.16, LC-MS measured value: 309.2 (M+H).
[0185] 5.8 Preparation of Intermediates 1-9 [ka]
[0186] Compound 1-8 (24.6 mmol, 7.6 g) was placed in a clean, dry reaction flask, and 260 mL of pyridine and N,N-diisopropylethylamine (1.5 equiv, 37.1 mmol, 4.8 g) were added. Diphenylcarbamoyl chloride (1.5 equiv, 37.1 mmol, 8.57 g) was added under ice bath conditions, and the mixture was stirred at room temperature for 1 hour. After the reaction, the reaction was quenched by adding 100 mL of saturated sodium bicarbonate solution dropwise, extracted with dichloromethane, dried over anhydrous sodium sulfate, concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0 - 90 / 10) to obtain a nearly white solid compound 1-9 (8.6 g, 17.1 mmol, A yield of 69% was obtained. Molecular formulas of compounds 1-9: C 26 H 29 N7O4, Molecular weight: 503.23, LC-MS measured value: 504.3 (M+H).
[0187] 5.9 Preparation of Intermediates 1-10 [ka]
[0188] 1-9 (17.1 mmol, 8.6 g) was placed in a clean, dry reaction flask, 86 mL of pyridine was added, and 4,4'-dimethoxytrityl chloride (1.3 equiv, 22.2 mmol, 7.5 g) was added at room temperature. The mixture was then stirred for 1 hour at room temperature. After the reaction, the mixture was concentrated to remove most of the solvent, 100 mL of ethyl acetate was added, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0 - 90 / 10) to obtain a pale yellow solid 1-10 (7.1 g, 8.8 mmol, 52% yield). Molecular formulas of compounds 1-10: C 47 H 47N7O6, Molecular weight: 805.36, LC-MS measured value: 806.5 (M+H).
[0189] 5.10 Preparation of compound SA000068(Ggs) [ka]
[0190] 1-10 (1.24 mmol, 1.0 g) was placed in a clean, dry reaction flask, and 10 mL of anhydrous dichloromethane was added. At room temperature under argon protection, the compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphodiamidite (2.0 equiv, 2.48 mmol, 0.75 g) and 4,5-dicyanoimidazole (1.5 equiv, 1.86 mmol, 0.22 g) were added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 10 mL of dichloromethane was added to the reaction mixture, washed with 20 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered, and concentrated. The resulting crude product was purified by C18 reverse-phase column chromatography to obtain the white solid SA000068 (0.8 g, 0.8 mmol, 64% yield).
[0191] Molecular formula of compound SA000068: C 56 H 64 N9O7P, Molecular weight: 1005.47, LC-MS measured value: 1006.7 (M+H). 1 H NMR (400 MHz, DMSO) δ 8.89 (s, 1H), 8.09 (s, 1H), 7.39 (dd, J = 8.8, 4.5 Hz, 8H), 7.32 - 7.21 (m, 4H), 7.21 - 7.11 (m, 3H), 7.08 (ddd, J = 8.6, 3.8, 2.2 Hz, 4H), 6.78 - 6.70 (m, 4H), 4.45 - 3.98 (m, 4H), 3.68 - 3.43 (m, 4H), 3.21 (s, 3H), 3.14 (s, 3H), 2.91 (ddd, J= 21.9, 9.6, 5.5 Hz, 1H), 2.70 (t, J = 5.9 Hz, 1H), 2.59 (ddd, J= 11.4, 8.6, 4.4 Hz, 2H), 1.36 - 1.27 (m, 1H), 1.20 (dd, J = 14.0, 6.4 Hz, 3H), 1.10 (d, J = 6.8 Hz, 6H), 1.02 (d, J = 6.7 Hz, 3H), 0.95 (d, J= 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO) δ 147.06, 146.09.
[0192] Example 6 Preparation of siRNA conjugates Using a solid-phase phosphoramidite method, nucleoside monomers were sequentially bonded in the 3'-5' direction in nucleotide sequence order using the specially modified compounds prepared in the above process and commercially purchased conventionally modified monomers (purchased from Shanghai Zhaowei Technology Development Co., Ltd.). Of these, the specially modified anti-off-target compound was placed in the seed region of the antisense strand (any position between 4 and 8 from the 5' end), and the bonding of each nucleoside monomer involved four reaction steps: deprotection, coupling, capping, oxidation, or thiolation. The same synthetic conditions were used for both the sense strand and the antisense strand.
[0193] Instrument model: MerMade 12 Oligonucleotide synthesizer solid-phase synthesis system, Beijing Haijing 1ml synthesis column, Cytiva Source TM 15Q 4.6 / 100PE purification column. The reagents used for synthesizing the siRNA conjugates were purchased from Suzhou Kerema.
