Primer sets, kits and methods for detecting Mycobacteroides abscessus subsp.

Abstract

To provide primer sets capable of discriminating three subspecies of nontuberculous mycobacterium Mycobacteroides abscessus complex, i.e., subsp. abscessus, subsp. massiliense and subsp. boletii.SOLUTION: Disclosed is a primer set comprising one or more of a first primer set, a second primer set and a third primer set, where the first primer set comprises primer (A) comprising a base sequence that is the same as or homologous to a specific sequence at the 3' end and primer (B) comprising a base sequence that is the same as or homologous to a specific sequence at the 3' end, the second primer set comprises primer (C) comprising a base sequence that is the same as or homologous to a specific sequence at the 3' end and primer (D) comprising a base sequence that is the same as or homologous to a specific sequence the at 3' end, and the third primer set comprises primer (E) comprising a base sequence that is the same as or homologous to a specific sequence at the 3' end and primer (F) comprising a base sequence that is the same as or homologous to a specific sequence at the 3' end.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a primer set for identifying and detecting Mycobacteroides abscessus subsp. [Background technology]

[0002] Mycobacteria are acid-fast, non-motile, gram-positive rods. Mycobacteria are broadly divided into three groups: Mycobacterium tuberculosis, Mycobacterium leprae, and nontuberculous mycobacteria, which are the causative agents of tuberculosis, leprosy, and nontuberculous mycobacterial disease, respectively.

[0003] More than 170 species of nontuberculous mycobacteria have been reported to date, of which about 30 are known to be pathogenic to humans. Nontuberculous mycobacterial disease (Mycobacteroides abscessus complex disease) caused by Mycobacteroides abscessus complex is resistant to existing antibiotics and no effective treatment has been established, so the number of patients is accumulating and the number of severe cases is on the rise.

[0004] In Japan, the number of patients with pulmonary Mycobacteroides abscessus complex disease has been rapidly increasing, and the latest epidemiological survey has estimated the incidence rate to be 0.5 per 100,000, which is approximately five times higher than the previous survey.

[0005] The causative bacterial group, Mycobacteroides abscessus complex, is composed of three subspecies: Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense. It has been reported that each subspecies has different susceptibility to antibiotics, ability to acquire susceptibility to antibiotics, and treatment outcomes. Therefore, it is important to distinguish between the three subspecies in order to select an appropriate treatment method.

[0006] However, in order to distinguish Mycobacteroides abscessus complex at the subspecies level, phylogenetic analysis based on genome information, multilocus sequence analysis using housekeeping genes such as hsp65 gene and rpoB gene, and spacer regions, or analysis by pulsed field electrophoresis are required, but these methods are complicated and expensive, and are not suitable for application in clinical settings in terms of speed. Patent Document 1 describes a method for distinguishing three subspecies, Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense, using a PCR method. However, the method described in Patent Document 1 requires electrophoresis of the obtained PCR product and analysis of the size of the nucleic acid amplification product, which has problems in simplicity and speed. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] JP 2019-97493 A Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention has been made in consideration of such problems, and aims to provide a primer set that can identify and detect three subspecies of nontuberculous mycobacteria, Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense, by subjecting them to a nucleic acid amplification reaction and detecting them based on the presence or absence of a nucleic acid amplification product. [Means for solving the problem]

[0009] (1) A primer set for identifying and detecting Mycobacteroides abscessus complex subspecies, comprising one or more of the following: a first primer set consisting of a forward primer (A) comprising a polynucleotide homologous to SEQ ID NO: 1 at its 3' end and a reverse primer (B) comprising a polynucleotide homologous to SEQ ID NO: 2 at its 3' end; a second primer set consisting of a forward primer (C) comprising a polynucleotide homologous to SEQ ID NO: 3 at its 3' end and a reverse primer (D) comprising a polynucleotide homologous to SEQ ID NO: 4 at its 3' end; and a third primer set consisting of a forward primer (E) comprising a polynucleotide homologous to SEQ ID NO: 5 at its 3' end and a reverse primer (F) comprising a polynucleotide homologous to SEQ ID NO: 6 at its 3' end.

[0010] (2) The primer set according to (1), wherein one of the forward primer and the reverse primer included in any one or more of the first primer set, the second primer set, and the third primer set further comprises a labeling portion which is a tag capable of binding to a labeling substance or is a labeling substance, and the other further comprises a binding portion which is a tag capable of binding to at least a portion of a solid phase carrier.

[0011] (3) A kit for identifying and detecting Mycobacteroides abscessus complex subspecies, comprising the primer set and a solid phase support having at least a portion capable of binding to the binding portion.

[0012] (4) A method for identifying and detecting Mycobacteroides abscessus complex subspecies by analyzing the presence or absence of a nucleic acid amplification product obtained using the primer set. Effect of the Invention

[0013] According to the present invention, three subspecies of the Mycobacteroides abscessus complex, Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense, can be simply and quickly identified and detected based on the presence or absence of nucleic acid amplification products. [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 is a schematic diagram of one embodiment of a nucleic acid detection device for detecting an amplified product from a nucleic acid amplification reaction using a primer set of the present invention. [Diagram 2] FIG. 2 is a schematic diagram of another embodiment of a nucleic acid detection device for detecting an amplified product from a nucleic acid amplification reaction using a primer set of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] Below, we will explain the embodiments of the present invention in detail. However, these embodiments are intended to facilitate understanding of the principles of the present invention. The scope of the present invention is not limited to the embodiments described below. Other embodiments in which a person skilled in the art appropriately replaces the configuration of the embodiments described below are also included in the scope of the present invention.

