Screening method for tuberculosis infection samples and probe set used therein

Abstract

Provided are a method for screening the presence or absence of tuberculosis infection using urine specimens and a set of probes for the screening. This screening method comprises using the ratio of the content B of miRNAs for biomarkers (SEQ ID Nos: 2 to 33 and / or SEQ ID NOs: 34 to 73) to the content S of hsa-miR-423-5p in a urine-derived sample [B / S] as an indicator, comparing with a cutoff value that is based on the ratio N (B / S) of healthy subjects and the same ratio P [B / S] of tuberculosis-infected subjects, and, depending on the comparison results, sorting urine-derived samples of subjects into tuberculosis-infected positive samples and negative samples.

Description

[Technical field]

[0001] The present invention relates to a screening method for separating a large number of specimen samples into samples that are possibly positive for tuberculosis infection and samples that are possibly negative, and in particular to a screening method that uses urine as a specimen sample and can easily screen while reducing the cost per sample, and a test probe set. [Background technology]

[0002] It is said that one-quarter of the world's population is infected with tuberculosis, and the infection is spreading particularly in developing countries. For this reason, there is a need to develop a rapid and simple method for testing for tuberculosis infection that can be implemented in developing countries.

[0003] In Japan, the most commonly used test method for tuberculosis infection diagnosis is a test method (QuantiFERON (registered trademark) TB, T Spot (registered trademark) TB) that measures interferon gamma (INF-γ) produced by lymphocytes by antigen stimulation with ESAT-6, CFP-10, etc. In this test method, blood is drawn from the subject, lymphocytes are separated, a certain amount is dispensed onto a culture plate coated with anti-human interferon gamma antibody, tuberculosis-specific antigens ESAT-6 and CFP-10 are added, and the plate is cultured for about 20 hours, after which the number of INF-γ-producing cells bound to the anti-human INF-γ antibody is measured. Since it is not affected by BCG vaccination or nontuberculous acid-fast bacteria, it has a higher specificity than the tuberculin reaction, but since it requires culture, it takes about two days to make a judgment. In addition, since it requires equipment for cell separation and cell culture, the cost per sample is high, making it difficult to spread in developing countries. Furthermore, in patients who are infected with not only Mycobacterium tuberculosis but also HIV (human immunodeficiency virus) (those who are co-infected with HIV and tuberculosis), the number of INF-γ-producing cells is low due to immunodeficiency, so there is a problem that the test result may be false negative, even in patients with tuberculosis infection.

[0004] In addition, the MPB64 antibody is known as an antibody specific to active tuberculosis patients, and a method is also known in which the amount of MPB64 antibody in plasma is detected, for example, by the dot blot method using such an antibody as a marker to determine whether or not a patient is in an active tuberculosis state. The MPB64 antibody is also present in urine, and it has been reported that there is a correlation with the results obtained when serum is used as a measurement sample (Non-Patent Document 1: Yasuko Tamada et.al., Microbiol immunol 2012;56:740-747). In a test method using the MPB64 antibody as a marker, urine, which is easy to collect, can be used as a measurement sample, making it suitable as a method for quickly determining the presence or absence of infection in developing countries where tuberculosis infection is likely to spread. However, the existence of antibodies that show cross-reactions is also known, and in the case of BCG vaccinated individuals, test results such as false positives may appear.

[0005] Sputum culture tests taken from subjects are highly accurate in determining whether or not tuberculosis bacteria are present; however, they require equipment for culture and a culture period of one to four weeks, making them difficult to use as a rapid testing or diagnostic method.

[0006] Under these circumstances, there is a need to develop a testing and diagnostic method for tuberculosis infection in developing countries that does not require cell culture, uses minimally invasive samples, and is rapid and has little risk of producing erroneous test results such as false positives and false negatives.

[0007] In recent years, it has been proposed to use miRNA as a biomarker, in addition to antibodies, cells, cytokines, etc. Abnormal expression of miRNA has been revealed to be involved in the onset and malignancy of many diseases, and miRNA can be detected in body fluids such as blood, so that its use as a liquid biopsy has attracted attention. In recent years, there have been various reports on the use of miRNA as a diagnostic marker, mainly in the field of cancer (Patent No. 5156829 (various cancers: Patent Document 1), Patent No. 6489583 (pancreatic cancer: Patent Document 2), WO2019 / 244575 (gastric cancer: Patent Document 3)).

[0008] In Patent Document 2, two types of miRNAs are specified as biomarkers, and the amount of the biomarker miRNA in a blood sample is compared with the amount of the same miRNA in a healthy person to determine the possibility of developing pancreatic cancer. The two types of miRNAs are a combination of miRNAs that are more abundant and miRNAs that are less abundant when the possibility of developing pancreatic cancer is high compared to healthy people, and the accuracy of determining the possibility of developing pancreatic cancer is improved by using such a combination. The comparison of the amount of miRNA present with healthy people uses the ΔCt value (the Ct value of the measurement sample minus the Ct value of cel-miR39 contained in the sample) corrected using cel-miR39 as an external control. The positive and negative discrimination is performed based on the cutoff value calculated based on the ΔCt value for the biomarker miRNA.

[0009] Patent Document 3 proposes a method for determining the onset of gastric cancer using the expression level of miRNA identified as a gastric cancer biomarker as an index. To determine the expression level, specific miRNAs (hsa-miR3610, hsa-miR4669) are used as standardization factors, and the value obtained by subtracting the Ct value of the standardization factor from the Ct value of the biomarker (ΔCt value) is used.

[0010] In addition, JP 2021-90451 (Patent Document 4) proposes using a minimally invasive sample (here, serum) to identify specific piRNAs (non-coding RNA molecules longer than miRNAs (26 to 31 nucleotides)) as biomarkers that can be used for population screening to distinguish between positive and negative colorectal cancer samples, and to compare the expression level of the marker RNA with a reference expression level. The expression levels used for comparison are those normalized using miR93-5p as a normalization marker (endogenous control), and the cutoff value for differentiation can be determined by statistical analysis of the normalized expression levels in healthy subjects and colon patient groups.

[0011] Several unique miRNAs have also been reported in tuberculosis patients (Non-Patent Document 2: Naveed Sabir et.al., Frontiers in Microbiology vol.9, March 2018), and Table 1 in Non-Patent Document 2 introduces miRNAs that can be candidates for biomarkers using human peripheral blood, whole blood, serum, or macrophages as samples. However, even when focusing on human peripheral blood and serum, the miRNAs shown in Table 1 vary depending on the reference literature, and it has not been clarified how specific each miRNA is as a diagnostic marker or how to determine it.

[0012] In addition, although blood is an excellent specimen for liquid biopsy, blood sampling is required for the test, and as a testing method in developing countries, it is limited to patients who are strongly suspected of having tuberculosis infection, and its application as a testing method for widely screening tuberculosis-infected patients is limited. [Prior art documents] [Patent documents]

[0013] [Patent Document 1] Patent No. 5156829 [Patent Document 2] Patent No. 6489583 [Patent Document 3] WO2019 / 244575 publication [Patent Document 4] Patent Publication No. 2021-90451 [Non-patent literature]

[0014] [Non-Patent Document 1] Yasuko Tamada et.al., “Diagnosis of active tuberculosis using MBP64, a specific antigen of Mycobacterium bovis”, Microbiol immunol 2012;56:740-747 [Non-Patent Document 2] Naveed Sabir et.al., “miRNAs in Tuberculosis: New Avenues for Diagnosis and Host-Directed Therapy”, Frontiers in Microbiology vol.9, March 2018 Summary of the Invention [Problem to be solved by the invention]

[0015] The present invention aims to provide a screening method for the presence or absence of tuberculosis infection using a biomarker that can provide useful information on the presence or absence of infection in a short period of time and at low cost, using a less invasive liquid biopsy, particularly urine, from which a sample can be easily collected, and a screening probe set. [Means for solving the problem]

[0016] The inventors comprehensively detected and analyzed miRNAs contained in urine collected from patients with active tuberculosis and healthy individuals, and identified miRNAs that are specifically up- or down-regulated in tuberculosis-infected patients compared to healthy individuals. They identified miRNAs that can be used as indicators for determining tuberculosis infection as candidate biomarkers, and filed a patent application (PCT / JP2021 / 023027).

