Extracellular vesicles functionalized with a tethering system for cargo delivery

Abstract

Extracellular vesicles (EVs) are gaining recognition as vectors for drug delivery. In particular, EVs loaded with targeting and therapeutic agents present an interesting opportunity to transform EVs into biomimetic selective delivery systems. Indeed, EVs constitute physiological carriers that are potentially less immunogenic than artificial delivery vehicles. Here, we have developed extracellular vesicles functionalized with HERV syncytin and tethering systems, as well as their use for cargo delivery.

Description

[Technical Field]

[0001] This invention relates to the field of medicine, particularly to the field of cargo delivery to target cells. [Background technology]

[0002] Extracellular vesicles (EVs) are currently recognized as intercellular transfer vectors capable of transferring nucleotides, lipids, and proteins from donor cells to acceptor cells (Skog, J. et al. Glioblastoma microvesicles transport RNA and proteins that promote tumor growth and provide diagnostic biomarkers. Nat. Cell Biol. 10, pp. 1470-1476 (2008); Valadi, H. et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 9, pp. 654-659 (2007); Flaherty, SE et al. A lipase-independent pathway of lipid release and immune modulation by adipocytes. Science (80-.). 363, pp. 989-993 (2019); Al-Nedawi, K. et al. Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumor cells. Nat. Cell Biol. 10, pp. 619-624 (2008). EV-mediated signaling has been associated with numerous physiological and pathophysiological functions, including cancer, immune responses, cardiovascular disease, lipid homeostasis, regeneration, and stem cell-based therapies (Mathieu, M., Martin-Jaular, L., Lavieu, G. & Thery, C. Specificities of secretion and uptake of exosomes and other extracellular vesicles for cell-to-cell communication. Nat. Cell Biol. 21, pp. 9-17 (2019)). The range of tissues / cells capable of releasing or capturing EVs is broad, including nerve cells, adipocytes, and immune cells.

[0003] Therefore, extracellular vesicles (EVs) are increasingly recognized as crucial vectors for physiology in general and are emerging as promising candidates for translational applications such as targeted drug delivery. In particular, EV loading with targeting and therapeutic agents presents an interesting opportunity to transform EVs into biomimetic selective delivery systems. Indeed, EVs constitute physiological carriers that are potentially less immunogenic than artificial delivery vehicles. EVs can favorably alter the pharmacokinetics, biodistribution, and bioavailability of cargoes by (i) protecting the cargo, (ii) directing them to the site of interest, and (iii) facilitating membrane transport (Murphy, DE et al. Extracellular vesicle-based therapeutics: natural versus engineered targeting and trafficking. Exp.Mol.Med.51, p.32 (2019)). Ultimately, using EVs or chemically formulated EV mimetics to deliver therapeutics (including gene editing toolboxes) to specific cells in the body has the potential to revolutionize cell / gene therapy. [Overview of the project] [Means for solving the problem]

[0004] The present invention is defined by the claims. In particular, the present invention relates to extracellular vesicles functionalized by HERV syncytin and tethering systems, and their use for cargo delivery. [Modes for carrying out the invention]

[0005] Main definitions: As used herein, the terms “polypeptide,” “peptide,” and “protein” are interchangeable and refer to polymers of amino acids of any length. These terms also encompass amino acid polymers modified, for example, by disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with labeling components. When discussed in the context of gene therapy, polypeptides refer to any fragments or genetically modified derivatives of each intact polypeptide or intact protein that retain the desired biochemical function.

[0006] As used herein, the term “polynucleotide” refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, their analogues, or mixtures thereof. The term refers to the primary structure of a molecule. Therefore, the term includes triple-stranded, double-stranded, and single-stranded deoxyribonucleic acid ("DNA") and triple-stranded, double-stranded, and single-stranded ribonucleic acid ("RNA"). The term also includes modified forms of polynucleotides, for example, by alkylation and / or capping, and unmodified forms of polynucleotides. More specifically, the term “polynucleotide” includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose) including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced ​​or unspliced, any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base, as well as other polymers containing a non-nucleotide backbone, such as polyamides (e.g., peptide nucleic acids “PNA”) and polymorpholinopolymers, and other synthetic sequence-specific nucleic acid polymers, provided that the polymers contain nucleic acid bases in a configuration that enables base pairing and base stacking as found in DNA and RNA. In some embodiments, the polynucleotide includes mRNA. In other embodiments, the mRNA is synthetic mRNA. In some embodiments, the synthetic mRNA includes at least one non-natural nucleic acid base. In some embodiments, all of a certain type of nucleic acid base is replaced with a non-natural nucleic acid base (for example, all uridines in the polynucleotides disclosed herein may be replaced with a non-natural nucleic acid base, such as 5-methoxyuridine). In some embodiments, the polynucleotide (e.g., synthetic RNA or synthetic DNA) contains only natural nucleic acid bases, i.e., A, C, T, and G in the case of synthetic DNA, or A, C, T, and U in the case of synthetic RNA.

[0007] As used herein, the term “encodes” refers to the inherent properties of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, and the biological properties arising therefrom, which serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids. Thus, a gene, cDNA, or RNA codes for a protein when the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of a gene or cDNA, may be said to code for a protein or other product of that gene or cDNA. Unless otherwise noted, “polynucleotide sequences encoding amino acid sequences” includes all nucleotide sequences that are degenerate versions of each other and that also encode the same amino acid sequence. The phrase “polynucleotide sequences encoding protein or RNA” may also include introns to the extent that protein-coding nucleotide sequences may contain one or more introns in some versions.

[0008] As used herein, the expression "derived from" refers to a first component (e.g., a first polypeptide) or a process of isolating, deriving, or preparing a different second component (e.g., a second polypeptide different from the first polypeptide) using information from that first component.

[0009] As used herein, "percent identity" between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions × 100), taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences, and the length of each gap. Sequence comparison and determination of percentage identity between two sequences can be performed using mathematical algorithms as described below. Percent identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (Needleman, Saul B. & Wunsch, Christian D. (1970). "A general method applicable to the search for similarities in the amino acid sequence of two proteins." Journal of Molecular Biology. 48(3): pp. 443-53). Percent identity between two nucleotide or amino acid sequences can also be determined using algorithms such as EMBOSS Needle (pairwise alignment; available at www.ebi.ac.uk). For example, EMBOSS Needle can be used with the BLOSUM62 matrix, a "gap open penalty" of 10, a "gap extension penalty" of 0.5, a false "end gap penalty", an "end gap open penalty" of 10, and an "end gap extension penalty" of 0.5. Generally, "percent identity" is a function of the number of matching positions divided by the number of positions compared, multiplied by 100. For example, if 6 out of 10 sequence positions are identical between two comparison sequences after alignment, the identity is 60%. Percent identity is usually determined over the entire length of the query sequence on which the analysis is performed. Two molecules having the same primary amino acid sequence or nucleic acid sequence are identical regardless of any chemical and / or biological modifications.According to the present invention, a first amino acid sequence having at least 70% identity with a second amino acid sequence means that the first sequence has 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity with the second amino acid sequence.

[0010] As used herein, the term “mutation” has its general meaning in the art and refers to substitution, deletion, or insertion. In particular, the term “substitution” means that a specific amino acid residue at a particular position is removed and another amino acid residue is inserted at the same position. In this specification, mutations are referred to according to standard mutation nomenclature.

[0011] As used herein, the terms “human endogenous retrovirus” or “HERV” have their general meaning in the art and refer to retroviruses that exist in the form of proviral DNA integrated into the human genome of all normal cells and are transmitted by a Mendelian inheritance pattern. Most endogenous retroviruses are transcriptionally silent or deficient but can be activated under certain conditions. HERV expression can range from the transcription of selected viral genes to the production of complete viral particles that may be infectious or non-infectious. Indeed, variants of HERV viruses may arise that are capable of exogenous viral replication cycles, although direct experimental evidence regarding an exogenous life cycle has not yet been found. In structurally complete HERVs, two long terminal repeats (LTRs) are adjacent to the proviral interior portion, which consists of the viral genes gag, pro, pol, and env. In short, gag encodes structural components of the matrix, capsid, and nucleocapsid; pro and pol identify the enzymes protease (PR), reverse transcriptase (RT), and integrase (IN); while env encodes the Env surface (SU) and transmembrane (TM) subunits. Among the 30 HERV families present in the human genome, human endogenous retroviruses (HERVs) are classified into various families based on their sequence similarities and evolutionary relationships. Here are some of the main HERV families:

[0012] 1. HERV-H: This family is one of the largest and most well-studied HERV families. It comprises several subgroups, including HERV-H / FRD, HERV-H / NT, and HERV-H / env62. HERV-H elements have been found to play a role in embryonic development and gene regulation.

[0013] 2. HERV-K: The HERV-K family is also very large and active. The HERV-K family contains multiple subgroups such as HERV-K (HML-2), HERV-K (C4), and HERV-K (CTRP). HERV-K elements are involved in various diseases including cancer, autoimmune disorders, and neurological conditions.

[0014] 3. HERV-W: The HERV-W family is associated with the human endogenous retrovirus type W. The HERV-W family includes elements such as syncytin-1 and syncytin-2 that are involved in placental development. HERV-W is associated with multiple sclerosis (MS) and other autoimmune diseases.

[0015] 4. HERV-L: The HERV-L family includes multiple subfamilies including HERV-L (Tro) and HERV-L (ERVK). HERV-L elements have been found to have regulatory functions and are thought to affect the expression of nearby genes.

[0016] 5. HERV-F: The HERV-F family consists of relatively ancient HERV elements. The HERV-F family has been found in various primate genomes including humans and is thought to have branched at an early stage of evolution.

[0017] 6. HERV-S: The HERV-S family includes elements detected in primate genomes including humans. The HERV-S family is suggested to play a role in the regulation of gene expression.

[0018] 7. HERV-E: The HERV-E family is one of the oldest HERV families and its elements are found in primate genomes. The HERV-E family is thought to have been integrated into the human genome millions of years ago.

[0019] As used herein, the term "envelope glycoprotein" or "Env" refers to, but is not limited to, glycoproteins expressed on the surface of the envelope of HERV. In the retroviral life cycle, Env glycoproteins mediate entry into host cells. Typically, the env gene encodes a precursor that is cleaved into an SU subunit that forms the viral receptor and a TM subunit that retains fusogenic and immunosuppressive activities.

[0020] As used herein, the term "HERV syncytin" has its ordinary meaning in the art and refers to highly fusogenic envelope glycoproteins derived from eutherian mammals belonging to the family of endogenous retroviruses (HERV). These proteins are preferentially expressed in the placenta and are encoded by genes that induce syncytium formation when introduced into cultured cells (Cornelis G, Heidmann O, Degrelle SA, Vernochet C, Lavialle C, Letzelter C, et al. (2013). Captured retroviral envelope syncytin gene associated with the unique placental structure of higher ruminants PNAS 110(9):E828-E837).

[0021] As used herein, the terms “syncytin-1” or “SYN” have their general meanings in the art and refer to the protein found in humans and other primates encoded by the ERVW-1 gene (endogenous retrovirus group W envelope member 1). Syncytin-1 is an intercellular fusion protein whose function has been best characterized in placental development. The term is also known as endogenous retrovirus group W member 1, Env-W, envelope polyprotein gPr73, Enverin, HERV-7q envelope protein, HERV-W envelope protein, HERV-W_7q21.2 proviral ancestral Env polyprotein, and syncytin. An exemplary amino acid sequence for syncytin-1 is represented by SEQ ID NO: 1. The signal peptide is the amino acid residue from position 1 to position 20 in SEQ ID NO: 1. The extracellular domain of syncytin-1 is the amino acid residue from position 21 to position 443 in Sequence ID No. 1. [ka]

[0022] As used herein, the term "ASCT1" refers to human neutral amino acid transporter A encoded by the SLC1A4 gene. Syncytin-1 can bind to ASCT1 (Antony JM, Ellestad KK, Hammond R, Imaizumi K, Mallet F, Warren KG, Power C. The human endogenous retrovirus envelope glycoprotein, syncytin-1, regulates neuroinflammation and its receptor expression in multiple sclerosis: a role for endoplasmic reticulum chaperones in astrocytes. J Immunol. 2007 Jul 15;179(2):1210~24. doi:10.4049 / jimmunol.179.2.1210.PMID:17617614).

[0023] As used herein, the term "ASCT2" refers to the neutral amino acid transporter B(0) encoded by the SLC1A5 gene. ASCT2 has been described as a receptor for syncytin-1 (Blond JL, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-Fernandes S, Mandrand B, Mallet F, Cosset FL. An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J Virol. 2000;74:3321~3329. doi:10.1128 / JVI.74.7.3321~3329.2000.).

[0024] As used herein, the terms “syncytin-1 polypeptide” or “SYN polypeptide” refer to any polypeptide derived from syncytin-1 and containing the SDGGGX2DX2R (SEQ ID NO: 2) conserved motif essential for the syncytin-1-hASCT2 interaction (see Cheynet V, Oriol G, Mallet F. Identification of the hASCT2-binding domain of the Env ERVWE1 / syncytin-1 fusogenic glycoprotein. Retrovirology. 2006 Jul 4;3:41. doi:10.1186 / 1742-4690-3-41. PMID:16820059;PMCID:PMC1524976). According to the present invention, syncytin-1 polypeptides can bind to the ASCT1 receptor, preferably the ASCT2 receptor, as determined by any assay well known in the art (see, for example, Cheynet V. et al. above).

[0025] As used herein, the terms “extracellular vesicle” or “EV” have their general meaning in the art and refer to cell-derived vesicles containing a membrane that encloses an internal space. Extracellular vesicles include all membrane-bound vesicles having a diameter smaller than the cell from which they originate. Generally, extracellular vesicles range in diameter from 50 nm to 1000 nm and may contain various polymeric cargoes within their internal space, presented on the external surface of the extracellular vesicle, and / or penetrating the membrane.

[0026] As used herein, the term "functionalization" refers to the fact that the EV of the present invention incorporates the desired polypeptide (e.g., HERV syncytin of the present invention) in its membrane.

[0027] As used herein, the terms “isolated,” “isolated,” “purified,” “purified,” “concentrated,” and “concentrated,” as used herein in relation to cells, mean that the extracellular vesicles (EVs) were isolated, purified, and ready for therapeutic use at some point in time. “Highly purified,” “highly concentrated,” and “highly isolated,” as used in relation to the extracellular vesicles described above, indicate that the cells of interest are at least about 70%, about 75%, about 80%, about 85%, about 90%, or more than the cells, and that about 95%, at least 99%, at least 99.5%, or at least 99.9%, or more than the EVs are pure, preferably about 95% or more.

[0028] As used herein, the term "donor cells" means cells suitable for the production of EVs according to the present invention.

[0029] As used herein, the term “target cell” means a cell that is desirable to fuse with the EV of the present invention.

[0030] As used herein, the term "cargo" refers to any molecule having the desired biological activity and appropriate solubility profile that is encapsulated within a virus extracellular molecule, such as nucleic acids, polypeptides, pharmaceuticals, etc.

[0031] As used herein, the term "load" refers to the introduction or insertion of a substance or object into or onto the EV of the present invention. As used herein, the term "loading" refers to the introduction or insertion of a substance or object into or onto the EV of the present invention.

[0032] As used herein, the term "targeting site" refers to any molecule that specifically binds to a target.

[0033] As used herein, the term “antibody” refers to an immunoglobulin molecule and a molecule containing an immunoactive portion of an immunoglobulin molecule, i.e., an antigen-binding site that binds immunospecifically to an antigen. In natural antibodies of rodents and primates, two heavy chains are linked to each other by disulfide bonds, and each heavy chain is linked to a light chain by disulfide bonds. Two types of light chains exist: lambda(l) and kappa(k). There are five major heavy chain classes (or isotypes) that determine the functional activity of antibody molecules: IgM, IgD, IgG, IgA, and IgE. Each chain contains distinct sequence domains. In a typical IgG antibody, the light chain contains two domains: a variable domain (VL) and a constant domain (CL). The heavy chain contains four domains: a variable domain (VH) and three constant domains (CH1, CH2, and CH3, collectively referred to as CH). The variable regions of both the light (VL) and heavy (VH) chains determine the binding recognition and specificity to the antigen. The constant region domains of the light (CL) and heavy (CH) chains confer important biological properties such as antibody chain binding, secretion, transplacental mobility, complement binding, and binding to the Fc receptor (FcR). The Fv fragment is the N-terminal portion of the Fab fragment of immunoglobulin and consists of variable regions of one light chain and one heavy chain. Antibody specificity lies in the structural complementarity between the antibody binding site and the antigenic determinant. The antibody binding site is mainly composed of residues derived from the hypervariable region or complementarity-determining region (CDR). In some cases, residues derived from the non-hypervariable region or framework region (FR) may be involved in the antibody binding site or may affect the entire domain structure and, consequently, the binding site. The complementarity-determining region or CDR refers to the amino acid sequence that together determines the binding affinity and specificity of the innate Fv region of the innate immunoglobulin binding site. The light and heavy chains of immunoglobulins each contain three CDRs, designated L-CDR1, L-CDR2, L-CDR3, and H-CDR1, H-CDR2, and H-CDR3, respectively. Therefore, the antigen-binding site typically contains six CDRs, including sets of CDRs from the V regions of the heavy and light chains. The framework region (FR) refers to the amino acid sequence inserted between the CDRs.Therefore, the variable regions of the light and heavy chains typically include four framework regions and three CDRs in the following sequence: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Residues in the antibody variable domain are conventionally numbered according to a system devised by Kabat et al. This system is described in Kabat et al., 1987, Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA (Kabat et al., 1992, hereafter "Kabat et al."). The designation of Kabat residues does not necessarily directly correspond to the linear numbering of amino acid residues in the sequence of sequence numbers. The actual linear amino acid sequence may contain fewer or more amino acids than the strict Kabat numbering, which corresponds to the shortening or insertion of structural components, whether it be the framework of the basic variable domain structure or the complementary determination regions (CDRs). The precise Kabat numbering of residues can be determined for a given antibody by aligning homologous residues in the antibody sequence with a “standard” Kabat-numbered sequence. The CDRs of the heavy chain variable domain are located at residues 31-35 (H-CDR1), 50-65 (H-CDR2), and 95-102 (H-CDR3) according to the Kabat numbering system. The CDRs of the light chain variable domain are located at residues 24-34 (L-CDR1), 50-56 (L-CDR2), and 89-97 (L-CDR3) according to the Kabat numbering system. For the antibodies described below, the CDRs were determined using the CDR discovery algorithm from www.bioinf.org.uk. - See the antibody page <<How to identify the CDRs by looking at a sequence> See the section with the title >.