[0016] <Design> The present inventors have prepared a primer set that specifically amplifies DNA derived from each subspecies based on the base sequence information of Mycobacteroides abscessus complex. They have found that the three subspecies Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense can be identified and detected by carrying out a nucleic acid amplification reaction using this primer set and analyzing the presence or absence of a nucleic acid amplification product, and have completed the present invention.

[0017] <Terminology> In the present invention, the term "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In RNA, thymine (T) can be read as uracil (U). As the polynucleotide, DNA containing U synthesized by substituting U for T at any position, or RNA containing T synthesized by substituting T for U at any position can be used. The polynucleotide may partially contain modified nucleotides such as inosine (I).

[0018] A polynucleotide may exist as a single strand or as a double strand, provided that at least one strand of the polynucleotide has certain characteristics as defined below. The method for producing the polynucleotide is not particularly limited, and the polynucleotide may be produced using a polynucleotide synthesizer or a custom synthesis service.

[0019] In the present invention, when "base sequence Y is homologous to base sequence X" or "base sequence X and base sequence Y are homologous", the base sequences X and Y may be identical or may be partially different, as long as a polynucleotide consisting of a complementary sequence of base sequence X and a polynucleotide consisting of base sequence Y can form sufficient hydrogen bonds to hybridize and form a stable double strand under the annealing conditions of a nucleic acid amplification reaction. For example, a polynucleotide consisting of a complementary sequence of base sequence X and a polynucleotide consisting of base sequence Y may have several mismatches, such as one mismatch in 10 nucleotides, one mismatch in 20 nucleotides, or one mismatch in 30 nucleotides. Typically, when a base sequence Y is "homologous" to a base sequence X, it means that the base sequences X and Y satisfy any of the following relationships. (A) The base sequence Y is the same as the base sequence X, or is a base sequence in which one or several bases have been deleted, substituted, added and / or inserted in the base sequence X. (B) The base sequence Y has an identity of 70% or more with the base sequence X. (C) A polynucleotide consisting of base sequence Y can hybridize under stringent conditions to a polynucleotide consisting of a base sequence complementary to SEQ ID NO:X. (D) A thymine (T) at any position in one of base sequences X and Y is replaced with a uracil (U) in the other.

[0020] In the above (A), "one or several" preferably refers to one to five, more preferably one to four, more preferably one to three, particularly preferably one or two, and most preferably one.

[0021] In (B), the identity value indicates a value calculated by using software (e.g., FASTA DNASIS and BLAST) that calculates identity between multiple base sequences with default settings. The identity value of a base sequence is calculated by calculating the number of matching bases when a pair of base sequences are aligned to maximize the degree of identity, and is calculated as a ratio of the number of matching bases to the total number of bases of the compared base sequences. Here, when there is a gap, the total number of bases is the number of bases counted with one gap as one base. For details of the method of determining identity, see, for example, Altschul et al., Nuc. Acids. Res. 25, 3389-3402, 1977 and Altschul et al., J. Mol. Biol. 215, 403-410, 1990.

[0022] In (B) above, the identity is more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 96% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more.

[0023] In the above (C), the term "stringent conditions" refers to conditions under which a specific hybrid is formed and a non-specific hybrid is not formed. For example, the conditions are as described in Green and Sambrook, Molecular Cloning, 4 thed (2012), Cold Spring Harbor Laboratory Press, can be appropriately determined. Specifically, stringent conditions can be set by the temperature during Southern hybridization, the salt concentration contained in the solution, and the temperature during the washing step of Southern hybridization, and the salt concentration contained in the solution. More specifically, stringent conditions include, for example, a sodium concentration of 25 to 500 mM, preferably 25 to 300 mM, and a temperature of 40 to 68°C, preferably 40 to 65°C, in the hybridization step. More specifically, hybridization can be performed in 1 to 7×SSC, 0.02 to 3% SDS, and at a temperature of 40°C to 60°C. A washing step may be performed after hybridization, and the washing step can be performed, for example, in 0.1 to 2×SSC, 0.1 to 0.3% SDS, and at a temperature of 50 to 65°C.

[0024] <Primer set> The primer set in the present invention consists of a forward primer and a reverse primer. A single primer set may be used in a reaction system, or a plurality of primer sets may be mixed and used in multiplex.

[0025] The first primer set in the present invention is composed of a forward primer (A) containing a polynucleotide homologous to SEQ ID NO: 1 at its 3' end and a reverse primer (B) containing a polynucleotide homologous to SEQ ID NO: 2 at its 3' end, and is designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. abscessus. As an example, when PCR is performed using the genomic DNA of Mycobacteroides abscessus subsp. abscessus ATCC19977 as a template, a 102 bp region flanked by each primer is specifically obtained as a nucleic acid amplification product.

