A tool for accurately assessing clonal immunoglobulin (IG) / T cell receptor (TR) gene rearrangements

Abstract

The present invention relates to means and methods for assessing clonal immunoglobulin (IG) / T-cell receptor (TR) gene rearrangements in clinical, diagnostic, and / or research settings. Provided is a quality control composition containing a mixture of genomic DNA isolated from a set of nine cultured cell lines, including the B cell lines ALL / MIK (ALL), Raji (Burkitt's lymphoma), REH (B-precursor ALL), TMM (CML-BC / EBV+B-LCL), TOM-1 (B-precursor ALL), and WSU-NHL (B-cell lymphoma), and the T cell lines JB6 (ALCL), Karpas299 (ALCL), and MOLT-13 (ALL), or in which one or more of the cell lines in the set are replaced with one or more other cell lines containing the same IG / TR gene rearrangement. Also provided is a composition consisting of substantially equimolar amounts of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells.

Description

[Technical field]

[0001] The present invention relates to the fields of immunology, immunogenetics and clinical diagnostics, and in particular to means and methods for assessing clonal immunoglobulin (IG) / T-cell receptor (TR) gene rearrangements in clinical, diagnostic and / or research settings. [Background technology]

[0002] Specific antigen recognition by cells of the adaptive immune system (B cells, T cells) is mediated through receptors (immunoglobulin, IG, and T cell receptor, TR) that are uniquely formed during immune development in the bone marrow and thymus, respectively. Through recombination of IG / TR loci, a unique diverse (polyclonal) repertoire of IG / TR receptors is created. In some autoimmune diseases, this repertoire is biased (oligoclonal), whereas in lymphoid malignancies, the receptors are nearly identical (monoclonal) (Non-Patent Documents 1-7). Thus, IG / TR rearrangements form unique genetic biomarkers (molecular signatures) for the study of immune cells for clinical, diagnostic, and research applications (Non-Patent Documents 8-11). Classically, immunogenetic analysis methods are mostly fragment analysis and Sanger sequencing. The introduction of next-generation sequencing (NGS) has enabled deeper analysis of IG / TR rearrangements, strongly impacting the main immunogenetic applications: clonality assessment, minimal residual disease (MRD) detection, and repertoire analysis (Non-Patent Documents 12-29).

[0003] Identification and evaluation of clonal IG / TR gene rearrangements is a widely used tool for the diagnosis and follow-up of lymphoid malignancies (Non-Patent Documents 30-35). NGS of IG / TR gene rearrangements is becoming increasingly popular in clinical laboratories, as it avoids the laborious design of patient-specific real-time quantitative (RQ)-PCR assays and allows sequencing of a large number of rearrangements and rearrangement types in a single sequencing run. Thus, several methods have already been described for high-throughput profiling of IG / TR rearrangements in the diagnosis and follow-up of acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), and other lymphoid malignancies (Non-Patent Documents 16, 17, 23, 24, 36, 37).

[0004] Potential applications of IG / TR NGS are the identification of clonal IG / TR markers in diagnostic samples for the subsequent analysis of minimal residual disease (MRD) in various lymphoid malignancies (mainly ALL, CLL, follicular lymphoma, mantle cell lymphoma, multiple myeloma), as well as the actual MRD analysis itself. Moreover, it can be applied to clonality diagnostic methods in the diagnostic process of lymphoproliferative disorders. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Tonegawa S. Somatic generation of antibody diversity. Nature 1983; 302: 575-581. [Non-Patent Document 2] Davis MM, Bjorkman PJ. T-cell antigen receptor genes and T-cell recognition. Nature 1988; 334: 395-402. [Non-Patent Document 3] Schlissel MS. Regulating antigen-receptor gene assembly. Nat Rev Immunol 2003; 3: 890-899. [Non-Patent Document 4] Lefranc MP, Lefranc G. The T cell receptor factsbook. Academic Press, 2001. [Non-Patent Document 5] Lefranc MP, Lefranc G. The immunoglobulin factsbook. Academic Press, 2001. [Non-Patent Document 6] Monroe JG, Dorshkind K. Fate Decisions Regulating Bone Marrow and Peripheral B Lymphocyte Development. In: Advances in immunology. 2007, pp 1-50. [Non-Patent Document 7] von Boehmer H, Melchers F. Checkpoints in lymphocyte development and autoimmune disease. Nat Immunol 2010; 11: 14-20. [Non-Patent Document 8] Evans PAS, Pott C, Groenen PJTA, Salles G, Davi F, Berger F et al. Significantly improved PCR-based clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets. Report of the BIOMED-2 Concerted Action BHM4-CT98-3936. Leukemia 2007; 21: 207-214. [Non-Patent Document 9] Bruggemann M, White H, Gaulard P, Garcia-Sanz R, Gameiro P, Oeschger S et al. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936. Leukemia 2007; 21: 215-221.

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Non-Patent Document 22

Direct Entries 26

Direct Accounts 27

Direct Environment 28

Direct Account 29

Draw 30 pages

Direct Entries 31

Direct Environment 32

Direct Entries 33

Direct Entries 34

Direct Entries 35

Direct Entries 36

Direct Entries 37

Outdoor Tools 42

Direct Environment 43

Direct Environment 44

Direct Environment 45

[0006] NGS assays, especially those based on amplicons, have proven to have significant challenges. For example, multiple primers need to be annealed under identical reaction conditions, while many technical variables, such as sample preparation, library construction, sequencing and bioinformatics, can be introduced, potentially resulting in inaccurate results (38). Unfortunately, scientifically controlled multi-center standardization and validation are still lacking. Strategies for standardization of experimental protocols and quality control (QC) of each component of NGS assays are highly needed, especially in clinical settings.

[0007] Standard samples are essential for the evaluation of wet-lab and in silico NGS processes to ensure analytical validity of test results before NGS technology is introduced into the clinic (Non-Patent Documents 29, 39, 40). Reference DNA material should be a stable source of re-edits that can be sequenced and used to measure qualitative and quantitative characteristics. However, the inventors recognized that the standards published to date are limited in scope and usefulness because (1) they do not cover all IG / TR loci, (2) they do not report the sequencing quality or sample and primer performance, and / or (3) they are synthetic constructs that may not reflect the complexity of native genomic DNA (Non-Patent Documents 23, 41, 42).

[0008] Therefore, they aimed to provide an improved type of quality control that could be easily unified with current systems for the immune profiles of IG / TR sequence data, in particular ARResT / Interrogate (43), a web-based interactive computational platform that can process and annotate large amounts of immunogenetic data, calculate multiple relevant statistics including QC, and present the results in the form of multiple interconnected visualizations. More specifically, they sought to provide a composition that could be added directly to samples to serve as an in-tube quantitative and qualitative standard for simultaneous library preparation and sequencing, and subjected to the same downstream technical variables as the added sample. Furthermore, they aimed to provide a composition that could uniformly assess performance bias or aberrant amplification shifts for all types of IG / TR gene rearrangements during sequencing by tracking primer usage and comparing it to a stored reference profile. [Means for solving the problem]

[0009] To that end, the inventors of the Euroclonality-NGS Working Group collaborated to develop, standardize, and validate in vitro assays and bioinformatics for the use of IG / TR. This resulted in the provision of two novel types of quality control, the in-tube focused quality / quantity control (cIT-QC) based on human B- and T-cell lines with well-defined IG / IR gene rearrangements, and the polytarget focused quality control (cPT-QC) based on a standardized mixture of lymphoid samples representing the entire repertoire of IG / TR genes.

[0010] Thus, in a first aspect, the invention provides a composition (also referred to herein as "centralized quality / quantity control in a tube (cIT-QC)") comprising a mixture of genomic DNA isolated from a set of nine cultured cell lines, the set including the B cell lines ALL / MIK (B-cell precursor ALL), Raji (Burkitt's lymphoma), REH (B-cell precursor ALL), TMM (CML-BC / EBV+B-LCL), TOM-1 (B-cell precursor ALL), WSU-NHL (B-cell lymphoma); and three T cell lines: JB6 (ALCL), Karpas299 (ALCL), and MOLT-13 (T-ALL), or one or more of the cell lines of the set are replaced with one or more other cell lines comprising the same immunoglobulin (IG) / T-cell receptor (TR) gene rearrangement, i.e., the same IG / TR rearrangement profile.

[0011] In a second aspect, the present invention provides a composition (also referred to herein as "polytarget focused quality control (cPT-QC)") consisting of substantially equimolar amounts of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells.