[0194] The synthesis process is outlined below. The single-chain synthesis reaction process extends in the 3'-5' direction and is completed on a solid-phase synthesizer. It involves four main reaction steps. a. Deprotection reaction: The protecting group DMT on the nucleotide is deprotected using dichloroacetic acid to obtain the 5'-hydroxy terminus. b. Coupling reaction: Protected nucleotide phosphoramidite monomers are mixed with the activator ethylthiotetrazole, activating the phosphoramidite group and forming a 5'-nucleotide molecule. The droxy remains protected by DMT and undergoes a condensation reaction with the 5'-hydroxyl group bound to the solid support to produce phosphite triester. c. Oxidation reaction: Under the action of iodine, an oxidizing agent, the triester phosphite obtained in the previous coupling reaction is converted to a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus). d. Thiomination reaction: Under the action of the thiolation reagent PADS, the phosphite triester obtained in the previous coupling reaction is converted to a phosphorothioate ester (oxidation or thiolation is selected depending on the sequence design). e. Capping reaction: In condensation reactions, a very small number of 5'-hydroxyl groups may not participate in the reaction (less than 2%). These are reacted with acetic anhydride and 1-methylimidazole, capping the ends with the acetate ester that cannot participate in the subsequent reaction and preventing further reaction. Such short fragments can be separated during purification.
[0195] The above four-step cycle is repeated until the desired sequence is synthesized. The main chemical reaction equations are as follows:
[0196] After the binding of the final nucleoside monomer is complete, the nucleic acid sequence bound to the solid support is sequentially cleaved, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands.
[0197] The cleavage and deprotection conditions are as follows. First, an ammonia lysis solution (2 mL of a mixed solution of aqueous ammonia and ethanol in a 3:1 ratio) is prepared, and the solid support is added to the reaction flask and shaken thoroughly to homogenize. Ammonia lysis is performed in a constant temperature water bath at 50°C for 16 hours. After 16 hours of ammonia lysis, the mixture is cooled to room temperature (25°C ± 2°C) in a water bath, filtered through a sintered glass funnel, the filtrate is collected in a round-bottom flask, the filtrate residue is washed with a 50% ethanol aqueous solution, the filtrate is collected, concentrated using a rotary evaporator, and then transferred to a glass bottle. A small sample of the crude product is sent to the analytical department for LC-MS measurement of the crude product. The measurement method is as follows. The purity of the sense and antisense chains is measured using Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18), and the molecular weight is analyzed. The measured values were in agreement with the theoretical values.
[0198] The purification and desalting conditions are as follows: Purification is performed using an ion-exchange chromatography column, followed by desalting using a Cytiva HiPrep™ 26 / 10 desalting gel column, and then the single strands are freeze-dried. After freeze-drying the single strands, sampling and LC-MS measurement are required.
[0199] Finally, the resulting sense strand and antisense strand need to be annealed to create a double strand.
[0200] The annealing procedure is as follows: The purified sense and antisense chains are each dissolved in sterile water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. These solutions are standardized to equimolar ratios using Thermo Nanodrop Eight and mixed. The mixture is heated at 90°C for 5 minutes, followed by slow natural cooling to allow them to form a double-stranded structure via hydrogen bonding. A sample is taken and the SEC purity of the product is measured. The double-stranded sample is freeze-dried.
[0201] Example 7 Preparation of siRNA bound to a delivery conjugate 1. Preparation of the GalNAc targeting portion 1. Synthesis of Compound 2 [ka]
[0202] Compound 1 (30 g, 0.112 mol, CAS: 69555-14-2, commercially available TCI), potassium carbonate (31 g, 0.224 mol), and tetrabutylammonium bromide (3.62 g, 0.011 mol) were added to 600 ml of acetonitrile and mixed homogeneously. After cooling to 0°C, Compound 1A (22 g, 0.112 mol, CAS: 17201-43-3, commercially available TCI) was gradually added. The temperature was then gradually raised to 25°C and stirred for 24 hours. After monitoring by thin-layer chromatography and confirming that Compound 1 had been completely consumed, the mixture was filtered and the solvent was removed by rotary evaporation. The remaining solid was washed once with 300 ml of 2 mol hydrochloric acid and once with 300 ml of tetrahydrofuran, and extracted three times with 300 ml of ethyl acetate. After extraction, the aqueous phase was adjusted to a pH of 8.0 with sodium carbonate, and extracted three more times with 300 ml of ethyl acetate. The organic phase was washed once with 300 ml of water and then separated using a separatory funnel. The ethyl acetate phase was dewatered with anhydrous sodium sulfate and concentrated using a rotary evaporator to obtain yellow solid compound 2 (14.1 g, 57.6% yield).
[0203] Compound 2 1 H NMR data: 400 MHz, CDCl37.60 (d, J = 8.0 Hz, 2H), 7.34 (d, J = 8.0 Hz, 2H), 4.16 (q, J = 7.2 Hz, 2H), 3.41-3.34 (m, 1H), 3.16-2.88 (m, 2H), 1.24 (t, J = 7.2 Hz, 3H). Mass spectrometry identification of compound 2 (C 12 H 14 N2O2, molecular weight 218.1, [M+H] = 219.1).