[0026] The second primer set in the present invention is composed of a forward primer (C) containing a polynucleotide homologous to SEQ ID NO: 3 at its 3' end and a reverse primer (D) containing a polynucleotide homologous to SEQ ID NO: 4 at its 3' end, and is designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. bolletii. As an example, when PCR is performed using the genomic DNA of Mycobacteroides abscessus subsp. bolletii BD as a template, the 122 bp region flanked by each primer is specifically obtained as a nucleic acid amplification product.

[0027] The third primer set in the present invention is composed of a forward primer (E) containing a polynucleotide homologous to SEQ ID NO: 5 at its 3' end and a reverse primer (F) containing a polynucleotide homologous to SEQ ID NO: 6 at its 3' end, and is designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. massiliense. As an example, when PCR is performed using the genomic DNA of Mycobacteroides abscessus subsp. massiliense JCM15300 as a template, the 88 bp region flanked by each primer is specifically obtained as a nucleic acid amplification product.

[0028] Here, "specific nucleic acid amplification products are obtained" typically means that nucleic acid amplification products using each primer set are obtained only when DNA derived from the corresponding subspecies is used as a template, and do not cross-react with uncorresponding subspecies or other acid-fast bacteria or bacteria.

[0029] The primers (A to F) may contain a polynucleotide homologous to any of SEQ ID NOs: 1 to 6 at the 3' end, and may further include other base sequences or modifications at the 5' end. SEQ ID NOs: 1 to 6 are listed in Table 1.

[0030] [Table 1]

[0031] The forward primers (A, C, E) may consist of only the polynucleotide, or may further include a labeling moiety or a binding moiety, which will be described later. The polynucleotide and the labeling moiety or the binding moiety can be chemically linked via a suitable spacer, which will be described later. In the forward primer, the position at which one of the labeling moiety and the binding moiety is linked to the polynucleotide is not particularly limited as long as it is a position that does not inhibit annealing of the polynucleotide with a polynucleotide containing a target region or its complementary strand and extension in a nucleic acid amplification reaction, but is preferably the 5' end of the polynucleotide.

[0032] The reverse primers (B, D, F) may consist of the polynucleotide alone, or may further comprise a labeling moiety or a binding moiety, which will be described later. The polynucleotide and the labeling moiety or the binding moiety can be chemically linked via a suitable spacer, which will be described later. In the reverse primer, the position at which one of the labeling moiety and the binding moiety is linked to the polynucleotide is not particularly limited as long as it is a position that does not inhibit annealing of the polynucleotide with a polynucleotide containing a target region or its complementary strand and extension in a nucleic acid amplification reaction, but is preferably the 5' end of the polynucleotide.

[0033] When at least one of the forward primer and the reverse primer contains a label, a nucleic acid amplification reaction using this primer gives a nucleic acid amplification product containing the label, making it easy to detect the nucleic acid amplification product.

[0034] When at least one of the forward primer and the reverse primer contains a binding site, a nucleic acid amplification reaction using this primer produces a nucleic acid amplification product containing the binding site, making it possible to fix the nucleic acid amplification product to a solid phase carrier and facilitating detection of the nucleic acid amplification product.

[0035] More preferably, one of the forward primer and the reverse primer further comprises a labeling portion, and the other further comprises a binding portion. In the nucleic acid amplification reaction using the primer set of this embodiment, a double-stranded nucleic acid amplification product containing the labeling portion and the binding portion is obtained, which makes it easy to detect by nucleic acid chromatography. This embodiment will be described below.

[0036] <Preferred embodiment of the primer set of the present invention> <Sign part> The labeling portion is either a tag capable of binding to a labeling substance or a labeling substance, and is preferably a tag capable of binding to a labeling substance. In this specification, a tag capable of binding to a labeling substance may be referred to as a labeling tag. When the labeling portion is a labeling tag, the tag contained in one end of the nucleic acid amplification product can be labeled by contacting the nucleic acid amplification product of the nucleic acid amplification reaction with the labeling substance. When the labeling portion is a labeling substance, a nucleic acid amplification product containing the labeling substance at one end can be obtained as the nucleic acid amplification product of the nucleic acid amplification reaction.

[0037] The labeling substance is not particularly limited as long as it allows the detection of the nucleic acid amplification product, but is preferably one that allows the visual detection of the nucleic acid amplification product. Examples of such labeling substances include colored particles, dyes, enzymes (peroxidase, alkaline phosphatase, luciferase, etc.), and the like, but is preferably colored particles. Examples of "colored particles" include metal (e.g., gold, silver, copper, platinum, etc.) particles, metal rods, colored latex particles, silica nanoparticles containing dyes, and the like, but are not limited thereto. The size of the labeling substance may be such that it does not prevent the nucleic acid amplification product from being captured on a solid phase carrier described later. The labeling substance is preferably one that develops color well during detection, and can be appropriately selected so that it has a size smaller than the pore size of the solid phase carrier described later and various porous members of the nucleic acid detection device equipped with the solid phase carrier. For example, the size of the labeling substance can be approximately 500 nm or less, preferably approximately 0.1 nm to 250 nm, and more preferably approximately 1 nm to 100 nm. As the dye, fluorescent dyes (fluorescein, cyanine, etc.) can also be used, and in that case, it is preferable to detect the dye by irradiating it with light of the excitation wavelength of the fluorescent dye.