[0012] The compositions according to the present invention are unknown or have not been proposed in the art. US Patent Publication No. 2018 / 208984 relates to a method for detecting IG / TR rearrangements using next-generation sequencing with one primer set. A set of plasmids containing known alleles including the TCR sequence of the T cell line JB6 and MOLT-13 are used as controls. However, the control sample of US Patent Publication No. 2018 / 208984 using cDNA is not included because incomplete TR and IG rearrangements are not transcribed into mRNA molecules. Such incomplete TR and IG rearrangements are a complementary target for clonality detection and MRD assessment, and therefore are clearly targeted in the present invention. For example, unlike the control composition of the present invention, US Patent Publication No. 2018 / 208984 cannot identify and quantify rearrangements TRBD-J, TRDV-D, TRDD-D, TRDD-J, IGK-Kde, and IGHD-J.

[0013] Beccutti et al. (BMC Bioinformatics, Vol. 18, no. 1, 2017, pages 1-12) describe a method for the detection of IG / TR rearrangements using NGS. DNA isolated from buffy coats (containing peripheral blood mononuclear cells) is used as a control. Beccutti et al. are silent on the use of DNA from additional tissue sources, not to mention proposing to include tonsil and thymus genomic DNA in the polytarget quality control composition in order to include essential rearrangements not found in PBMCs.

[0014] The cIT-QC composition provided herein has many unique and advantageous properties. First, the set of only 9 selected cell lines has a total of 46 rearrangements, which is representative of as few cell lines as possible, while covering each target with at least three rearrangements, thus allowing detection of ALL cells with lineage-related as well as cross-lineage rearrangements. Second, the rearrangements can be unambiguously detected by Sanger sequencing and / or amplicon-based NGS. Third, the various regions of the IGH gene rearrangements are unmutated, immediately avoiding the problem of primer annealing. A full list of the 46 rearrangements is shown in Table 1.

[0015] By using genomic DNA, the compositions of the present invention specifically avoid the use of plasmids, which are known to pose a serious threat of contaminating PCR assays. Moreover, the genomic DNA was selected to optimally represent the patient samples that are the subject of the assay and that also contain genomic DNA.

[0016] Genomic DNA is easily isolated from cell lines using established extraction protocols known in the art. In one embodiment, DNA is obtained using a phenol-chloroform extraction protocol, followed by ethanol precipitation and elution into tris(ethylenediaminetetraacetic acid) buffer. The composition is suitable for being in a dry (e.g., lyophilized) form for reconstitution with liquid prior to use.

[0017] [Table 1]

[0018] In a preferred embodiment, the composition comprises a mixture of approximately equal amounts of genomic DNA isolated from a set of selected cultured cell lines. For example, the cIT-QC composition is formulated to provide a test sample with at least 40 cell copies, preferably at least 50 cell copies, of DNA from each cell line. There is no maximum number of copies of cells contained in the control sample, but very large amounts of genomic DNA can significantly consume the sequencing capacity of the assay. In an embodiment, the cIT-QC composition is formulated to reconstitute a solution containing approximately equal numbers of cell line DNA copies from a set of selected cultured cell lines, with 20-50 cell copies of genomic DNA from each cell line per reaction.

[0019] B and T cell lines for use in the cIT-QC compositions provided herein can be obtained from any suitable (commercially available) source. For example, the Raji cell line is DSMZACC319, the REH cell line is DSMZACC22, the TMM cell line is DSMZACC95, the TOM-1 cell line is DSMZACC578, the WSU-NHL cell line is DSMZACC58, the Karpas299 cell line is DSMZACC31, and / or the MOLT-13 cell line is DSMZACC436. Of course, one or more cell lines shown in Table 1 can be replaced with another cell line that contains (or has) the same rearrangement and has good growth characteristics. Thus, compositions containing a mixture of genomic DNA isolated from a set of cultured cell lines that together cover the profile of the 46 rearrangement types shown in Table 1 are also included. In particular, the present invention provides a composition comprising a mixture of genomic DNA isolated from a set of nine cultured cell lines, the set including the B cell lines ALL / MIK (B cell precursor ALL), Raji (Burkitt's lymphoma), REH (B precursor ALL), TMM (CML-BC / EBV+B-LCL), TOM-1 (B precursor ALL), WSU-NHL (B cell lymphoma); and the T cell lines JB6 (ALCL), Karpas299 (ALCL), and MOLT-13 (T-ALL), or one or more of the cell lines of the set are replaced with one or more other (i.e., different from the nine cell lines listed) cell lines that contain the same immunoglobulin (IG) / T cell receptor (TR) gene rearrangements. Such "equivalent" cell types include at least the same gene rearrangements as those shown in Table 1, or the same type of IG / TR rearrangement, i.e., a different CDR3. In a preferred embodiment, the composition includes genomic DNA isolated from the B cell lines ALL / MIK, REH, and TOM-1, each of which contains a cross-lineage TR rearrangement.

[0020] In a preferred embodiment, the composition consists of a mixture of, preferably approximately equal amounts of, genomic DNA isolated from the B cell lines ALL / MIK, Raji, REH, TMM, TOM-1, WSU-NHL, and the T cell lines JB6, Karpas299, and MOLT-13.

[0021] In a further aspect, the present invention provides a cPT-QC composition consisting essentially of equimolar amounts of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells (PB-MNCs). In other words, it consists of an equimolar mixture of 1 / 3 thymus, 1 / 3 tonsil, and 1 / 3 peripheral blood mononuclear cell DNA. As used herein, the term "healthy" refers to tissue obtained from a human subject known or suspected to be free of malignant immune underlying diseases or disorders. In one aspect, the thymus is obtained by resection from a young child due to the physical inability to reach the heart for surgery.

[0022] For each tissue, genomic DNA is preferably obtained from many different human individuals. For example, for each tissue, DNA from 3-10 human subjects is used. This composition represents a "standardized lymphocyte preparation" and is therefore suitable for use as a separate sample to be processed together with the specimen, and is preferably formulated to provide essentially the same amount of DNA as the normal sample being tested. Typically, a range of 50-200 ng is preferred. In certain embodiments, the composition is dried, e.g., lyophilized.

[0023] As used herein, the terms "approximately equal amounts" or "essentially equal amounts" reflect the intent that the cell line / lymphoid tissue samples in the mixture of genomic DNA are in equal amounts, respectively.

[0024] The present invention also provides a diagnostic kit comprising (1) a container comprising a "centralized quality control / quantity control in a tube" (cIT-QC) composition of the present invention, and / or (2) a container comprising a "centralized polytarget quality control" (cPT-QC) composition disclosed herein. In an embodiment, the kit comprises at least a cIT-QC composition disclosed herein. In another embodiment, the kit comprises at least a cPT-QC composition of the present invention. The cPT-QC composition may be packaged with one or more additional useful quality control compositions. For example, the additional quality control composition may comprise a mixture of genomic DNA isolated from a set of cultured cell lines that together cover the profiles of the 46 rearrangement types shown in Table 1, so that both quality controls can be used to monitor the performance of the assay when evaluating clonal IG / TR gene rearrangements.

[0025] Preferably, the kit comprises both the cIT-QC composition and the cPT-QC composition disclosed herein. The kit may advantageously further comprise one or more agents for detecting IG / TR gene rearrangements, such as a primer set for amplicon-based NGS of IG / TR gene rearrangements. In certain embodiments, the diagnostic kit comprises, in addition to one or both of the QC compositions provided herein, one or more primer sets for detecting one or more IG / TR gene rearrangements selected from the group consisting of IGH-VJ, IGH-DJ, IGK-VJ-Kde, TRB-VJ, TRB-DJ, TRD, and TRG. Particularly preferred primers, for example for use in combination with the QC compositions, are those optimized for NGS-based detection, such as the primers shown in FIG. 5 or Table 3.

[0026] The present invention also provides a primer set for amplicon-based next-generation sequencing (NGS) of IG / TR gene rearrangements, comprising two or more primers selected from the primers shown in Figure 5. Preferably, the set comprises at least two primers for detecting one or more, preferably two or more, most preferably three or more IG / TR gene rearrangements selected from the group consisting of IGH-VJ, IGH-DJ, IGK-VJ-Kde, TRB-VJ, TRB-DJ, TRD, and TRG. In a particular embodiment, the primer set comprises a primer for detecting each of IGH-VJ, IGH-DJ, IGK-VJ-Kde, TRB-VJ, TRB-DJ, TRD, and TRG gene rearrangements.

[0027] The primer sequences in FIG. 5 may include universal primer sequences (M13 forward sequence M13 forward primer (-20): GTAAAACGACGGCCAGT; and / or T7 universal primer: TAATACGACTCACTATAGGG), or universal primer sequences known in the art that do not hybridize to the target sequence, and / or other adapter or barcode sequences.