[0204] 2. Synthesis of Compound 3 [ka]
[0205] Compound 2 was added to 85 ml of water containing 8.46 g (0.212 mol) of sodium hydroxide. After replacing the oxygen in the system with nitrogen gas, the solution was heated to 100°C and stirred for 4 hours. After compound 2 had completely reacted, the reaction system was cooled to 50°C, the pH was adjusted to 7.0 with 12 mol of hydrochloric acid, and then it was further cooled to 25°C and stirred for 1 hour. The solvent was removed at 50°C to obtain yellow solid 3 (12.2 g, yield 90.3%).
[0206] Molecular formula of compound 3 C 10 H 11 NO4, molecular weight 209.1, [M+H] = 210.1.
[0207] 3. Synthesis of Compound 3A [ka]
[0208] Synthesis method of compound 3A: 16.3 grams (0.078 mol) of compound 3 was dissolved in 114 ml of methanol, and 46.3 grams of thionyl chloride (0.39 mol) was added at 0-5°C. The mixture was stirred at 0-5°C for 30 minutes, then the temperature was raised to 65°C and refluxed for 2 hours. After confirming that compound 3 had been completely consumed by LC-MS, the reaction system was concentrated, the pH was adjusted to 1-2 with concentrated hydrochloric acid, and the mixture was extracted three times with 20 ml of dichloromethane. The pH of the aqueous phase was then adjusted to 11-12 with potassium carbonate solid, and the mixture was extracted three more times with 20 ml of dichloromethane. The organic phase was combined and evaporated to dryness. The resulting solid was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 50:1 to 1:1) to obtain 8.1 grams of yellow oily compound 3A (on TLC, Rf value 0.3 in a petroleum ether:ethyl acetate = 1:1 system, reaction yield 43.8%).
[0209] Compound 3A 1H NMR data: 400 MHz, CDCl37.98 (d, J = 8.4 Hz, 2H), 7.28 (d, J = 8.4 Hz, 2H), 3.91 (s, 3H), 3.79-3.74 (m, 1H), 3.71 (s, 3H), 3.13 (dd, J = 14.4, 5.6 Hz, 1H), 2.92 (dd, J = 13.6, 8.0 Hz, 1H). Mass spectrometry data for compound 3A: Molecular formula C 12 H 15 NO4, molecular weight 237.1, [M+H] = 238.1.
[0210] 4. Synthesis of Compound 4 [ka]
[0211] 6.7 grams of compound 3A (0.028 mol) was dissolved in 34 milliliters of tetrahydrofuran, and then added dropwise (at 0-5°C) to 100 milliliters of tetrahydrofuran containing 3.22 grams of lithium aluminum hydride (0.085 mol), and the mixture was stirred at 0-10°C for 1 hour. LC-MS confirmed that compound 3A was consumed and a new compound was formed. After stopping the reaction by adding 3 milliliters dropwise to the reaction system (at 5-15°C), 9 milliliters of 15% aqueous sodium hydroxide solution, 9 milliliters of water, and 9 grams of sodium sulfate were added in sequence, and the mixture was stirred for 30 minutes. The mixture was then filtered through Celite and concentrated to obtain yellow oily compound 4 (3.8 grams, yield 74.2%).
[0212] Nuclear magnetic data of compound 4 1H NMR: 400 MHz, DMSO-d67.32-7.02 (m, 4H), 5.10 (s, 1H), 4.55 (s, 1H), 4.45 (s, 2H), 3.30-3.23 (m, 1H), 3.20-3.11 (m, 1H), 2.89-2.78 (m, 1H), 2.64 (dd, J = 13.2, 5.6 Hz, 1H), 2.39 (dd, J = 13.2, 7.6 Hz, 1H). Molecular formula of compound 4 C 10 H 15 NO2 (molecular weight 181.1, [M+H] = 182.2).
[0213] 5. Synthesis of Compound 5 [ka]
[0214] 9.38 grams of compound 4A (0.021 mol) were dissolved in 57 milliliters of N,N-dimethylformamide, and 4.07 grams (0.0315 mol) of DIPEA and 8.74 grams of HBTU (0.023 mol) were added. Then, 3.8 grams of compound 4 (0.021 mol) were added at 0-10°C and the mixture was stirred at 0-10°C for 16 hours. After filtering the reaction system, the filtrate was purified by preparative high-performance liquid chromatography (Xtimate C18 preparative column, 250 mm x 80 mm, mobile phase water:acetonitrile = 10%-40%, 21 min) to obtain a white solid 5 (5.6 grams, yield 43.7%).