[0038] The labeling tag that can be used as the labeling part is not particularly limited as long as it can bind to the labeling substance and can be appropriately selected depending on the structure of the labeling substance. For example, a tag made of a nucleic acid (DNA, RNA, etc.), a protein, a peptide, or other compounds (for example, low molecular weight compounds such as biotin, fluorescein isothiocyanate (FITC), digoxigenin (DIG)), or a combination thereof can be used. One preferred form of the labeling tag is one that contains a polynucleotide or consists of a polynucleotide. The polynucleotide that can be contained in the labeling tag is not particularly limited as long as it does not substantially interfere with the nucleic acid amplification reaction using the primer set of the present invention, and is, for example, a polynucleotide having a base number of 5 to 50, preferably 10 to 35, and more preferably, a polynucleotide containing (or consisting of) the base sequence shown in SEQ ID NO: 7 or a partial base sequence thereof, or a complementary base sequence thereof can be used. Another preferred form of the labeling tag is one made of a low molecular weight compound such as biotin, FITC, DIG, etc. When the labeling part is the above-mentioned labeling tag, the binding between the labeling substance and the labeling tag may be direct or indirect, and the binding means may be appropriately selected according to the combination of the labeling substance and the labeling tag to be used. For example, when the labeling tag contains a polynucleotide, the labeling substance can be indirectly bound to the labeling tag by binding the labeling substance to a polynucleotide capable of hybridizing to the polynucleotide (for example, a polynucleotide containing a sequence complementary to the base sequence of the polynucleotide) and hybridizing the two polynucleotides. The binding between the labeling substance and the polynucleotide may be performed via a peptide, a protein, a nucleic acid, or the like, or via an appropriate functional group. The hybridization conditions are not particularly limited as long as they are conditions under which hybridization occurs, and can be performed, for example, by reacting at 20°C to 40°C in a buffer solution (pH 6 to 7) containing 10 mM to 50 mM phosphate. In order to increase the hybridization efficiency, the buffer solution may further contain a salt such as sodium chloride.

[0039] Furthermore, when the labeling tag is a low molecular weight compound, it can be labeled with a labeling substance linked to a binding substance such as a protein that specifically binds to it (e.g., avidin that binds to biotin, or a protein that binds to FITC), an antibody (e.g., an anti-DIG antibody), an aptamer, etc. In this case, the labeling tag and the binding substance can be bound to each other using various near-neutral buffer solutions.

[0040] The labeling portion (labeling tag or labeling substance) can be bound to the polynucleotide contained in the forward primer or the polynucleotide contained in the reverse primer by any means, and can be bound directly or indirectly. However, when at least the portion of the labeling portion that is connected to the polynucleotide is made of a polynucleotide, the polynucleotide is bound to the labeling portion via a spacer that can suppress or stop the progress of the DNA polymerase reaction so that the portion is not double-stranded together with the polynucleotide by the nucleic acid amplification reaction. Such a "spacer" may be any that can inhibit or stop the progress of a DNA polymerase reaction and prevent double-stranded formation of the labeled moiety, and examples thereof include, but are not limited to, a nucleic acid sequence having a strong hairpin structure or pseudoknot structure, L-type nucleic acid, peptide nucleic acid (PNA), bridged nucleic acid (Bridged Nucleic Acid (BNA) or Locked Nucleic Acid (LNA)), fluorescein, Cy3, Cy5, a divalent group containing an azobenzene structure represented by formula I, an aliphatic chain (alkylene chain or polyoxyalkylene chain), a divalent group containing an inverted sequence structure such as a 5'-5' bond or a 3'-3' bond, and the like.

[0041] [ka]

[0042] When two polynucleotide molecules are connected via a divalent group represented by formula I, the phosphate group at one end of the divalent group refers to the phosphate group of the 3'- or 5'-terminal nucleotide of one polynucleotide molecule, and the oxygen atom at the other end forms a phosphate ester bond with the phosphate group of the 3'- or 5'-terminal nucleotide of the other polynucleotide molecule.

[0043] An example of the aliphatic chain spacer is a spacer represented by the following formula (II). -OC m H 2m -O- Formula (II) (In the formula, the oxygen atom at one end represents an oxygen atom of a phosphodiester bond at the 3'-end or 5'-end of one polynucleotide molecule, the oxygen atom at the other end represents an oxygen atom of a phosphodiester bond at the 3'-end or 5'-end of the other polynucleotide molecule, and m represents an integer of 1 to 40. H may be substituted with a substituent.)

[0044] In formula (II), m is preferably 2 or more and 36 or less, more preferably 3 or more and 16 or less. H in formula (II) may be substituted with a substituent, and typical examples of the substituent include an alkyl group, an alkoxy group, and a hydroxyl group. The number of carbon atoms in the alkyl group and alkoxy group as the substituent is preferably 1 to 8, more preferably 1 to 4. When the compound has two or more substituents, the substituents may be the same or different. Furthermore, it is also preferable that the compound has no substituent.