[0034] As used herein, the term “antibody fragment” refers to at least a portion of an intact antibody, preferably the antigen-binding region or variable region of the intact antibody, that retains the ability to specifically interact with an antigen epitope (e.g., by binding, steric hindrance, stabilization / destabilization, or spatial distribution). “Fragment” includes a portion of an intact antibody, generally including the antigen-binding site or variable region. Examples of antibody fragments include any antibody fragment (referred herein to as “single-chain antibody fragment” or “single-chain polypeptide”) which is a polypeptide having a primary structure consisting of Fab, Fab', Fab'-SH, F(ab')2, and Fv fragments, a diabody, and one uninterrupted sequence of adjacent amino acid residues, and includes, but is not limited to, an antibody fragment containing (1) a single-chain Fv molecule, (2) a fragment containing a single light-chain variable domain without an associated heavy-chain moiety, or three CDRs of the light-chain variable domain, and (3) an antibody fragment containing a single heavy-chain variable region without an associated light-chain moiety, or three CDRs of the heavy-chain variable region, as well as a polyspecific antibody formed from the antibody fragment. Fragments of this antibody can be obtained using standard methods.

[0035] As used herein, the terms “single-domain antibody,” “sdAb,” or “VHH” refer to a single heavy-chain variable domain of an antibody of a type that can be found in nature in camelid mammals lacking a light chain. Such VHHs are also called “nanobody®.” According to the present invention, the sdAb may be, in particular, a llama sdAb.

[0036] As used herein, the term "scFv" refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light and heavy chain variable regions are sequentially linked via, for example, a synthetic linker, for example, a short flexible polypeptide linker, and can be expressed as a single-chain polypeptide, wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used herein, the scFv may have the VL and VH variable regions in either order with respect to the N-terminus and C-terminus of the polypeptide, and the scFv may comprise a VL-linker-VH or a VH-linker-VL.

[0037] As used herein, the term “specificity” refers to the ability of an antibody to detectably bind to a target molecule (e.g., an epitope presented on an antigen) while exhibiting relatively low detectable reactivity with other target moieties. Specificity can be determined relatively by binding or competitive binding assays, for example, using a Biacore instrument, as described elsewhere herein. Specificity can be expressed, for example, by the affinity / avidity ratio of binding to a specific antigen versus nonspecific binding to other unrelated molecules, such as about 10:1, about 20:1, about 50:1, about 100:1, 10,000:1, or higher.

[0038] As used herein, the term "affinity" refers to the strength of binding of an antibody to a target molecule (e.g., an epitope). The affinity of a binding protein is denoted by the dissociation constant Kd. For antibodies, Kd is defined as [Ab] × [Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of the unbound antibody, and [Ag] is the molar concentration of the unbound antigen. The affinity constant Ka is defined by 1 / Kd. Preferred methods for determining the affinity of binding proteins can be found in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1988), Coligan et al., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, NY, (1992, 1993), and Muller, Meth. Enzymol. 92: pp. 589-601 (1983), and these references are fully incorporated herein by reference. One of the preferred standard methods well known in the art for determining the affinity of binding proteins is the use of a Biacore instrument.

[0039] As used herein, the term "binding" refers to a direct bond between two molecules resulting from interactions such as covalent bonds, electrostatic bonds, hydrophobic bonds, ionic bonds, and / or hydrogen bonds, including interactions such as salt bridges and water bridges. In particular, as used herein, the term "binding" typically refers to about 10 degrees in the context of antibody binding to a given target molecule (e.g., an antigen or epitope). -7 M or less, for example, about 10 -8 M or less, for example, about 10 -9 M or less, about 10 -10 M or less, or about 10 -11 M or less than K D This is a bond that has an affinity equivalent to [a certain type of bond].

[0040] As used herein, the terms “subject,” “host,” “individual,” or “patient” refer to a male or female mammal of any age requiring treatment, preferably a human.

[0041] As used herein, the terms “treatment” or “to treat” include both prophylactic or preventive treatments and curative or disease-modifying treatments, including treatments for patients at risk of developing the disease or suspected of having the disease, and patients who are ill or diagnosed with the disease or condition, and include the suppression of clinical relapses. Treatments may be administered to patients with medical impairment or those likely to acquire impairment in order to prevent, cure, or delay the onset of impairment or recurrent impairment, reduce its severity, improve one or more symptoms, or extend the patient’s survival beyond the expected survival in the absence of such treatment. “Treatment regimen” means a pattern of treatment for a disease, for example, a pattern of medication used during treatment. A treatment regimen may include an induction regimen and a maintenance regimen. The terms “induction regimen” or “induction period” refer to a treatment regimen (or part of a treatment regimen) used for the initial treatment of a disease. The general goal of an induction regimen is to provide the patient with a high level of medication during the initial period of the treatment regimen. Induction regimens may (in part or in whole) be “loading regimens,” which may include administering a higher dose of the drug than the physician uses in the maintenance regimen, administering the drug more frequently than the physician uses in the maintenance regimen, or both. The terms “maintenance regimen” or “maintenance period” refer to a treatment regimen (or part of a treatment regimen) used to maintain a patient during treatment for a disease, for example, to keep the patient in remission for an extended period (several months or several years). Maintenance regimens may be continuous treatment (e.g., administering the drug at regular intervals, e.g., weekly, monthly, yearly) or intermittent treatment (e.g., intermittent treatment, intermittent treatment, treatment on relapse, or treatment upon achievement of certain predetermined criteria [e.g., pain, disease findings, etc.]).

[0042] As used herein, the term “pharmaceutical composition” refers to a composition described herein, including other components such as carriers and / or excipients, or a pharmaceutically acceptable salt thereof. The pharmaceutical compositions provided herein typically include a pharmaceutically acceptable carrier.

[0043] As used herein, the term “pharmaceutically acceptable carrier” includes any solvent, diluent, or other liquid vehicle suitable for a particular dosage form, dispersant or suspension aid, surfactant, isotonic agent, thickener or emulsifier, preservative, solid binder, lubricant, etc. Remington's Pharmaceutical-Sciences, 6th edition, EW Martin (Mack Publishing Co., Easton, Pa., 1980) discloses various carriers used in the formulation of pharmaceutical compositions and known techniques for their preparation.

[0044] Extracellular vesicles of the present invention: The first object of the present invention relates to isolated extracellular vesicles that are functionalized at a targeting site, loaded with one or more cargoes of interest, and optionally functionalized with HERV envelope proteins.

[0045] Targeting area: According to the present invention, the targeting site is a polypeptide having binding domains. The term "binding domain," as used herein, refers to one or more regions of a polypeptide that mediate specific binding to a target molecule (e.g., an antigen, ligand, receptor, substrate, or inhibitor). Examples of binding domains include antibody variable domains, ligand-binding domains of ligands, ligand-binding domains of receptors, or enzyme domains. The term "ligand-binding domain," as used herein, refers to any innate receptor (e.g., a cell surface receptor) or any region or derivative thereof that retains at least the qualitative ligand-binding ability of the corresponding innate receptor. The term "receptor-binding domain," as used herein, refers to any innate ligand or any region or derivative thereof that retains at least the qualitative receptor-binding ability of the corresponding innate ligand. In some embodiments, the polypeptide comprises at least one, two, three, four, or five binding sites. The polypeptide may be a monomer or a polymer. For example, in some embodiments, the polypeptide is a dimer. In some embodiments, the dimer is a homodimer comprising two identical monomeric subunits. In some embodiments, the dimer is a heterodimer containing two non-identical monomeric subunits. The dimer's subunits may contain one or more polypeptide chains. For example, in some embodiments, the dimer contains at least two polypeptide chains. In some embodiments, the dimer contains two polypeptide chains. In some embodiments, the dimer contains four polypeptide chains (for example, as in an antibody molecule).

[0046] In some embodiments, the targeting site is a ligand.

[0047] In some embodiments, the targeting site is scFv or VHH or other functional fragments containing immunoglobulin without a light chain, Fab, Fab', F(ab *)2, Fv, antibody fragment, diabody, scAB, single-domain heavy chain antibody, single-domain light chain antibody, Fd, CDR region, etc., are antibodies or antibody fragments, or any part of an antibody or peptide sequence capable of binding an antigen or epitope. Therefore, in some embodiments, the polypeptide having a binding domain is a light chain immunoglobulin chain. In some embodiments, the polypeptide having a binding domain is a heavy chain immunoglobulin chain. In some embodiments, the polypeptide having a binding domain is a single heavy chain variable domain of an antibody of a type that can be found in nature in camelid mammals that lack a light chain. Such single-domain antibodies are also called VHH or “nanobody®”. Furthermore, for a general explanation of (single) domain antibodies, please refer to the prior art cited above, as well as European Patent No. 0368684, Ward et al. (Nature, October 12, 1989; 341(6242): pp. 544-546), Holt et al., Trends Biotechnol., 2003, 21(11): pp. 484-490; and International Publication Nos. 06 / 030220 and 06 / 003388.

[0048] Techniques for preparing and using various antibody-based constructs and fragments are well known in the art (see, for example, Kohler and Milstein, Nature, 256:495, 1975).

[0049] In some embodiments, the antibody is a monoclonal antibody.

[0050] In some embodiments, the targeting site has binding affinity to a cell surface molecule of the target cell. In some embodiments, the cell surface molecule is a receptor. In some embodiments, the cell surface molecule is a transmembrane protein. In some embodiments, the targeting moiety is specific to a target protein antigen, carbohydrate antigen, or glycosylated protein. For example, an antibody may target glycosylated groups of antigens preferentially produced by transformed (neoplastic or cancerous) cells, infected cells, etc. (cells associated with other immune system-related disorders).

[0051] A partial list of suitable mammalian cells that can be targeted by the targeting site of the present invention includes, but is not limited to, blood cells, myoblasts, bone marrow cells, peripheral blood cells, umbilical cord blood cells, cardiomyocytes (and their progenitor cells), chondrocytes (chondrocytes), dendritic cells, fetal nerve tissue, fibroblasts, hepatocytes (liver cells), islet cells, keratinocytes (skin cells), and stem cells.

[0052] In some embodiments, the targeting site is particularly suitable for targeting populations of malignant cells. Therefore, in some embodiments, the targeting site is specific to cancer antigens. Known cancer antigens include, but are not limited to, c-erbB-2 (also known as c-neu or HER-2), which is associated with cells of breast, ovarian, and colon tumors, as well as neuroblastoma, lung cancer, thyroid cancer, pancreatic cancer, prostate cancer, kidney cancer, and gastrointestinal cancers. Another type of cancer antigen is non-enzymatic carcinoembryonic protein. These antigens are found in a variety of neoplasms and are often referred to as "tumor-associated antigens." Carcinoembryonic antigen (CEA) and alpha-fetoprotein (AFP) are two examples of such cancer antigens. AFP levels are elevated in patients with hepatocellular carcinoma: 69% of patients with liver cancer express high levels of AFP in their serum. CEA is a 200 kDa serum glycoprotein found in adenocarcinoma of the colon, as well as cancers of the lung and genitourinary tract. Another type of cancer antigen is specific to a particular tumor, sometimes referred to as a “tumor-specific antigen,” such as heat shock proteins derived from certain types of tumors (e.g., hsp70 or hsp90 proteins). Other targets include the MICA / B ligand of NKG2D. These molecules are expressed in many types of tumors but are not normally expressed in healthy cells.Further specific examples of cancer antigens include epithelial cell adhesion molecules (Ep-CAM / TACSTD1), mesothelin, tumor-associated glycoprotein 72 (TAG-72), gp100, Melan-A, MART-1, KDR, RCAS1, MDA7, cancer-associated viral vaccines (e.g., human papillomavirus antigen), prostate-specific antigens (PSA, PSMA), RAGE (renal antigen), CAMEL (CTL-recognizing antigen on melanoma), and CT antigens (MAGE-B5, -B6, -C2, -C). Examples include 3, and D; Mage-12; CT10; NY-ESO-1, SSX-2, GAGE, BAGE, MAGE, and SAGE), mucin antigens (e.g., MUC1, mucin-CA125), cancer-associated ganglioside antigens, tyrosinase, gp75, C-myc, Mart1, MelanA, MUM-1, MUM-2, MUM-3, HLA-B7, Ep-CAM, tumor-derived heat shock proteins, etc. (Similarly, for example, Acres et al., Curr See Opin Mol Ther, February 6, 2004: pp. 40-47; Taylor-Papadimitriou et al., Biochim Biophys Acta, October 8, 1999; 1455(2-3): pp. 301-313; Emens et al., Cancer Biol Ther, July-August 2003; 2(4Suppl1): pp. S161-18; and Ohshima et al., Int J Cancer, July 1, 2001; 93(1): pp. 91-96). Other exemplary cancer antigen targets include CA195 tumor-associated antigen-like antigens (see, e.g., U.S. Patent No. 5,324,822) and female urine squamous cell carcinoma-like antigens (see, e.g., U.S. Patent No. 5,306,811), and mammary cell carcinoma antigens described in U.S. Patent No. 4,960,716.

[0053] In some embodiments, the targeting regions are CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD5, CD6, CD7, CD8 alpha, CD8 beta, CD9, CD10, CD11a, CD11b, CD11c, CDw12, CD13, CD14, CD15u, CD16a, CD16b, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33 , CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42a, CD42b, CD42c, CD42d, CD43, CD44, CD44R, CD45, CD46, CD47R, CD48, CD49a, CD49b, CD49c, CD49d , CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD60a, CD60b, CD60c, CD61, CD62E, CD62L, CD62P, CD63, CD64, CD65, CD65s, CD66a, CD66b, CD66c, CD66d, CD66e, CD66f, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD75s, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, C D85, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CDw93, CD94, CD95, CD96, CD97, CD98, CD99, CD100, CD101, CD102, CD103, CD104, CD105, CD106, CD107a, C D107b, CD108, CD109, CD110, CD111, CD112, CDw113, CD114, CD115, CD116, CD117, CD118, CDw119, CD120a, CD120b, CD121a, CDw121b, CD122, CD123, CD12 4, CDw125, CD126, CD127, CDw128a, CDw128b, CD129, CD130, CD131, CD132, CD133, CD134, CD135, CDw136, CDw137, CD138, CD139, CD140a, CD140b, CD141,CD142、CD143、CD144、CDw145、CD146、CD147、CD148、CDw149、CD150、CD151、CD152、CD153、CD154、CD155、CD156a、CD156b、CDw156C、CD157、CD158、CD159a、CD159c、CD160、CD161、CD162、CD162R、CD163、CD164、CD165、CD166、CD167a、CD168、CD169、CD170、CD171、CD172a、CD172b、CD172g、CD173、CD174、CD175、CD175s、CD176、CD177、CD178、CD179a、CD179b、CD180、CD181、CD182、CD183、CD184、CD185、CDw186、CD191、CD192、CD193、CD195、CD196、CD197、CDw198、CDw199、CDw197、CD200、CD201、CD202b、CD203c、CD204、CD205、CD206、CD207、CD208、CD209、CDw210、CD212、CD213a1、CD213a2、CDw217、CDw218a、CDw218b、CD220、CD221、CD222、CD223、CD224、CD225、CD226、CD227、CD228、CD229、CD230、CD231、CD232、CD233、CD234、CD235a、CD235b、CD235ab、CD236、CD236R、CD238、CD239、CD240CE、CD240D、CD240DCE、CD241、CD242、CD243、CD244、CD245、CD246、CD247、CD248、CD249、CD252、CD253、CD254、CD256、CD257、CD258、CD261、CD262、CD263、CD264、CD265、CD266、CD267、CD268、CD269、CD271、CD272、CD273、CD274、CD275、CD276、CD277、CD278、CD279、CD280、CD281、CD282、CD283、CD284、CD289、CD292、CDw293、CD294、CD295、CD296、CD297、CD298、CD299、CD300a、CD300c、CD300e、CD301、CD302、CD303、CD304、CD305、It has binding affinity to CD (differentiation cluster) molecules selected from the group consisting of CD306, CD307, CD309, CD312, CD314, CD315, CD316, CD317, CD318, CD319, CD320, CD321, CD322, CD324, CDw325, CD326, CDw327, CDw328, CDw329, CD331, CD332, CD333, CD334, CD335, CD336, CD337, CDw338, and CD339.

[0054] In some embodiments, the targeting site is conjugated to an extracellular vesicle (EV) by a tethering system.

[0055] As used herein, "tethering system" refers to a structure anchored to an extracellular vesicle that includes a portion capable of forming a reversible or irreversible covalent bond with a targeting site. Therefore, the system is primarily used to conjugate a targeting site to an extracellular vesicle.

[0056] In some embodiments, the extracellular vesicles are conjugated to a biotinylated targeting moiety and an avidin moiety capable of creating an avidin-biotin complex. As used herein, the term "biotinylated" refers to any covalent or non-covalent adduct between biotin and other moieties such as the targeting moieties of the present invention. As used herein, the term "avidin" includes the natural egg white protein avidin, as well as any derivatives, analogs, and other non-natural forms of avidin that can specifically bind to biotin moieties. In some embodiments, the avidin moiety is avidin in a deglycosylated form, a bacterial streptavidin produced by a selected strain of Streptomyces, such as Streptomyces avidinii, a cleaved streptavidin, as well as recombinant avidin and streptavidin, and derivatives of natural, deglycosylated, and recombinant avidin, and natural, recombinant, and cleaved streptavidin, such as N-acylavidin, such as N-acetyl, N-phthalyl, and N-succinyl avidin, and commercially available products ExtrAvidin®, Captavidin®, Neutravidin®, and Neutralite Avidin®. All forms of avidin-type molecules, including both natural and recombinant avidin and streptavidin and derivatized molecules such as deglycosylated avidin, N-acylavidin, and cleaved streptavidin, are encompassed within the term "avidin". Thus, the term encompasses any derivative of avidin that is monomeric or multimeric, lacks multimerization, or has an increased affinity that is pH-sensitive. As used herein, "biotin-avidin complex" and its variants refer to the specific binding formed between a biotin moiety and an avidin moiety. Typically, the biotin moiety can bind to the avidin moiety with high affinity, and the dissociation constant Kd is typically on the order of 10 -14 ~10 -15 mol / L. Typically, such binding occurs via non-covalent interactions.