[0028] In certain aspects, the primers of the invention comprise a forward or reverse M13 sequence. In an embodiment, the primer sequences of Figure 5 comprise a universal M13 tail at the 5' end, preferably the sequence GTAAAACGACGGCCAGT. In another embodiment, the primer sequences of Figure 5 comprise the sequence of a T7 promoter. In certain aspects, the invention provides a set of two or more primers selected from the primers shown in Table 3.

[0029] The provision of the novel QC composition of the present invention has important implications for quality control and quantification strategies. As described herein below, the cPT-QC composition produces detectable changes in the sequence profile, making it a valuable tool for monitoring the reproducibility of results and for identifying primer perturbations and other biases in wet lab protocols. The addition of cPT-QC to each sequence allows for post-sequencing checks of primer and assay performance. Analysis of cPT-QC data allows for the detection of accidental bias in the concentration of one primer in a multiplex IG / TR primer set, tracking the performance degradation of one primer, and evaluating the results of IG / TR analysis.

[0030] Furthermore, we show the advantages and diverse usefulness of cIT-QC. In contrast to plasmid or synthetic reference templates, the cIT-QC cell line is a source of large amounts of genomic DNA and is commercially available, making it particularly suitable to be used as a control. The cIT-QC rearrangements represent 2 / 3 of the rearrangements that are amplifiable with all eight primer sets, thus offering the opportunity to highlight many issues, most obviously over / under-amplification, but also bioinformatics misidentifications. Furthermore, the cIT-QC rearrangements can be substituted for buffy coat DNA without affecting the patient's immune repertoire (as cIT-QC rearrangements are bioinformatically identified and excluded from the results by default) due to their PCR stability.

[0031] cIT-QC allows the conversion of reads to cell counts, which is of paramount importance for clinical use. Diagnostic material analyzed for the identification of MRD markers may exhibit a large number of specific clonotypes that do not reflect the clonal composition of the sample. For example, if a diagnostic sample is highly infiltrated by lymphoid malignancies that do not harbor the targeted rearrangement, the (small number of) residual lymphoid cells will generate the full range of detectable rearrangements. In such a situation, a small number of physiological B- or T-cell clones may be misidentified as clones carrying leukemic markers.

[0032] In addition to its use in identifying markers, as exemplified by the depletion of B and T cells in aplasia follow-up samples, cIT-QC is ideal for quantifying MRD in samples during or after treatment, especially when B- or T-cell directed therapy is applied that minimizes the background of polyclonal gene rearrangements. If the relative tumor burden is calculated by the ratio of leukemia-specific reads to total annotated reads without normalization, the quotient reflects the frequency of the marker only among cells with a particular type of rearrangement (e.g., IG rearrangement in the total pool in which B cells are present), and therefore may overestimate the actual tumor burden (Non-Patent Document 44).

[0033] Furthermore, QC protocols can easily be embedded in ARResT / Interrogate, which can provide reports and messages to the user, e.g., to include back into the analysis samples that failed QC. The logic is that a "fail" flag signals a failure to meet predefined QC criteria, but does not necessarily indicate that the data is completely wrong. However, flagged data should always be used with caution, depending on the application or problem.

[0034] The present invention therefore also relates to the use of a composition according to the invention as described herein above, or a kit, in an assay for the detection of IG / TR gene rearrangements. The skilled artisan will recognize and appreciate the various applications. By way of example only, the assay is a clinical diagnostic assay, preferably for detecting clonality, for identifying MRD markers and / or MRD monitoring, and for analyzing (clonal) immune repertoires in lymphoid malignancies.

[0035] Further embodiments relate to an in vitro method for detecting IG / TR gene rearrangements in at least one biological sample using NGS, which includes the conventional steps of sample preparation, PCR and / or library construction, sequencing, and bioinformatics analysis, but is characterized in that at least one QC composition is used. For example, at least one biological sample is spiked with a cIT-QC composition in an amount that results in at least 40 cell copies of DNA of each cell line. Such use as an in-tube quality and quantity control allows the conversion of read numbers to cell phase numbers, which is of primary importance for clinical use.

[0036] Alternatively, or in addition, the cPT-QC composition is added to at least one biological "test" sample in parallel with another sample to serve as an external reference to check primer and assay performance after sequencing.

[0037] Typically, at least one biological sample is a clinically relevant sample.In one embodiment, it is the sample for detecting clonality to support or exclude the diagnosis of malignant lymphoproliferation.In another embodiment, it is the sample taken for MRD marker identification or MRD monitoring analysis, or (clonal) immune repertoire analysis.

[0038] The methods provided herein can be performed using standard means and protocols known in the art. In certain embodiments, at least a portion of the method can be performed using microfluidic technology. For example, sample preparation, PCR, library construction, and / or sequencing are performed in a microfluidic device containing one or more preloaded agents. Particularly preferred for use in the methods of the present invention are centrifugal microfluidic disk systems (also known in the art as "centrifugal microfluidic biochips" or "centrifugal microfluidic biodiscs"), a type of lab-on-a-chip technology used to integrate processes such as separation, mixing, reaction, and detection of nano-sized molecules in a single platform containing a CD or DVD. There are various typical units in centrifugal microfluidic structures, including valves, volumetric measurements, mixing, and flow switching. These types of units can create structures that can be used in various ways. Before a molecule can react with an agent, it is necessary to prepare the molecule for reaction. Most typically, this is separation by centrifugal force. In the case of blood, for example, sedimentation of blood cells from plasma can be achieved by spinning the biodisc for several minutes. After separation, a cell / vial lysis step is required in all molecular diagnostic assays to release genomic and proteomic materials for further processing. Typical lysis methods include chemical and physical methods. Chemical lysis methods are the simplest and use chemical detergents or enzymes to break the membrane. Physical lysis can be performed using a bead-on-disc crushing system. Lysis occurs through collision and shear between the beads and cells, as well as frictional shear along the walls of the lysis chamber.

[0039] In some embodiments, the discs contain preloaded reagents for automating and integrating DNA extraction, PCR, and / or library construction (see, for example, the review in Tang et al., 2003).

[0040] Exemplary discs for use in the methods of the present invention include those having one or more of the specific features as disclosed in patent applications in the name of Hahn Schickard, such as WO 2013 / 124258, WO 2014 / 198703, WO 2015 / 189280, WO 2015 / 051950, and WO 2017 / 191032.

[0041] In the method of the invention, the bioinformatics analysis advantageously includes the use of web-based interactive applications. For example, the bioinformatics analysis includes the use of dedicated bioinformatics applications (such as ARResT / Interrogate, or equivalent) for raw data pre-processing, primer sequence analysis, immunogenetic annotation, post-processing of results, analysis and use of cIT-QC (including marker quantification), analysis and use of cPT-QC (including comparison with previously analyzed and stored reference data sets), and reporting / accessing / visualizing results.

[0042] The present invention shows the application of two reference / QC standards, which allows standard analysis of IG / TR NGS data (e.g., using the NGS primer sets disclosed herein) with high reproducibility, accuracy and precision in the identification of markers. ARResT / Interrogate provides a complete in silico solution accompanied by an in vitro assay, which allows the analysis of IG / TR sequences including all the quality criteria and quantification concepts required for valid marker identification in lymphoid malignancies. [Brief description of the drawings]