[0017] However, the amount of miRNA (miRNA concentration) contained in a collected urine sample varies from person to person, so a determination based on a simple comparison of the expression level (content in a urine sample) of a miRNA selected as a biomarker with the expression level of the same miRNA in a healthy individual based on the relative content is unreliable. In this regard, the problem of concentration differences between individuals can be solved by focusing on the expression frequency of miRNA and comparing the expression frequency of the biomarker miRNA of the subject with the average expression frequency of healthy individuals to determine whether the expression of the biomarker miRNA is increased / decreased. However, in order to accurately know the magnitude of the expression frequency of a specific miRNA, it is necessary to identify and quantify the amount of miRNA that serves as a parameter, that is, a large number of miRNAs expressed in each individual, to determine the total amount of expressed miRNA. For such measurement, it is necessary to use an expensive device such as a next-generation sequencer that can simultaneously identify and quantify hundreds of types of miRNA, and it takes a long time to analyze each sample, so it is difficult to apply it to a large-scale screening method that picks out samples that may be infected with tuberculosis from a large number of samples, such as health checkups.

[0018] Furthermore, miRNAs used as biomarkers generally do not have a high expression frequency (approximately 0 to 2.5%), and it is particularly important to accurately grasp the total amount of miRNAs that are expressed less frequently in tuberculosis infection than in healthy individuals. In addition, in order to increase the accuracy of the total amount, it is necessary to detect many types of miRNAs. In this sense, too, an RNA array equipped with many types of primer probes, an expensive PCR device, and a large number of measurement engineers and analysts are required.

[0019] The present inventors further investigated a method for determining whether the expression of a miRNA used as a biomarker is increased or decreased compared to healthy individuals without measuring the total amount (total number of reads) of the majority of miRNAs expressed in each individual. They then investigated various miRNAs that can be used as standards (internal controls for standardization) for determining whether the expression of a miRNA that serves as a biomarker for tuberculosis infection is increasing or decreasing in each individual.

[0020] In order to use it as an internal control for standardization, the following requirements must be met: a) It is an miRNA that is constantly expressed in all individuals (i.e., it can be expected that a certain level of expression will always be present in all individuals). b) miRNA with small individual variation (small individual variation in expression frequency) c) miRNAs that have very little effect on tuberculosis infection

[0021] The inventors identified an miRNA (internal control for standardization) that can satisfy the above requirements, and discovered that the presence or absence of tuberculosis infection can be determined by using the relative content of this internal control for standardization as an indicator, thereby completing the present invention.

[0022] The method for screening tuberculosis-infected samples (Type I) of the present invention is a method for screening tuberculosis-infected samples by detecting one or more types of biomarker miRNAs selected from miRNAs (SEQ ID: 2 to SEQ ID: 33 and / or SEQ ID: 34 to SEQ ID: 73) contained in a urine sample from a subject, comprising: Obtaining the ratio [B / S] of the content B of the biomarker miRNA to the content S of hsa-miR-423-5p (sequence ID: 1) in the urine-derived sample; and comparing the obtained ratio [B / S] of the subjects with a cutoff value based on the ratio N(B / S) of the content B of the biomarker miRNA to the content S of hsa-miR-423-5p in a urine sample derived from a healthy subject and the same ratio P[B / S] of tuberculosis-infected subjects; The method includes a step of classifying the subject's urine-derived sample into a tuberculosis infection positive sample or a tuberculosis infection negative sample based on the result of the comparison step.

[0023] The cutoff value may be a cutoff value that can statistically distinguish between a healthy subject group and a tuberculosis-infected subject group with respect to the B / S (P(B / S)) of the tuberculosis-infected subject group relative to the average B / S (N(B / S)) derived from a healthy subject group. When at least one selected from hsa-miR-532-3p (sequence ID: 49), hsa-miR-423-3p (sequence ID: 56), and hsa-miR-451a (sequence ID: 37) is selected as the biomarker, the separation process is a process of separating the sample into a tuberculosis-infected sample when the subject's [B / S] is smaller than the cutoff value.

[0024] The separation step includes a separation step (first separation step) using an miRNA selected from sequence ID: 2 to sequence ID: 33 as a biomarker, and a separation step (second separation step) using an miRNA selected from sequence ID: 34 to sequence ID: 73, and when the sample is separated into a tuberculosis-infected sample in the first separation step and into a tuberculosis-infected sample in the second separation step, the sample may be separated into a tuberculosis-infected positive sample.

[0025] According to another aspect of the present invention, a method for screening a tuberculosis infection sample (Type II) comprises: measuring the content of hsa-miR-423-5p (Sequence ID: 1) and at least two of the marker miRNAs hsa-miR-532-3p (Sequence ID: 49), hsa-miR-423-3p (Sequence ID: 56) and hsa-miR-451a (Sequence ID: 37) in a urine sample from the subject; Obtaining the ratio [B / S] of the content B of each of the miRNAs for markers to the content S of hsa-miR-423-5p in the urine-derived sample; and a step of comparing the obtained ratio [B / S] of subjects with a cutoff value set for each biomarker based on the ratio N(B / S) of the content B of the miRNA for biomarker to the content S of hsa-miR-423-5p in a urine sample derived from a healthy subject and the same ratio P[B / S] of tuberculosis-infected subjects; The method includes a step of classifying the urine sample from the subject as a tuberculosis infection-positive sample when the result of the comparison step is lower than the cutoff value for at least one or all of the biomarkers.

[0026] In the above-mentioned Type II screening method, the process of separating tuberculosis-infected samples consists only of the second separation step of the Type I screening method, but by using multiple markers as biomarkers in the comparison step, it is possible to ensure the accuracy of the determination.

[0027] The test probe set used in screening tuberculosis-infected samples of the present invention is a test probe set for active tuberculosis that includes a standardization nucleotide probe capable of hybridizing to hsa-miR-423-5p under stringent conditions and having a detectable label; and at least one probe selected from the group consisting of nucleotide probe 1 and nucleotide probe 2 described below. Probe 1: A nucleotide probe capable of hybridizing under stringent conditions with one or more of sequences selected from sequence ID2 to sequence ID33 and having a detectable label. Probe 2: A nucleotide probe capable of hybridizing under stringent conditions with one or more of the sequences selected from SEQ ID NO:34 to SEQ ID NO:73, and having a detectable label.

[0028] A sample screening run for type I tuberculosis infection will include both probe 1 and probe 2. To screen type II tuberculosis infection samples, a test probe set including a combination of the above standardization nucleotide probe and probe 3 described below is used. Probe 3: A set of nucleotide probes for markers capable of hybridizing to each of the probes of sequence ID: 49 and sequence ID: 56 under stringent conditions and having a detectable label.