[0045] Other spacers include a spacer represented by the following formula (III). -(OC n H 2n ) L -O- Formula (III) (In the formula, the oxygen atom at one end represents an oxygen atom of a phosphodiester bond at the 3'-end or 5'-end of one polynucleotide molecule, and the oxygen atom at the other end represents an oxygen atom of a phosphodiester bond at the 3'-end or 5'-end of the other polynucleotide molecule, n represents an integer of 2 or more and 4 or less, L represents an integer of 1 or more, and (n+1)×L represents an integer of 40 or less. H may be substituted with a substituent.) In formula (III), (n+1)×L is preferably 2 or more and 36 or less, more preferably 3 or more and 16 or less. The same embodiments as those of the substituents in formula (II) are applied to the substituents of H in formula (III).

[0046] Other aliphatic chain spacers include, for example, the following divalent groups: [ka]

[0047] When two polynucleotide molecules are connected via these divalent groups, the phosphate group at one end of each divalent group points to a phosphate group in the 3'- or 5'-terminal nucleotide of one polynucleotide molecule, and the oxygen atom at the other end forms a phosphate ester bond with the phosphate group in the 5'- or 3'-terminal nucleotide of the other polynucleotide molecule.

[0048] <Binding moiety and solid phase carrier> The binding portion is a tag capable of binding to a solid phase carrier, which will be described later. In this specification, a tag capable of binding to a solid phase carrier may be referred to as an immobilization tag. The immobilization tag that can be used as a binding part is not particularly limited as long as it can bind to a solid phase carrier and can be appropriately selected depending on the structure of the solid phase carrier. For example, a polynucleotide (DNA, RNA, etc.), a protein, a peptide, or other compound (for example, a low molecular weight compound), or a combination thereof can be used. The immobilization tag preferably contains a polynucleotide or consists of a polynucleotide. The polynucleotide that can be contained in the immobilization tag is not particularly limited as long as it does not substantially interfere with the nucleic acid amplification reaction using the primer set of the present invention, and is, for example, a polynucleotide having a base number of 5 to 50, preferably 10 to 35, and more preferably, a polynucleotide containing (or consisting of) the base sequences shown in SEQ ID NOs: 8 to 10, or partial base sequences thereof, or complementary base sequences thereof can be used.

[0049] When the primer set of the present invention includes two or three of the first primer set, the second primer set, and the third primer set, it is preferable that the immobilization tags linked to one primer of each primer set can be bound to different positions on the solid support. For example, when the immobilization tags are polynucleotides, they are preferably designed to be non-homologous and hybridize to different polynucleotides.

[0050] The solid phase carrier is not particularly limited, and may be made of resin, metal, polysaccharide, mineral, etc., and may be in the form of a membrane, film, nonwoven fabric, plate, gel, etc. Preferably, the solid phase carrier has a porous structure so that the nucleic acid amplification product or labeling substance in the solution can be developed. Examples of solid phase carriers that can be used in the present invention include filter paper, nitrocellulose membrane, polyethersulfone membrane, nylon membrane, various dried gels (silica gel, agarose gel, dextran gel, gelatin gel), silicon, glass, plastic, etc. The size and shape of the solid phase carrier can be appropriately selected from those suitable for various operations and detection.

[0051] The solid phase carrier may be configured so that at least a portion thereof can bind to the tag for immobilization, and more preferably, only a portion thereof can bind to the tag for immobilization. By configuring only a specific portion of the solid phase carrier to be capable of binding to the tag for immobilization, the nucleic acid amplification product captured by the solid phase carrier is detected only in that portion, making it easy to distinguish between positive and negative.

[0052] The binding between the solid phase carrier and the tag for immobilization may be direct or indirect, and the binding means can be appropriately selected according to the combination of the solid phase carrier and the tag for immobilization used. For example, when the tag for immobilization contains a polynucleotide, a polynucleotide capable of hybridizing to the polynucleotide (e.g., a polynucleotide containing a sequence complementary to the base sequence of the polynucleotide) is immobilized on the solid phase carrier to serve as a tag capture means, and the solid phase carrier and the tag for immobilization can be indirectly bound by hybridizing the two polynucleotides. The immobilization of the polynucleotide on the solid phase carrier may be performed via a peptide, a protein, a nucleic acid, or the like, or via an appropriate functional group. The hybridization conditions can be the same as those described above for the binding between the labeling tag and the labeling substance. When the polynucleotide is immobilized on the solid phase carrier, the immobilization is limited to a specific portion, so that the captured nucleic acid amplification product is detected only in a specific portion, making it easy to distinguish between positive and negative.

[0053] In particular, when the primer set of the present invention includes two or three of the first primer set, the second primer set, and the third primer set, the solid phase carrier for detecting the reaction product of the nucleic acid amplification reaction preferably holds different tag capture means at different positions. For example, when the tags for immobilization are polynucleotides that are not homologous to each other, it is preferable that polynucleotides capable of specifically hybridizing to one polynucleotide of the tags for immobilization are held as tag capture means at different positions on the solid phase carrier.