[0057] In some embodiments, streptavidin consists of the amino acid sequence described in SEQ ID NO: 3. [ka]

[0058] In some embodiments, the avidin moiety is conjugated to an extracellular vesicle by any method well known in the art. For example, polypeptides such as the avidin moiety have been shown to be covalently linked to myristic acid by i) an amide bond to the N-terminal glycine residue, to a fatty acid or diacylglycerol by an amide or thioether bond to the N-terminal cysteine, respectively, or to a phosphatidylinositol (PI) molecule by the C-terminal amino acid of the protein (see Low, Biochem. J. 244: pp. 1-13, 1987 for an overview). In the latter case, the PI molecule is linked to the C-terminus of the protein by an intervening glycan structure, and subsequently the PI embeds itself in the phospholipid bilayer. Thus, in some embodiments, the avidin moiety is conjugated to a GPI anchor. As used herein, the term “GPI anchor” includes glycosylphosphatidylinositol (phosphatidylinositol-glycan) (GPI) bond that anchors the polypeptide to the surface. These anchors conjugate polypeptides (e.g., avidin moieties) to phospholipids, such as phosphatidylinositol, via oligosaccharide linkages. Such linkages can be cleaved by phosphatidylinositol-specific phospholipase C. GPI-anchored polypeptides may have signal sequences at their carboxyl termini that are cleaved and replaced by the GPI anchors (see, for example, U.S. Patent No. 5,891,432). Incorporation of GPI anchors into the carboxyl termini of the avidin moiety allows the moiety to be directed to the surface of extracellular vesicles.

[0059] In some embodiments, the avidin moiety is fused to a GPI anchor having the amino acid sequence described in SEQ ID NO: 4, forming an "adapter protein." Thus, the adapter fusion protein can be anchored to the extracellular vesicle of the present invention via GPI and capture a biotinylated targeting site (e.g., an antibody). [ka]

[0060] In some embodiments, the avidin moiety is also optionally fused to one or more tags. As used herein, the term “tag” refers to any chemical portion of a nucleotide, oligonucleotide, polynucleotide, amino acid, peptide, protein, or other chemical substance that, when attached to another sequence, provides further utility to that sequence, or confers useful properties to that sequence, particularly in detection or isolation. Examples of tags include, but are not limited to, glutathione S-transferase (GST), green fluorescent protein (GFP), maltose-binding protein (MBP), Nus-tag (NusA protein), thioredoxin (Trx), Fc-tag (immunoglobulin Fc domain), e.g., rabbit IgG, mouse IgG, goat IgG, rat IgG, bovine IgG, or canine IgG, carbohydrate-binding module (CBM), yellow fluorescent protein, mCherry, β-galactosidase, digoxigenin, biotin, small molecular weight ubiquitin-like modifier (SUMO), AviTag, calmodulin-tag, polyglutamate-tag, E-tag, Flag-tag, HA-tag, His-tag, Myc-tag, S-tag, SBP-tag, Strep-tag, TC-tag, V5-tag, VSV-tag, Xpress-tag, Isopeptag, and Spy-tag. In some embodiments, the avidin moiety is fused to one or more fluorescent proteins. As used herein, the term "fluorescent protein" refers to fluorescent proteins produced by various organisms, such as those of the genera Renilla and Aequorea, as well as modified forms of these naturally occurring fluorescent proteins that may fluoresce in a wide range of visible colors. A broad range of wavelengths of visible light are emitted by these proteins depending on the specific modifications applied.Non-limiting examples of fluorescent proteins include those isolated from Aequorea victoria, Aequorea coerulescens, Renilla reniformis, Zoanthus sp., Anemonia majano, Anemonia sulcata, Heteractis crispa, Discosoma striata, Clavularia sp., and Phialidium gregarium. Furthermore, non-limiting examples include variants of wild-type fluorescent proteins possessing improved fluorescence, improved stability, various physiological requirements, or alterations in the excitation emission spectrum. Appropriate examples are known in the art. In one embodiment, the fluorescent donor or acceptor may be Aequoria victoria green fluorescent protein (GFP), Aequoria coelurescens GFP (AcGFP), high-sensitivity green fluorescent protein (EGFP), GFPuv, blue fluorescent protein (BFP), cyan fluorescent protein (CFP), high-sensitivity cyan fluorescent protein (ECFP), yellow fluorescent protein (YFP), pH-insensitive variant of YFP (YFPi), red fluorescent protein (RFP), amFP486, cFP484, drFP583, and mCherry. In some embodiments, the avidin moiety is fused to one or more luciferase fragment polypeptides. Typically, the luciferase protein fragment is derived from a luciferase selected from the group consisting of sea urchin luciferase, Gaussian luciferase, firefly luciferase, and Nanoluc.

[0061] In some embodiments, the adapter protein is obtained from a fusion between monomeric streptavidin, the fluorescent protein mCherry, and a GPI anchor, as described in the Examples and Figure 12. In some embodiments, the adapter protein comprises the amino acid sequence described in Sequence ID No. 5. In some embodiments, the fusion adapter protein further comprises nanoluciferase (NLuc), as described in the Examples and Figure 12. In some embodiments, the adapter protein comprises the amino acid sequence described in Sequence ID No. 6. [ka] [ka]

[0062] cargo: Typically, cargo can have any properties of load and suitability in an EV.

[0063] In some embodiments, the cargo is selected from the group consisting of organic molecules, polymers, polypeptides, polynucleotides, and small organic compounds having a molecular weight greater than 50 daltons and less than about 2,500 daltons. The cargo may also be found among biomolecules including peptides, sugars, fatty acids, lipids, steroids, purines, pyrimidines, their derivatives, structural analogs, or combinations.

[0064] In some embodiments, the cargo includes chemotherapeutic agents, anti-inflammatory agents, hormones or hormone antagonists, ion channel modifiers, and neuroactive agents. Exemplary pharmaceuticals suitable for the present invention are described in "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, NY, (1996), 9th edition, in the sections: Drugs Acting at Synaptic and Neuroeffector Junctional Sites; Drugs Acting on the Central Nervous System; Autoacoids; Drug Therapy of Inflammation; Water, Salts and Ions; Drugs Affecting Renal Function and Electrolyte Metabolism; Cardiovascular Drugs; Drugs Affecting Gastrointestinal Function; Drugs Affecting Uterine Motility; Chemotherapy of Parasitic Infections; Chemotherapy of Microbial Diseases; Chemotherapy of Neoplastic Diseases; Drugs Used for Immunosuppression; Drugs Acting on Blood-Forming Organs; Hormones and Hormone This includes the descriptions in Antagonists; Vitamins, Dermatology; and Toxicology, all of which are incorporated herein by reference. It also includes toxins, as well as warfare agents and chemical weapons agents; see, for example, Somani, SM (ed.), "Chemical Warfare Agents," Academic Press, New York, 1992.

[0065] In some embodiments, the cargo is a polynucleotide. In some embodiments, the polynucleotide is an RNA or DNA molecule.

[0066] In some embodiments, polynucleotides can be introduced into target cells of a tissue or organ and expressed under appropriate conditions, or in other circumstances, they can confer beneficial properties to the cells. Therefore, polynucleotides are selected based on the desired therapeutic outcome. For example, polynucleotides encode polypeptides that confer beneficial properties to cells or desired therapeutic outcomes. Examples of polynucleotides of interest include, but are not limited to, those encoding polypeptides selected from protective polypeptides (e.g., neuroprotective polypeptides such as GDNF, CNTF, NT4, NGF, and NTN); anti-angiogenic polypeptides (e.g., soluble vascular endothelial growth factor (VEGF) receptors; VEGF-binding antibodies; VEGF-binding antibody fragments (e.g., single-chain anti-VEGF antibodies)); and anti-apoptotic polypeptides (e.g., Bcl-2, Bcl-Xl).

[0067] In some embodiments, polynucleotides encode antigens. As used herein, the term “antigen” has its general meaning in the art and generally refers to a substance or fragment thereof that is recognized and selectively bound by an antibody or a T cell antigen receptor, resulting in the induction of an immune response. Antigens according to the present invention are typically, but not exclusively, peptides and proteins. In the context of the present invention, an antigen may include any subunit, fragment, or epitope of any proteinaceous molecule, including proteins or peptides of viral, bacterial, parasitic, fungal, protist, prion, cellular, or extracellular origin, which ideally induces an immune response in mammals, preferably resulting in protective immunity. In some embodiments, the antigen is a tumor antigen. In particular, the antigens belong to the following virus families: Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Badnavirus, Barnaviridae, Birnaviridae, Bromoviridae, Bunyaviridae, Caliciviridae (e.g., norovirus (also known as "Norwalk-like virus")), Capillovirus, and Carlavirus (C arlavirus), caulimovirus, Circoviridae, Closterovirus, Comoviridae, Coronaviridae (e.g., Severe Acute Respiratory Syndrome (SARS) virus, or coronaviruses such as SARS-CoV-2), Corticoviridae, Cystoviridae, Deltavirus, Dianthovirus, Enamovirus, Filoviridae (e.g.,Marburg virus and Ebola virus (e.g., Zaire, Reston, Ivory Coast, or Sudan strains), Flaviviridae (e.g., Hepatitis C virus, Dengue virus 1, Dengue virus 2, Dengue virus 3, and Dengue virus 4), Hepadnaviridae (e.g., Hepatitis B virus or Hepatitis C virus), Herpesviridae (e.g., Human herpesvirus (HSV) 1, 2, 3, 4, 5, and 6, Cytomegalovirus, and EPS virus) Taymbar virus (EBV), Hypoviridae, Iridoviridae, Leviviridae, Lipothrixviridae, Microviridae, Orthomyxoviridae (e.g., influenza viruses A and B), Papovaviridae, Papillomavirus The peptides may be derived from any virus, including but not limited to viruses from any of the following families: Papillomaviridae (e.g., human papillomavirus (HPV)), Paramyxoviridae (e.g., measles, mumps, and human multinucleated respiratory virus (RSV)), Parvoviridae, Picornaviridae (e.g., poliovirus, rhinovirus, hepatovirus, and aftovirus (e.g., foot-and-mouth disease virus)), Poxviridae (e.g., vaccinia virus), Reoviridae (e.g., rotavirus), Retroviridae (e.g., lentiviruses such as human immunodeficiency virus (HIV) 1 and HIV 2), Rhabdoviridae, and Totiviridae.

[0068] In some embodiments, the polynucleotide of the present invention is an RNA molecule, particularly messenger RNA (mRNA). In some embodiments, the EV encapsulates one or more RNA molecules capable of i) transferring one or more endogenous or exogenous coding sequences of interest to a target cell, ii) transferring one or more non-coding RNAs, such as RNA capable of inducing an effect on gene expression using shRNA, miRNA, sgRNA, LncRNA, or circRNA, iii) transferring intracellular RNA of a messenger RNA type or other (such as miRNA), a subgenome replicon of an RNA virus (such as HCV), or the complete genome of an RNA virus, iv) co-expression of endogenous or exogenous coding or non-coding sequences in the target cell, or vi) inducing involvement of a genome manipulation system, such as the CRISPR system, in modifying the target cell's genome.

[0069] In some embodiments, the polynucleotide is an antisense or siRNA sequence that acts to reduce the expression of a targeted sequence. Antisense or siRNA nucleic acids are designed to bind specifically to RNA, resulting in the formation of RNA-DNA or RNA-RNA hybrids with the cessation of DNA replication, reverse transcription, or messenger RNA translation. Gene expression is reduced through various mechanisms. Antisense nucleic acids based on selected nucleic acid sequences can interfere with the expression of the corresponding gene. Antisense oligodeoxynucleotides (ODNs) include synthetic ODNs with chemical modifications derived from natural nucleic acids, or nucleic acid constructs that express antisense molecules such as RNA. A single antisense molecule or a combination of antisense molecules may be administered, where the combination may include multiple different sequences. Antisense oligonucleotides generally have a length of at least about 7, usually at least about 12, more typically at least about 20 nucleotides, about 500 or less, usually about 50 or less, and more typically about 35 or less, where the length is governed by specificity, including the efficiency of inhibition and the lack of cross-reactivity.

[0070] Furthermore, RNAi agents are of interest. RNAi agents are small ribonucleic acid molecules present in a double-strand structure (referred to herein as interfering ribonucleic acids), i.e., oligoribonucleotides, for example, two distinct oligoribonucleotides hybridized to form a double-strand structure, or a single ribooligonucleotide that takes small hairpin formation. Oligoribonucleotide means a ribonucleic acid that does not exceed about 100 nt, and usually does not exceed about 75 nt, where in certain embodiments the length is less than about 70 nt. When the RNA agent is a double-strand structure of two distinct ribonucleic acids hybridized to each other, for example siRNA, the length of the double-strand structure is usually in the range of about 15 to 30 bp, usually about 15 to 29 bp, where in certain embodiments a length of about 20 to 29 bp, for example 21 bp, 22 bp is particularly desired. If the RNA agent is a double-stranded structure of a single ribonucleic acid present during hairpin formation, i.e., shRNA, the length of the hybridized portion of the hairpin is typically the same as that provided above for the siRNA type, or 4-8 nucleotides longer.

[0071] In some embodiments, the cargo is a polynucleotide encoding an endonuclease, base editing enzyme, epigenome editing enzyme, or prime editor, as described later in this specification.

[0072] In some embodiments, the cargo is a polypeptide. Examples of the polypeptide of interest include biologically active proteins such as transcription factors, proteins involved in signaling pathways, cytokines, chemokines, and toxins. Such polypeptides may include proteins not found in the target cell, proteins from different species, or cloned versions of proteins found in the target cell. Preferred target proteins of the present invention are those whose post-translational modifications are expressed in the same manner as those found in the target cell and that have the same state as those found in the target cell. Such modifications include glycosylation or lipid modification, coenzyme addition, or quaternary structure formation. Wild-type proteins corresponding to mutant forms or proteins not present in the target cell are most preferred. In some embodiments, the polypeptide is a membrane protein or a non-membrane protein. Non-limiting examples of membrane proteins include ion channels, receptor tyrosine kinases such as PDGF receptors and SCF-R receptors (stem cell factor receptors, or c-kit, or CD117), and G protein-coupled receptors such as adrenaline receptors. Non-membrane proteins include cytoplasmic proteins such as actin, Ras, and ERK1 / 2, as well as nuclear proteins such as steroid receptors, histone proteins, or transcription factors.

[0073] In some embodiments, the cargo is an endonuclease that provides site-specific knockdown of gene function. For example, if a dominant allele encodes a defective copy of a gene that is a structural protein and / or provides normal function in the wild type, a site-specific endonuclease can target the defective allele and knock it out. In addition to knocking out the defective allele, site-specific nucleases can also be used to stimulate homologous recombination with donor DNA encoding a functional copy of the protein encoded by the defective allele. Thus, for example, the method of the present invention can be used to deliver a site-specific endonuclease that knocks out a defective allele, and can also be used to deliver a functional copy of the defective allele, resulting in repair of the defective allele and thereby providing the production of a functional protein.

[0074] In some embodiments, the DNA-targeting endonuclease is a transcription-activating effector nuclease (TALEN). TALENs are artificially produced by fusing TAL effector ("TALE") DNA-binding domains, such as one or more TALEs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 TALEs), to a DNA modification domain, such as a FokI nuclease domain. The transcription-activating effector (TALE) can be designed to bind to any desired DNA sequence (Zhang (2011), Nature Biotech. 29: pp. 149-153). By combining the manipulated TALE with a DNA-cleaving domain, restriction enzymes specific to any desired DNA sequence can be produced. These can then be introduced into cells, where they can be used for genome editing (Boch (2011) Nature Biotech. 29: pp. 135-136; and Boch et al. (2009) Science 326: pp. 1509-1512; Moscou et al. (2009) Science 326: p. 3501). TALE is a protein secreted by bacteria of the genus Xanthomonas. The DNA-binding domain contains a repeating, highly conserved sequence of 33-34 amino acids, except for the 12th and 13th amino acids. These two positions are highly variable and show a strong correlation with specific nucleotide recognition. Therefore, they can be manipulated to bind to a desired DNA sequence (Zhang (2011), Nature Biotech. 29: pp. 149-153). To produce TALEN, the TALE protein is fused to a nuclease (N), e.g., wild-type or mutant FokI endonuclease.Several mutations in FokI have been made for its use in TALENs, for example, to improve cleavage specificity or activity (Cermak et al. (2011) Nucl. Acids Res. 39:e82; Miller et al. (2011) Nature Biotech. 29:pp. 143-148; Hockemeyer et al. (2011) Nature Biotech. 29:pp. 731-734; Wood et al. (2011) Science 333:p. 307; Doyon et al. (2010) Nature Methods 8:pp. 74-79; Szczepek et al. (2007) Nature Biotech. 25:pp. 786-793; and Guo et al. (2010) J. Mol. Biol. 200:p. 96). The FokI domain functions as a dimer, requiring two constructs with specific DNA-binding domains for a site in the target genome that has the appropriate orientation and spacing. The number of amino acid residues between the TALE DNA-binding domain and the FokI cleavage domain, as well as the number of bases between the two individual TALEN-binding sites, appear to be important parameters for achieving high levels of activity (Miller et al. (2011) Nature Biotech. 29: pp. 143-148). TALENs can be used intracellularly to induce double-strand breaks in target nucleic acids, such as at sites within genes. Mutations can be introduced at the cleavage site if the repair mechanism improperly repairs the break via non-homologous end joining (Huertas, P., Nat. Struct. Mol. Biol. (2010) 17: pp. 11-16). For example, improper repair can introduce frameshift mutations. Alternatively, foreign DNA can be introduced into cells along with TALENs, and depending on the sequence of the foreign DNA and chromosome sequence, this process can be used to modify target genes via homologous direct repair pathways, for example, by correcting defects in the target gene and thus causing expression of the repaired target gene, or by introducing such defects into the wt gene and thus reducing the expression of the target gene.