[0215] Nuclear magnetic data of compound 5 1H NMR: 400 MHz, DMSO-d67.82 (d, J = 9.2 Hz, 1H), 7.60 (d, J = 8.4 Hz, 1H), 7.24-7.09 (m, 4H), 5.21 (d, J = 3.2 Hz, 1H), 5.10 (t, J = 5.6 Hz, 1H), 4.96 (dt, J = 11.2, 3.6 Hz, 1H), 4.79-4.71 (m, 1H), 4.52-4.39 (m, 3H), 4.08-3.96 (m, 3H), 3.93-3.80 (m, 2H), 3.71-3.61 (m, 1H), 3.28-3.20 (m, 1H), 2.87-2.76 (m, 1H), 2.61-2.54 (m, 1H), 2.10 (s, 3H), 2.03-1.96 (m, 5H), 1.89 (s, 3H), 1.76 (s, 3H), 1.52-1.27 (m, 4H). Molecular formula of compound 5: C 29 H 42 N2O 12 , molecular weight 610.2, [M+H] = 611.2.
[0216] 6. Synthesis of Compound 6 [ka]
[0217] 5.6 grams of compound 5 (9.17 mmol) were added to 50 ml of pyridine, followed by the addition of 3.73 grams of 4,4'-dimethoxytrityl chloride (11.0 mmol) at 0-5°C. The mixture was then heated to 25°C and stirred for 16 hours. After filtering the reaction system, the filtrate was evaporated to dryness and separated by preparative high-performance liquid chromatography (Waters Xbridge BEH C18 column, 250 mm x 50 mm, 10 μm, mobile phase: water:acetonitrile 45-65%, 10 min). After purification, the sample was lyophilized to obtain 1.2 grams of white solid 6 (yield 14.3%).
[0218] Nuclear magnetic field data for compound 6: 1H NMR: 400 MHz, DMSO-d67.77 (dd, J = 9.2, 3.2 Hz, 1H), 7.58 (d, J = 8.4 Hz, 1H), 7.42-7.36 (m, 2H), 7.33-7.24 (m, 6H), 7.23-7.17 (m, 3H), 7.17-7.12 (m, 2H), 6.91-6.84 (m, 4H), 5.21-5.12 (m, 1H), 4.97-4.88 (m, 1H), 4.78-4.69 (m, 1H), 4.43 (dd, J = 8.4, 7.2 Hz, 1H), 4.03-3.91 (m, 5H), 3.91-3.77 (m, 2H), 3.70 (s, 6H), 3.67-3.57 (m, 1H), 3.38-3.32 (m, 1H), 3.27-3.19 (m, 1H), 2.84-2.75 (m, 1H), 2.60-2.51 (m, 1H), 2.08-2.03 (m, 3H), 2.01-1.90 (m, 5H), 1.85 (s, 3H), 1.76-1.67 (m, 3H), 1.47-1.24 (m, 4H). Compound 6 is unstable and easily decomposes in aqueous solution, therefore, complete mass spectrometry data for compound 6 could not be obtained.
[0219] 7. Synthesis of compound SA000004 [ka]
[0220] 1 g of compound 6 (1.09 mmol) and 1H-imidazole-4,5-dicarbonitric acid (194 mg, 1.64 mmol) were added to 1000 ml of dichloromethane. At 25°C, 496 mg of compound 6A (1.64 mmol) was added, and the mixture was stirred at 25°C for 16 hours. TLC confirmed that compound 6 had been consumed and that a new compound had been formed. After evaporating the reaction system to dryness, the mixture was separated by silica gel column chromatography (petroleum ether:ethyl acetate, 20:1 to 1:1) to obtain 211 mg of white compound SA000004 (yield 17.3%).
[0221] Nuclear magnetic data of compound SA000004 1 H NMR: 400 MHz, CD3CN 7.52-7.45 (m, 2H), 7.40-7.29 (m, 6H), 7.29-7.19 (m, 5H), 6.94-6.83 (m, 4H), 6.53-6.37 (m, 2H), 5.27 (d, J = 3.2 Hz, 1H), 5.04-4.93 (m, 1H), 4.47 (dd, J = 15.6, 8.4 Hz, 1H), 4.26-4.14 (m, 1H), 4.12-4.01 (m, 4H), 4.01-3.69 (m, 11H), 3.68-3.34 (m, 5H), 2.96-2.85 (m, 1H), 2.79-2.69 (m, 1H), 2.66 (t, J = 5.6 Hz, 2H), 2.11-2.04 (m, 5H), 1.98-1.95 (m, 3H), 1.91 (s, 3H), 1.84-1.79 (m, 3H), 1.63-1.32 (m, 4H), 1.22-1.09 (m, 12H).
[0222] 2. Preparation of siRNA conjugates Using a solid-phase phosphoramidite method, nucleoside monomers were sequentially bonded in the 3'-5' direction in nucleotide sequence order using the specially modified compounds prepared in the above process and commercially purchased conventionally modified monomers (purchased from Shanghai Zhaowei Technology Development Co., Ltd.). Of these, the specially modified anti-off-target compound was placed in the seed region of the antisense strand (any position between 4 and 8 from the 5' end), and the delivery monomer compound was freely positioned at the 3' or 5' end as a conventional monomer. The bonding of each nucleoside monomer involved four reaction steps: deprotection, coupling, capping, oxidation, or sulfidation. The same synthetic conditions were used for both the sense strand and the antisense strand.