[0043] [Figure 1 (1-2)] Research design. [Figure 1 (2-2)] Schematic diagram of the cIT-QC and cPT-QC development and application workflow, as well as the 96-well plate test dataset. [Figure 2 (1-2)]Schematic diagram of SOPs for quality control and quantification in marker identification. Library preparation, PCR & NGS. [Figure 2 (2-2)] Bioinformatics using ARResT / Interrogate. [Diagram 3] Plot of the relationship between cIT-QC and markers in the test dataset. A: Relationship between cIT-QC and % reads between markers (%). The denominator for % for cIT-QC is reads with junctions, and the denominator for % for markers is what we call "usable" reads with junctions excluding cIT-QC reads, which makes the total > 100%. B: Amount of marker before and after normalization to percentage of cells. *Values ​​may exceed 100% due to normalization. [Figure 4 (1-4)] Schematic of the workflow for multicenter validation of the IG / TR NGS assay for marker identification in ALL. IG and TR gene rearrangements are amplified in a two-step approach using a multiplex PCR assay. Each participating laboratory performed NGS-based IG / TR MRD marker identification in 10 patients with ALL. Primer performance was monitored using the polytarget centralized quality control (cPT-QC) composition of the invention, and in-tube centralized quality control / quantity control (cIT-QC) of the invention was added to each sample as a library-specific quality control and calibration function. Pipetting was performed in a 96-well format. Data analysis was performed using ARResT / Interrogate. [Figure 4 (2-4)]Schematic of the workflow for multicenter validation of the IG / TR NGS assay for marker identification in ALL. IG and TR gene rearrangements are amplified in a two-step approach using a multiplex PCR assay. Each participating laboratory performed NGS-based IG / TR MRD marker identification in 10 patients with ALL. Primer performance was monitored using the polytarget centralized quality control (cPT-QC) composition of the invention, and in-tube centralized quality control / quantity control (cIT-QC) of the invention was added to each sample as a library-specific quality control and calibration function. Pipetting was performed in a 96-well format. Data analysis was performed using ARResT / Interrogate. [Figure 4 (3-4)] Schematic of the workflow for multicenter validation of the IG / TR NGS assay for marker identification in ALL. IG and TR gene rearrangements are amplified in a two-step approach using a multiplex PCR assay. Each participating laboratory performed NGS-based IG / TR MRD marker identification in 10 patients with ALL. Primer performance was monitored using the polytarget centralized quality control (cPT-QC) composition of the invention, and in-tube centralized quality control / quantity control (cIT-QC) of the invention was added to each sample as a library-specific quality control and calibration function. Pipetting was performed in a 96-well format. Data analysis was performed using ARResT / Interrogate. [Figure 4 (4-4)] Schematic of the workflow for multicenter validation of the IG / TR NGS assay for marker identification in ALL. IG and TR gene rearrangements are amplified in a two-step approach using a multiplex PCR assay. Each participating laboratory performed NGS-based IG / TR MRD marker identification in 10 patients with ALL. Primer performance was monitored using the polytarget centralized quality control (cPT-QC) composition of the invention, and in-tube centralized quality control / quantity control (cIT-QC) of the invention was added to each sample as a library-specific quality control and calibration function. Pipetting was performed in a 96-well format. Data analysis was performed using ARResT / Interrogate. [Figure 5A-1] A summary of the rearrangements and primer sets, and a histogram showing the junction nucleotide length for each locus examined. 5A-1 is a summary of the IGH-VJ and IGH-DJ rearrangements. The relative positions of the VH family primers, DH family primers, and consensus JH primers are according to the most upstream (-) or most downstream (+) 5' nucleotide of the associated RSS. [Figure 5A-2] Histograms showing junction nucleotide lengths of complete IGH rearrangements (IGH-VJ tubes) from BCP-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to VJ gene combination. [Figure 5A-3] Histograms showing junction nucleotide lengths of incomplete IGH rearrangements (IGH-DJ tubules) from BCP-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to DJ gene combinations. [Figure 5B-1] Schematic diagram of the IGK-VJ rearrangement and the two types of Kde rearrangements (V-Kde and intronic RSS-Kde). The relative positions of the VK, JK, Kde, and intronic RSS (INTR) primers are according to the most upstream (-) or most downstream (+) 5' nucleotide of the associated RSS. [Figure 5B-2] Histograms showing junction nucleotide lengths of IGK-VJ and IGK-V-Kde rearrangements (IGK-VJ-Kde tubes) in B-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to the VJ-Kde gene combination. [Figure 5B-3] Histograms showing junction nucleotide lengths of intron-Kde rearrangements (intron-Kde tubes) in BCP-ALL patients, cPT-QC, BC, thymus, and tonsils. [Figure 5C-1]Schematic of TRB-VJ and DJ rearrangements. The relative positions of the TRB V family primers, TRB D primers, and TRB primers are according to the most upstream (-) or most downstream (+) 5' nucleotide of the associated RSS. [Figure 5C-2] Histograms showing junction nucleotide lengths of complete TRB rearrangements (TRB-VJ tubes) from T-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to the VJ gene combination. [Figure 5C-3] Histograms showing junction nucleotide lengths of incomplete TRB rearrangements (TRB-DJ tubules) in T-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to the DJ gene combination. [Figure 5D-1] Schematic of the TRG VJ rearrangement and the relative positions of the TRG V and TRG J primers. The relative positions of the TRG V and TRG J primers are according to the most upstream (-) or most downstream (+) 5' nucleotide of the associated RSS. [Figure 5D-2] Histograms showing junction nucleotide lengths of TRG rearrangements (TRG tubes) from T-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to VJ gene combinations. [Figure 5E-1] Schematic of VD-JD, DD-JD, DD-DD, and VD-DD, VD-JA29 reconstructions, all combined in one tube, showing the positions of the VD, JD, DD, and JA29 primers. The relative positions of the Vd, Dd, and Jd primers are according to the most upstream (-) or most downstream (+) 5' nucleotide of the associated RSS. [Figure 5E-2] Histograms showing junction nucleotide lengths of TRD rearrangements (TRD tubes) in T-ALL patients, cPT-QC, BC, thymus, and tonsils. Bars are colored according to VDJ gene combinations. [Figure 6]Multicenter validation results for MRD marker identification in ALL. Left column: index sequences identified by Sanger sequencing. Right column: index sequences identified by NGS. The darkest parts of the columns reflect clonal sequences identified by both methods, the lightest parts are sequences identified exclusively by each method. Intermediate parts are clonal sequences identified by both methods but less than 5% by NGS after normalization. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] (Example 1: Design and production of in-tube centralized quality control / quantity control (cIT-QC))

[0045] Sources and Methods A total of 59 human B (n = 30) and T (n = 29) lymphoid cell lines were obtained from the American Type Culture Collection (ATCC; www.lgcpromochem-atcc.com, Manassas, VA, USA) and the German Collection of Microorganisms and Cell Cultures GmbH (DSMZ; www.dsmz.de, Braunschweig, Germany). DNA was isolated from cultured cell lines using a phenol-chloroform extraction protocol, followed by ethanol precipitation and elution into tris-ethylenediaminetetraacetic acid (TE) buffer. Alternatively, DNA was isolated with the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's protocol.

[0046] Identification of cell line-specific clonal IG / TR gene rearrangements Each of the 59 cell lines was screened for clonal IG / TR gene rearrangements using the Euroclonality-NGS assay described above, without the addition of buffy coat (BC), on 100 ng of DNA from each cell line (quantified with Thermo Fisher Scientific's Qubit3.0). Paired-end sequencing (2 × 250 bp) was performed on an Illumina MiSeq (Illumina, San Diego, CA, USA) at a final concentration of 7 pM per library, resulting in at least 2000 reads per sample. A 10% PhiX control was added to each sequencing run to avoid issues with low-complexity libraries.

[0047] Verification of cell line-specific clonal IG / TR gene rearrangements Additional methods were used to validate the cell line reconstitution of NGS amplicon identification. 1. A capture-based protocol established by the Euroclonality-NGS Working Group covering the V, D, and J coding genes of the IG / TR locus; in brief, cell line DNA was sheared and processed with the KAPA Hyperplus Kit and Library Amplification (Roche Sequencing Solutions, Pleasanton, CA, USA); libraries were hybridized with custom SeqCap EZ Choice Probes (Roche Sequencing Solutions, Pleasanton, CA, USA) developed based on Wren et al. (37) and subjected to 2 × 150 bp paired-end sequencing on an Illumina NextSeq. 2. Multiplex amplification and Sanger sequencing according to the BIOMED-2 protocol: PCR products were confirmed for fragment size and clonality with the QIAXCEL Advanced System (11, 46). Clonal PCR products were subjected to heteroduplex analysis and sequenced on either the ABI3130 or ABI3500 platform (Applied Biosystems, Foster City, CA, USA).

[0048] The IG / TR rearrangement profiles of all cell lines obtained by different methods were compared.

[0049] Verification of cell line-specific gene rearrangements in human B and T cell lines by ddPCR To verify the discrepancies in the results between the three methods, IG / TR allele-specific PCR assays were designed with digital droplet PCR (ddPCR) (QX200TM Droplet DigitalTM PCR System, Bio-Rad). Absolute quantification of IG / TR rearrangements by ddPCR was performed using two different amounts of gDNA (50ng, 100ng). Each experiment included a polyclonal buffy coat BC control and a no-template control.

[0050] Allele-specific primers for the clonal IG / TR rearrangement and probes for quantification were synthesized by Sigma Aldrich. All primers were desalted and purified, while hydrolysis probes with 5'-FAM / 3'-TAMRA reporter dyes were HPLC purified. All oligonucleotides were resuspended in TE buffer to a total strand concentration Ct=100 μM and stored at -20°C until use.