[0075] In some embodiments, the DNA-targeting endonuclease is a zinc finger nuclease (ZFN). Similar to TALENs, a ZFN is a FokI nuclease domain (or a derivative thereof) fused to a DNA modification domain, such as a nuclease domain, such as a DNA-binding domain. In the case of a ZFN, the DNA-binding domain contains one or more zinc fingers, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 zinc fingers (Carroll et al. (2011) Genetics Society of America 188:773-782; and Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-1160). A zinc finger is a small protein structural motif stabilized by one or more zinc ions. A zinc finger can include, for example, Cys2His2 and can recognize a sequence of approximately 3 bp. Various zinc fingers with known specificities can be combined to produce multi-finger polypeptides that recognize approximately 6, 9, 12, 15, or 18 bp sequences. A variety of selection and modular assembly techniques, including phage displays, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells, are available for generating zinc fingers (and combinations thereof) that recognize specific sequences. Zinc fingers can be manipulated to bind to predetermined nucleic acid sequences. Criteria for manipulating zinc fingers to bind to predetermined nucleic acid sequences are known in the art (Sera (2002), Biochemistry, 41:7074-7081; Liu (2008), Bioinformatics, 24:1850-1857). ZFNs using the FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. The two individual ZFNs must have their nucleases properly spaced apart to join opposite strands of DNA (Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: pp. 10570-1055).Furthermore, similar to TALENs, ZFNs can create DSBs in DNA, which can generate frameshift mutations if improperly repaired, for example, via non-homologous end joining, leading to a decrease in the expression of target genes in cells.

[0076] In some embodiments, DNA-targeting endonucleases are CRISPR-associated endonucleases. In bacteria, the CRISPR / Cas locus encodes an RNA-induced adaptive immune system against mobile genetic elements (viruses, translocation elements, and conjugative plasmids). Three types (I-VI) of CRISPR systems have been identified. CRISPR clusters contain spacers, which are sequences complementary to the preceding mobile elements. CRISPR clusters are transcribed and processed into mature CRISPR (clustered, regularly arranged, short palindromic sequence repeats) RNA (crRNA). CRISPR-associated endonucleases Cas9 and Cpf1 belong to the type II and type V CRISPR / Cas systems and possess potent endonuclease activity for cleaving target DNA. Cas9 is induced by transactivating small RNA (tracrRNA) that acts as a guide for ribonuclease III-assisted processing of mature crRNA and precrRNA containing approximately 20 nucleotides (called spacers) of a specific target sequence. The crRNA:tracrRNA double helix guides Cas9 to target DNA via complementary base pairing between a spacer on the crRNA and a complementary sequence on the target DNA (called a protospacer). Cas9 recognizes the trinucleotide (NGG) protospacer adjacent motif (PAM) to identify the cleavage site (the third or fourth nucleotide from the PAM). crRNA and tracrRNA can be expressed separately or engineered into artificial fusion small guide RNAs (sgRNAs) via synthetic stem-loops to mimic the natural crRNA / tracrRNA dimer. Such sgRNAs, like shRNAs, can be synthesized or transcribed in vitro for direct RNA transfection, or expressed from U6 or H1-promoting RNA expression vectors.

[0077] In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. The Cas9 nuclease may have the same nucleotide sequence as the wild-type Streptococcus pyrogenes sequence. In some embodiments, the CRISPR-associated endonuclease may be a sequence derived from other species, e.g., other Streptococcus species such as Thermophilus; Pseudomonas aeruginosa; Escherichia coli; or other sequenced bacterial genomes and archaea; or other prokaryotes. Alternatively, the wild-type Streptococcus pyrogenes Cas9 sequence may be modified. The nucleic acid sequence may be codon-optimized, i.e., "humanized," for efficient expression in mammalian cells. The humanized Cas9 nuclease sequence may be a Cas9 nuclease sequence encoded by any of the expression vectors listed under Genbank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GL669193765. Alternatively, the Cas9 nuclease sequence may be a sequence contained in commercially available vectors such as Addgene (Cambridge, MA) pX330, pX260, or pMJ920. In some embodiments, the Cas9 endonuclease may have an amino acid sequence that is a variant or fragment of any of the following Cas9 endonuclease sequences: GenBank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GL669193765, or the Cas9 amino acid sequences pX330, pX260, or pMJ920 (Addgene, Cambridge, MA).

[0078] In some embodiments, the cargo is a base editing enzyme. As used herein, “base editing enzyme” refers to a fusion protein containing a deficient CRISPR / Cas nuclease linked to a deaminase polypeptide. The term is also known as “base editor.” As used herein, the term “deaminase” refers to an enzyme that catalyzes a deamination reaction. As used herein, the term “deamination” refers to the removal of an amino group from a molecule. In some embodiments, the deaminase is a cytidine deaminase that catalyzes the hydrolytic deamination of cytidine or deoxycytidine to uracil or deoxyuracil, respectively. In some embodiments, the deaminase is an adenosine deaminase that catalyzes the hydrolytic deamination of adenosine to inosine, which is then treated by cells like guanosine, creating an A-to-G (or T-to-C) conversion. Two types of base editing enzymes, cytosine base editing enzymes (CBEs) and adenine base editing enzymes (ABEs), can be used to produce single-base pair edited molecules without double-strand breaks. Typically, cytosine base editing enzymes are created by fusing a deficient CRISPR / Cas nuclease to a deaminase.

[0079] In some embodiments, the cargo is a prime editor consisting of a fusion protein in which a catalytically impaired Cas9 endonuclease is fused to an engineered reverse transcriptase. By complexing with prime editing guide RNA (pegRNA), the prime editor can identify a target site and provide new genetic information for replacing a target DNA nucleotide. Prime editors mediate targeted insertions, deletions, and base changes without requiring double-strand breaks (DSBs) or donor DNA templates (Anzalone, Andrew V., Randolph, Peyton B., Davis, Jessie R., Sousa, Alexander A., ​​Koblan, Luke W., Levy, Jonathan M., Chen, Peter J., Wilson, Christopher, Newby, Gregory A., Raguram, Aditya, Liu, David R. (October 21, 2019). "Search-and-replace genome editing without double-strand breaks or donor DNA". Nature. 576(7785): pp. 149-157).

[0080] In some embodiments, the EV is loaded with i) a polypeptide (or a polynucleotide encoding it) selected from the group consisting of CRISPR-related endonucleases, base editing enzymes, epigenome editing factors, and primer editors, and ii) one or more guide RNA molecules.

[0081] As used herein, the term “guide RNA molecule” generally refers to an RNA molecule (or group of RNA molecules) that binds to the Cas9 protein and targets the Cas9 protein to a specific location within target DNA. Guide RNA may comprise two segments: a DNA targeting guide segment and a protein-binding segment. The DNA targeting segment contains a nucleotide sequence complementary to (or at least capable of hybridizing under stringent conditions with) the target sequence. The protein-binding segment interacts with CRISPR proteins such as Cas9 or Cas9-related polypeptides. These two segments may be located in the same RNA molecule or in two or more separate RNA molecules. When the two segments are present in separate RNA molecules, the molecule containing the DNA targeting guide segment is sometimes referred to as CRISPR RNA (crRNA), while the molecule containing the protein-binding segment is sometimes referred to as transactivating RNA (tracrRNA).

[0082] In some embodiments, the cargo is a toxin.

[0083] As used herein, the term “toxin” generally refers to a molecule or part that is lethal to a cell. In some embodiments, the toxin is a bacterial toxin or a fragment thereof. As used herein, the term “bacterial toxin” refers to a polypeptide produced by pathogenic bacteria that is involved in the pathogenic activity described above. A bacterial toxin may be the direct cause of bacterial toxicity, or it may be involved in its toxicity. As used herein, the term “toxin fragment” refers to any part of a toxin that retains toxic activity. In particular, bacterial toxins are often described as presenting different distinct functional domains, particularly domains involved in toxic activity (catalytic sites) distinct from other domains involved in site recognition or interaction with partners. Most bacterial toxins, such as diphtheria toxin, Pseudomonas exotoxins, and Clostridium perfringens enterotoxin, include a receptor-binding portion that targets the toxin to specific cell surface receptors, and a portion responsible for the toxicity of the toxin protein. For example, Clostridium perfringens enterotoxin binds to claudin-3 and claudin-4 on the cell surface. Clostridium perfringens enterotoxin (CPE) is a protein consisting of 319 amino acid residues. The peptide consisting of residues 290-319 of Clostridium perfringens enterotoxin binds to claudin-3 and claudin-4 but is not toxic (Hanna et al., 1991, J. Biol. Chem. 266: pp. 11037-43). Approximately 45-116 residues of CPE are responsible for cell lysis by forming a large complex within the cell membrane (Kokai-Kun, JF et al., 1996, Infect.Immun.64:pp. 1020-1025; Kokai-Kun, JF et al., 1997, Clin.Infect.Dis.25(Suppl.2):pp. S165-5167; Kokai-Kun, JF et al., Infect.Immun.65:pp. 1014-1022; Kokai-Kun, JF et al., 1999, Infect.Immun.67:pp. 5634-5641; Hanna, PC et al., 1991, J.Biol.Chem.266:pp. 11037-43).Indeed, the deletion of residues 315-319 is sufficient to eliminate receptor binding (Kokai-Kun, JF et al., 1999, Infect.Immun. 67: pp. 5634-5641). Therefore, in some embodiments, the toxin is a fragment of CPE containing residues 45-116 but lacking residues 315-319. In some embodiments, the toxin is diphtheria toxin or a toxic fragment thereof. Diphtheria toxin is a protein consisting of 535 amino acid residues (SEQ ID NO: 4). The diphtheria toxin contains three domains: i) residues 1-193 are a catalytic domain with ADP-ribosyltransferase activity that inactivates elongation factor-2 in cells, thereby killing the cells (Choe, S. et al., 1992, Nature 357: pp. 216-222); ii) residues 203-378 are responsible for the translocation of the toxin across the cell membrane; and ii) residues 386-535 are responsible for binding to the receptor. Therefore, in certain embodiments, the toxin of the present invention contains the amino acid sequence described in Sequence ID No. 7. [ka]

[0084] Other cargoes of interest include detectable markers, such as luciferase, luciferin, green fluorescent protein, and fluorescent dyes, such as FITC. The detectable markers may also include imaging entities, such as metal nanoparticles of gold, platinum, or silver, which can be provided as nanoparticles, typically less than 10 nm, or about 5 nm.

[0085] Load system: In some embodiments, the EV of the present invention includes a structural polypeptide capable of forming a dimer with a cargo polypeptide.

[0086] As used herein, the term “structural polypeptide” refers to a protein that is naturally incorporated into the EV membrane and contributes to the overall structure of the EV described above.

[0087] In some embodiments, the structural polypeptide is selected from among transmembrane proteins. As used herein, the term “transmembrane protein” has its general meaning in the art and refers to a membrane protein that spans the lipid bilayer of a membrane. In some embodiments, the transmembrane protein is a tetraspanin. As used herein, the term “tetraspanin” has its general meaning in the art and refers to a superfamily of four small transmembrane domain proteins involved in a wide variety of physiological processes. Members of the tetraspanin include, but are not limited to, CD9, CD37, CD53, CD63, CD81, and CD82. In some embodiments, the tetraspanin is CD63.

[0088] The means by which the structural polypeptide and cargo polypeptide form dimers are not particularly limited. In some embodiments, the structural polypeptide and cargo polypeptide (e.g., a toxin) are fused to their respective dimerizable domains, either directly or via a linker, in the presence of the compound. For example, it is possible to use a system in which the FK506-binding protein ("FKBP domain") and the FKBP-rapamycin-related protein 1, FRAP1 fragment ("FRB domain") form heterodimers in the presence of rapamycin. Thus, in some embodiments, the structural polypeptide is fused to the FKBP domain and the cargo polypeptide (e.g., a toxin) is fused to the FRB domain (or vice versa), and the FKBP domain and FRB domain can be dimerized in the presence of rapamycin during the production of the EV of the present invention. In some embodiments, the FKBP domain consists of the amino acid sequence described in SEQ ID NO: 8, and the FRB domain consists of the amino acid sequence described in SEQ ID NO: 9. [ka] [ka]

[0089] Alternatively, systems in which GAI (gibberellin-insensitive) and GID1 (gibberellin-insensitive dwarf 1) form heterodimers in the presence of gibberellin or GA3-AM can be used (see, for example, Miyamoto T. et al., Rapid and Orthogonal Logic Gating with a Gibberellin-induced Dimerization System, Nat Chem Biol., 8(5), pp. 465-470, 2012), or systems in which PyL (PYR1-like, consisting of amino acids 33 to 209) and ABI1 (consisting of amino acids 126 to 423) form heterodimers in the presence of S-(+)-abscisic acid (ABA) (see, for example, Liang FS et al., Engineering the ABA plant stress pathway for regulation of induced proximity, Sci Signal., 4(164), rs2, 2011).

[0090] In some embodiments, the EV of the present invention includes a loading system in which the tetraspanin CD63 is fused to the FKBP2 domain. In some embodiments, the EV of the present invention includes a loading system consisting of the amino acid sequence described in SEQ ID NO: 10. In some embodiments, a cargo polypeptide (e.g., a toxin) is fused to the FRB domain and can therefore dimerize with the CD63-FKBP2 fusion protein in the presence of rapamycin, enabling loading of the cargo polypeptide into the EV. [ka]

[0091] HERV envelope protein: In some embodiments, the extracellular vesicles of the present invention are optionally functionalized with HERV envelope proteins.

[0092] In some embodiments, the HERV glycoprotein is HHERV syncytin.

[0093] The HERV syncytin according to the present invention may be selected from human syncytin (e.g., HERV-W and HERV-FRD), mouse syncytin (e.g., syncytin-A and syncytin-B), syncytin-Ory1, syncytin-Car1, syncytin-Rum1, or their functional orthologues (Cornelis G, Heidmann O, Degrelle SA, Vernochet C, Lavialle C, Letzelter C et al. (2013). Captured retroviral envelope syncytin gene associated with the unique placental structure of higher ruminants PNAS 110(9): E828~E837; Dupressoir A, Marceau G, Vernochet C, Benit L, Kanellopoulos C, Sapin V et al. (2005). Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae. Proceedings of the National Academy of Sciences of the United States of America 102:725-730).

[0094] Functional orthologs are intended to be ortholog proteins encoded by ortholog genes that exhibit fusion properties. These fusion properties can be evaluated in a fusion assay described in Dupressoir A, Marceau G, Vernochet C, Benit L, Kanellopoulos C, Sapin V et al. (2005). Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae. Proceedings of the National Academy of Sciences of the United States of America 102: pp. 725-730. In short, cells are subjected to, for example, lipofectamine (Invitrogen) and 5 × 10⁶ cells. 5 For each cell, approximately 1-2 μg of DNA or calcium phosphate precipitate (Invitrogen, 5 × 10⁻⁶). 5 Cells are transfected using 5-20 μg of DNA per cell. Plates are generally examined for cell fusion 24-48 hours after transfection. Syncytia can be visualized by May-Gillunwald and Giemsa staining (Sigma), and the fusion index is calculated as [(NS) / T] × 100 (wherein N is the number of nuclei in the syncytia, S is the number of syncytia, and T is the total number of nuclei counted).

[0095] Human syncythin encompasses HERV-W and HERV-FRD. Functional orthologues of these proteins can be found in the Hominidae family. HERV-W refers to a highly fusionable membrane glycoprotein belonging to the family of human endogenous retroviruses (HERV). HERV-W is an envelope glycoprotein and is also called syncythin-1. HERV-W has the sequence shown in the Ensembl database, corresponding to transcript ERVW-1-001, ENS00000493463. HERV-FRD also refers to a highly fusionable membrane glycoprotein belonging to the family of human endogenous retroviruses (HERV). HERV-FRD is an envelope glycoprotein and is also called syncythin-2. HERV-FRD has the sequence shown in the Ensembl database, corresponding to transcript ERVFRD-1, ENSG00000244476.

[0096] Mouse syncytin encompasses mouse syncytin-A (i.e., mouse syncytin-A, synA) and mouse syncytin-B (i.e., mouse syncytin-B, synB). Functional orthologues of these proteins can be found in the Muridae family. Mouse syncytin-A is encoded by the syncytin-A gene. Syncytin-A has the sequence shown in the Ensembl database Syna ENSMUSG00000085957. Mouse syncytin-B is encoded by the syncytin-B gene. Syncytin-B has the sequence shown in the Ensembl database Synb ENSMUSG00000047977.

[0097] Syncythin-Ory1 is encoded by the syncythin-Ory1 gene. Functional orthologues of syncythin-Ory1 can be found in families of the Leporidae family (usually rabbits and hares).

[0098] Syncythin-Car1 is encoded by the syncythin-Car1 gene. Functional orthologues of syncythin-Car1 can be found in the superorder Laurasiatheria (Cornelis et al., 2012; Lavialle et al., 2013).

[0099] Syncythin-Rum1 is encoded by the syncythin-Rum1 gene. Functional orthologues of syncythin-Rum-1 ​​can be found in ruminant mammals.

[0100] In some embodiments, the HHERV syncytin according to the present invention can be selected from the group consisting of HERV-W, HERV-FRD, syncytin-A, syncytin-B, syncytin-Ory1, syncytin-Car1, and syncytin-Rum1 and their functional orthologs. Preferably, the HERV syncytin is selected from the group consisting of HERV-W, HERV-FRD, mouse syncytin-A, and their functional orthologs. More preferably, the HERV syncytin is selected from the group consisting of HERV-W, HERV-FRD, and mouse syncytin-A. Even more preferably, the HERV syncytin is HERV-W or HERV-FRD.

[0101] In some embodiments, HERV syncythin is syncythin-1 polypeptide.