[0029] In this specification, "tuberculosis" refers to an infectious disease caused by tuberculosis bacteria. It refers to an active tuberculosis state in which symptoms such as coughing and weight loss have already appeared and tuberculosis bacteria can be detected in sputum. On the other hand, it does not cover the determination of the presence or absence of latent tuberculosis in which there are no symptoms or abnormal clinical findings such as chest X-ray findings or bacterial test findings, but the patient is infected with tuberculosis bacteria.

[0030] As used herein, the term "healthy subject" refers to a sample derived from a subject who is tuberculosis infection-negative, i.e., tuberculosis bacteria are not detected in sputum, and who can be determined to be AIDS-negative based on the proportion of CD4-positive T cells.

[0031] As used herein, "miRNA (microRNA)" refers to the miRNA identified by a sequence ID (sequence number), when the miRNA is identified by the sequence. Unless otherwise specified, the term includes mature miRNA, which is a non-coding RNA of approximately 16 to 25 bases, as well as pri-miRNA, which is an initial transcription product transcribed from a miRNA gene by RNA polymerase II and has a hairpin loop structure, and pre-miRNA, which is a precursor of miRNA and is formed when this pri-mRNA is partially cleaved by RNaseIII-like Drosha.

[0032] In this specification, the term "miRNA content" refers to the amount of miRNA contained in a measurement sample, which can usually be quantified by real-time PCR. In order to enable absolute quantification and comparison between samples, an endogenous control (a miRNA that is constantly present in samples from patients and healthy subjects and is expressed in both) is used. difference In the present invention, the ratio [B / S] of the content B of a biomarker miRNA to the content S of a standardization miRNA contained in the same measurement sample is used as a parameter to discriminate between positive and negative tuberculosis infection, so either the absolute amount or the relative amount is acceptable. The quantification of the relative amount by real-time PCR may be carried out by either a method using a calibration curve or the ΔΔCt method.

[0033] The parameters used in this specification, i.e., the content ratio [B / S], are generally referred to as P(B / S) when referring to the ratio [B / S] of tuberculosis-infected patients, and as N(B / S) when referring to the ratio B / S of healthy individuals. In addition, the content B of each biomarker in a sample is, for example, when hsa-miR-532-3p is used as a biomarker, B 532-3p The expression is expressed using B (abbreviation of miRNA), as in the above. The content ratio of the corresponding biomarker to the internal miRNA (endogenous control) for normalization (for example, in the case of hsa-miR-532-3p, it is [B 532-3p / S) is abbreviated as P(532-3p) in tuberculosis-infected individuals and N(532-3p) in healthy individuals.

[0034] As used herein, the term "miRNA expression frequency" refers to the ratio of the number of reads of a target miRNA (e.g., a biomarker) to the total number of reads when read by a next-generation sequencer. It corresponds to the ratio (%) of the content of the target miRNA to the total content of miRNAs (usually 200 to 500 types) contained in detectable amounts in a sample.

[0035] As used herein, the term "cycle number" refers to the number of PCR repetitions required to detect the target miRNA, and a higher cycle number (referred to as "Ct" in this specification) indicates a lower content of the target miRNA.

[0036] As used herein, the term "capable of hybridizing under stringent conditions" refers to a nucleotide sequence having a complementary sequence to each sequence of a target miRNA, or a sequence that is 85% or more, preferably 90% or more, more preferably 95% or more, with respect to the complementary sequence. , most preferably 100% have matching sequences. Effect of the Invention

[0037] The screening method for tuberculosis-infected samples of the present invention uses a specific number of miRNAs as biomarkers and utilizes the ratio of the biomarker content to the endogenous control content [B / S] as an index for judgment, therefore, there is no need to determine the total amount of miRNA to calculate the expression frequency, and variation between individuals is small. Therefore, the screening method of the present invention makes it possible to separate a large number of samples into possible positive and possible negative groups in a short period of time without using expensive equipment such as a next-generation sequencer. Furthermore, since urine is used as the measurement specimen, which does not require collection by an expert, it is possible to quickly and inexpensively screen potentially positive samples from a large number of specimens. [Brief description of the drawings]

[0038] [Figure 1] This is a scatter plot showing the expression levels of hsa-miR23-5p in all individuals measured in the examples. [Diagram 2] A scatter plot showing the normalized content ratio [B / S] of hsa-miR532-3p. [Diagram 3] A scatter plot showing the normalized content ratio [B / S] of hsa-miR423-3p. [Figure 4] A scatter plot showing the normalized content ratio [B / S] of hsa-miR451a. [Diagram 5] This is a scatter plot showing the normalized content ratio [B / S] of hsa-miR532-3p obtained in verification part 3. [Figure 6] This is a scatter plot showing the normalized content ratio [B / S] of hsa-miR423-3p obtained in verification part 3. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] <Internal miRNA for standardization> The standardization miRNA used in the method for screening tuberculosis-infected samples of the present invention is hsa-miR423-5p contained in each specimen, which specifically has the base sequence "UGAGGGGCAGAGAGCGAGACUUU" (Sequence ID: 1).

[0040] It has been reported that hsa-miR423-5p is constantly expressed in various normal or pathological tissues (Eliana Bignotti et.al., “Identification of stably expressed reference small non-cording RNAs for microRNA quantification in high-grade serous ovarian carcinoma tissues”, Journal of Cellular and Molecular Medicine 2016 vol.20, No 12, pp.2341-2348, Cosmobio: RNAi Handbook 2nd Edition https: / / www.cosmobio.co.jp / upfiles / catalog / pdf / catalog_11711.pdf). The inventors also confirmed that hsa-miR423-5p is stably and constantly expressed with relatively little variation in urine samples from both healthy subjects and tuberculosis-infected subjects by analysis of miRNAs contained in urine samples (analysis by next-generation sequencer) and quantification by real-time PCR (expression frequency 0.0086 to 0.29%). Here, "stably expressed" means that the protein is constantly present in urine and is detectable.

[0041] <Biomarkers for determining tuberculosis infection> The miRNAs that can be used as biomarkers in the screening method for tuberculosis-infected samples of the present invention are those that are up- or down-expressed in a state of active tuberculosis compared to healthy individuals. Specifically, the miRNAs that are overexpressed compared to healthy individuals (group 1) are miRNAs having the sequences shown in Table 1 (sequence ID: 2-ID: 33); the miRNAs that are underexpressed compared to healthy individuals (group 2) are miRNAs having the sequences shown in Table 2 (sequence ID: 34-ID: 73).

[0042] [Table 1] [Table 2]

[0043] These miRNAs were found by comprehensively detecting miRNAs contained in urine samples from tuberculosis-infected individuals, and their expression frequencies were found to be significantly different from the average miRNA profile contained in urine samples from healthy individuals. The first group of miRNAs was found to be significantly overexpressed compared to the expression frequencies of healthy individuals, while the second group of miRNAs was found to be significantly underexpressed.

[0044] Here, "significant" means that the significance level indicating an increase (Table 1) or decrease (Table 2) in expression frequency compared to healthy individuals is p<0.1 (preferably p<0.05) in Welch's t-test in the results of RNA sequence analysis using a next-generation sequencer, or p<0.05 (preferably p<0.01) in statistical processing using Fisher's exact test, or an expression frequency that is more than twice (Table 1) or less than half (Table 2) at a significance level of p<0.05 (preferably p<0.01) based on statistical processing using a likelihood ratio test or pseudo-likelihood F test. In addition, regarding the results of real-time PCR, it refers to a case where the content of the target miRNA is increased (Table 1) or decreased (Table 2) with a significance level of p<0.05 (preferably p<0.01) in the Mann Whitney U test relative to the average content of the target miRNA in healthy individuals.