[0223] Instrument model: MerMade 12 Oligonucleotide synthesizer solid-phase synthesis system, Beijing Haijing 1ml synthesis column, Cytiva Source TM15Q 4.6 / 100PE purification column. The reagents used for synthesizing the siRNA conjugates were purchased from Suzhou Kerema.
[0224] The synthesis process is outlined below. The single-chain synthesis reaction process extends in the 3'-5' direction and is completed on a solid-phase synthesizer. It involves four main reaction steps. a. Deprotection reaction: The protecting group DMT on the nucleotide is deprotected using dichloroacetic acid to obtain the 5'-hydroxy terminus. b. Coupling reaction: The protected nucleotide phosphoramidite monomer is mixed with the activator ethylthiotetrazole, which activates the phosphoramidite group. The 5'-hydroxyl group remains protected by DMT and undergoes a condensation reaction with the 5'-hydroxyl group bound to the solid support to produce phosphite triester. c. Oxidation reaction: Under the action of iodine, an oxidizing agent, the triester phosphite obtained in the previous coupling reaction is converted to a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus). d. Thiomination reaction: Under the action of the sulfurizing agent PADS, the phosphorous acid obtained in the previous coupling reaction is used. Convert the triester to a phosphorothioate ester (select either oxidation or thiolation depending on the sequence design). e. Capping reaction: In condensation reactions, a very small number of 5'-hydroxyl groups may not participate in the reaction (less than 2%). These are reacted with acetic anhydride and 1-methylimidazole, capping the ends with the acetate ester that cannot participate in the subsequent reaction and preventing further reaction. Such short fragments can be separated during purification.
[0225] The above four-step cycle is repeated until the desired sequence is synthesized. The main chemical reaction equations are as follows:
[0226] After the binding of the final nucleoside monomer is complete, the nucleic acid sequence bound to the solid support is sequentially cleaved, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands.
[0227] The cleavage and deprotection conditions are as follows. First, an ammonia lysis solution (2 mL of a mixed solution of aqueous ammonia and ethanol in a 3:1 ratio) is prepared, and the solid support is added to the reaction flask and shaken thoroughly to homogenize. Ammonia lysis is performed in a constant temperature water bath at 50°C for 16 hours. After 16 hours of ammonia lysis, the mixture is cooled to room temperature (25°C ± 2°C) in a water bath, filtered through a sintered glass funnel, the filtrate is collected in a round-bottom flask, the filtrate residue is washed with 50% aqueous ethanol solution, the filtrate is collected, concentrated using a rotary evaporator, and then transferred to a glass bottle. A small sample of the crude product is sent to the analytical department for LC-MS measurement of the crude product. The measurement method is as follows. The purity of the sense and antisense chains is measured using Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18), and the molecular weight is analyzed. The measured values are in agreement with the theoretical values.
[0228] The purification and desalting conditions are as follows: Purification is performed using an ion-exchange chromatography column, followed by desalting using a Cytiva HiPrep™ 26 / 10 desalting gel column, and then the single strands are freeze-dried. After freeze-drying the single strands, sampling and LC-MS measurement are required.
[0229] Finally, the resulting sense strand and antisense strand need to be annealed to create a double strand.
[0230] The annealing procedure is as follows: After purification, the obtained sense and antisense chains are dissolved in sterile water for injection to prepare solutions of 0.1 mg / mL to 40 mg / mL. These solutions are standardized to equimolar ratios using Thermo Scientific Nanodrop Eight and mixed. The mixture is heated at 90°C for 5 minutes, then allowed to cool slowly at room temperature to allow them to form a double-stranded structure via hydrogen bonding. A sample is taken and the SEC purity of the product is measured. The double-stranded sample is freeze-dried.
[0231] Example 8: In vitro evaluation of on-target and anti-off-target activity of Safe01 In this example, we investigated the effects of including the chemical modification indicated by (II) at the 6th or 7th nucleotide position in the 5' region of different antisense strands on the on-target and anti-off-target activities of siRNA. [ka]
[0232] In equation (II), B1 can be A, G, C, or U.
[0233] If B1 is a base A, the chemically modified base A is called Ago. If B1 is a base G, the chemically modified base G is called Ggo. If B1 is a base C, the chemically modified base C is called Cgo. If B1 is a base U, the chemically modified base U is called Ugo.
[0234] As will be seen, different B1 groups result in different structures, but in this example, we investigated the on-target and anti-off-target activities when the siRNA contains Ggo, Ago, Ugo, Cgo, or Ggs. For the sake of clarity in this example, we use the general term Safe01, which includes Ggo, Ago, Ugo, or Cgo as shown in Table 1 or Table 2, the specific structures of which have already been shown above.