[0102] In some embodiments, the syncytin-1 polypeptide comprises the amino acid sequence (SDGGGX2DX2R) described in SEQ ID NO: 2 and is capable of binding to the ASCT1 receptor, preferably the ASCT2 receptor.

[0103] In some embodiments, the syncytin-1 polypeptide comprises the amino acid sequence (SDGGGVQDQAR) described in SEQ ID NO: 11.

[0104] In some embodiments, the syncytin-1 polypeptide of the present invention comprises the amino acid sequence (SDGGGVQDQAR) described in SEQ ID NO: 11, and includes at least 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of SEQ ID NO: 1.

[0105] In some embodiments, the syncytin-1 polypeptide of the present invention includes an amino acid sequence having 70% identity with the amino acid sequence in the range from the amino acid residue at position 21 to the amino acid residue at position 538 in SEQ ID NO: 1. In some embodiments, the syncytin-1 polypeptide of the present invention comprises an amino acid sequence ranging from the amino acid residue at position 21 to the amino acid residue at position 538 in SEQ ID NO: 1, where the arginine residue at position 393 (R) and the phenylalanine residue at position 399 (F) are mutated to confer immunosuppressive activity (Mangeney M, Renard M, Schlecht-Louf G, Bouallaga I, Heidmann O, Letzelter C, Richaud A, Ducos B, Heidmann T. Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proc Natl Acad Sci USA. December 18, 2007; 104(51):20534~9. doi:10.1073 / pnas.0707873105.Epub December 12, 2007. PMID:18077339; PMCID:PMC2154466). In some embodiments, the syncytin-1 polypeptide of the present invention comprises an amino acid sequence ranging from the amino acid residue at position 21 to the amino acid residue at position 538 in SEQ ID NO: 1, where the arginine residue (R) at position 393 is substituted with a glutamine residue (Q), and the phenylalanine residue (F) at position 399 is substituted with an alanine residue (A).

[0106] Method for producing EVs according to the present invention: According to the present invention, the EV is prepared from the components of the EV, namely HERV syncytin, one or more cargoes of interest, and a donor that has been genetically engineered to express a loading system and targeting site, as well as optionally selected. Typically, the donor cell is transduced to express one or more polynucleotides encoding various components of the EV. The polynucleotide construct is intended to be introduced into the donor cell as naked DNA or in a suitable vector. Naked DNA generally refers to DNA contained in a plasmid expression vector in an orientation suitable for expression. Physical methods for introducing the polynucleotide construct into the donor cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, and electroporation. Other means may be used, including colloidal dispersion systems such as polymer complexes, nanocapsules, microspheres, and beads, as well as lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. In some embodiments, polynucleotide constructs are introduced into donor cells by viral vectors, such as adeno-associated viruses (AAV), retroviruses, lentiviruses, bovine papillomaviruses, adenovirus vectors, vaccinia viruses, polyomaviruses, or infectious viruses. In some embodiments, the vector is a retrovirus. Retroviruses may be chosen as gene delivery vectors due to their ability to integrate their genes into the host genome, deliver large amounts of foreign genetic material, infect a wide range of species and cell types, and package in specialized cell systems. To construct a retroviral vector, polynucleotides are inserted into the viral genome in place of certain viral sequences, producing a virus with replication defects. To produce virions, a packaging cell system is constructed that contains gag, pol, and / or env genes but lacks LTR and / or packaging components.When a recombinant plasmid containing cDNA is introduced into this cell line along with the retroviral LTR and packaging sequence (e.g., by calcium phosphate precipitation), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture medium. The medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are capable of infecting a wide range of cell types. Lentiviruses are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural functions. This higher complexity allows the virus to modulate its life cycle, such as during latent infection. Some examples of lentiviruses include human immunodeficiency viruses (HIV1, HIV2) and simian immunodeficiency viruses (SIV). Lentiviral vectors are produced by multiple attenuation of HIV pathogenic genes, for example, by deletion of the env, vif, vpr, vpu, and nef genes, making the vector biologically safe. Lentiviral vectors are known in the art, see, for example, U.S. Patent Nos. 6,013,516 and 5,994,136, both incorporated herein by reference. Generally, vectors are plasmid-based or virus-based and are configured to possess essential sequences for taking up foreign nucleic acids, for selection, and for transferring the nucleic acids into host cells. The gag, pol, and env genes of the vector of interest are also known in the art. Thus, the relevant genes are cloned into the selected vector and subsequently used to transform the target cells of interest. Recombinant lentiviruses capable of infecting non-dividing cells, in which a suitable host cell is transfected with two or more vectors possessing packaging functions, namely gag, pol, and env, as well as rev and tat, are described in U.S. Patent No. 5,994,136, incorporated herein by reference.This describes a first vector capable of providing nucleic acids encoding viral gag and pol genes for producing packaging cells, and another vector capable of providing nucleic acids encoding viral env. By introducing a vector that provides heterologous genes to its packaging cells, producer cells are produced that release infectious viral particles carrying the desired foreign genes. Env is preferably an amphiphilic envelope protein that enables transduction of human and other species cells. Typically, the vectors of the present invention include “regulatory sequences,” which collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (IRESs), enhancers, etc., which collectively provide replication, transcription, and translation of the coding sequence in recipient cells. Not all of these regulatory sequences are always necessary, as long as the selected coding sequence can be replicated, transcribed, and translated in a suitable host cell. Another nucleic acid sequence is a “promoter” sequence, which is used herein in its usual sense, referring to a nucleotide region containing a DNA regulatory sequence, where the regulatory sequence originates from a gene capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence. Transcription promoters may include “inducible promoters” (where the expression of a polynucleotide sequence operably linked to a promoter is induced by an analyte, cofactor, regulatory protein, etc.), “repressive promoters” (where the expression of a polynucleotide sequence operably linked to a promoter is induced by an analyte, cofactor, regulatory protein, etc.), and “constitutive promoters.” In some embodiments, the polynucleotide is encoded by a nucleic acid molecule whose sequence is codon-optimized for expression in mammalian cells. Codon optimization refers to the discovery that the frequency of synonymous codons (i.e., codons encoding the same amino acid) in coding DNA is biased in different species. Such codon degeneracy makes it possible for the same polypeptide to be encoded by various nucleotide sequences.Various codon optimization methods are known in the art and include, for example, the methods disclosed in U.S. Patent Nos. 5,786,464 and 6,114,148. Various assays can be performed to confirm the presence of polynucleotides in donor cells. Such assays include, for example, well-known "molecular biological" assays such as Southern blotting and Northern blotting, RT-PCR and quantitative PCR, or "biochemical" assays such as detecting the presence or absence of specific peptides.

[0107] Examples of donor cells include, but are not limited to, epithelial cells, circulating immune cells, hematopoietic cells, bone marrow cells, circulating vascular progenitor cells, cardiac cells, chondrocytes, osteocytes, beta cells, hepatocytes, and neurons. Furthermore, pluripotent stem cells are also examples of donor cells. Where intended herein, the term "pluripotent stem cells" refers to mitotically competent cells readily differentiated into one or more cell types. Preferably, pluripotent stem cells are not differentiated. Pluripotent stem cells encompass stem cells, particularly adult stem cells (e.g., mesenchymal stem cells (MSCs)) and embryonic stem cells. The term also encompasses induced pluripotent stem cells (IPS). In some embodiments, the donor cells are mesenchymal stem cells. As used herein, the terms “mesenchymal stem cells” or “MSCs” have their general meaning in the art and refer to pluripotent stromal cells that can differentiate into various cell types, including osteoblasts (osteocytes), chondrocytes (chondrocytes), myocytes (muscle cells), and adipocytes (adipocytes) (see, for example, Wang, Stem Cells 2004;22(7);pp. 1330-1337; McElreavey, 1991 Biochem Soc Trans(1), 29s; Takechi, Placenta March / April 1993, 14(2), pp. 235-2345; Takechi, 1993; Kobayashi, Early Human Development, July 10, 1998, 51(3), pp. 223-233; Yen, Stem Cells, 2005, 23(1)pp. 3-9). In some embodiments, the donor cells include purified primary cells and immortalized cell lines. In some embodiments, the donor cells are suspended cells (e.g., circulating leukocytes (PBMCs)) or adherent cells (e.g., endothelial cells).

[0108] In some embodiments, the EVs of the present invention are prepared by any method well known in the art. In some embodiments, the EVs of the present invention are prepared by methods well known in the art relating to 3D culture, including, but not limited to, standard culture in a 2D flask, hanging drop culture, culture on a matrix, culture on a microcarrier, culture on a synthetic extracellular scaffold, culture on a chitosan membrane, culture under magnetic levitation, suspension culture in a rotating bioreactor, or culture under non-contact inhibition conditions. For example, see Haycock J W. (2011). "3D cell culture: a review of current approaches and techniques." Methods Mol Biol. 695: pp. 1-15; Lee, J., Cuddihy MJ, Kotov N A. (March 14, 2008). Three-dimensional cell culture matrices: state of the art. doi:10.1089 / teb.2007.0150; Pampaloni, Francesco (October 2007). "The third dimension bridges the gap between cell culture and live tissue." Nature Reviews 8: pp. 839-845; and Souza, Glauco (March 14, 2010). "Three-dimensional tissue culture based on magnetic cell levitation." Nature Nanotechnology: pp. 291-296. The entire contents of each are incorporated herein by reference.

[0109] In some embodiments, the EVs of the present invention are prepared by a system culture as described in International Publication No. 2019 / 002608. In particular, the EVs of the present invention are prepared according to the method described in the examples. More specifically, the method comprises a fluid system comprising at least one container, a liquid medium contained in the container and producer cells, wherein the method comprises microcarriers suspended in the liquid medium, wherein the majority of the producer cells are adhered to the surface of the microcarriers, and a liquid medium agitator, wherein the dimensions of the agitator and the container are such that the liquid medium agitator can control the turbulence of the liquid medium in the container. Thus, a further object of the present invention relates to a method for preparing the EVs of the present invention comprising the steps of i) inducing turbulence of a culture medium in a container, wherein the culture medium is suspended in a culture medium comprising donor cells adhered to the surface of microcarriers, and the microcarriers optionally comprising a certain amount of a dimerizing agent (e.g., rapamycin) for loading cargo polypeptides onto the EVs, and ii) collecting the produced EVs from the liquid medium. Typically, the microcarriers are microbeads. Commercially available culture media can be used for the growth, culture, and maintenance of donor cells. Examples of such media include, but are not limited to, Dulbecco's Modified Eagle Medium (DMEM).

[0110] Therapeutic use: The present invention provides compositions and kits suitable for use in therapeutic applications (in vivo or ex vivo), the compositions and kits comprising the EV of the present invention. According to the present invention, the therapeutic effect is brought about by one or more cargoes loaded in the EV of the present invention. For example, the EV and products comprising it may be used for gene therapy or vaccine purposes.

[0111] Therefore, a further object of the present invention is a method for treating a subject in need of treatment, comprising the step of administering a therapeutic amount of the EV of the present invention to the subject.

[0112] The types of diseases and disorders that can be treated by the method of the present invention include, but are not limited to, infectious diseases, autoimmune diseases, inflammatory diseases, cancer, neurological diseases, cardiovascular diseases, eye diseases, ear diseases, blood diseases, bone diseases, congenital diseases, metabolic diseases, musculoskeletal diseases, gastrointestinal diseases, renal and genitourinary diseases, respiratory diseases, or skin diseases.

[0113] In particular, the EVs of the present invention, especially EVs loaded with toxins, are particularly suitable for the treatment of cancer.

[0114] As used herein, the term “cancer” has its general meaning in the art and refers to one or more cells that are growing or will grow in an uncontrolled manner to form cancerous tissue. The term includes, but is not limited to, solid tumors and hematological tumors. The terms “cancer” and “tumor” are used interchangeably throughout this specification. The term “cancer” is not limited to any stage, grade, histological features, invasiveness, aggressiveness or malignancy of the affected tissue or cell aggregate. In particular, it includes stage 0 cancer, stage I cancer, stage II cancer, stage III cancer, stage IV cancer, grade I cancer, grade II cancer, grade III cancer, malignant cancer and primary cancer. As used herein, the term “solid cancer” includes, but is not limited to, “carcinoma,” “adenocarcinoma,” and “sarcoma.” “Sarcoma” is cancer of connective tissue, cartilage, bone, muscle, etc. “Carcinoma” is cancer of epithelial (endometrial) cells. “Adenocarcinoma” refers to carcinoma originating from glandular cells.

[0115] Examples of cancers that can be treated by the methods and compositions of the present invention include, but are not limited to, cancer cells originating from the bladder, blood, bone, bone marrow, brain, chest, colon, esophagus, gastrointestinal tract, gingiva, head, kidney, liver, lung, nasopharynx, neck, ovaries, prostate, skin, stomach, testes, tongue, or uterus. Furthermore, cancer may specifically be, but is not limited to, the following histological types: malignant neoplasms; undifferentiated carcinomas; giant cell and spindle cell carcinomas; small cell carcinomas; papillary carcinomas; squamous cell carcinomas; lymphoepithelial carcinomas; basal cell carcinomas; pilomatrix carcinomas; transitional cell carcinomas; papillary transitional cell carcinomas; adenocarcinomas; malignant gastrinomas; cholangiocarcinomas; hepatocellular carcinomas; combined hepatocellular carcinomas and cholangiocarcinomas; trabecular adenocarcinomas; adenoid cystic carcinomas; adenocarcinomas within adenomatous polyps; familial adenomatous polyposis; solid tumors; malignant carcinoid tumor; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; lymphoid carcinoma; sebaceous carcinoma; auditory canal adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; Adenocarcinoma with squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant theca cell tumor; malignant granulosa cell tumor; malignant androblastoma; Sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extramammary paraganglioma; pheochromocytoma; glomus tumor; malignant melanoma; achromatic melanoma; superficial spreading melanoma; malignant melanoma within a megapigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; Fetal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; Müllerian duct mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymal tumor; malignant Brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; undifferentiated germ cell tumor; fetal carcinoma; malignant teratoma; malignant ovarian goiter; choriocarcinoma; malignant mesonephroma; angiosarcoma; malignant hemangioendothelioma; Kaposi's sarcoma; malignant hemangioemyothelioma; lymphangiosarcoma; osteosarcoma; paraosteal osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; malignant odontogenic tumor;Ameloblastic odontosarcoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pineal glandoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma; primitive neuroectodermal tumor; cerebellar sarcoma; ganglioblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paramecia Paragranuloma; small lymphocytic lymphoma; large cell diffuse lymphoma; follicular lymphoma; mycosis fungoides; other specified non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative bowel disease; leukemia; lymphocytic leukemia; plasmacytic leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myelosarcoma; and hairy cell leukemia.

[0116] A further object of the present invention relates to compositions comprising the EV of the present invention ("EV compositions"). The compositions described herein encompass pharmaceutical compositions used for the purpose of carrying out therapeutic methods in subjects requiring treatment, including non-human mammals and human individuals requiring treatment. The compositions of the present invention can be formulated for delivery to animals for veterinary purposes (e.g., livestock such as cattle and pigs), and other non-human mammalian subjects, as well as to human subjects. For example, EV can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications. In some embodiments, the compositions further comprise one or more transduction helper compounds. The transduction helper compounds are preferably selected from the group comprising cationic polymers, as described in particular by Zuris et al. (2015, Nat Biotechnol, Vol. 33 (n°1): pp. 73-80).Transduction helper compounds include polyblen (also known as hexadimethrin bromide), protamine sulfate, 12-myrisstart 13-acetate (also known as phorbol myrisstart acetate or PMA, described by Johnston et al., 2014, Gene Ther, Vol. 21(12): pp. 1008-1020), bectofucin (described by Fenard et al., 2013, Molecular Therapy Nucleic Acids, Vol. 2: p. e90), poloxamer P338 (described by Anastasov et al., 2016, Lentiviral vectors and exosomes as gene and protein delivery tools, in Methods in Molecular Biology, Vol. 1448: pp. 49-61), RetroNectin® reagent (commercialized by Clontech Laboratories Inc.), and Viral Plus® transduction enhancer (Applied Biological Materials). The cationic transduction helper compound may be selected from the group including TransPlus® viral transduction enhancer (commercialized by Clinisciences), Lentiboost® (commercialized by Sirion Biotech), or ExpressMag® transduction system (commercialized by Sigma-Aldrich). As shown in the examples herein, the cationic transduction helper compound may consist of polybrene. The EV may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. The EV may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. The injectable formulation may be provided in unit dosage forms, for example in ampoules or in multi-dose containers, with the addition of preservatives. The EV composition may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and may contain formulation agents such as suspending agents, stabilizers and / or dispersants.Liquid preparations of EV compositions can be prepared by conventional means using pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats), emulsifiers (e.g., lecithin or gum arabic), non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils), and preservatives (e.g., methyl or propyl-p-hydroxybenzoate or sorbic acid). The preparations may also contain buffering salts. Alternatively, the composition may exist in powder form for composition using a suitable vehicle, such as sterile pyrogen-free water, before use.

[0117] The EV composition of the present invention can be administered to a subject in a therapeutically effective dose to provide a therapeutic effect. In some embodiments, the amount of the EV composition of the present invention is administered in dose units ranging from about 0.1 to 5 micrograms (μg) / kilogram (kg). For this purpose, the EV composition of the present invention can be formulated in doses ranging from about 7 mg to about 350 mg to treat an average subject weighing 70 kg. The amount of the EV composition of the present invention that can be administered can be selected from the group including 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1.0 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 3.0 mg / kg, 3.5 mg / kg, 4.0 mg / kg, 4.5 mg / kg, or 5.0 mg / kg. The EV dose in the unit dose of the composition may be selected from groups including 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, or 750 mg, particularly for treating an average subject weighing 70 kg. These doses may be administered once or repeatedly, for example, daily, every other day, weekly, every other week, or monthly. In some embodiments, the composition may be administered to the subject in single, double, triple, quadruple, quintuple, six or more doses. The interval between doses may be determined based on the practitioner's determination that the medication is necessary.

[0118] The composition may, if desired, be provided in packaging or a dispenser device that can contain one or more unit dosage forms containing the active ingredient. The packaging may include metal or plastic foil, such as blister packaging. The packaging or dispenser device may be accompanied by instructions for administration. In some embodiments, the composition may exist in liquid or solid (e.g., lyophilized) form.