[0045] Of these, particularly for the second group of biomarkers, hsa-miR-532-3p (sequence ID: 49), hsa-miR-423-3p (sequence ID: 56), and hsa-miR-451a (sequence ID: 37) are preferably used. These miRNAs have a relatively high expression frequency, and there is less chance of amplification errors occurring when a urine sample containing low concentrations of miRNA is amplified and detected.

[0046] Although only one of the above biomarkers may be used, it is preferable to use two or more of them in combination, which can improve the accuracy of the determination based on the markers. In particular, it is preferable to use a combination of miRNA classified into the first group and miRNA classified into the second group. By using a combination of two groups whose expression frequency increases or decreases inversely due to tuberculosis infection, a more reliable determination result (tuberculosis positive or tuberculosis negative) can be obtained. In addition, even in the case of HIV infection, the risk of erroneous determination such as false positive or false negative can be reduced.

[0047] In addition, even if only miRNA classified into the first or second group is used as a marker for the judgment, if the judgment based on all comparison results for multiple markers is the same, the judgment result can be said to be highly reliable. For example, by using three types of markers classified into the second group, a combination of hsa-miR-532-3p (sequence ID: 49) and hsa-miR-423-3p (sequence ID: 56), and further a combination of hsa-miR-451a (sequence ID: 37), it is possible to reduce the number of specimens judged as false positives.

[0048] <Inspection probe set> The test probe set of the present invention is a probe set for determining the possibility of a positive result for active tuberculosis in a urine sample of a subject, and is a set combining probes for detecting the above biomarkers. Specifically, it includes an internal standard probe for detecting a standardization miRNA (hsa-miR-423-5p), and a probe 1 for detecting a first group of biomarkers and / or a probe 2 (preferably a probe 3) for detecting a second group of biomarkers.

[0049] (1) Internal standard probe A probe that can hybridize to hsa-miR-423-5p under stringent conditions Specifically, it has a sequence that is 85% or more, preferably 90% or more, and more preferably 95% or more identical to the complementary sequence of the base sequence (UGAGGGGCAGAGAGCGAGACUUU) of hsa-miR-423-5p represented by sequence ID: 1, and is labeled for detection. Furthermore, if necessary, a primer sequence, a linking nucleotide chain for immobilization on a carrier, an adapter, etc. may be linked to the 5' end or 3' end of the sequence, and the phosphate moiety and sugar moiety may be appropriately modified.

[0050] (2) Probe 1 A nucleotide probe or a probe set capable of hybridizing under stringent conditions with one or more miRNAs included in the first group (sequence ID: 2 to sequence ID: 33) shown in Table 1 and labeled for detection.

[0051] (3) Probe 2 A nucleotide probe or a probe set capable of hybridizing under stringent conditions with one or more miRNAs included in the second group (sequence ID: 34 to sequence ID: 73) shown in Table 2 and labeled for detection.

[0052] It is preferable that probe 2 comprises a nucleotide probe capable of hybridizing under stringent conditions to at least one nucleotide selected from the group consisting of sequences ID:37, ID:49, and ID:56, and which is labeled for detection.

[0053] (4) Probe 3 Probe 3 is a preferred embodiment of probe 2, and is a set of marker nucleotide probes that can hybridize to each of the probes of sequence ID: 49 and sequence ID: 56 under stringent conditions and have a detectable label.

[0054] Probe 3 may further comprise a marker nucleotide probe capable of hybridizing to SEQ ID NO:37 under stringent conditions and having a detectable label.

[0055] Probe 1, probe 2, and probe 3 each have a sequence that can hybridize with the target miRNA under stringent conditions, and if necessary, a primer sequence, a linking nucleotide chain for immobilization on a support, an adapter, etc. may be linked to the 5' or 3' end of the sequence, and the phosphate and sugar moieties may be appropriately modified.

[0056] Here, a nucleotide capable of hybridizing under stringent conditions is a nucleotide having a complementary sequence to each sequence of the target miRNA, or a nucleotide having a sequence that is 85% or more identical to the complementary sequence, preferably 90% or more identical, more preferably 95% or more identical, and particularly preferably 99% or more identical.

[0057] The probe set of the present invention is a probe set including an internal standard probe and a biomarker probe, and examples of the combinations include the following: ·Internal standard probe and probe 1 ·Internal standard probe and probe 2 · Internal standard probe, probe 1 and probe 2 ·Internal standard probe and probe 3 ·Internal standard probe, probe 1 and probe 3

[0058] The types of biomarker probes included are selected depending on the type of screening method to be applied, ie, the separation step to be employed. The probe set may be provided as a microarray, a probe panel, or the like.

[0059] These nucleotide probes can be detected and quantified when hybridized with the target miRNA based on the label. The label may be any of the known direct and indirect labels that are preferably used for nucleotide probes. Examples of direct labeling substances include: 32 isotopes such as P; indirect labeling substances include antibodies, labeling enzymes such as the avidin-biotin system, chemiluminescence systems such as luminescence / quenching, fluorescent dyes, and gold colloids.

[0060] <Preparation of specimens and measurement samples> The specimen to be tested is urine collected from the subject. By using urine as the test sample, out of all human body fluids, collection of specimen samples, such as blood samples, does not have to be dependent on specific skilled workers. Saliva is also a sample that can be collected without relying on specific skilled workers, but it can be difficult to collect from subjects with dry mouth, such as elderly people. In this respect, urine is an excellent specimen that can be easily collected from all subjects. Therefore, the screening method of the present invention is suitable as a simple screening method for comprehensively testing a large number of samples.

[0061] Although urine tends to contain fewer exosomes containing miRNA than blood, it is possible to collect large amounts of urine compared to other bodily fluids, and since no blood collection equipment such as syringes is required, there is no risk of infection with blood-borne viral infections due to needlestick injuries, etc., so using urine as a sample is suitable for testing in developing countries.

[0062] Like other body fluids such as blood, urine contains exosomes that contain mature miRNAs that serve as biomarkers. Exosomes are membrane vesicles secreted from cells, and generally have a diameter of 30 to 150 nm when observed under an electron microscope. In addition to mature miRNAs, exosomes contain pri-miRNAs, pre-miRNAs, coding-mRNAs, DNA, enzymes, cytoskeleton proteins, signal molecules, etc.

[0063] Although it is possible to use urine collected from a subject as is, it is usually preferable to use a urine-derived sample containing nucleotides as a measurement sample, in order to detect the target miRNA by hybridization.

[0064] Examples of urine-derived samples include exosome-enriched or roughly purified fractions (hereinafter referred to as "exosome-rich fractions"), samples from which RNA has been extracted, etc. Among these, from the viewpoint of accuracy of determination, it is preferable to use samples from which RNA has been directly extracted as measurement samples.

[0065] A measurement sample (RNA isolate) can be prepared from the urine of a subject by a conventionally known method. For example, exosomes may be isolated from a urine sample by size exclusion chromatography, centrifugation, or the like, and RNA may be extracted from the resulting exosome-rich fraction. Alternatively, exosomes may be isolated using a commercially available kit, or RNA may be isolated directly.