[0235] In this example, Agn was formed by introducing GNA chemical modification to base A, Ggn was formed by introducing GNA chemical modification to base G, Ugn was formed by introducing GNA chemical modification to base U, and Cgn was formed by introducing GNA chemical modification to base C.
[0236] In this embodiment, the native sequences used for the modifications shown in Table 1 below are as follows in the 5'-3' directions, and please refer to Table 1 below for details on sequence modifications.
[0237] siRNA-1: Sense strand: UGACAGAAUCCUCACAAU (SEQ ID NO: 1) Antisense chain: AUUGUGAGGAUUCUUGUCAAC(SEQ ID NO: 2); siRNA-2: Sense strand: CCUUGAGGCAUACUUCAAA (SEQ ID NO: 3) Antisense chain: UUUGAAGUAUGCCUCAAGGUU (SEQ ID NO: 4); siRNA-3: Sense strand: GUGUGCACUUCGCUUCACA (SEQ ID NO: 5) Antisense chain: UGUGAAGCGAAGUGCACACUU (SEQ ID NO: 6); siRNA-4: Sense strand: ACUGAAGCAUUUGAUGCAA (SEQ ID NO: 7) Antisense chain:UUGCAUCAAAUGCUUCAGUGU(SEQ ID NO: 8); siRNA-5: Sense strand: AUAACUCACUAUAAUUACU (SEQ ID NO: 9) Antisense chain: AGUAAUUAUAGUGAGUUAUUU (SEQ ID NO: 10).
[0238] The on-target and anti-off-target activity of the compound at different sequences was measured using a dual luciferase reporter gene assay. HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. Cells were co-transfected with the reporter gene plasmid and siRNA at different concentrations using Lipofectamine 2000 (ThermoFisher, 11668019) according to the product instructions. See Table 1 for siRNA sequences. After 24 hours of transfection, the activity was measured using a dual luciferase assay kit (Yi Sheng Biological, 11405ES80). The 3' untranslated region of the sea urchin luciferase in the reporter plasmid contained either an on-target reporter plasmid (a sequence complementary to the antisense strand) or five tandem sequences corresponding to positions 12-19 of the 5' end of the sense strand (an off-target reporter plasmid). All reporter plasmids contained firefly luciferase as an internal standard. A control group was used, consisting of individuals transfected with plasmids only. The results are shown in Table 2, demonstrating that siRNAs containing Safe01 retained on-target activity in vitro while significantly reducing off-target activity. Test results at different targets indicate that Safe01 exhibits superior on-target and anti-off-target activity compared to GNAs.
[0239] [Table 1] TIFF2026513376000065.tif189170
[0240] [Table 2] TIFF2026513376000067.tif53170
[0241] Example 9: In vivo activity test of Safe01-modified compounds using C57BL / 6-HBV (Hepatitis B virus) transgenic mice C57BL / 6-HBV transgenic mice were selected from Beijing Weitongda Biotechnology Co., Ltd. Transgenic mice were obtained by injecting 1.28 times the length of HBV (type A, GeneBank: AF305422.1) linearized fragments into the pronucleus of C57BL / 6NCrl mouse embryos. Peripheral blood HBV copy number analysis revealed that the copy number was 10 7 ~10 8 We maintained founder mice that reached eq / ml and established an HBV transgenic mouse line by crossing hemizygotes with wild-type C57BL / 6NCrl mice.
[0242] The original siRNA sequence compound is SD003254, and the Safe01 anti-off-target modified compound is SD003257, their sequences as shown in Table 3.
[0243] C57BL / 6-HBV transgenic mice were divided into three groups, with five mice in each group. On day 3, blood was collected from the submandibular gland of the animals. After blood collection, the samples were centrifuged at 5000 rpm, 4°C, and for 10 minutes. The serum was diluted with PBS, and the dilution ratio should be determined according to the actual situation. The diluted samples were then sent to Beijing Di'an Medical Laboratory Co., Ltd. for HBV DNA detection, and the measurement results were calculated backward according to the dilution ratio. The HBV DNA quantitative detection method was the fluorescent probe quantitative PCR method. Based on the HBV DNA levels, the animals were divided into groups, and on day 0, each of the three groups was subcutaneously injected with vehicle (phosphate-buffered saline), SD003254, and SD003257, respectively. The injection dose was 3 mg / kg body weight, for a total of one injection. On day 56 of the experiment, blood samples were taken again to detect HBV DNA levels, and the activity of SD003254 and SD003257 was compared.
[0244] Figure 1 shows the relative levels (%) of HBV DNA compared to the vehicle group before and after administration.