[0119] Administration of EVs to human subjects or animals requiring EVs may be by any means known in the art for administering viral vectors. Exemplary modes of administration include rectal, transmucosal, topical, transdermal, inhalation, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, and intra-articular) administration, as well as direct tissue or organ injection, or intrathecal, direct intramuscular, intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injection. Injectable preparations may be prepared in conventional forms, either as a liquid solution or suspension, a solid form suitable for dissolution or suspension in liquid before injection, or as an emulsion. Alternatively, the virus may be administered topically rather than systemically, for example, in a depot or sustained-release formulation.

[0120] The present invention is further illustrated by the following drawings and embodiments. However, these embodiments and drawings should not be construed as limiting the scope of the present invention in any way. [Brief explanation of the drawing]

[0121] [Figure 1]EV-cargo loading system. (A) Scheme illustrating the loading system. The EV membrane marker FKBP2-RFP-CD63 is co-expressed with the luminescent reporter FRB-tagged nanoluciferase. The drug-inducible FKBP2-FRB interaction is reversible, enabling EV-cargo loading. The fate of the luminescent cargo can be tracked by luminometry in extracellular medium and in recipient cells. (B) FKBP2-RFP-CD63 (loader) was transiently expressed in HeLa WT cells and monitored by confocal microscopy. As expected, the loader exhibits an endosomal pattern. (C) The loader and FRB-NLuc cargo (which is also tagged with HA) were transiently expressed in HeLa WT cells. Transfected cells were incubated for 1 hour with or without the dimerizing drug. Cells were fixed, labeled, and monitored by confocal microscopy. The fluorescence intensities of both the loader and the cargo were plotted. These results show significant co-localization of the two signals only in the presence of the drug, demonstrating the loader's ability to mobilize the FRB fusion protein. [Figure 2]Drug-induced recruitment of cargo to EVs. (A) Loading agents and FRB-NLuc cargo were transiently expressed in HeLa WT cells, and EVs were produced by these cells in the presence or absence of the dimerizing agent. EVs were isolated by sequential centrifugation. Western blotting was performed to analyze loading agent and cargo expression, as well as classical positive and negative EV markers. Each well was loaded with the same amount of protein. The dimerizing agent did not alter the EV composition as determined by Western blotting. (B) In parallel, associated luminescence within isolated EVs was measured. The graph shows the luminescence activity within EVs emitted from cells treated with or untreated with the dimerizing agent. NLuc specific activity was normalized and plotted against the “no drug” condition, which corresponds to nonspecific bulk loading of overexpressed cargo. Each dot represents the mean of two technical double repeats. A significant 3.5-fold increase in EV NLuc specific activity is observed when donor cells are treated with the “drug”. (C) Suspension assays were performed on "untreated" and "treated" EVs. The NLuc activity in each fraction was plotted. Both conditions showed a peak in NLuc activity in fraction 7, demonstrating that NLuc is associated with suspension EVs. The inventors also observed a four-fold increase in NLuc activity in the "treated" condition in fraction 7 compared to the "untreated" condition, supporting Figure 2B. (D) The fractions obtained after suspension were analyzed by Western blotting, monitoring cargo and various positive and negative EV markers. The results show that NLuc in fraction 7 is associated with EVs. (E-F) Particle size and concentration were measured by nanoparticle tracking analysis, and (G) EV protein concentration was measured by BCA. Each dot represents the mean of technical double repeats. These last three parameters do not show any change when donor cells are treated with drugs. [Figure 3]EV cargo loading results in increased uptake and delivery within recipient cells. (A) Uptake experiments were performed at different time points by incubating HeLa WTs with loaded EVs produced in the presence or absence of a dimerizing drug (drug) or (no drug). Note that the dimerizing drug was washed away during EV isolation, allowing for putative delivery within acceptor cells. The graph shows luminescence activity over time. Each point corresponds to the mean of the technical double repeat and the biological triple repeat, with SEM error indicated. When produced in the presence of a dimerizing drug, loaded EVs can mediate up to four times higher uptake than under the "no drug" condition. (B) Contents delivery assays were performed by incubating HeLa WTs for 24 hours with loaded EVs produced in the presence or absence of a dimerizing drug (drug) or (no drug). Briefly, after mechanically disrupting acceptor cells and cell fractionation, the presence of luminescent cargo was examined in the membrane and cytoplasmic fractions. NLuc activity associated with the membrane and cytoplasmic fractions under the "drug" condition was normalized to the "no drug" condition. The results confirmed a fourfold increase in overall uptake (membrane + cytoplasm), indicating that this increase directly impacts EV content delivery (cytoplasm), which also shows a fourfold increase. [Figure 4] Manipulation of virus-free fusion EVs. HeLa-derived EVs transiently expressing GFP ("mock condition"), VSV-G, or syncytin-1 (Syn1) were characterized according to various parameters. Note that donor cells stably express NLuc-HSP70, a common EV cargo. (A) Particle concentration, (B) EV protein concentration, (C) Particle size, and (D) EV-specific NLuc activity were measured and plotted. All parameters except particle size were normalized to the "mock" condition. The results show increased particle and protein concentrations for the VSV-G and Syn1 conditions. Nevertheless, EV size and specific NLuc activity remained unchanged, suggesting that EV loading capacity was not altered. [Figure 5]SYN1-positive fusion EVs increase EV cargo delivery. (A) Uptake experiments were performed by incubating HeLa WTs with EVs possessing NLuc-Hsp70 with either GFP ("mock" condition), VSV-G, or Syn1 at various time points. NLuc activity normalized to total NLuc input is shown. Syn1+-EV-mediated uptake demonstrates a significant increase compared to the "mock" condition. (B) Content delivery assays by cell fraction were performed by incubating HeLa WTs with fusion EVs possessing GFP ("mock" condition), VSV-G, or Syn1 for 24 hours. NLuc activity associated with membrane and cytoplasmic fractions was normalized to the "mock" condition. The results show a 5-fold increase in content delivery for fusion EVs compared to the control, and comparable EV delivery for both VSV-G and Syn1. [Figure 6] DTA-resistant donor cells. A. Parental HeLa cells were infected with lentiviral-encoding shRNA targeting the DPH2 gene to generate DTA-resistant donor cells (DPH2KD). DPH2 knockdown in donor cells was confirmed by qRT-PCR. B. Parental cells or DPH2KD cells were transfected with plasmids encoding DTA-HA and / or mCherry. Equiprotein samples were analyzed by Western blotting. DTA-HA expression inhibited protein synthesis in parental cells, including the synthesis of detectable amounts of DTA-HA itself (mCherry was not detected), while DPH2KD allowed for the co-expression of both DTA-HA and mCherry. This indicates that DPH2KD cells are resistant to DTA-HA-induced inhibition of protein synthesis. C. Quantitative protein synthesis assays showed that DPH2KD cells maintained nearly 80% de novo protein synthesis when DTA-HA was expressed. Under these conditions, parental cells exhibit less than 3% de novo protein synthesis. Western blot analysis of EVs produced by DPH2KD donor cells expressing D.DTA-HA indicates that DTA-HA is not efficiently loaded into EVs. [Figure 7]Heterodimerization-dependent DTA loading into extracellular viable cells (EVs). A. Scheme for heterodimerization-dependent DTA loading into EVs. FRB-DTA ​​and FKBP-CD63 are co-expressed in donor cells. Upon addition of the dimerizer, the two proteins bind to each other, recruiting FRB-DTA ​​to the EV membrane during their biogenesis, enabling efficient FRB-DTA ​​loading into EVs. FRB-DTA-loaded EVs can deliver their contents to the cytoplasm of acceptor cells upon washing away the dimerizer. B. Western blot analysis shows that FRB-DTA ​​is efficiently loaded into EVs upon addition of the dimerizer in DPH2KD donor cells. Equal amounts of protein were loaded into each sample. [Figure 8] Palm-DTA loading onto EVs. A. Scheme of Palm-DTA association with the membrane. B. Cell fractions show that Palm-DTA is mainly bound to the membrane, with only trace amounts of the protein soluble in the cytoplasm, in contrast to DTA-HA, which is found only in a soluble form. C. Quantitative protein synthesis assays show that Palm-DTA is very potent in parental cells, while DPH2KD cells are partially resistant to its activity. D. Western blot analysis reveals that when expressed in DPH2KD donor cells, Palm-DTA is efficiently loaded onto EVs. [Figure 9]Killer EVs are potent in vitro. A. Western blot characterization of EVs generated from DPH2KD donor cells expressing either Palm-DTA, Palm-DTA + VSV-G (killer EV), or none (mock). Particle quantification obtained for EVs in BA. C. The indicated EVs were incubated for 24 hours on GFP-PEST-expressing HT1080 acceptor cells. Post-incubation, GFP fluorescence quantification by FACS showed that killer EVs efficiently reduce protein synthesis in acceptor cells. D. Quantification of data from panel C shows that co-expression of VSV-G and Palm-DTA significantly improves Palm-DTA-containing EV activity in both the level of protein synthesis inhibition (GFP MFI) and the level of cell death induction (cell number). Similar experiments as in EC and D show that the effect of killer EVs is dose-dependent, as protein synthesis inhibition increases with increasing EV dose. Killer EVs are 5 times more efficient than Palm-DTA EVs. Microscopic observation of GFP-PEST-expressing HT1080 acceptors incubated with F. killer EV showed complete cell loss after 3 days. [Figure 10] Virus-free killer EVs are potent in vitro. A. DPH2KD donor cells expressing FKBP2-RFP-CD63, FRB-DTA-HA, and syncytin 1 were treated with a dimerizing agent for 24 hours before EV isolation, or not. GFP-PEST-expressing HT1080 acceptor cells were treated with DTA-loaded or unloaded syncytin 1-positive EVs using a drug-inducible loading system. GFP fluorescence quantification by FACS shows that virus-free killer EVs (loaded with DTA and decorated with syncytin 1) efficiently reduce protein synthesis in acceptor cells. B. Quantification of data from Panel A shows that syncytin 1 + DTA + EVs exhibit superior efficiency in terms of protein synthesis inhibition (GFP MFI) and cell death induction (cell number). [Figure 11]Generation of EVs for editing. (A) HeLa cells stably expressing FRB-Cas9-HA (FC9H) and CXCR4 gRNA, and EVs derived from them, were characterized by Western blotting with various positive (Alix, CD63, Hsp70, CD9) and negative (calnexin) markers. FRB-Cas9-HA expression was also analyzed using an antibody that recognizes the HA tag. Equal amounts of protein were loaded for both "cell" and "EV" conditions. (B) Wild-type HeLa, stable FC9H+ HeLa, and stable RNP HeLa (FC9H+ / CXCR4 gRNA+) were labeled with α-CXCR4 antibody coupled to APC (blue) or unlabeled (red), and analyzed by FACS using an RL1 laser. The results for "labeled cells" were plotted against the results for "unlabeled cells". Fluorescence intensity was plotted on the x-axis, and the number of cells was normalized to the mode on the y-axis. (C~D) Wild-type HeLa cells were incubated with extracellular viable cells (EVs) possessing only Cas9 and gRNA (RNP+EV), or with EVs further modified with syncytin-1 (Syn1+ / RNP+EV). After 48 hours, acceptor cells were collected, labeled with α-CXCR4 antibody coupled to APC, and analyzed by FACS using an RL1 laser. The results for "RNP+EV" or "Syn1+ / RNP+EV" were plotted against the "no EV" condition. Fluorescence intensity was plotted on the x-axis, and cell count was normalized to the mode on the y-axis. [Figure 12A]Development of a versatile tethering system. (A) A versatile tethering system was designed to increase EV docking on the acceptor cell surface. The EV surface was decorated with an adapter protein capable of capturing biotinylated antibodies. The adapter arose from a fusion between monomeric streptavidin, nanoluciferase (NLuc), the fluorescent protein mCherry, and a GPI anchor (G). Two versions of the adapter were developed: streptavidin-NLuc-mCherry-GPI (SNCG) and streptavidin-mCherry-GPI (SCG), one with nanoluciferase and one without. In this study, the adapter was coupled with α-CD8a-biotin to target CD8a-GFP+ cells. [Figure 12B] (B) Confocal images of HeLa cells transfected with mCherry cells transfected with α-CD8-biotin and α-mouse Alexa 488 ("α-mouse 488") antibody or α-mouse Alexa 488 alone, or with mCherry cells transfected with α-CD8-biotin and α-mouse Alexa 555 ("α-mouse 555") antibody. Cell labeling was performed without permeabilization. Merges represent the overlay of green and red channels. Scale bar, 10 μm. [Figure 12C] Generation of a multi-purpose tethering system. (C)EVs derived from HeLa cells transiently expressing the SNCG adapter or stably expressing nanoluciferase-Hsp70 (NLuc-Hsp70) were isolated and subjected to a sucrose gradient (20-80%). The gradient was divided into 12 fractions, which were analyzed by luminescence. Each point represents an experimental value. [Figure 12D]Development of a versatile tethering system. (D) HeLa cells transiently expressing streptavidin-NLuc-mCherry-GPI ("SNCG adapter") and EVs derived therefrom were characterized by Western blotting using various positive (CD63, CD9) and negative (calnexin) markers. SNCG adapter expression was also analyzed using α-mCherry antibody. Equal amounts of protein were loaded under both "cell" and "EV" conditions. [Figure 12E] Generation of a multi-purpose tethering system. (E)EVs emitted from HeLa cells transiently expressing the SCG adapter were isolated and analyzed by nanoparticle tracking analysis (NTA). [Figure 12F] Production of a multi-purpose tethering system. (F) EVs emitted from HeLa transiently expressing streptavidin-NLuc-mCherry-GPI were isolated and incubated with α-CD8-biotin and α-mouse Alexa 488 antibody for 2 hours, followed by size exclusion chromatography. Pick (1) contains a complex of EVs possessing an adapter and antibody, and Pick (2) contains excess free antibody. [Figure 13A] The tethering system increases EV binding and uptake. (A) Confocal images of CD8-GFP+HeLa cells transfected with α-CD8-biotin and α-mouse Alexa 555 ("α-mouse 555") antibody or α-mouse Alexa 555 alone, or GFP cells labeled with α-CD8, biotin, and α-mouse Alexa 555 ("α-mouse 555") antibody. Cell labeling was performed without permeabilization. Merges represent the superposition of green and red channels. Scale bar, 10 μm. [Figure 13B] The tethering system increases EV binding and uptake. (B) Acceptor cells CD8-GFP+ cells are pre-incubated with α-CD8, biotin, or simple α-CD8 at 4°C for 2 hours, and then incubated with EV-containing medium. [Figure 13C]Tethering systems increase EV binding and uptake. (C) HeLa cells were transfected with NLuc-mCherry-GPI or streptavidin-NLuc-mCherry-GPI, and EVs derived from them were produced over 36 hours. After removing 2,000 g and 10,000 g pellets from the EV-containing medium, the cells were incubated for 3 hours at 4°C or 37°C on CD8-GFP+ HeLa cells that had been pre-incubated for 2 hours with anti-CD8 antibody, biotinylated anti-CD8 antibody ("anti-CD8-biotin"), or without antibody. All values ​​were normalized to the "NLuc-mCherry-GPI, no antibody, 4°C" condition. [Figure 13D] The tethering system increases EV binding and uptake. (D) CD8-GFP+HeLa was pre-incubated in HBSS at 4°C for 2 hours with biotinylated anti-CD8 (anti-CD8, biotin) or non-biotinylated (anti-CD8), then incubated with a medium containing SCG+EV at 4°C for 4 hours, and imaged by confocal microscopy. The merge represents the superposition of green and red channels. Scale bar, 10 μm. [Figure 13E] The tethering system increases EV binding and uptake. (E)CD8-GFP+HeLa was pre-incubated with biotinylated anti-CD8 in HBSS at 4°C for 2 hours, and then further incubated with a medium containing SCG+EV at 4°C for another 2 hours to decorate the cell surface. The temperature was increased to 37°C for 2 hours to enable endocytosis. Subsequently, the samples were imaged by confocal microscopy. Scale bar, 10 μm. [Figure 14]The tethering system is a highly specific targeting system. (A) Wild-type HeLa and CD8-GFP+ HeLa cells were co-cultured in various ratios and pre-incubated in HBSS at 4°C for 2 hours with anti-CD8-biotin ("anti-CD8, biotin") or none ("anti-CD8"), followed by incubation in a medium containing SNCG+EV at 37°C for 5 hours. All values ​​were normalized to the "100% WT, anti-CD8" condition. (B) Wild-type HeLa cells and CD8-GFP+ HeLa cells were co-cultured and pre-incubated in HBSS at 4°C for 2 hours with biotinylated anti-CD8, followed by incubation in a medium containing SCG+EV at 4°C for 4 hours, and imaged by confocal microscopy. White lines represent the cell plasma membrane. Scale bar, 10 μm. (C) Wild-type and CD8-GFP+ acceptor HeLa cells were co-cultured in various ratios and pre-incubated with α-CD8-biotin antibody in HBSS at 4°C for 2 hours. These were then incubated with SNCG and EV cells containing mCherry (mock) or syncytin-1 at 4°C or 37°C for 4 hours. Luminescence activity associated with acceptor cells was measured, and the putative synergistic effect between syncytin-1 and the targeting system was evaluated. The "SNCG+mCherry" value was normalized to the "100%WT;SNCG+mCherry" condition, and the "SNCG+syncytin-1" value was normalized to the "100%WT;SNCG+syncytin-1" condition. [Examples]

[0122] (Example 1) A method for load-integration of EV systems Cell culture. HeLa cells—wild-type (ATCC, Virginia, USA) and genetically modified—were grown in DMEM GlutaMAX (Gibco, Illinois, USA) supplemented with 10% FBS at 37°C and 5% CO2. HeLa cells expressing nanoluciferase-Hsp70 were generated according to Bonsergent et al., Nat Comm. 2021. HeLa CD8-GFP or FRB-nanoluciferase-HA were selected after lipofectamine 2000 transfection using hygromycin B (50 mg / mL, Invitrogen, Massachusetts, USA). HeLa NLuc-CD63 was selected after lipofectamine 2000 transfection using Geneticin (50 mg / mL, Gibco, Illinois, USA).