[0054] The binding portion (fixation tag) and the polynucleotide contained in the forward primer or the polynucleotide contained in the reverse primer can be bound by any means, and can be bound directly or indirectly. However, when at least the portion of the fixation tag that is connected to the polynucleotide is made of a nucleic acid, the polynucleotide and the fixation tag are bound via a spacer that can suppress or stop the progress of the DNA polymerase reaction so that the portion is not double-stranded together with the polynucleotide by the nucleic acid amplification reaction. Specific examples of the spacer provided between the binding portion and the polynucleotide are the same as those described above for the spacer provided between the labeling portion and the polynucleotide. SEQ ID NOs: 7 to 10 are shown in Table 2.

[0055] [Table 2]

[0056] <Detection target> The target sample in the present invention may be any sample that may contain Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, or Mycobacteroides abscessus subsp. massiliense, and examples of such samples include samples containing parts of living organisms such as animals and plants (organs, tissues, cells, etc.), feces, body fluids (blood, saliva, urine, sputum, lymph, etc.), foods and beverages, microbial cultures, products of nucleic acid amplification reactions, etc. The genus Mycobacteroides may also be referred to as the genus Mycobacterium.

[0057] The polynucleotide to be detected may be a naturally occurring polynucleotide, or may be a polynucleotide artificially prepared from a naturally occurring polynucleotide. Examples of such polynucleotides include genomic DNA, mRNA transcribed from the genomic DNA, cDNA prepared from the mRNA, and nucleic acid amplification products obtained by amplifying these polynucleotides, and genomic DNA or its nucleic acid amplification products are particularly preferred. The terms genomic DNA, mRNA, cDNA, and the like also include fragments thereof. The polynucleotide to be detected may be present in a sample in the form of a double strand.

[0058] <Detection method using the primer set of the present invention> One embodiment of the detection method of the present invention includes step 1 of performing a nucleic acid amplification reaction using a primer set of the present invention including one or more of the first primer set, the second primer set, and the third primer set, using a polynucleotide in a sample as a template, and step 2 of analyzing the presence or absence of a nucleic acid amplification product amplified by the nucleic acid amplification reaction.

[0059] The polynucleotide used as a template in step 1 is typically DNA. The polynucleotide may be in a form extracted from a sample and purified, or may be in a form extracted from a sample and roughly purified. Alternatively, if the sample contains polynucleotides at a relatively high concentration, such as a part of a cell or tissue, the sample itself may be included in the nucleic acid amplification reaction as it is.

[0060] The nucleic acid amplification reaction in step 1 can be carried out according to an isothermal nucleic acid amplification method such as the PCR method, the RPA method, the HDA method, the ICAN method, the LAMP method, etc. In other words, assuming the presence of a polynucleotide derived from Mycobacteroides abscessus complex, the nucleic acid amplification reaction can be carried out under reaction conditions such that a fragment of a predetermined target region is amplified when the nucleic acid amplification reaction is carried out using the primer set of the present invention.

[0061] As an example, the DNA polymerase used in PCR is not particularly limited as long as it is a heat-resistant DNA polymerase. In the present invention, a commercially available DNA polymerase can be used, and for example, TaKaRa Ex Taq (registered trademark) can be preferably used. In addition, the temperature, time, composition of the buffer solution, etc. can be appropriately selected depending on the DNA polymerase used, the concentration of each primer, etc.

[0062] The hot start PCR method is useful because it is expected to have the effect of suppressing the formation of primer dimers. The hot start PCR method can be performed using commercially available hot start PCR reagents such as TaKaRa Ex Taq (registered trademark) Hot Start Version (Takara Bio). In addition, TaKaRa Taq HS PCR Kit, UNG plus (registered trademark) can also be used, and the use of this kit is expected to have the effect of suppressing carryover contamination of nucleic acid amplification products.

[0063] The number of cycles in the PCR method is preferably 25 or more, more preferably 30 or more. The upper limit of the number of cycles is not particularly limited, but is usually 60 or less, preferably 50 or less.

[0064] The primer concentration at the start of the PCR reaction system is not particularly limited, and can be adjusted appropriately depending on the polynucleotide used as the template. The preferred primer concentration at the start of the reaction in the reaction system is 0.05 μM or more and 1.0 μM or less for the forward primer and the reverse primer. If it is less than 0.05 μM, the detection sensitivity may decrease, resulting in a decrease in the standard detection sensitivity. The upper limit of the primer concentration is not particularly limited, but is preferably 1.0 μM.

[0065] In step 1, when a sample contains a polynucleotide derived from Mycobacteroides abscessus complex, a nucleic acid amplification product containing a predetermined target region is generated as a specific nucleic acid amplification product.

[0066] In step 2, the presence or absence of a nucleic acid amplification product amplified by the nucleic acid amplification reaction in step 1 is analyzed. Step 2 may be performed simultaneously with step 1, or may be performed after step 1 is completed.