[0245] On day 56 after treatment, the HBV DNA suppression rates in the SD003254 and SD003257 groups were approximately 92.8% and 87.6%, respectively, compared to the vehicle group, indicating nearly identical activity (P > 0.5, no statistically significant difference). This suggests that Safe01 molecular modification does not significantly affect the long-term in vivo persistence of the compound.
[0246] [Table 3]
[0247] In this embodiment, the conjugate group (FIN) conjugated to the siRNA is as follows: [ka]
[0248] Example 10: Analysis of anti-off-target activity of Safe01-modified compounds using RNA-seq RNA-seq, or transcriptome sequencing, is a high-throughput sequencing technique used to perform sequencing analysis and analyze differentially expressed genes. A standard workflow begins with laboratory RNA extraction, followed by mRNA enrichment or ribosomal RNA removal, cDNA reverse transcription, and preparation of a sequencing library with adapters attached. This library is then sequenced on a high-throughput sequencing platform, with each sample typically sequenced to 10 to 30 million reads. Finally, the experimentally obtained data is mapped or assembled into a transcriptome, the reads covering the transcript are quantified, filtering and inter-sample normalization are performed, and statistical models are used to describe the differences in expression levels of each gene across different sample groups.
[0249] Using an in vitro transfection method, HEK293 cells were transfected with SD003254 and SD003257, and the difference in gene expression levels of HEK293 cells was analyzed using RNA-seq to compare the improvement of off-target effects by Safe01-modified compounds. HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. At the time of transfection, HEK293 cells were seeded in a 6-well plate with a seeding density of 600,000 cells per well and 2 mL of medium per well. Lipofectamine was used according to the product instructions. siRNA was transfected using RNAiMAX (ThermoFisher, 13778150), and the final siRNA concentration was 10 nM. Cells were harvested 24 hours after treatment and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for RNA-seq analysis.
[0250] The RNA-seq results are shown in Table 4. The results indicate that the Safe01-modified compound SD003257 reduced the number of upregulated and downregulated genes compared to SD003254, demonstrating that Safe01 improved off-target effects.
[0251] [Table 4]
[0252] Example 11: In vitro comparative evaluation of on-target activity of Safe01 and A0360 In this example, the effect of including chemical modifications (II) and A0360 at the nucleotide position 6 of the 5' region of the antisense strand on the on-target activity of siRNA was compared and evaluated. [ka]
[0253] In equation (II), B1 can be A, G, C, or U.
[0254] Different B1s result in different structures. To make this embodiment easier to explain, we use the general term Safe01, which includes the Ago (when B is base A, the chemically modified base A is called Ago) shown in Table 5 or Table 6, the specific structures of which have already been shown above.
[0255] On-target activity of the sequence was measured using Dual-Glo® dual luciferase. On-target activity was evaluated by co-transfecting cells with 10 ng of an on-target reporter gene plasmid (in which the GSCM sequence, which is completely complementary to the antisense strand, was inserted into the 3' untranslated region of the sea urchin luciferase in the reporter plasmid) and siRNA diluted 2.5-fold from 20 nM to 0.00524 nM using Lipofectamine 2000 (ThermoFisher, 11668019). HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. See Table 5 for siRNA sequences. After 24 hours of transfection, the activity was measured using a dual luciferase assay kit (Promega, E1980). All reporter plasmids contained firefly luciferase as an internal standard. The group transfected with plasmid only was used as the control group.
[0256] The sea urchin luciferase signal readings in each well were normalized as a ratio to the firefly luciferase (control) signal, and then relative levels at different concentrations were calculated compared to cells transfected with the same plasmid but without siRNA treatment. The results are shown in Table 6, demonstrating that siRNA containing Safe01 retained nearly the same on-target activity as the original sequence in vitro, and that the on-target activity of Safe01 was superior to that of A0360.
[0257] [Table 5]
[0258] [Table 6]
[0259] The present invention has been described in detail above, but its purpose is to enable those skilled in the art to understand and implement the present invention, and not to limit the scope of protection of the present invention. Any equivalent changes or modifications made based on the spirit substance of the present invention should be included within the scope of protection of the present invention.
Claims
1. An oligonucleotide, characterized in that each single-stranded or double-stranded oligonucleotide has 15 to 35 nucleotides, and at least one non-terminal nucleotide position of the oligonucleotide contains a chemical modification represented by formula (II) or a tautomer thereof. 【Chemistry 1】 In the formula, B1 is a natural nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. R 1 、 R 2 and R 3 are each independently H, OH, halogen, NH 2 , C 1 -C 6 alkyl group, C 1 -C 6 alkoxy group, C 2 -C 6 alkenyl group, C 2 -C 6 alkynyl group, S-CH 3 , NCH 3 (CH 3 ), OCH 2 CH 2 OCH 3 and -O-alkylamino group, and are selected from n is 1, 2, or 3. Here, the chemical modification represented by formula (II) is 【Chemistry 2】 isn't it.