[0123] Transfection. Cells were transfected with lipofectamine 2000 (Invitrogen) by mixing 10 μg of DNA in 10 μL of lipofectamine 2000 in a total of 2 mL of a single 10 cm dish, and 1 μg of DNA in 1 μL of lipofectamine 2000 in a total of 100 μL of a single 24-well plate well for 20 minutes. The cells were incubated with the transfection mix at 37°C and 5% CO2 for 6 hours, and their medium was replaced with serum-free DMEM GlutaMAX (Gibco, Illinois, USA). A / C heterodimerized drugs (Takara Bio Inc., Shiga, Japan) were added at this stage for loading experiments.

[0124] EV isolation. Donor cells were transfected according to the transfection section. EVs were produced in serum-starved conditions in 5 mL of DMEM GlutaMAX per 10 cm dish. After 36 hours of production, the medium was collected and centrifuged at 2,000 g at 4°C for 20 minutes to remove dead cells and cellular debris, followed by centrifuging at 10,000 g at 4°C for 30 minutes to remove large endoplasmic reticulum and apoptotic bodies (45Ti rotor). Finally, the EVs were isolated by centrifuging at 100,000 g at 4°C for 1 hour and 30 minutes (45Ti rotor, Optima® XE-90 ultracentrifuge, Beckman Coulter, California, USA). Lastly, a 100 kg pellet was collected and centrifuged again in PBS at 100,000 g at 4°C for 1 hour and 10 minutes to wash away the medium (SW55 rotor). The final pellet was resuspended in PBS and used immediately or stored at 4°C.

[0125] Suspension assay. EV isolation was performed without a washing step. 100 kg pellet was resuspended in 1 mL of 60% sucrose in PBS (prepared according to MM Temoche-Diaz, Bio Protoc. 2020) and dropped onto the bottom of an SW55 tube. 1 mL of 30% sucrose, followed by 1 mL of PBS, was deposited on the 60% fraction. The sample was then centrifuged at 4°C for at least 15 hours (SW55 rotor) and subsequently collected into nine 300 μL fractions. The luminescence activity of each fraction was directly analyzed. Next, the sucrose was washed off, and each fraction was diluted in a total of 4 mL of PBS for Western blotting, and centrifuged at 100,000 g, 4°C for 1 hour (MLA-50 rotor, Optima® MAX-XP ultracentrifuge, Beckman Coulter, California, USA).

[0126] NLuc-based uptake assays and content delivery assays were performed using EVs containing FRB-nanoluciferase-HA or nanoluciferase-CD63 as donor EVs, in accordance with Bonsergent et al. 2021. Luminescence was read using a Nano-Glo Luciferase Assay System (Promega, Wisconsin, USA) and an iD3 SpectraMax microplate reader (Molecular Devices, California, USA).

[0127] Recruitment assay. Cells were seeded on coverslips in D0 and co-transfected the following day with pC4-FKBP2-RFP-CD63 and pC4-FRB-NLuc-HA in 30% / 70% ratios. On day 3, cells were treated with an A / C heterodimerizing agent (Takara) at 37°C for 1 hour, or left untreated, and then labeled with FRB-NLuc-HA in green to prepare for confocal microscopy observation.

[0128] Cloning. PCR oligonucleotides were ordered from Eurofins Genomics (Luxembourg, Luxembourg). PCR reactions were performed according to Thermo Fisher or NEB protocols, and digestion and ligation (vector:insert molar ratio 1:3) were performed according to NEB protocols and software. 2 μL of ligation product was used to transform 20 μL of competent bacteria (Library Efficiency® DH5α competent cells, Thermo Fisher Scientific, Massachusetts, USA) at 42°C for 30 seconds. The bacteria were collected in 200 μL of SOC medium at 37°C for 1 hour with agitation, then spread on ampicillin or kanamycin agar plates and incubated overnight at 37°C.

[0129] Plasmids. pC4-GFP-HA was generated by Gregory Lavieu. VSV-G was purchased from AddGene (#8454). Syncytin-1 was provided by Thierry Heidmann. pC4-FRB-HA was generated by pC4-R H E (corresponds to Takara Bio's ARIAD). pC4-FKBP2-HA is equivalent to pC4-R H E and pC4M-F2E(ARIAD) are processed by XbaI and SpeI, and FKBP2 is processed by an empty pC4-R H It was produced by replacing with E. pC4-FKBP2-RFP-CD63 was produced by amplifying RFP-CD63 (provided by Walther Mothes) and inserting it into pC4-FKBP2-HA digested with EcoRI and BamHI. pC4-FRB-NLuc-HA was produced by amplifying NLuc (derived from NLuc-Hsp70, Bonsergent et al. 2021) and inserting it into pC4-R using the SpeI restriction enzyme site. H It was generated by inserting it into E.

[0130] antibody. Primary antibodies: anti-TGN46 (PA5-23068, Invitrogen), anti-hCD9 (Clone MM2-57, Millipore), anti-hCD63 (556019, BD Pharmingen), anti-HA (for IF, 66006-2-Ig, Proteintech; for WB, C29F4, Cell Anti-Cherry (5993-100, BioVision), Anti-Calnexin (ab133615, Abcam), Anti-ALIX (Clone 3A9, 2171S, Cell Signaling), Anti-HSP70 / HSP72 (Clone C92F3A-5, ADI-SPA-810F, Enzo Life Sciences), Anti-actin (Clone C4, MAB1501, Millipore). Secondary antibodies for Western blotting: Goat anti-rabbit IgG(H+L)-HRP conjugate (1706515, Bio-Rad) and goat anti-mouse IgG(H+L)-HRP conjugate (1706516, Bio-Rad). Secondary antibody for immunofluorescence: Goat anti-mouse IgG(H+L) high cross-absorption secondary antibody, Alexa Fluor® 488 (A11029, Thermo Fisher Scientific).

[0131] Western blotting. Cells were collected, washed in PBS, and the pellet was resuspended on ice for 20 minutes in lysis buffer (Tris 50mM, NaCl 150mM, Triton X-100 1%, protease / phosphatase inhibitor cocktail (Roche, Switzerland), pH 8). The pellet was then centrifuged at 20,000g for 15 minutes to pelletize the membrane, and the supernatant was collected. Protein concentrations of cell lysates and extracellular proteins were estimated using the Micro-BCA® protein assay kit (Thermo Scientific, Illinois, USA). Samples were mixed with 4×Laemmli buffer (Bio-Rad, California, USA) prepared with 10% β-mercaptoethanol (BME), excluding CD63 protein, which cannot be detected in the presence of BME. Electrophoresis was performed on 4-20% polyacrylamide gels in Tris / glycine / SDS buffer (Bio-Rad) (Bio-Rad, California, USA), and proteins were transferred to Immun-Blot PVDF membranes (0.2 μm, Bio-Rad) using the TransBlot Turbo system (Bio-Rad). Precision Plus Protein® standard material (Bio-Rad) was used as a ladder. Subsequently, the membranes were blocked in 0.05% Tween 5% milk in PBS at room temperature for 1 hour, and then incubated overnight with primary antibody diluted 1 / 1000 in 0.05% Tween 5% milk in PBS. Next, the membranes were washed in PBS 0.05% Tween for 1 hour, incubated with secondary antibody diluted 1 / 10,000 in PBS 0.05% Tween, and washed in PBS 0.05% Tween for 1 hour. The membranes were colorized using Clarity® Western ECL substrate (Bio-Rad) and ImageQuant® LAS400 (GE Healthcare Life Sciences, Chicago, USA). Image analysis and quantification were performed using Fiji software.

[0132] Confocal microscopy. For stable cell lines, cells were seeded on coverslips one day before fixation; for transient protein expression, cells were seeded two days prior and transfected the following day. Next, the cells were washed three times with cold PBS and incubated in 4% PFA at room temperature for 15 minutes. If antibody labeling was performed, the cells were permeabilized with Triton-X100 (Sigma-Aldrich, Massachusetts, USA) at room temperature for 15 minutes, incubated with a 1 / 500 diluted primary antibody at room temperature for 2 hours, incubated with a 1 / 2,000 diluted secondary antibody at room temperature for 1 hour, and finally, DAPI staining was performed at a 1 / 10,000 dilution if necessary. Coverslips were attached using ProLong® Diamond Antifade Mountant (Invitrogen).

[0133] Images were acquired using an LSM880 confocal microscope (ZEISS, Baden-Württemberg, Germany). Image analysis and quantification were performed using Fiji software.

[0134] Nanoparticle tracking analysis was performed using a ZetaView x20 (Particle Metrix, Amazey, Germany) with the following parameters: 488 nm laser, scattering, 11 positions, 1 cycle, sensitivity 80, shutter 100, pH 7 input, T°C detection. All samples were diluted in 1× filtered PBS.

[0135] (Example 2) "Killer EV" method: Cell culture. HeLa cells and HT1080 cells (ATCC, Virginia, USA) and their transgenic derivatives were grown at 37°C under 5% CO2 and high humidity in DMEM medium (Gibco, Illinois, USA) supplemented with 10% heat-inactivated fetal bovine serum (Biowest, France). The HT1080 cell medium was further supplemented with MEM NEAA (Gibco, Illinois, USA).

[0136] Stable DPH2KD HeLa cells were obtained by lentiviral transduction with a DPH2-targeting shRNA (Horizon Discovery, Cat# VGH5518-200302258, UK) and selected with 4 μg / mL puromycin (Gibco, Illinois, USA). Stable GFP-PEST HT1080 clones were obtained by transfection with a GFP-PEST coding plasmid (Addgene, Cat# 26821, Massachusetts, USA) followed by cell selection with 0.5 mg / mL geneticin (Gibco, Illinois, USA).

[0137] Transient transfection was performed using lipofectamine 2000 (Invitrogen, Massachusetts, USA) according to the manufacturer's instructions.

[0138] Plasmid construct. To construct a plasmid encoding DTA-HA, the sequence for DTA (Addgene, Cat# 42521, obtained from Massachusetts, USA) was used in pC4R H The HA tag sequence was fused to the E backbone (ARIAD Pharmaceuticals, Massachusetts, USA) using an infusion cloning strategy with an XbaI / SpeI cloning site (Takara Bio Europe, France). Next, the DTA-HA construct was subcloned to the pCDNA3.1 backbone (Invitrogen, Massachusetts, USA) using an NheI / BamHI cloning site.

[0139] To construct a plasmid encoding Palm-DTA-HA, the SNAP25 palmitoylation sequence (Greaves et al., JBC 2000) was inserted into the N-terminus of DTA-HA using infusion cloning (Takara Bio Europe, France).

[0140] To construct the plasmid encoding FRB-DTA-HA, first the FRB sequence is obtained using the NheI / BamHI cloning site, and plasmid pC4R is used as the FRB template. H The DTA-HA sequence was cloned into the pcDNA3.1 backbone (Invitrogen, Massachusetts, USA) using E. Subsequently, the DTA-HA sequence was cloned into the BamHI / XbaI region of this plasmid.

[0141] qRT-PCR. Total RNA was extracted from cells using the Nucleospin RNA Kit (Macherey Nagel, France) according to the manufacturer's instructions. Equal amounts of total RNA were reverse transcribed using the iScript cDNA synthesis kit, all according to the manufacturer's instructions, and subjected to qPCR using the iTaq SYBR Green Kit (Bio-Rad, France). qPCR was performed on a CFX96 system (Bio-Rad, France) for 40 cycles: 10 minutes at 95°C, followed by 15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C. DPH2 gene expression was normalized to the PGK housekeeping gene according to the 2-ΔΔCt method.

[0142] Protein synthesis assay. Parental or DPH2KD HeLa cells were seeded in 24-well plates and then co-transfected with a plasmid encoding NanoLuc-Hsp70 and a mock, or a plasmid encoding either DTA-HA or Palm-DTA-HA. Six hours after transfection, cells were detached and divided into triple repeat wells of a 96-well plate. After 24 hours, cells were washed with DPBS, and NanoLuc activity was measured in each well using a Nano-Glo Live Cell Assay System (Promega, Wisconsin, USA) with an iD3 SpectraMax microplate reader (Molecular Devices, California, USA) according to the manufacturer's instructions. The percentage of protein synthesis was calculated for each cell type examined, relative to mock-transfected cells (mock set to 100%).

[0143] EV preparation. EV donor cells were transfected with the indicated plasmid for 16 hours, followed by incubation in serum-free DMEM for 24 hours. The conditional medium was collected and centrifuged at 2000×g for 20 minutes at 4°C to remove cell debris. The EVs were then pelletized by ultracentrifugation at 100,000×g for 1 hour and 30 minutes at 4°C (45Ti rotor and Optima® XE-90 ultracentrifuge, Beckman Coulter, California, USA). The EV pellet was washed with DPBS and centrifuged at 100,000×g for 1 hour and 30 minutes at 4°C (MLA50 rotor with dedicated adapter and Optima MAX-XP ultracentrifuge, Beckman Coulter, California, USA). The washed pellet was resuspended in DPBS, and the EVs were stored at -20°C (if Western blot analysis was planned) or applied immediately to acceptor cells.

[0144] Western blotting. Cells to be analyzed were scraped in DPBS on ice and pelleted at 1000×g for 5 minutes at 4°C. The cell pellet was resuspended in PBX lysis buffer (DPBS, Triton-X-100 1%, EDTA-free protease / phosphatase inhibitor cocktail (Roche, Switzerland)) and incubated on ice for 10 minutes with intermittent vortexing. The sample was then centrifuged at 15,000×g for 10 minutes at 4°C to pellet the nuclei and undestroyed cells. The supernatant (cell lysate, CL) was collected. Protein concentrations of cell lysate and extracellular proteins were obtained using the Micro BCA Protein Assay Kit (Thermo Scientific, Illinois, USA). Except for the detection of CD63 and CD9 (without β-mercaptoethanol), the samples were mixed with Laemmli buffer (Bio-Rad, France) containing 10% β-mercaptoethanol and loaded onto 4-15% polyacrylamide gels (Bio-Rad, France). After electrophoresis, the proteins were transferred to a PVDF membrane using the Trans-Blot Turbo system (Bio-Rad, France). The membrane was incubated with DPBS (blocking buffer) containing 0.05% Tween20 and 5% nonfat milk, followed by 1 / 1000 dilution of primary antibodies (α-actin (Cat# MAB1501, Millipore, Germany), α-ALIX (Cat# 2171, Cell Signaling, Massachusetts, USA), α-calnexin (Cat# ab133615, Abcam, UK), α-CD63 (Cat# 556019, BD Bioscience, New Jersey, USA), α-CD9 (Cat# cbl162, Millipore, Germany), α-Hsp70 (Cat# ADI-SPA-810-D, Enzo LifeScience, New York, USA), α-HA (Cat# 3724, Cell Signaling, Massachusetts, USA), α-mCherry (Cat# The sample (5993, BioVision, California, USA) was incubated overnight in blocking buffer at 4°C.Next, the membranes were washed and finally incubated with a 1 / 5000 dilution of HRP-coupled secondary antibody (α-mouse or α-rabbit, Cat# 115-035-003, Jackson ImmunoResearch, UK) in DPBS containing 0.05% Tween20. The HRP signals on the membranes were spread using Clarity Western ECL substrate (Bio-Rad, France) and imaged using ImageQuant LAS4000 (GE Healthcare Life Sciences, France).

[0145] Cytoplasmic / membrane fractionation. Cells to be analyzed were scraped in DPBS on ice and pelleted at 1000 × g at 4°C for 5 minutes. The cell pellet was resuspended in 5x volume of hypotonic lysis buffer (10 mM Tris-HCl pH8, 0.5 mM MgCl2, EDTA-free protease / phosphatase inhibitor cocktail (Roche, Switzerland)), incubated on ice for 10 minutes, and then homogenized by passing through a 26 g needle 10 times up and down. Tonicity was restored by adding 0.25 volume of hypotonic buffer containing 0.6 M NaCl. Nuclei and undestroyed cells were pelleted at 500 × g at 4°C for 5 minutes. After adding EDTA to the supernatant to a final concentration of 0.05 M, the sample was subjected to ultracentrifugation at 100,000 × g at 4°C for 30 minutes (MLA50 rotor with dedicated adapter and Optima MAX-XP ultracentrifuge, Beckman Coulter, California, USA). The resulting supernatant constituted the cytoplasmic fraction. The pellet was resuspended in PBX and centrifuged at 10,000 × g at 4°C for 15 minutes to pelletize the insoluble material. The supernatant constituted the membrane fraction.

[0146] Particle weighing. Nanoparticle tracking analysis was performed using ZetaView® QUATT (Particle Metrix, Meerbusch, Germany) and its corresponding software (ZetaView 8.02.28). For size measurement, a 448 nm scattering mode laser was used. 1 ml of sample diluted in DPBS was loaded into a cell, and each sample was measured at 11 different locations throughout the cell using the instrument. After automated analysis of all locations and removal of any outliers, the mean, median, and mode (expressed as diameter) were calculated by optimization machine software.

[0147] FACS analysis. After treatment, cells were detached from the cell culture plate with 0.05% trypsin-EDTA and washed once in DPBS. Finally, the cells were resuspended in DPBS and kept on ice (less than 1 hour) until analysis on an Attune NxT flow cytometer (Thermo Scientific, Illinois, USA). Each sample was incubated with 10 μg / mL DAPI (Merck Millipore, Massachusetts, USA) immediately before analysis. Data were analyzed using FlowJo software (BD Bioscience, New Jersey, USA).

[0148] Microscopy. Living cells were visualized at 20x magnification under an EVOS M5000 microscope. Image analysis was performed using ImageJ software (NIH, Maryland, USA).

[0149] result: The inventors have developed a novel method for controlling the cargo load to EVs as needed. These EVs are equipped with non-viral fusogens as needed, thereby enhancing EV-cargo delivery to acceptor cells.