[0066] Commercially available exosome isolation kits include ExoQuick TMExosome precipitation solution series (for example, ExoQuick-TC, ExoQuick-CG, etc., all manufactured by System Biosciences), as a separation kit for obtaining nucleic acid extraction samples from urine, miRNeasy mini kit (manufactured by Qiagen), MagMax mirVana Total RNA kit (Thermo Fisher), Magtration (registered trademark) using magnetic particles (Precision System Science), etc. can be used. Alternatively, a method of recovering exosomes (nanobiodevice method) by simply feeding an exosome-containing sample (urine) to a nanowire structure may be used. Preferably, for example, MagMax TM It is a total RNA extraction sample prepared according to the protocol of the operation manual (urine sample) of the mirVana Total RNA-Seq kit (Thermo Fisher).

[0067] <Detection and quantification of miRNA> As a method for detecting and quantifying the target miRNA (hsa-miR-423-5p and the miRNA used as a biomarker) from the measurement sample (RNA-containing sample) prepared as described above, it may be hybridized using the probe set of the present invention, and the luminescence intensity, radioactivity, fluorescence intensity, enzyme activity, etc. may be measured based on the type of label used for the probe.

[0068] Examples of miRNA quantification methods include real-time PCR method, microarray method, Northern blot method, liquid-phase nucleic acid hybridization, colorimetric method, etc. A method of detecting a marker by color development by combining the PCR method and the immunochromatography method may also be used. These methods are appropriately selected according to the type of label of the probe used. For example, when a fluorescent label is used, it can be detected by visually observing the presence or absence of fluorescence emitted by hybridization. Also, the content and content ratio can be calculated by scaling the intensity according to the type of labeling substance, such as fluorescence intensity.

[0069] The quantification performed in the screening method of the present invention is not limited to measurement of the absolute amount of the target miRNA contained in the measurement sample, but may be quantification of the relative amount. As described below, the quantification of miRNA is performed to obtain the ratio [B / S] of the biomarker miRNA content B to the hsa-miR-423-5p content S, and therefore the method may be one that can directly obtain [B / S] without calculating the number of cycles, the content of hsa-miR-423-5p as an endogenous control contained in the sample, and the content of the biomarker miRNA of interest.

[0070] For example, when quantifying by real-time PCR, the [B / S] of the measurement sample can be obtained by either the calibration curve method or the ΔΔCt method.

[0071] <Screening method for active tuberculosis samples> The screening method of the present invention is a method for screening for samples that may be positive for active tuberculosis from specimens, and can be used as a screening method for separating a large number of samples into positive and negative sample groups, as in health checkups, and as a simple testing method for the initial examination of patients suspected of having tuberculosis.

[0072] The screening method of the present invention is characterized in that it uses the ratio [B / S] of the content B of biomarker miRNA to the content S of hsa-miR-423-5p in a specimen as an indicator for determining whether a sample is positive or negative.

[0073] That is, a step of detecting and quantifying hsa-miR-423-5p and a selected biomarker miRNA contained in the prepared measurement sample to obtain the ratio [B / S] of the content B of the biomarker miRNA to the content S of hsa-miR-423-5p; The method includes a step of comparing the obtained [B / S] with a cutoff value based on the same ratio N(B / S) of an RNA-containing sample prepared by a similar processing method from the urine of a healthy person, and classifying the urine-derived sample of the subject into a tuberculosis infection-positive sample and a tuberculosis infection-negative sample depending on the type of biomarker (first group or second group) based on the result of the comparison.

[0074] The subject's [B / S] can be obtained by obtaining hsa-miR-423-5p (content S) and the selected biomarker miRNA (content B) contained in the measurement sample using the detection and quantification methods described above, and then calculating the [B / S] of the measurement sample. Alternatively, [B / S] can be calculated directly based on the cycle number (Ct) of the measurement value obtained by real-time PCR, as in the ΔΔCt method.

[0075] By using the probe set of the present invention, it is possible to directly obtain [B / S], for example, from the relative intensity of the labels.

[0076] The cutoff value is a threshold value that can statistically distinguish between a group of healthy subjects and a group of tuberculosis-infected subjects with respect to [B / S], and can be appropriately set by ROC analysis or the like. For example, a ROC curve can be created for a data set of [B / S] of tuberculosis patients normalized by the average value of N(B / S) derived from a large number of healthy subjects, and a threshold value that includes a large number of tuberculosis patients can be set as a cutoff value. In this case, the cutoff value corresponds to how many times the expression frequency of the same biomarker in healthy subjects is.

[0077] The average value of N(B / S) for normalization is the average value obtained by detecting and quantifying the target marker miRNA for a group of healthy individuals using the same method as that used to obtain the [B / S] of the measurement samples. The cutoff value used in the comparison is determined appropriately depending on the type of miRNA, the method for preparing the measurement sample, the type of label, the quantification method, and the like.

[0078] The process of obtaining and comparing the [B / S] of the subject is performed for each biomarker. When two or more types of biomarkers are used, the [B / S] obtained for each biomarker is compared with the corresponding cutoff value, and the measured specimen is classified as a tuberculosis infection positive sample or a tuberculosis infection negative sample based on the magnitude relationship with the cutoff value.

[0079] When the miRNAs in Table 1 (first group) are selected as biomarkers, if the obtained [B / S] is higher than the above cutoff value, the sample is classified as a tuberculosis-infected sample (first determination). When the miRNAs shown in Table 2 (Group 2) are selected as biomarkers, if the obtained [B / S] is lower than the above cutoff value, the sample is classified as a tuberculosis-infected sample (Group 2 judgment).

[0080] When two or more biomarkers are used, a comparison is made for each biomarker with a predefined cutoff value. The screening method of the present invention may include only either the first determination step or the second determination step, but from the viewpoint of increasing the accuracy of the determination, it is preferable to select biomarkers from both the first group and the second group, respectively, and perform the first determination and the second determination (Type I screening method).

[0081] If the biomarkers used are only those of the first or second group, only one of the first or second judgments will be performed. However, by using a combination of multiple biomarkers belonging to the first or second group, and adopting a judgment criterion of judging as positive or negative when the comparison results of the B / S value of each biomarker and the cutoff value all match, it is possible to ensure the accuracy of the judgment.

[0082] When both the first and second judgments are performed, the order of these judgments is not particularly limited, and the first judgment may be performed after the second judgment, or the second judgment may be performed after the first judgment, or the first judgment and the second judgment may be performed simultaneously. By using the probe set of the present invention, multiple determinations can be made simultaneously.

[0083] An example of a screening method using a biomarker belonging to only either the first or second group is a screening method using a probe set combining an internal standard probe and probe 3 (type II).

[0084] In this case, when the comparison result between the B / S value of the biomarker used as probe 3 and the cutoff value is lower than the cutoff value for all markers, the sample is determined to be positive for tuberculosis infection, thereby making it possible to ensure high accuracy of determination. Alternatively, in the case of reducing false negatives, when the B / S of any one of the markers is lower than the cutoff value, it can be determined that the sample is possibly positive for tuberculosis infection.

[0085] The entire contents of PCT / JP2021 / 023027 are incorporated herein by reference. EXAMPLES

[0086] The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to the following examples as long as it does not depart from the gist of the present invention.

[0087] [Specimen] Urine samples were used from 19 healthy Laotian individuals, 19 Laotian patients with active tuberculosis infection (two of whom were co-infected with HIV), and 12 Japanese patients with severe COVID-19 (without tuberculosis infection). Urine samples were frozen after collection, and samples from active tuberculosis patients were stored for more than one year before preparation of RNA samples for measurement. Urine samples from healthy subjects and severe COVID-19 patients were frozen for up to 60 days.