[0051] ddPCR reactions were prepared in a volume of 20 μL with 10 μL of 2× ddPCR SuperMix (Bio-Rad Laboratories, Hercules, CA), two different amounts of cell line gDNA to be tested (50 ng / 500 ng) previously quantified with the Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific, Waltham, MA), forward primer (FP) and reverse primer (RP) at final concentrations of 300 nmol / L each, and FAM-labeled probe (100 nmol / L). Droplets were generated with a QX200 droplet generator (Bio-Rad) using 20 μL of reaction mixture and 70 μL of droplet generation oil for the probe (Bio-Rad) and placed onto the appropriate wells of a DG8 cartridge (Bio-Rad). Approximately 45 μL of the drop oil mixture (12,000–20,000 drops) was transferred to a 96-well plate (Bio-Rad) and placed on a DNA Engine Dyad Peltier Thermal Cycler with the following amplification protocol: 95°C for 10 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 1 min, and extension at 60°C for 1 min. PCR products were fed into a QX200 droplet reader and analyzed by QuantaSoft Version 1.2 (Bio-Rad Laboratories).

[0052] Preparation of cell line mixtures First, DNA quantification of selected B and T cell lines was performed by Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific, Waltham, MA). To accurately measure the number of cells per μL of DNA, the quantification values ​​were reconfirmed by ddPCR-based quantification of the albumin housekeeping gene using 50–200 ng DNA / cell line. Primers and probes for albumin quantification were synthesized by Sigma Aldrich. ddPCR was performed in duplicate for each cell line according to the protocol described above. After completion of PCR, samples were analyzed on a droplet reader for the copy number of the cell line per 20 μL reaction volume. Based on the values ​​from ddPCR, the cell line DNA was diluted with TE buffer to 400 copies / μL. Then, a separate ddPCR quantification was performed to reconfirm the dilution of each cell line DNA. Two different volumes of cell line dilutions (0.5 μL DNA [200 copies] and 2 μL DNA [800 copies]) were used as input volumes. At the appropriate quantification values, cell line DNA was further diluted and mixed so that each cell line was present at 40 copies in 2 μL of DNA mixture, and this mixture was added to each sample as cIT-QC and subjected to simultaneous library preparation before sequencing.

[0053] Running cIT-QC Bioinformatically, cIT-QC reads are identified using an extremely fast immunogenetic annotation-based approach that avoids computational and potentially inaccurate alignment-based approaches and tolerates sequence variation. In ARResT / Interrogate, the term "spike-in" is also used to refer to cIT-QC.

[0054] Regarding QC, identification of at least one read per cIT-QC reconstruction and at least as many total cIT-QC reads as the total number of cells used is required, otherwise the sample will be tagged as "QC failed" (see below for usage in ARResT / Interrogate). The quantification factor - calculated by dividing the total cIT-QC cell number by the total number of reads - is stored and applied in any case so the user can analyze the sample.

[0055] Quantification is based on applying a quantification factor to convert clonotype read counts to cell numbers and calculate relative abundance to total input cells.

[0056] Example 2: Design and Production of Polytarget Centralized Quality Control (cPT-QC)

[0057] Sources and Methods We prepared a cPT-QC composition consisting of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells (DNA amounts mixed in a 1:1:1 ratio). To this end, (semi-)automated genomic DNA extraction was performed on cell suspensions obtained after cutting and mincing of tissues or after Ficoll density blood separation.

[0058] The cPT-QC composition is suitable for use in NGS library preparation together with the investigational samples. In the Euroclonality-NGS assay, one cPT-QC sample is amplified in eight tubes per run.

[0059] Running cPT-QC In each read from the eight cPT-QC tubes, primers were bioinformatically identified and their abundance was compared to the stored cPT-QC reference results using a ratio test.

[0060] The stored reference results are the ARResT / Interrogate output from the analysis of cPT-QC samples. These results should be verified by repeat runs in each laboratory to adjust for technical variability. To ensure that bioinformatics analyses are not inadvertently compromised by users, results rather than raw data are stored, which means that results are updated with every major release of ARResT / Interrogate to ensure compatibility with new runs.

[0061] Problems with the abundance of a particular primer or a particular primer set are used to tag the corresponding cPT-QC sample and all user samples of the same primer set as "QC failures."

[0062] Repeated Attempts Reproducibility is important in this type of QC, and cPT-QC is run in replicates. The relative abundance of the 5' primers was compared using a ratio test.

[0063] Run with primer perturbation To evaluate the utility of cPT-QC for detecting problems in primer performance, perturbations in primer concentrations were artificially created to mimic failure to pipette primers or pipetting the wrong primer concentration.

[0064] First, 5' primer usage was analyzed in cPT-QC samples, and two primers with different abundances were selected from each primer set, excluding the intron-Kde primer set, which had only two primers; IGH-VJ-FR1-M-1, IGH-V-FR1-O-1; IGH-DB-1, IGH-DE-1; IGK-VG-1, IGK-VI-1; TRB-V-AD-1, TRB-VG-1; TRB-DA-1, TRB-DB-1; TRG-VF-1, TRG-VE-1; TRD-DA-1, TRD-VB-1. These primers were perturbed by completely removing them from the primer pool, decreasing their concentration to 10%, and increasing it to 200%. The relative abundance of the 5' primers was compared to these perturbed sets and to cPT-QC using a ratio test.

[0065] Creating a test dataset To evaluate and showcase the aforementioned concepts and functionality, we created a dataset consisting of the following examples: 1. Four diagnostic bone marrow B- / T-ALL samples with a high content of leukemic cells (60–80% leukemic infiltrate as assessed by routine cytomorphology). 2. Four samples from patients with B / T cell aplasia after B / T cell targeted therapy. Two samples with B cell aplasia were CLL samples after rituximab (anti-CD20) treatment, and two samples with T cell aplasia were T-PLL (prolymphocytic leukemia) samples after alemtuzumab (anti-CD52) treatment. In all these samples, lineage-specific aplasia was confirmed by flow cytometry. 3. cPT-QC for all IG / TR primer sets, but the results for the TRB-VJ primer set are replaced with the perturbation results from the validation experiment described above.To showcase the functionality of the general QC, we artificially selected less than 1000 random reads from one of the diagnostic samples.

[0066] methodology The diagnostic samples and cPT-QC are run with all primer sets, whereas the follow-up samples of aplasia are run only with the corresponding primer sets, i.e., IG set for samples of B cell aplasia and TR set for samples of T cell aplasia (shown in Figure 1, test data set). In addition, the follow-up samples were run without the addition of buffy coat (BC) to test whether the addition of the cIT-QC composition is sufficient to stabilize the samples for sequencing without compromising the immunogenetic profile. For this purpose, the protocol visualized in Figure 2 was followed.

[0067] Primer performance evaluation using cPT-QC Tests of the ratios of relative abundances of 5' primers applied to libraries with cPT-QC, BC, their replicates, and primer perturbations showed clear differences in p-values ​​between unperturbed and perturbed primer sets. In other words, the p-values ​​of the differences in abundance of perturbed primers are notably lower. Table 2 presents a simplified representation of the results, focusing on the abundance of perturbed primers per primer set, and at least one other unperturbed primer, to indicate normal behavior of primers or to consider abnormal behavior. Percentage of abundance of 5' primers in all primer sets. Primers in the upper group are perturbed, while the lower group are selected primers that remain unperturbed, one selected alphabetically per primer set, plus two examples where primer behavior is the subject of discussion (see text). Results: cPT-QC replicate runs (third column); paired primer excluded samples ("0%", fourth column), samples with paired primers reduced to 10% (fifth column), and samples with paired primers increased to 200% (sixth column). Percentage changes that led to tests of proportions (shown individually as + / -).

[0068] At a p-value threshold of 1e-200, no primers are flagged in cPT-QC, highlighting the reproducibility of the assay, whereas in the perturbation scenario, all perturbed primers are flagged. Indeed, the lowest P-value in the normal sample is 7.86e-142 for TRD-VA-1 primers, compared to multiple zero values ​​in the perturbation comparison (mostly 200% perturbed with a few exceptions) (Table 2). Significant changes in abundance were also seen in different cells, with the most likely explanation being that those primers were indirectly affected by the perturbation of other primers. That is, when the primers with the initial abundance were removed, some primers "take over" because they amplify a partially overlapping list of genes, such as IGH-V-FR1-D-1 when IGH-VJ-FR1-M-1 was perturbed.

[0069] Evaluation of QC aspects in ARResT / Interrogate. In silico quality control information based on both cPT-QC and cIT-QC is available in ARResT / Interrogate, and "QC Failed" samples are excluded by default to alert and prevent users from unintentionally using them, but users are informed and have the option to include them back in the analysis.

[0070] General quality control is also performed on the samples, checking in particular for low raw read counts and low percentage of reads with identified junctions. Such samples are also tagged as "QC failed."