2. The single-stranded or double-stranded oligonucleotide according to claim 1, wherein the oligonucleotide is siRNA and comprises a sense strand and an antisense strand, each strand having 15 to 35 nucleotides, and the antisense strand includes a chemical modification represented by formula (II-1), formula (II-2), formula (II-3), or formula (II-4) or a tautomer modification thereof at at least one nucleotide position among the 2nd to 8th positions of its 5' region. 【Transformation 3】 In the formula, B1 and B2 are, respectively, a native nucleic acid base, a modified nucleic acid base, a universal base, or an H atom.
3. The single-stranded or double-stranded oligonucleotide according to claim 2, characterized in that the chemical modification is selected from any of the following structures. 【Chemistry 4】
4. The single-stranded or double-stranded oligonucleotide according to claim 2, characterized in that the chemical modification is selected from any of the following structures. 【Transformation 5】
5. A single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 4, characterized in that the chain includes a chemical modification represented by formula (II), (II-1), (II-2), (II-3), or (II-4) or a tautomer modification thereof at at least one nucleotide position among the 5th to 8th positions of its 5' region.
6. The single-stranded or double-stranded oligonucleotide according to claim 5, characterized in that the chain includes a chemical modification represented by (II), (II-1), (II-2), (II-3), or (II-4) or a tautomer modification thereof at at least one nucleotide position among the 6th and 7th positions of its 5' region.
7. The single-stranded or double-stranded oligonucleotide according to claim 5, characterized in that the chain is an antisense chain of a double-stranded oligonucleotide, and at least one nucleotide position among the 6th and 7th positions of its 5' region contains a chemical modification represented by Ago, Ggo, Cgo, Ugo, Ggs, or Tgo, or a tautomer modification thereof.
8. The single-stranded or double-stranded oligonucleotide according to claim 5, characterized in that, in addition to a nucleotide comprising a chemical modification represented by formula (II), (II-1), (II-2), (II-3), or (II-4) or a tautomer modification thereof, the chain further comprises at least one other modified nucleotide.
9. The single-stranded or double-stranded oligonucleotide according to claim 8, characterized in that the other modified nucleotides are independently selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxy-nucleotides, 2'-amino-modified nucleotides, and 2'-substituted amino-modified nucleotides.
10. The single-stranded or double-stranded oligonucleotide according to claim 8, wherein the oligonucleotide is siRNA and comprises a sense strand and an antisense strand, and the siRNA has at least one of the following characteristics. (i) The antisense chain contains 2, 3, 4, 5 or 6 2'-fluoromodifications, (ii) The antisense chain consists of 1, 2, 3, or 4 phosphorothioate nucleotides Including interconnections, (iii) The sense chain contains 2, 3, 4, or 5 2'-fluoromodifications, (iv) The sense strand contains one, two, three, or four phosphorothioate nucleotide interlinks.
11. An siRNA conjugate characterized by comprising a single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 10 and a conjugate group conjugated to the oligonucleotide.
12. A pharmaceutical composition comprising a single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 10 or an siRNA conjugate according to claim 11, and a pharmaceutically acceptable carrier.
13. A kit characterized by comprising a single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 10, an siRNA conjugate according to claim 11, or a pharmaceutical composition according to claim 12.
14. A compound represented by the following formula (IV) or its tautomer. 【Transformation 6】 In the formula, B1 is a natural nucleic acid base, a modified nucleic acid base, a universal base, or an H atom. E is a leaving group, preferably E is MMTr or DMTr. Q is a phosphorus-containing active reactive group, preferably Q is 【Transformation 7】 That is the case.
15. A compound represented by formula (IV) according to claim 14 or a tautomer thereof, characterized in that it is selected from any of the following structures. 【Transformation 8】
16. A method for producing a single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 10 or an siRNA conjugate according to claim 11, characterized by comprising the following steps. 1) A step of synthesizing a compound represented by formula (IV) according to claim 14 or 15 or a tautomer thereof. 2) A step of synthesizing the oligonucleotide or siRNA conjugate using the compound from step 1) or its tautomer.
17. A method for suppressing a target gene in a cell, comprising the step of introducing a single-stranded or double-stranded oligonucleotide according to any one of claims 1 to 10 or an siRNA conjugate according to claim 11 into the cell.
18. A method for reducing off-target activity by modifying the 2-8 positions of the antisense strand of siRNA, characterized by introducing a chemical modification represented by the general formula (II), (II-1), (II-2), (II-3), or (II-4) described in claim 1 or 2, or a tautomer thereof, to the 2-8 positions of the antisense strand of an siRNA molecule.
19. The method according to claim 18, characterized in that the chemical modification represented by the general formula (II), (II-1), (II-2), (II-3), or (II-4) or its tautomer is selected from any of the following structures. 【Chemistry 9】
20. The method according to claim 18, characterized in that the chemical modification represented by the general formula (II), (II-1), (II-2), (II-3), or (II-4) or its tautomer is selected from any of the following structures. 【Chemistry 10】