[0088] [Preparation of RNA samples for measurement] (1) Preparation method 1 From a 3ml urine sample, MagMax TM Total RNA extraction samples were obtained according to the protocol in the operating manual (urine sample) of the mirVana Total RNA-Seq kit (Thermo Fisher). The specific procedure is as follows. 2.4 ml of Lysis Buffer was added to 3 ml of urine and shaken for 7 minutes (500 rpm). 350 μl of Binding Beads Mix (a mixture of 234 μl of RNA Binding Beads and 116 μl of Lysis / Binding Enhancer) was added to the resulting mixture and shaken for 5 minutes (500 rpm). 5.76 ml of isopropanol was added to the resulting solution, which was then pipetted and incubated for 20 minutes (200 rpm). The mixture was then placed on a magnetic stand to separate the particles, after which the supernatant was discarded, a washing solution was added, the mixture was washed by shaking, and then the mixture was washed with Turbo DNase. TM The RNA was re-bound to the RNA Binding Beads by adding the solution, and the re-bound RNA was separated again using a magnet. After repeated separation and washing, elution buffer was added to the dried RNA Binding Beads and incubated at 65°C for 5 minutes. The mixture was placed on a magnetic stand, and the resulting supernatant was used as a measurement sample.

[0089] (2) Preparation method 2 Using Urine Conditioning Buffer (ZYMO RESEARCH), RNeasy Mini Kit, and RNeasy MiniElute Cleanup Kit (Qiagen), RNA extraction samples containing miRNA were obtained from 15 ml of urine specimens. 15 ml of urine specimens were pretreated (centrifuged at room temperature (2000 xg) for 20 minutes, and the supernatant was filtered through a PVDF membrane filter (Millex-GV Syringe Filter Unit, 0.22 μm, (MERCK)) and concentrated (1.05 μm Urine Conditioning Buffer was added to the filtrate obtained by pretreatment, and centrifuged at room temperature (3000 xg) for 20 minutes), and then total RNA extraction samples were obtained according to the RNeasy Mini Kit protocol. The specific procedure is as follows. The precipitate obtained above was mixed with 2.25 ml of Qiazol and 450 μl of isopropanol, and left to stand at room temperature for 2 minutes. Then, it was centrifuged at 4°C for 30 minutes (maximum speed, 21100 xg), and the aqueous phase was added to the column provided with the RNeasy Mini Kit, and separation and washing by centrifugation was repeated (centrifugation at 8000 xg or more at room temperature for 15 seconds → addition of the flow-through to the RNeasy MiniElute Cleanup Kit → centrifugation at 8000 xg or more at room temperature for 15 seconds (discarding the flow-through) → addition of the wash buffer provided with the RNeasy MiniElute Cleanup Kit to the column → centrifugation at 8000 xg or more at room temperature for 15 seconds (discarding the flow-through) → addition of 80% ethanol to the column → centrifugation at 8000 xg or more at room temperature for 2 minutes → centrifugation at 21100 xg or more at room temperature for 5 minutes). Finally, 23 μl of sterilized water heated to 70° C. was added to the column, which was then allowed to stand at room temperature for 5 minutes and centrifuged at room temperature for 1 minute (8000×g or higher), and the resulting flow-through liquid was used as a measurement sample.

[0090] [Sequence analysis method] Using the RNA extraction samples obtained by preparation method 1 or 2, adapters were added and reverse transcription was performed according to the operating manual for the Ion Total RNA-Seq kit v2 for small RNA Libraries (Thermo Fisher), to prepare a cDNA library for next-generation sequencers. The sequence of the prepared cDNA library was analyzed using a next-generation sequencer Ion Torrent S5 (Thermo Fisher).

[0091] The obtained sequences were comprehensively compared using known miRNAs (miRNAs registered on the data bank site: miRBase) as reference sequences, and the number of reads for each miRNA was calculated to quantify the miRNAs in the sample, and the ratio to the total number of miRNA reads was calculated. When a sequence matched with a reference sequence and contained 10 or more consecutive bases, the sequence was identified as the miRNA corresponding to the reference sequence.

[0092] The detected miRNAs were arranged in order of expression frequency, and it was possible to quantify more than 200 types of miRNAs from each prepared sample.

[0093] [Quantification of miRNA: Real-time PCR method] The target miRNA content of the measurement samples prepared from urine specimens by Preparation Method 2 was quantified by qRT-real-time PCR. The quantification method by real-time PCR is as follows.

[0094] 1. Reverse transcription of miRNA The RNA extracted samples were reverse transcribed using the miRCURY LNA miRNA PCR Starter Kit (Qiagen). For the reverse transcription reaction, a reaction solution (10 μl) having the following composition (addition amount is the volume μl per sample) was used in a 0.2 ml tube. 5×miRCURY RT Reaction Buffer (buffer) 2.0μl 10×miRCURY RT Enzyme Mix (reverse transcriptase solution) 1.0 μl Template RNA 6.5μl Nuclease-free water 0.5 μl

[0095] The reverse transcription reaction was carried out using a thermal cycler, GeneAtlas G02 (ASTEC), under the following conditions. Step 1: 42°C for 60 minutes Step 2: 95°C for 5 minutes Step 3: Store at 4°C

[0096] 2. Real-time PCR 2-1 Real-time PCR reaction (SYBR Green method) The cDNA synthesized by the above reverse transcription was quantified by real-time PCR. For the real-time reaction, a 15-fold dilution (dilution with nuclease-free water) of the synthesized cDNA was prepared using the miRCURY LNA miRNA PCR Starter Kit (Qiagen), and 10 μl of reaction solution (composition shown below, amounts added are in μl volume per sample) was prepared in a strip tube (0.1 ml), and the reaction was performed using a real-time thermal cycler, Roter Gene Q (Qiagen). 2×miRCURY SYBR Green Master Mix (buffer) 5.0μl PCR primer (miRCURY LNA miRNA PCR assay) 1.0 μl cDNA template (15-fold dilution) 3.0 μl Nuclease-free water 1.0 μl

[0097] The PCR reaction consisted of an initial denaturation (95°C, 2 min) followed by 45 cycles of 95°C for 10 s and 56°C for 60 s. Melting curve analysis was performed over the range of 60-95°C at 1.0 s / 0.5°C.

[0098] 2-2 Calculation of Ct value The Ct value was calculated by drawing an auxiliary threshold line in the region where the fluorescence amplification curve was exponentially amplified, and the intersection point between this threshold line and the amplification curve was calculated as the Ct value.

[0099] 2-3 Calculation of miRNA content by relative quantification method A mixture of 1 μl of cDNA from all healthy subjects and patients analyzed was used as a reference sample. This reference sample was serially diluted 8-fold, 32-fold, 128-fold, 512-fold, and 2048-fold to prepare five types of standard samples, which were then used to perform real-time PCR reactions to create a calibration curve. The concentrations (relative values) of the standard samples were 256, 64, 16, 4, and 1, respectively.

[0100] [Confirmation of tuberculosis and HIV infection in specimens] The presence or absence of tuberculosis infection in the samples used for the sequence analysis was confirmed by culture testing of tuberculosis bacteria contained in the sputum of each subject and analysis using the GeneXpert (registered trademark) system. The presence or absence of tuberculosis bacteria was confirmed using the GeneXpert (registered trademark) system by amplifying RNA contained in the sputum by PCR and then examining it using a probe targeting the drug resistance region of the rpoB gene of tuberculosis bacteria. The presence or absence of HIV infection was examined by measuring the proportion of CD4 positive T cells using FACS Presto (registered trademark) from BD biosciences.

[0101] [Verification of standardized miRNAs] For RNA samples prepared from urine samples from healthy individuals, patients with active tuberculosis infection, and COVID19 patients using method 2, hsa-miR-423-5p was identified and quantified by real-time PCR. The quantitative results are shown in Figure 1.