[0067] The detection method in step 2 is not particularly limited. For example, the nucleic acid amplification reaction in step 1 may be carried out in the presence of a fluorescent dye that binds to double-stranded DNA, such as SYBR Green I, and the presence or absence of a nucleic acid amplification product may be analyzed using an increase in fluorescence intensity indicating that nucleic acid amplification has occurred by the primer set of the present invention as an indicator. In addition, the nucleic acid amplification reaction in step 1 may be carried out in the presence of a probe in which a reporter fluorescent substance is linked to the 5' end of a polynucleotide and a quencher dye is linked to the 3' end, and the presence or absence of a nucleic acid amplification product may be analyzed using fluorescence indicating that a nucleic acid amplification product containing a predetermined target region is generated as an indicator. In addition, after completion of step 1, a method in which a labeled polynucleotide probe specific to a nucleic acid amplification product containing a predetermined target region is hybridized to the reaction solution of the nucleic acid amplification reaction or its product to detect the complex can be exemplified. In addition, when one of the forward primer and the reverse primer of the primer set of the present invention further contains a labeling portion that is a tag or a labeling substance that can be bound to a labeling substance, and the other further contains a binding portion that is a tag that can be bound to a solid phase carrier, the following detection step using a solid phase carrier can be carried out as step 2.

[0068] <Detection step using solid phase carrier> In this detection step, the product of the nucleic acid amplification reaction in step 1 is contacted with a solid phase carrier that contains, at least in part, a portion capable of binding to the binding moiety, and the nucleic acid amplification product at the portion of the solid phase carrier is detected using the labeling portion as an indicator.

[0069] When the labeling part is the above-mentioned labeling tag, a labeling step of binding a labeling substance to the labeling tag may be further carried out. The labeling step will be described in detail later. When the labeling part is the above-mentioned labeling substance, the labeling step is not necessary. In the detection step, "using the labeling part as an indicator" refers to detecting the nucleic acid amplification product using the labeling substance bound through the labeling step as an indicator when the labeling part is a labeling tag, and refers to detecting the nucleic acid amplification product using the labeling substance as an indicator when the labeling part is a labeling substance. The product of the nucleic acid amplification reaction refers to the reaction solution of the nucleic acid amplification reaction which may contain the amplification product, or a sample obtained by further increasing the concentration of the nucleic acid amplification product from the reaction solution. The details of the solid phase carrier are as described above.

[0070] The contact of the product with the binding moiety of the solid phase carrier and the binding moiety may be carried out under appropriately adjusted conditions (e.g., hybridization conditions or buffer conditions of about pH 5 to 9) depending on the combination of the solid phase carrier and the binding moiety so that, when a nucleic acid amplification product is contained in the product, the binding moiety of the nucleic acid amplification product binds to the binding moiety.

[0071] The detection of the nucleic acid amplification product can be carried out by detecting, preferably visually detecting, the labeling substance bound to the nucleic acid amplification product captured on the solid phase carrier. When the nucleic acid amplification product is present, the labeling substance of the nucleic acid amplification product captured and bound to the solid phase carrier is detected. Using the presence or absence of such detection as an indicator, it is possible to determine the presence or absence of a nucleic acid amplification product (a nucleic acid amplification product containing a target region) in the reaction system of the nucleic acid amplification reaction, and also to determine the presence or absence of Mycobacteroides abscessus complex and / or polynucleotides derived from Mycobacteroides abscessus complex in the sample.

[0072] <Labeling process> The labeling step is a step carried out when the labeling portion contained in the primer set of the present invention is the above-mentioned labeling tag, and is carried out by contacting the product of the nucleic acid amplification reaction with a labeling substance and binding the labeling substance to the labeling tag. The labeling step may be carried out before or after contacting the product of the nucleic acid amplification reaction with the solid phase carrier, or may be carried out simultaneously with the contact.

[0073] The labeling substance may be contacted with the product under appropriately adjusted conditions (e.g., the hybridization conditions described above, or buffer conditions at a pH of about 5 to 9) depending on the combination of the labeling substance and the labeling tag, such that the labeling substance binds to the labeling tag of the nucleic acid amplification product if the product contains the nucleic acid amplification product.

[0074] <Detection device> The above-mentioned detection step and labeling step can be performed using a nucleic acid detection device that utilizes nucleic acid chromatography. By using the nucleic acid detection device, the presence or absence of a nucleic acid amplification product (a nucleic acid amplification product containing a target region) in a reaction system of a nucleic acid amplification reaction can be detected and determined without requiring a special device, and the results can be obtained easily and quickly.

[0075] The nucleic acid detection device may be a known nucleic acid detection device (WO2012 / 070618) that is used to detect a labeled nucleic acid amplification product by nucleic acid chromatography.

[0076] 1 and 2 are schematic diagrams of an embodiment of a nucleic acid detection device that can be used in the present invention, but the nucleic acid detection device is not limited to this embodiment. In the following description, the reference numerals given to the respective members correspond to the reference numerals shown in FIG. 1 and FIG.

[0077] The nucleic acid detection device 10 in FIG. 1 is formed by arranging a sample pad 3, which is a reaction system receiving part for receiving a reaction system of a nucleic acid amplification reaction, a conjugate pad 2 for holding a labeling substance, a porous solid phase carrier 1 including a part 6 capable of binding to a binding part contained in a nucleic acid amplification product, and an absorbent pad 4 on a base material 5 so that they are in contact with each other in this order. The part 6 of the solid phase carrier 1 is a part where a means for capturing a nucleic acid amplification product (capturing means) (for example, the above-mentioned oligonucleotide, etc.) is locally arranged and immobilized. Although not shown, the surface of the solid phase carrier 1 may be covered with a film. The sample pad 3, the conjugate pad 2, the solid phase carrier 1, and the absorbent pad 4 can be composed of a member having a porous structure that can be used as the above-mentioned solid phase carrier. These may be composed of the same material, or may be composed of different materials. The base material 5 may be any material that can support various members arranged thereon and facilitates the operation of the nucleic acid detection device, and may be made of, for example, a material made of a resin, metal, mineral, etc. When a labeling substance is mixed into the developing solution or when the labeling part is a labeling substance, the conjugate pad 2 can be omitted.