[0071] [Table 2]

[0072] Example 3: Identification and quantification of markers The abundance of lymphocyte subpopulations is often unknown in samples from patients with lymphoid neoplasms. Moreover, since IG / TR NGS only reflects the relative representation of rearrangements, it was important to establish a calibration function that would allow normalizing the sequencing reads to the input DNA cells. This is especially important for tubes (especially TRD and intron-Kde tubes) that exclusively cover rearrangements present only in minority lymphoid cells. TRD genes are not rearranged in normal B cells and are deleted in most TRαβ cells. Thus, oligoclonal TCRγδ T cells may give rise to dominant clonotypes in TRD NGS assays, especially when the normal TCRγδ T cell repertoire is severely biased in childhood. Here, the cIT-QC-based abundance correction is paramount to avoid misidentifying (minor) clonal TRD rearrangements from minority TCRγδ T cell populations as leukemic rearrangements that would be markers for further MRD analysis.

[0073] Analysis of the test dataset demonstrated the usefulness of cIT-QC in marker identification and quantification. Without cIT-QC, both diagnostic and aplastic samples appear to be oligoclonal based solely on the number of reads (Figure 3). However, the very high number of reads from a very limited number of cIT-QC cells (120-144, depending on the number of cIT-QC rearrangements per primer set) in all aplastic and some diagnostic samples indirectly but clearly indicates that there is a limited number of input cells for patients with rearrangements of the specific IG / TR loci in those samples. In another view, the total read rate of cIT-QC is considerably higher than that of the rearrangements in these samples, suggesting that the number of cIT-QC cells is also higher than the number of input cells for patients. Indeed, after quantification with cIT-QC, the cell abundance is well below the threshold indicating clonality. Meanwhile, as expected, in diagnostic samples, there are a few cIT-QC sequences. Thus, with cIT-QC the abundance of certain rearrangements can be determined more precisely and recalculated into cellular abundance.

[0074] Furthermore, five experienced Euro-MRD ALL reference laboratories performed IG / TR NGS on 50 diagnostic ALL samples and compared the results with those from routine IG / TR Sanger sequencing. Primer performance was monitored using cPT-QC compositions, and cPT-QC was added to each sample as a library-specific quality control and calibration feature. NGS identified 259 (mean 5.2 / sample, range 0-14) clonal sequences compared with 248 (mean 5.0 / sample, range 0-14) by Sanger sequencing. Overall concordance between Sanger and NGS was 78%, including nondetected libraries.

[0075] Example 4: Development and multicenter validation of an IG / TR NGS assay for identification of MRD markers in ALL This example describes the development and design of the IG / TR assay, including bioinformatics and validation for MRD marker identification in acute lymphoblastic leukemia (ALL). Five Euro MRD ALL MRD reference laboratories performed IG / TR NGS on 50 diagnostic ALL samples and compared the results with routine IG / TR marker screening and Sanger sequencing. cPT-QC compositions were used to monitor primer performance and were spiked into each sample as a library-specific quality control and calibration function. The overall workflow of the validation study is shown in Figure 4.

[0076] (material and method) Basic Concepts of Assay Design Aiming to develop a universal amplicon-based NGS approach for IG / TR sequence analysis at the DNA level that can be applied to all lymphoid tumors, we designed assays for multiple IG / TR loci, including complete and incomplete rearrangements, where applicable, for IG heavy chain (IGH), IG kappa (IGK), TR beta (TRB), TR gamma (TRG), and TR delta (TRD). IG lambda (IGL) was excluded due to its limited complementation to other IG loci and low diversity. TR alpha (TRA) was excluded because its considerable complexity precludes rational multiplex PCR methods at the DNA level.

[0077] The IGH locus is rearranged in two steps (Figure 5A). After the initial joining of one IGH-D gene and an IGH-J gene, an IGH-V gene joins the incomplete IGH-DJ rearrangement, resulting in a complete IGH-VJ rearrangement. For the amplification of the complete IGH rearrangement, primers located in the FR1, FR2, and FR3 regions were designed, and here we describe a FR1 assay for marker identification in ALL. The IGH-DJ rearrangement is amplified in a separate multiplex PCR reaction. The IGK light chain locus consists of functional IGKV and IGKJ genes and a so-called kappa deletion element (Kde) that can rearrange into the IGKV gene, or a recombination signal sequence (RSS) in the IGKJ-IGKC intron that results in functional inactivation of the IGK allele (Figure 5B). An IGKV forward primer was designed for use in combination with the IGKJ and Kde reverse primers in one multiplex reaction, and a second PCR was developed with the forward intron RSS primer and the reverse Kde primer.

[0078] The TRB locus is also characterized by a two-step process of first constructing an incomplete TRB-DJ rearrangement followed by a complete TRB-VJ rearrangement. Incomplete and complete TRB rearrangements were designed to be detected in two separate multiplex PCR reactions (Figure 5C). Because the TRG locus rearrangement is a one-step VJ recombination with a limited number of TRGV and TRGJ genes, a single multiplex assay could be developed (Figure 5D). Finally, at the TRD locus, DD, VD, and DJ rearrangements occur before the complete VJ rearrangement. In addition, certain TR genes can rearrange TRDJ and TRAJ, and TRDV-TRAJ rearrangements, usually with TRAJ, can also occur. All these rearrangements are designed to be amplified in a single multiplex PCR assay (Figure 5E). The bioinformatics platform ARResT / Interrogate (Non-Patent Document 43), already developed de novo within the Euroclonality-NGS Working Group to facilitate pleiotropic activities, was further adapted for this study as described below.

[0079] Technical validation of primer design and primer performance Primers were designed to be gene specific, but degenerate primers were designed to facilitate multiplexing in the presence of allelic variants. For similar reasons, one mismatch in the middle or 5' end of the primer is tolerated. Table 3 shows primer sequences including the nucleotide sequence of FIG. 5 and additional adapter sequences (forward or reverse). Those skilled in the art will recognize that the examples are merely illustrative and that many variations of the specific methods of the examples are possible. For example, it is not necessary to use the M13 sequence as part of the primer as used in the examples. It can be replaced with any other known DNA sequence.

[0080] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]

[0081] Primer specificity and multiplexing were confirmed using Primer 3 (Non-Patent Document 31), Primer Digital (PrimerDigital Ltd, Helsinki, Finland), MFEprimer-2.0 (Non-Patent Document 32), and Oligo (Molecular Biology Insights, Inc., Colorado, USA). Primer design criteria were as follows for all loci: primer melting temperature 57-63°C; final amplicons of comparable size; primer length 20-24 nt; avoidance of primer dimers; minimum distance between 3' primer end and junction region, preferably more than 10-15 bp, to avoid missing due to rearrangements that delete larger nucleotides from germline sequences; avoid regions with known single nucleotide polymorphisms to allow the same primer to anneal to all alleles of each V, D, or J gene; preferably target all V, D, and J genes known to be rearranged and the intronic RSS and Kde regions of IGK.

[0082] Following in silico design, primers were first tested in single and multiplex reactions using primary patient samples or cell lines with defined rearrangements. When such samples were not available, healthy tonsil or mononuclear DNA samples were used. Oligoclonal template pools were then generated from a mixture of rearranged cell lines and diagnostic samples with defined rearrangements covering many different V, D, and / or J genes. Alternatively, pools of plasmids were generated for several loci, covering as many different rearrangements as possible. These multi-target pools allow good tuning of reaction conditions and / or primer concentrations to assess comparable amplification efficiencies. This iterative testing process also results in the reduction of primers if they are found to be redundant. Furthermore, multicenter testing with a limited number of monoclonal and poly / oligoclonal samples, as well as different sequencing platforms, allowed the evaluation of the robustness of the primer mix and protocol.

[0083] The assay was designed to be platform independent, so a two-step PCR was employed, allowing switching of sequencing adapters to reduce the total number of primers even when a large number of barcodes were required. Additionally, the maximum amplicon length was defined relative to the maximum read length that can be sequenced on the current sequencer. PCR conditions were optimized with the aim of finding a common optimal condition for all reactions, thus allowing parallel library preparation. Various PCR cycle numbers in the first and second PCR, different polymerases, and several library preparation methods were tested and compared.

[0084] This study was performed exclusively on an Illumina MiSeq, but the suitability of the same PCR panel was also tested in a single center on an IonTorrent instrument (ThermoFischer Scientific), and the one-step Illumina MiSeq PCR method was also tested in a single center.