[0102] In Figure 1, the vertical axis represents the Ct of hsa-miR-423-5p in each sample (the cycle number at which hsa-miR-423-5p was detected in each sample). A higher Ct value indicates a lower content. In Figure 1, "Healthy" indicates healthy individuals, "TB" indicates tuberculosis patients, "TB+HIV" indicates patients co-infected with tuberculosis and HIV, and "Covid19" indicates Japanese patients with severe Covid19.

[0103] In both tuberculosis infection-negative groups (healthy individuals and Covid19), the Ct value was 20 to 24, and it can be seen that the variation within the group was small. This indicates that there is no difference in the expression frequency of hsa-miR-423-5p in urine between races. It can also be seen that there is little individual variation in the tuberculosis-negative group.

[0104] The Ct values ​​of the TB group were 25 to 30, and the variation within the group was small. Therefore, it can be seen that hsa-miR-423-5p is a microRNA with small individual differences even in the tuberculosis-positive group.

[0105] Differences were observed in the Ct value range between the tuberculosis infection negative group (Healthy, Covid19) and the tuberculosis infection positive group (TB, TB+HIV). This is thought to be due to the difference in the frozen storage period for urine samples after urine collection, preparation of the measurement sample, and measurement. The frozen storage period for healthy subjects was within 60 days, but the samples from the tuberculosis positive group were stored for more than one year, depending on the type of sample, which is thought to have led to the degradation of the target miRNA.

[0106] From the above, it was confirmed that hsa-miR-423-5p is constantly present in urine samples, has small individual variation, and is little affected by HIV infection, tuberculosis infection, and another respiratory disease, Covid-19, making it suitable as a standardization miRNA for relative comparison.

[0107] [Verification of biomarkers by the screening method of the present invention, Part 1] (1) Setting of N(B / S) For the RNA samples prepared from healthy subjects (No. 1-19) by the preparation method 2, the contents of the standardized internal microRNA (hsa-miR-423-5p) and the biomarkers belonging to the second group (hsa-miR-532-3p, hsa-miR-423-3p) were calculated by the calibration curve method from the Ct values ​​measured by real-time PCR. Next, the ratio of the content (B) of each biomarker to the content (S) of hsa-miR-423-5p [B / S] was calculated. The measurement and calculation results for healthy subjects are shown in Table 3.

[0108] [Table 3]

[0109] In Table 3, for N(532-3p), the average values ​​of the content ratios N(532-3p) and N(423-3p) for each biomarker were calculated, except for sample No. 16. The calculation results are as follows. hsa-miR-532-3p N(532-3p)={18 healthy subjects [B 532-3p / S] / 18=28.02 hsa-miR-423-3p N(423-3p)={19 healthy people [B 423-3p / S] / 19=0.82

[0110] The values ​​normalized by the average value (normalized B / S) for each sample are also shown in Table 3. Normalization is done by converting the average value to 1, and the content ratio of each sample [B 532-3p / S] with an average of 28.02 for N(532-3p), [B 423-3p / S] by the average value of N(423-3p), 0.82.

[0111] (2) Calculation of P(B / S) and setting of cutoff value For the RNA samples prepared from the tuberculosis patient group specimens (No. 21-39) by the preparation method 2, the contents of the standardized internal microRNA (hsa-miR-423-5p) and the biomarkers belonging to the second group (hsa-miR-532-3p, hsa-miR-423-3p) were calculated from the Ct values ​​measured by real-time PCR. Next, the content ratio [B / S] of the content (B) of each biomarker to the content (S) of hsa-miR-423-5p was calculated. Furthermore, the calculated [B / S] of each specimen was divided by the average value of N (B / S) of healthy subjects to calculate the standardized value (normalized B / S), and the results are shown in Table 4.

[0112] [Table 4]

[0113] As can be seen from Tables 3 and 4, when the marker miR532-3p was used, the normalized [B / S] values ​​for healthy subjects were in the range of 0.32 to 1.97, whereas those for tuberculosis-infected subjects were in the range of 0 to 0.84 (No. 23 was not considered because it was rejected by the test). In addition, when the marker miR423-3p was used, the normalized [B / S] values ​​for healthy subjects were in the range of 0.00 to 1.96, whereas those for tuberculosis-infected subjects were in the range of 0 to 1.42.

[0114] Also, P(B 532-3p The average value of / S was 5.92, and P(B 423-3p The average value of N(532-3p) / S) was 0.44, both of which were significantly lower than the average values ​​of N(532-3p) and N(423-3p). When compared with normalized B / S, they were statistically significantly lower at 0.22 and 0.54, respectively, compared to 1.0 for healthy subjects (significance levels P<0.0001 and P<0.0031), demonstrating their usefulness as biomarkers for the second group.

[0115] The cutoff value was determined by ROC analysis using the statistical analysis software EZR (Reference: Bone Marrow Transplantation (2013) 48, 452-458). The cutoff value was as follows. When setting the cutoff value using the marker miR532-3p, No. 23, which was out of the group, was rejected by the test. Cutoff value for marker miR532-3p: 0.46 Cutoff value for marker miR423-3p: 0.73

[0116] (3) Validation of screening methods The [B / S] after standardization in Tables 3 and 4 are shown in Figures 2 and 3. Data rejected by the test are not plotted in Figures 2 and 3. In the figure, the vertical axis indicates the normalized content ratio [B / S] for each biomarker, i.e., the average value of N(B / S) is 1.0.

[0117] As shown in Figure 2 (miR532-3p), when the cutoff value was set at 0.46, approximately 94% of the samples were below the cutoff value classified as positive for tuberculosis infection. Furthermore, as shown in FIG. 3 (miR423-3p), when the cutoff value was set at 0.73, approximately 74% of the samples were below the cutoff value for classification as positive for tuberculosis infection.

[0118] From the above, it can be confirmed that, using hsa-miR-423-5p as a standardized internal microRNA, it is possible to distinguish samples into tuberculosis infection positive or negative samples based on the cutoff value set based on the content ratio with the marker [B / S]. That is, according to the screening method of the present invention, samples that are highly likely to be positive for tuberculosis infection can be easily screened by simply detecting and quantifying a specific number of miRNAs.

[0119] When only one of the first group or the second group is used as a biomarker, it is possible to reduce false negatives and false positives by using multiple types of biomarkers belonging to that group. For example, false positives can be avoided by classifying a sample as positive for tuberculosis infection only when the comparison results with the cutoff values ​​are consistent for all markers.

[0120] On the other hand, for the purpose of health checkups, from the viewpoint of reducing false negatives, it may be preferable to judge the possibility of positive tuberculosis infection based on the comparison result of even one of the multiple markers used with the cutoff value. For example, when the marker hsa-miR423-3P is used, the result of the judgment of infected person No. 29 is false negative because the normalized B / S value is 1.42, but the normalized B / S value of marker 523-3p is 0.17, which is smaller than the cutoff value of 0.46, so it is classified as a sample possibly positive for tuberculosis infection, and a false negative judgment can be avoided.

[0121] [Verification of biomarkers by the screening method of the present invention, Part 2] For hsa-miR-451a (ID: 37), a biomarker belonging to the second group, real-time PCR was performed on RNA samples prepared from healthy subjects (No. 1-19) and tuberculosis patient samples (No. 21-39) using preparation method 2, as in Part 1. The content was calculated from the obtained Ct value in the same manner as in Part 1, and the ratio of the content (B) of each biomarker to the content (S) of standardization miRNA (hsa-miR-423-5p) [B / S] was calculated.