[0150] To acutely measure this process, the inventors tracked the fate of luciferase-tagged cargo. Cargo loading was made possible by a drug-reversible, inducible dimerization system. Briefly, donor cells were transfected with a plasmid encoding CD63 tagged with the classic membrane EV marker FKBP and FRB-nanoluciferase (NLuc), which is normally present in the cytoplasm. Upon addition of the dimerized drug, FRB-NLuc interacts with FKBP-CD63 and is recruited to secreted EVs. This is accompanied by enhanced delivery to acceptor cells. This phenomenon can be further enhanced if the EVs possess syncytin 1, a mammalian fusion protein that induces fusion between the EV membrane and the plasma membrane of acceptor cells.

[0151] The inventors anticipate that a first application will be the development of "editing EVs" to deliver the Cas9 editing mechanism to target cells / tissues. Another application will be the delivery of toxins using "killer EVs" aimed at the specific elimination of cells / tissues, including tumor cells.

[0152] Using a novel process developed by the inventors, they have demonstrated that the catalytic domain of diphtheria toxin (DTA), which is responsible for inhibiting protein synthesis and ultimately causing cell death, can be delivered to acceptor cells via functionalized extracellular matrix (EVs). This resulted in inhibition of protein synthesis and death of the acceptor cells.

[0153] This novel method and its derived applications are expected to open a new chapter in precision medicine, particularly when extracellular viable cells (EVs) possess antibodies against cell-specific antigens.

[0154] (Example 3) Materials and methods relating to Examples 4 and 5 Cell culture. HeLa cells—wild-type and stable genetically modified—were cultured at 37°C and 5% CO2 in DMEM GlutaMAX (Gibco, Illinois, USA) supplemented with 10% FBS. HeLa cells stably expressing CD8-GFP or FRB-Cas9-HA were selected using hygromycin B (50 mg / mL, Invitrogen, Massachusetts, USA) after lipofectamine transfection. FRB-Cas9-HA + Using HeLa, clone selection is performed after transfection using puromycin (10 mg / mL, Gibco, Illinois, USA), and CXCR4 - By subcloning to enrich populations with HeLa (FACS screening), RNPs that stably express both FRB-Cas9-HA and CXCR4-gRNA can be developed. + HeLa was generated.

[0155] Transfection. Cells were transfected at confluence 70% using lipofectamine 2000 (Invitrogen, Massachusetts, USA) according to the constructor protocol, with 10 μL of lipofectamine and 10 μg of DNA per 10 cm dish, and 1 μL of lipofectamine and 1 μg of DNA per well in a 24-well plate.

[0156] Plasmid. Syncytin-1 was generously provided by Thierry Heidmann. The CD8-GFP plasmid was purchased from Addgene (#86051), digested with NheI and XbaI, and inserted into pcDNA3-smURFP-IRES-eGFP (Addgene, #80343). pC4-mCherry, pC4-GFP, and pC4-FKBP2-RFP-CD63 have been generated in our laboratory to date (Bui et al. 2023).

[0157] Cas9-NLS was amplified from Wrench CRISPRv2 Neo (AddGene #98292) using (forward) CTACTATCTAGAGACAAGAAGTACAGCATCGGCCTGG and (reverse) CTGCTGACTAGTTTTCTTCTTCTTAGCCTGTCCAGCCT, digested with XbaI and SpeI, and inserted into pC4-RhE (Takara Bio Inc., Shiga, Japan) (pC4-Cas9-FRB-HA) digested with XbaI or pC4-RhE (Takara Bio Inc., Shiga, Japan) (pC4-FRB-Cas9-HA) digested with SpeI. FRB-Cas9-HA was transferred into the pIRES vector (Addgene #80343) using NheI and BsrGI, and the following primers: (forward) GCAGCAGCTAGCGCCACCATGGCTTCTAGAATCCTCTG and (reverse) GCAGCATGTACATTATGCGTAGTCTGGTACGTCGTACG.

[0158] pGL3-U6-CXCR4-gRNA was generated as follows: Two ssDNA oligos corresponding to spacer sequences that recognize the CXCR4 target sequence (GAAGCGTGATGACAAAGAGG, source Mocciaro, CommBiol, 2018) were annealed and phosphorylated according to the Kosuke Yusa protocol. The vector was digested with BsaI enzyme and ligation was performed according to the NEB protocol. ssDNA oligo sequences: (upper strand) CCGGGAAGCGTGATGACAAAGAGG and (lower strand) AAACCCTCTTTGTCATCACGCTTC.

[0159] pC4-nanoluciferase was generated by inserting nanoluciferase adjacent to XbaI and SpeI in pC4-RhE (Takara Bio Inc., Shiga, Japan) digested with XbaI and SpeI. Nanoluciferase was PCR amplified from the NLuc-Hsp70 plasmid (Bonsergent 2021) using the following primers: (forward) GCAGCATCTAGAATGGTCTTCACACTCGAAGATTTCGTTG and (reverse) GCAGCAACTAGTCGCCAGAATGCGTTCGCAC.

[0160] pC4-mCherry-GPI was generated by inserting adjacent GPIs with XbaI and SpeI, followed by PCR amplification from the SBP-EGFP-GPI plasmid (boncompain et al., 2012) using the following primers: (forward) GCAGCATCTAGACTGGAAAATGGCGGAACCTC and (reverse) GCAGCAACTAGTTCATGGGTGGAGGGACCAAG, and then digesting pC4-mCherry with SpeI.

[0161] pC4-ss-mCherry-GPI was generated by replacing mCherry-GPI with pC4-ss-mCherry-GPI digested with XbaI and SpeI, and then with pC4-ss-GFP-FM4-TMCD8 (Lavieu et al., 2013) plasmid digested with XbaI and SpeI. This procedure allowed for the addition of a signal sequence (ss).

[0162] pC4-NanoLuciferase-mCherry-GPI was generated in pC4-ss-mCherry-GPI, which was digested with XbaI alone, by nanoluciferase genes adjacent to XbaI and SpeI. The nanoluciferase genes arise from the digestion of pC4-nanoluciferase by XbaI and SpeI.

[0163] pC4-streptavidin-mCherry-GPI was generated by amplifying streptavidin and its signal sequence from the Str-KDEL_ManII-SBP-EGFP plasmid (Boncompain et al., 2012), and inserted into pC4-mCherry-GPI using EcoRI and XbaI. The primers used for amplification were: (forward) GCAGCAGAATTCATGGATGTATGCGTCCGTCTTGC and (reverse) GCAGCATCTAGACTGCTGGACGGCATCCAGAG.

[0164] pC4-streptavidin-nanoluciferase-mCherry-GPI was generated by the nanoluciferase gene adjacent to XbaI and SpeI in pC4-streptavidin-mCherry-GPI digested with XbaI alone. The nanoluciferase gene arises from the digestion of pC4-nanoluciferase by XbaI and SpeI.

[0165] RT-PCR. RT-PCR experiments were performed using the OneTaq® One-Step RT-PCR Kit (NEB, MA, USA) according to the constructor's instructions, and the "no RT" control was performed using OneTaq® Hot Start DNA Polymerase (NEB, MA, USA). The following primers were used: (CXCR4-gRNA, forward) GAAGCGTGATGACAAAGAGGGT, (CXCR4-gRNA, reverse) ACCGACTCGGTGCCACTT, (GAPDH, forward) CGAGCCACATCGCTCAGAC, and (GAPDH, reverse) ATGTAGTTGAGGTCAATGAAGGGGTC.

[0166] Indel tracking based on Sanger sequencing. PCR products were sequenced using the Eurofins Genomics Sanger sequencing service. Sequences were processed using ICE software provided by Synthego.

[0167] Antibodies. CD8a monoclonal antibody (OKT8 (OKT-8)), biotin (#13-0086-82, eBioscience®, California, USA); CD8a monoclonal antibody (OKT8 (OKT-8)) (#14-0086-80, eBioscience®, California, USA); CD184 (also known as CXCR4) mouse anti-human, APC, Clone 12G5 (BD Biosciences, New Jersey, USA).

[0168] Secondary antibodies for immunofluorescence: Goat anti-mouse IgG(H+L) high cross-absorption secondary antibody, Alexa Fluor® 488 (A11029, Invitrogen, Massachusetts, USA) and Goat anti-mouse IgG(H+L) high cross-absorption secondary antibody, Alexa Fluor® 555 (A21424, Invitrogen, Massachusetts, USA).

[0169] EV production and isolation. EVs were produced according to the protocol of Bui et al.

[0170] FACS. Cells were collected, washed three times with cold PBS, fixed with 1% PFA, and stored at 4°C for up to 72 hours. Labeling and FACS analysis were performed on the same day. CXCR4 labeling using CD184 (also known as CXCR4) mouse anti-human, APC, Clone 12G5 (BD Biosciences, New Jersey, USA) was performed according to the constructor protocol, followed by three PBS washes. FACS analysis was performed using an Attune NxT flow cytometer (ThermoFisher, Massachusetts, USA), and data were analyzed using FlowJo software. Antibody recruitment by decorated EVs. EVs possessing streptavidin-nanoluciferase-mCherry-GPI were isolated and finally resuspended in 100 μl of PBS. EVs were incubated with 0.1 ng each of primary antibody (anti-CD8 antibody, biotin) and secondary antibody (Alexa Fluor) at 4°C with agitation (300 rpm). Next, the EVs were subjected to size exclusion chromatography using a "qEV original / 70nm Gen2 column" (Izon Science, Christchurch, New Zealand). 500 μL was collected from the first five fractions, followed by 400 μL from each subsequent fraction. Emission was measured in a white 96-well plate, and fluorescence in a black 96-well plate.

[0171] Binding and uptake by transfer to EV-containing medium. On day 1, donor WT HeLa cells were seeded in 24-well plates and reached 80% confluence the following day. On day 2, donor WT HeLa cells were transfected with either the pC4-streptavidin-mCherry-GPI or pC4-streptavidin-nanoluciferase-mCherry-GPI plasmid, and the complete medium was replaced with serum-free medium 6 hours after incubation. On day 3, acceptor cells (CD8-GFP) were transfected. +HeLa or WT HeLa cells were seeded and reached 40% confluence for confocal microscopy experiments and 90% confluence for luminescence experiments. On day 4, acceptor cells were pre-incubated at 4°C for 2 hours with antibodies diluted in Hanks buffer solution (HBSS, Gibco, Illinois, USA). The antibodies were biotinylated or unbiotinylated anti-CD8 antibodies diluted to a final concentration of 0.5 ng / μL. Next, the donor cell medium was collected in sterile tubes and fractionated by centrifugation: 2,000 g at 4°C for 10 minutes, followed by 10,000 g at 4°C for 10 minutes. The medium was kept on ice. After pre-incubation of acceptor cells, the antibody-containing HBSS was rapidly discarded, and excess antibody was removed by washing with cold PBS. Next, the conditioning medium was added to the cells (200 μL for 96-well plates and 1 mL for 24-well plates), and the cells were incubated at 4°C for the binding assay or at 37°C for the uptake assay.

[0172] EV-mediated gene editing. Donor gRNA + / FC9H + HeLa cells were seeded in a 10 cm dish on day 1 and reached 80% confluence on day 4. On day 4, donor cells were transfected, and after 6 hours of incubation, the culture medium was replaced with serum-free DMEM. On day 5, acceptor cells (wild-type or CD8-GFP) were transfected. +HeLa cells were seeded and reached 60% confluence the following day. On day 6, extracellular viable cells (EVs) derived from donor cells were isolated by fractionation ultracentrifugation and incubated on acceptors in serum-free DMEM for 48 hours. EV amounts were normalized based on protein concentrations estimated by BCA. When EVs were decorated with a targeting system, acceptor cells were pre-incubated with α-CD8-biotin diluted in HBSS at 4°C for 2 hours, followed by incubation with EVs for 48 hours. On day 8, acceptor cells were treated as follows: the EV-containing medium was discarded, cells were detached using 250 mM EDTA, double repeats were pooled, cells were fixed with 1% PFA, labeled with α-CXCR4-APC on ice for 1 hour, and then subjected to FACS analysis.

[0173] (Example 4) EV for editing: The inventors have previously engineered killer extracellular genes (EVs) using a Syn-1 fusion system free of load and virus (Example 2). Here, the inventors engineered an editing EV containing guide RNA for Cas9 and the plasma membrane-localized receptor CxCR4, and decorated with syncytin 1 to enhance delivery capacity. The inventors demonstrated that the Syn1+ editing EV could efficiently knock out CxCr4 in approximately 30% of acceptor cells (Figure 11).

[0174] (Example 5) Targeting The inventors have previously described loading and fusion systems (Examples 1 and 2). Here, the inventors manipulated a targeting system in which a membrane-tethered protein possesses luminal streptavidin. This chimeric protein, which the inventors refer to as the adapter, can decorate EVs and recruit any biotinylated antibody on its surface. As proof of concept, the inventors selected CD8 as the target antigen and demonstrated that EVs possessing the adapter can be exclusively and selectively targeted to CD8-positive cells. The results are shown in Figures 12 to 14. This extends the previous examples and confirms a three-step process (loading, targeting, and fusion). Importantly, Figure 13C shows that the fusion and targeting modules work synergistically.

[0175] References: Throughout this application, various references describe the cutting edge of the art relating to the present invention. The disclosures of these references are incorporated into this disclosure by reference.

Claims

1. Isolated extracellular vesicles (EVs) that are functionalized at a targeting site, loaded with one or more target cargoes, and optionally functionalized with HERV envelope proteins.

2. The isolated EV according to claim 1, wherein the targeting site is a ligand or an antibody.

3. The isolated EV according to claim 2, wherein the targeting site has binding affinity to cell surface molecules of the target cell.

4. The isolated EV according to claim 3, wherein the targeting site is specific to a cancer antigen.

5. The isolated extracellular vesicle (EV) according to any one of claims 1 to 4, wherein the targeting site is biotinylated and conjugated to the extracellular vesicle (EV) by a tethering system consisting of the biotinylated targeting site and one avidin moiety that creates an avidin-biotin complex.

6. The isolated EV according to claim 5, wherein the avidin portion is a monomer of streptavidin.

7. The isolated EV according to claim 6, wherein the streptavidin monomer consists of the amino acid sequence described in SEQ ID NO:

3.

8. The isolated EV according to claim 6 or 7, wherein the avidin portion is conjugated to the EV via a GPI anchor.

9. The isolated EV according to claim 8, wherein the GPI anchor has the amino acid sequence described in SEQ ID NO:

4.

10. The isolated EV according to any one of claims 5 to 9, wherein the avidin portion is fused to one fluorescent protein and optionally to a luciferase fragment protein.

11. The isolated EV according to claim 10, conjugated to an adapter protein resulting from a fusion between monomeric streptavidin, the fluorescent protein mCherry, a GPI anchor, and optionally nanoluciferase.

12. The isolated EV according to claim 11, wherein the adapter protein comprises the amino acid sequence described in SEQ ID NO: 5 or SEQ ID NO:

6.

13. The isolated EV according to any one of claims 1 to 12, wherein the cargo is selected from the group consisting of organic molecules, polymers, polypeptides, polynucleotides and small organic compounds having a molecular weight greater than 50 daltons and less than about 2,500 daltons.

14. The isolated EV according to claim 13, wherein the cargo is a polynucleotide, more specifically, an RNA or DNA molecule.

15. The isolated EV according to claim 13, wherein the cargo is a polypeptide selected from the group consisting of transcription activator-like effector nucleases (TALEN), zinc finger nucleases (ZFN), CRISPR-related endonucleases, base editing enzymes, and DNA targeting endonucleases such as prime editors.

16. The isolated EV according to claim 13, wherein the cargo is toxic.

17. The isolated EV according to claim 16, wherein the toxin is diphtheria toxin or a toxic fragment thereof.

18. The isolated EV according to claim 17, wherein the diphtheria toxin comprises residues 1 to 389 of SEQ ID NO:

7.

19. An isolated EV according to any one of claims 1 to 18, comprising a structural polypeptide capable of forming a dimer with a cargo polypeptide.

20. The isolated EV according to claim 19, wherein the structural polypeptide and the cargo polypeptide are fused directly or via a linker to their respective domains, which are capable of dimerization in the presence of the compound.

21. The isolated EV according to claim 20, wherein a structural polypeptide is fused to the FKBP domain and a cargo polypeptide (e.g., a toxin) is fused to the FRB domain (or vice versa), thereby enabling dimerization of the FKBP domain and the FRB domain in the presence of rapamycin during EV production.

22. The isolated EV according to claim 21, comprising a loading system in which a transmembrane protein is fused to the FKBP2 domain.

23. The isolated EV according to claim 22, wherein the transmembrane protein is a tetraspanin.

24. The isolated EV according to claim 23, wherein the tetraspanin is CD63.

25. The isolated EV according to claim 24, wherein the loading system consists of the amino acid sequence described in Sequence ID No.

10.

26. The isolated EV according to any one of claims 1 to 25, which is functionalized with HERV envelope glycoprotein.

27. The isolated HERV according to claim 26, wherein the HERV envelope glycoprotein is HHERV syncytin.

28. The isolated EV according to claim 27, wherein HHERV syncytin is selected from the group consisting of human syncytin (e.g., HERV-W and HERV-FRD), mouse syncytin, syncytin-Ory1, syncytin-Car1, syncytin-Rum1, or functional orthologs thereof.

29. The isolated EV according to claim 28, wherein HERV syncythin is a syncythin-1 polypeptide comprising the amino acid sequence (SDGGGX2DX2R) described in SEQ ID NO: 2, and capable of binding to the ASCT1 receptor, preferably the ASCT2 receptor.

30. The isolated EV according to claim 28, wherein the syncytin-1 polypeptide comprises the amino acid sequence (SDGGGVQDQAR) described in SEQ ID NO:

11.

31. The isolated EV according to claim 30, wherein the syncytin-1 polypeptide comprises an amino acid sequence having 70% identity with the amino acid sequence in the range from the amino acid residue at position 21 to the amino acid residue at position 538 in SEQ ID NO:

1.

32. A method for treating a subject in need of treatment, comprising the step of administering a therapeutic dose of an isolated EV according to any one of claims 1 to 31 to the subject.

33. The method according to claim 32 for the treatment of cancer.

34. A pharmaceutical composition comprising an isolated EV according to any one of claims 1 to 31.

Images