[0085] Multicenter validation of an assay for identification of MRD markers in ALL Five laboratories skilled in EuroClonality-NGS tested the robustness and adaptability of the optimized assay for IG / TR marker identification in ALL, compared with standard techniques. All laboratories (Bristol / London, Paris, Monza, Prague, and Kiel) are members of the EuroMRD Consortium and are reference laboratories for ALL MRD analysis. Each participating laboratory performed NGS-based identification of IG / TR MRD markers in 10 patients with ALL of B or T lineage. Key standard operating procedures were strictly followed in all laboratories. The study was performed using Illumina MiSeq (2 × 250bp v2 kit). NGS analysis was performed in full parallel with conventional PCR and Sanger sequencing of clonal products following standard guidelines (Non-Patent Document 11). For some cases of unclear and conflicting results between the two methods, allele-specific PCR analysis (either digital droplet PCR or real-time quantitative PCR) was designed to clarify whether the respective clonal rearrangement represents the majority of the leukemia. The EuroMRD guidelines were used to design and interpret allele-specific PCR assays (33, 34).

[0086] (result) Technical validation of primer design and primer performance Based on the results of the testing and validation phase, the final IG / TR primer mix consisted of 8 tubes of 92 forward and 30 reverse primers (15 of the latter used in different tube pairs). The primer positions and sequences are shown in Figure 5 and Table 3.

[0087] Conducting quality control composition Robust amplification, library preparation, and sequencing quality control are paramount for these multiplex assays. While different primers must function under identical reaction conditions, sample characteristics and sequence may introduce additional variability. Primer performance must be monitored over time, and it is important to normalize to the number of sequence reads per input molecule to accurately estimate clonal abundance.

[0088] To address these issues, two quality control compositions were included: (i) the cIT-QC of Example 1 was added to each tube as a library control and calibrator, and (ii) the cPT-QC of Example 2 was run in parallel to monitor general primer performance and sequencing.

[0089] Laboratory Protocols Primers were tailed with universal and T7 linker sequences and divided into eight tubes (IGH-VJ, IGH-DJ, IGK-VJ-Kde, Intron-Kde, TRB-VJ, TRB-DJ, TRG, TRD). The PCR protocol is summarized in Table 4. Each prepared a sequencing library by two-step PCR with 100 ng of diagnostic DNA and 10 ng of polyclonal DNA in a final reaction volume of 50 μl. For cIT-QC, genomic DNA equivalent to 40 cells of each of the nine different cell lines was added to all samples. MgCl2 was intended to be used at a final concentration of 1.5 mM, but optimization was required for some tubes. Thus, the master mix for the first PCR was tube-specific, but the temperature profile was constant for all tubes.

[0090] After the first round of PCR, gel electrophoresis was performed to confirm that all targets were successfully amplified. Prior to the second round of PCR, gel extraction of the PCR products specific for TRB was performed.

[0091] All PCR products from the first round were diluted 1:50 unless they were very low amplicons, except for TRB, which had low amplicons. were used undiluted. The master mix and temperature profile for the second PCR were the same for all tubes (Table 4). Primers for the second PCR contained a sequence adapter and a sequence index (barcode). For each library, a unique combination of forward and reverse indexes was used. In the second PCR, 3 μl of undiluted TRB PCR product and 1 μl of diluted 1:50 PCR products of IGH, IGK, TRG, and TRD were amplified.

[0092] [Table 4]

[0093] Following the second round of PCR, the products of all samples run were pooled in equimolar ratios into eight tube-shaped subpools and purified by gel extraction (see Table 5 for amplicon lengths). Finally, the subpools were pooled in equimolar ratios into one final pool. Amplicon libraries were sequenced on an Illumina MiSeq sequencer using 2x250bp v2 chemistry with a final concentration of 7pM and 10% PhiX control added to avoid issues with low complexity libraries.

[0094] [Table 5]

[0095] Bioinformatics Protocols ARResT / Interrogate was the main bioinformatics platform used in this study, along with Vidjil (47) and IMGT (48) resources, which were used in certain aspects of the study. The absence of mismatches was confirmed and demultiplexing was performed. Reads were classified by euroclonality-NGS primer sequence (to trim non-amplicon sequences and for cPT-QC-based quality control), paired-end junction, dereplicates, immunogenetic annotation (48), and rearrangement type (complete and incomplete, as well as other specific types such as intron-Kde rearrangements), or annotated by "junction type". Reads without rearrangements were excluded from the total number of reads used for relative abundance.

[0096] The cIT-QC sequences mentioned above were identified in the data through their immunogenetic annotation. Their counts served both as "in-tube" controls and for normalization per primer set, with the total cIT-QC cell count divided by the total cIT-QC reads, and the resulting coefficient was used to convert the reconstituted reads to cells, which were then divided by the total input cell count (15,000 in this example). Identification of IG / TR sequences was defined as index sequences if their abundance after cIT-QC normalization was greater than 5%.

[0097] ARResT / Interrogate can track the DNJ3' stem of the junction, a sequence that remains stable during IGH or TRB clonal evolution in the case of V rearrangements or ongoing V to DJ rearrangements. The stem consists of the last 3 nt or less of the D (or NDN, if no D is identified), some or all of the N2 nucleotides, and the J nucleotide of the junction. This stem is available as another immunogenetic feature in all samples and can therefore be linked to other features, e.g., clonotype.

[0098] Multicenter validation of an assay for identification of MRD markers in ALL Next, 50 ALL diagnostic samples (29 BCP-ALL and 21 T-ALL) were analyzed for a multicenter validation study. Each of the five participating laboratories received a pre-set 96-well plate containing a different multiplex NGS primer combination for each target (Figure 4).

[0099] In summary, 96 libraries were generated per laboratory (total of 480 libraries) and sequenced with a total output of 47M reads (φ9.2M / lab). Focused analysis was performed with ARResT / Interrogate (43) using IMGT germline sequences (48), and further analysis and validation were performed with Vidjil (47) and IMGT / V-QUEST (48).

[0100] Overall, 311 clonal IG / TR rearrangements (clonotypes) were identified, with an average of 5.9 (0–14) / sample by NGS (applying a 5% threshold to NGS after cIT-QC-based normalization) vs. 5.0 (0–14) / sample by Sanger, while 217 (45%) libraries showed no clonotypes above the threshold by either method. A total of 196 / 311 (63%) clonotypes were perfectly concordant between NGS and Sanger (Figure 6). NGS exclusively identified 63 index sequences, and 52 IG / TR Sanger sequences were not assigned as index sequences in NG by ARResT / Interrogate. 26 NGS-detected / Sanger-nondetected cases each showed clonal PCR products even in the low-throughput approach, but subsequent Sanger sequencing failed due to polyclonal background, mixed sequences, or few PCR products. In a further 6 Sanger nondetectable / NGS detectable cases, the respective primers were missing in the low-throughput approach. For the remaining 31 discrepancies, no technical explanation for the Sanger failure was found (in 16 / 19 q / ddPCR evaluations, rearrangements were confirmed by ASO-PCR, 3 / 16 at the subclonal level).

[0101] Conversely, 52 clonal IG / TR rearrangements were only detected by Sanger when applying the 5% NGS threshold, for five sequences (1 TRG, 2 TRB-VJ, and 2 IGH-DJ) no suitable primers were present in the NGS primer set, and in 12 cases no explanation for the discrepancy was found. However, in the major discrepant cases (35 / 52) where Sanger identified sequences (7 TRD, 8 TRB-VJ, 6 TRG, 4 TRB-DJ, 2 IGK-VJ-Kde, 5 IGH-VJ, and 3 IGH-DJ) they could also be detected by NGS, but at less than 5% abundance. In 36 / 39 q / ddPCR evaluations, including all low NGS-detected sequences, the rearrangement was confirmed by ASO-PCR, and in 14 / 36 cases it was at the subclonal level. Including non-detected libraries, the overall concordance between Sanger and NGS was 78%.

[0102] In 12 / 29 B-lineage ALL samples, predominant clonal IGH sequence evolution was identified using ARResT / Interrogate. The evolved clonotypes shared the predominant DNJ stem but different VND rearrangements.

[0103] Assay performance was also analyzed by standard evaluation of QC samples (cIT-QC and cPT-QC), which showed remarkably high intra- and inter-laboratory consistency with no statistically significant differences among the five laboratories.

[0104] Appropriate modifications of key SOPs for identification of MRD markers During the multicenter validation process, appropriate modifications of the SOP were tested in parallel in specific laboratories.

[0105] One-step PCR versus two-step PCR: The Euroclonality-NGS Working Group decided to use two-step PCR to allow switching of sequencing adapters and to limit the total number of primer batches needed even if a large number of barcodes are required. The first-round PCR products are not barcoded, making the identification of contamination events difficult with this method. Therefore, one-step PCR was tested in a single center (Paris) as an alternative for laboratories able to maintain a larger number of different primer batches. The one-step approach reduces the risk of contamination and therefore favors the use of NGS for marker identification as well as MRD assessment. Standard operating procedures are presented in the Supplementary Information.