[0122] The average B / S value of the healthy subject group was calculated, and each B / S value was divided by the average value, to standardize the results. In other words, the average value (N(B / S)) of healthy subjects after standardization is 1.00. A scatter plot of the results of the standardized B / S is shown in Figure 4. The average B / S value N(451a) of healthy subjects was 0.066, and the average B / S value P(451a) of the tuberculosis patient group was 0.0000089.

[0123] While the standardized B / S values ​​for healthy subjects were 0 to 3.56, the standardized B / S values ​​for hsa-miR-451a in tuberculosis patients were 0 to 0.00072, with an average value of 0.00014. As shown in Figure 4, even if a cutoff value of 0.4 is adopted, the standardized B / S values ​​of tuberculosis patients are lower than the cutoff value, so that the samples can be separated into a group that is likely to be positive for tuberculosis infection.

[0124] On the other hand, when the marker hsa-miR451a is used, even if a sample may be judged as positive because the normalized B / S value is small, if the normalized B / S values ​​of the other two markers are not below the cutoff value, it is possible to judge that the sample is likely to be a false positive. For example, 451a The value of / S was 0, so it could be judged as positive, but after normalization of the same sample, B 532-3P / S=0.46 (cutoff value 0.46), normalized B 423-3p Since / S=2.44 (cutoff value 0.73), it is possible to determine that there is a high possibility of a false positive.

[0125] [Verification of biomarkers by the screening method of the present invention, Part 3] For urine samples (24 healthy subjects, 39 patients with active tuberculosis infection) obtained separately from the samples used in the above-mentioned verifications 1 and 2, measurement RNA samples were prepared by the preparation method 2. For the obtained measurement RNA samples, real-time PCR was performed according to the biomarker verification 1, and the contents of the standardization internal microRNA (hsa-miR-423-5p) and the biomarkers belonging to the second group (hsa-miR-532-3p, hsa-miR-423-3p) were calculated. Next, the ratio [B / S] of the content of each biomarker (B) to the content of hsa-miR-423-5p (S) was calculated, and each specimen sample was normalized by the average value of healthy subjects.

[0126] After normalization, [B 532-3p Fig. 5 shows the scatter plot of [B 423-3pA scatter plot of [ / S] is shown in Figure 6. The normalized values ​​of the samples with low expression levels that could not be amplified in the specified cycles in real-time PCR or the samples that were outlying from the group were excluded. 532-3p Based on the average value (n=34) of [B 532-3p / S] cutoff value is 0.526, [B 423-3p The cutoff value for [ / S] was set at 0.73.

[0127] The results were classified as positive or negative based on the above cutoff value, and the sensitivity and specificity were calculated based on the table below. [Table 5]

[0128] "Sensitivity" is the proportion of tuberculosis-infected samples (true positives) that are correctly determined to be tuberculosis-infected samples, and is calculated using the following formula. Sensitivity = a / (a+c) "Specificity" is the proportion of non-tuberculosis samples (true negatives) that are correctly determined to be non-tuberculosis samples, and is calculated using the following formula. Specificity=d / (b+d)

[0129] When miR532-3p was used as a biomarker, the sensitivity was 0.939 and the specificity was 0.696, and when miR423-3p was used as a biomarker, the sensitivity was 0.818 and the specificity was 0.571.

[0130] Therefore, for example, 532-3p For samples that were determined to be positive by comparing with the cutoff value for [B 423-3p Samples that are positive for the TB infection test based on the comparison of the TB infection test with the cutoff value may be considered to be more likely to be positive for TB infection, thereby reducing false positives.

[0131] From the above, it was confirmed that the use of these biomarkers and standardization allows for reproducible discrimination between the presence and absence of tuberculosis infection, that standardization using hsa-miR-423-5p as the standardization miRNA has high sensitivity and specificity, and that by combining the results of multiple biomarkers, it is possible to distinguish between positive and negative samples with high accuracy. [Industrial Applicability]

[0132] The screening method for tuberculosis infection samples of the present invention can use urine samples as the specimen sample, which is minimally invasive for the subject and easy to collect, and can quickly obtain results without the need for culture or the like to determine whether or not there is tuberculosis infection. Therefore, it is useful as a testing method for checking for the presence or absence of active tuberculosis infection in areas where facilities are not well developed, such as developing countries.

Claims

1. A method for screening tuberculosis-infected samples by detecting one of the miRNAs (SEQ ID: 2 to 33) shown in Table 1, as well as hsa-miR-532-3p (SEQ ID: 49) and hsa-miR-423-3p (SEQ ID: 56), as a biomarker miRNA contained in a urine sample from a subject, comprising: Obtaining the ratio [B / S] of the content B of the biomarker miRNA to the content S of hsa-miR-423-5p in the urine-derived sample; and comparing the obtained ratio [B / S] of the subject with a cutoff value based on the ratio N(B / S) of the content B of the biomarker miRNA to the content S of hsa-miR-423-5p in a urine sample derived from a healthy subject and the same ratio P[B / S] of tuberculosis-infected subjects; A step of classifying the urine sample of the subject into a tuberculosis infection positive sample or a tuberculosis infection negative sample based on the result of the comparison step. A method for screening a tuberculosis infection sample comprising: 【Table 1】

2. The screening method according to claim 1, wherein the cutoff value is a cutoff value capable of statistically distinguishing between a healthy subject group and a tuberculosis-infected subject group with respect to the B / S (P(B / S)) of the tuberculosis-infected subject group relative to the average B / S (N(B / S)) derived from a healthy subject group.

3. A separation step (first separation step) in which the biomarker is a miRNA shown in Table 1 and a separation step (second separation step) in which the biomarker is hsa-miR-532-3p (sequence ID: 49) and hsa-miR-423-3p (sequence ID: 56) are performed; the second classification step is a step of classifying the subject as a tuberculosis-infected sample when the [B / S] of the subject is smaller than the cutoff value, The screening method according to claim 1, wherein when a sample is separated into a tuberculosis-infected sample in the first separation step and a tuberculosis-infected sample in the second separation step, the sample is separated into a tuberculosis-infected positive sample.

4. Measuring the content of hsa-miR-423-5p, and hsa-miR-532-3p (SEQ ID: 49) and hsa-miR-423-3p (SEQ ID: 56) as marker miRNAs in a urine sample from the subject; Obtaining the ratio [B / S] of the content B of each of the marker miRNAs to the content S of hsa-miR-423-5p in the urine-derived sample; and a step of comparing the obtained ratio [B / S] of the subjects with a cutoff value set for each biomarker based on the ratio N(B / S) of the content B of the miRNA for biomarker to the content S of hsa-miR-423-5p in a urine sample derived from a healthy subject and the same ratio P[B / S] of tuberculosis-infected subjects; a step of classifying the urine sample of the subject as a tuberculosis infection-positive sample when the result of the comparison step shows that the values ​​of at least one or all of the biomarkers are lower than the cutoff value; A method for screening a tuberculosis infection sample comprising:

5. A test probe set for distinguishing a sample derived from a urine sample from a subject from a sample positive for active tuberculosis, comprising: A normalization nucleotide probe having a complementary sequence to hsa-miR-423-5p (SEQ ID: 1) and having a detectable label; and Probe 3: A set of marker nucleotide probes having complementary sequences to each nucleotide of SEQ ID NO: 49 and SEQ ID NO: 56 and having a detectable label. A probe set for testing for active tuberculosis, including:

Images