[0106] Bead extraction: During our single-target evaluation and validation phase, we found that gel extraction of specific TRB amplicons resulted in more specific libraries compared to bead extraction. However, because gel extraction is not used in all laboratories, in a later phase of this study we also tested bead purification of all libraries. Optimization of the purification process resulted in a similar percentage of specific reads regardless of the type of library purification.

[0107] No polyclonal DNA was added to the reaction mix: polyclonal DNA was added to each reaction to prevent excessive primer-dimer formation in samples without specific rearrangements. However, the addition of polyclonal DNA alters the composition of the polyclonal background of the samples and interferes with the analysis of the immune repertoire. Therefore, we tested 4 samples with B cell aplasia and 4 samples with T cell aplasia and showed that the addition of cIT-QC was sufficient to prevent the excessive formation of nonspecific PCR products.

[0108] (Additional Note) (Appendix 1) 1. A composition comprising a mixture of genomic DNA isolated from a set of nine cultured cell lines, the set including the B cell lines ALL / MIK (B-precursor ALL), Raji (Burkitt's lymphoma), REH (B-precursor ALL), TMM (CML-BC / EBV+B-LCL), TOM-1 (B-precursor ALL), WSU-NHL (B-cell lymphoma), and the T cell lines JB6 (ALCL), Karpas299 (ALCL), and MOLT-13 (T-ALL), or wherein one or more of the cell lines in the set are replaced with one or more other cell lines that contain the same immunoglobulin (IG) / T-cell receptor (TR) gene rearrangement.

[0109] (Appendix 2) The composition of claim 1, comprising a mixture of genomic DNA isolated from B cell lines ALL / MIK, Raji, REH, TMM, TOM-1, WSU-NHL, and T cell lines JB6, Karpas299 and MOLT-13.

[0110] (Appendix 3) 3. The composition of claim 1 or 2, comprising substantially equal amounts of genomic DNA of each of said cell lines.

[0111] (Appendix 4) A composition consisting of substantially equimolar amounts of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells.

[0112] (Appendix 5) 5. The composition of claim 4, wherein for each tissue, the genomic DNA is obtained from multiple, preferably 3 to 10, different human individuals.

[0113] (Appendix 6) A diagnostic kit comprising a container containing a composition according to any one of appendices 1 to 3, and / or a container containing a composition according to appendices 4 or 5.

[0114] (Appendix 7) 7. The kit of claim 6, comprising a first container comprising the composition of any one of claims 1 to 3, and a second container comprising the composition of claim 4 or 5.

[0115] (Appendix 8) The kit of claim 6 or 7, further comprising one or more agents for detecting immunoglobulin (IG) / T cell receptor (TR) gene rearrangements.

[0116] (Appendix 9) 9. The kit of claim 8, comprising a set of primers for amplicon-based next-generation sequencing (NGS) of IG / TR gene rearrangements.

[0117] (Appendix 10) The kit described in appendix 8 or 9, comprising a primer set for detecting one or more of the IG / TR gene rearrangements selected from the group consisting of IGH-VJ, IGH-DJ, IGK-VJ-Kde, TRB-VJ, TRB-DJ, TRG, and TRD.

[0118] (Appendix 11) 11. The kit according to claim 9 or 10, comprising one or more primers selected from the primers shown in FIG. 5, preferably one or more primers selected from the primers shown in Table 3.

[0119] (Appendix 12) A primer set for amplicon-based next-generation sequencing (NGS) of IG / TR gene rearrangements, comprising two or more primers selected from the primers shown in Figure 5.

[0120] (Appendix 13) A primer set according to Appendix 12, comprising two or more primers selected from the primers shown in Table 3.

[0121] (Appendix 14) Use of a composition according to any one of appendices 1 to 5, a kit according to any one of appendices 6 to 11, and / or a primer set according to appendices 12 or 13 in an assay for detecting IG / TR gene rearrangement.

[0122] (Appendix 15) The use according to claim 14, wherein the assay is a clinical diagnostic assay, preferably an assay for the detection of clonality, for the identification of minimal residual disease (MRD) markers and / or for monitoring MRD and / or for the analysis of (clonal) immune repertoires in lymphoid tumors.

[0123] (Appendix 16) An in vitro method for detecting IG / TR in at least one biological sample using NGS, comprising the steps of sample preparation, PCR and / or library construction, sequencing and bioinformatics analysis, wherein a composition according to any one of appendices 1 to 3 is added to said at least one biological sample and / or a composition according to appendices 4 or 5 is run as a sample in parallel with said at least one biological sample.

[0124] (Appendix 17) The method according to claim 16, wherein the at least one biological sample is a clinically relevant sample, preferably a sample for detection of clonality to support or exclude a diagnosis of malignant lymphoproliferation, or a sample taken for MRD marker identification or MRD monitoring analysis, or (clonal) immune repertoire analysis.

[0125] (Appendix 18) 19. The method of claim 17 or 18, wherein at least a portion of the method is carried out using a microfluidic device.

[0126] (Appendix 19) 19. The method of claim 18, wherein the microfluidic device comprises a centrifugal microfluidic disc system, preferably the disc containing pre-loaded reagents for automating and integrating DNA extraction, PCR, and / or library creation.

[0127] (Appendix 20) The method according to any one of appendices 17 to 19, wherein the bioinformatics analysis steps include pre-processing of raw data, primer sequence analysis, immunogenetic annotation, post-processing of results, analysis and use of cIT-QC (including quantification of markers), analysis and use of cPT-QC (including comparison with a previously analyzed and stored reference dataset), and use of a web-based interactive application for reporting / accessing / visualizing results.

Claims

1. A composition for use as a quantitative and qualitative standard for assessing clonal immunoglobulin (IG) / T cell receptor (TR) gene rearrangements, comprising: The composition comprises a mixture of genomic DNA isolated from a set of nine cultured cell lines, the set including B cell lines ALL / MIK, Raji, REH, TMM, TOM-1, WSU-NHL, and T cell lines JB6, Karpas299, and MOLT-13, or wherein one or more of the cell lines in the set are replaced with one or more other cell lines that contain the same immunoglobulin (IG) / T cell receptor (TR) gene rearrangements.

2. 2. The composition of claim 1, comprising a mixture of genomic DNA isolated from B cell lines ALL / MIK, Raji, REH, TMM, TOM-1, WSU-NHL, and T cell lines JB6, Karpas299 and MOLT-13.

3. The composition described in claim 1 or 2, comprising substantially equal amounts of genomic DNA from each of the cell lines.

4. 4. A diagnostic kit for assessing clonal immunoglobulin (IG) / T-cell receptor (TR) gene rearrangements, comprising a first container containing the composition of any one of claims 1 to 3, and a second container containing a composition consisting of substantially equimolar amounts of genomic DNA isolated from healthy human thymus, healthy human tonsils, and healthy human peripheral blood mononuclear cells.

5. The kit described in claim 4, wherein the second container contains the genomic DNA obtained from 3 to 10 different human individuals for each tissue.

6. The kit of claim 4 or 5, further comprising a set of primers for amplicon-based next-generation sequencing (NGS) of IG / TR gene rearrangements.

7. The kit of claim 6, comprising a primer set for detecting one or more of the IG / TR gene rearrangements selected from the group consisting of IGH-VJ, IGH-DJ, IGK-VJ-Kde, TRB-VJ, TRB-DJ, TRG, and TRD.

8. A kit described in claim 6 or 7, comprising one or more primers selected from primers having a nucleotide sequence set forth in any one of SEQ ID NOs: 3 to 298.

9. The composition according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 8 for an assay for detecting IG / TR gene rearrangement.

10. 10. The composition or kit of claim 9, wherein the assay is for the detection of clonality, for the identification of minimal residual disease (MRD) markers and / or for monitoring MRD and / or for the analysis of (clonal) immune repertoires in lymphoid tumors.

11. The composition according to any one of claims 1 to 3, which is added to at least one biological sample by an in vitro method for detecting IG / TR in said at least one biological sample using NGS, comprising the steps of sample preparation, PCR and / or library construction, sequencing and bioinformatics analysis.

12. The composition described in claim 11, wherein at least one biological sample is a clinical sample.

13. The composition of claim 12, wherein the clinical sample is a sample for detection of clonality to support or exclude a diagnosis of malignant lymphoproliferation, or a sample taken for MRD marker identification or MRD monitoring analysis, or clonal immune repertoire analysis.

14. The composition of any one of claims 11 to 13, wherein at least a portion of the method is carried out using a microfluidic device.

Images