[0078] The reaction system of the nucleic acid amplification reaction obtained in step 1 is added to the sample pad 3. The reaction system may be added as it is, or may be added together with an appropriate developing solution (e.g., phosphate buffer, Tris buffer, Good's buffer, SSC buffer). The developing solution may further contain a surfactant, salt, protein, nucleic acid, etc., as necessary. The reaction system added to the sample pad 3 develops from upstream to downstream by the capillary phenomenon in the direction shown by the arrow in FIG. 1.

[0079] In another embodiment, the nucleic acid detection device can be placed in a container (e.g., a PCR tube, an Eppendorf tube, a 96-well plate, etc.) holding the product of the nucleic acid amplification reaction and / or the developing solution, and the sample pad 3 can be immersed in the product of the nucleic acid amplification reaction and / or the developing solution. In this case, the width of the sample pad 3 is preferably 2.0 to 10.0 mm, more preferably 2.0 to 5.0 mm, so that the sample pad 3 can be placed in the container holding the product of the nucleic acid amplification reaction and / or the developing solution.

[0080] In an embodiment in which the labeling portion is a labeling tag, the nucleic acid amplification product in the reaction system comes into contact with the labeling substance as it passes through the conjugate pad 2 on which the labeling substance is retained, and is labeled with the labeling substance via the labeling tag.

[0081] Next, the nucleic acid amplification product in the reaction system comes into contact with the capture means immobilized on the portion 6 as it passes through the solid phase carrier 1, and is captured and bound to the solid phase carrier 1 via the immobilization tag.

[0082] When a target nucleic acid is present in a sample, a labeling substance bound to the nucleic acid amplification product captured and bound to portion 6 of solid phase carrier 1 containing a capture means is detected in portion 6. If the labeling substance can be visually confirmed, portion 6 will develop a color due to the labeling substance. The presence or absence of the target nucleic acid in a sample can be determined using the presence or absence of detection (coloration) of the labeling substance as an indicator.

[0083] There may be one or more portions 6, and multiple types of nucleic acid amplification products may be detected at separate portions 6. For example, in the example of a nucleic acid detection device 10 shown in Fig. 2, the portion 6 of the solid phase carrier 1 is composed of three portions 61, 62, and 63 at different positions, and a means for capturing the nucleic acid amplification product (capture means) (e.g., the above-mentioned oligonucleotide, etc.) is locally arranged and immobilized on each portion. Although not shown, when there are two types of nucleic acid amplification products to be detected, a nucleic acid detection device including a solid phase carrier having a capture means retained on two different portions can be used.

[0084] <Detection method using a probe> Another aspect of the detection method of the present invention includes step 3 of incubating a polynucleotide in a sample or a nucleic acid amplification product amplified by a nucleic acid amplification reaction using a polynucleotide in a sample as a template with a probe that hybridizes with the nucleic acid amplification product under conditions allowing hybridization, and step 4 of detecting hybridization between the polynucleotide or the nucleic acid amplification product and the probe.

[0085] In step 3, the nucleic acid amplification product amplified by carrying out a nucleic acid amplification reaction using a polynucleotide in a sample as a template is the nucleic acid amplification product obtained in the nucleic acid amplification reaction in step 1 above using the primer set of the present invention. The "hybridizable conditions" in step 3 refer to conditions under which a specific hybrid is formed and a non-specific hybrid is not formed, as described, for example, in Green and Sambrook, Molecular Cloning 4. th Ed (2012), Cold Spring Harbor Laboratory Press. Specific examples of stringent conditions include those similar to the "stringent conditions" described above in <Terminology>. In step 4, the means for detecting hybridization between the polynucleotide or the nucleic acid amplification product and the probe is not particularly limited.

[0086] For example, when the probe has the labeling moiety, the unreacted probe can be removed from the reaction mixture after the incubation in step 3, and the complex between the polynucleotide or the nucleic acid amplification product and the probe can be detected using the label from the labeling moiety as an indicator. When the labeling moiety is a labeling tag, a labeling step of adding a labeling substance may be carried out as necessary.

[0087] Furthermore, when the probe has the binding moiety, a complex between the polynucleotide or the nucleic acid amplification product and the probe can be immobilized on a solid support via the binding moiety, and then the complex on the solid support can be detected by an appropriate means. The probe containing the binding moiety may be provided in a state in which it has been immobilized on a solid support via the binding moiety in advance.

[0088] <Kit> The present invention also provides The present invention relates to a kit for detecting a polynucleotide derived from Mycobacteroides abscessus complex, comprising the primer set of the present invention. The kit can be used in the detection method of the present invention.

[0089] The kit of the present invention may further include various reagents for nucleic acid amplification reactions (e.g., DNA polymerase, nucleic acid amplification reaction buffer, dNTPs, etc.), various reagents for incubation (incubation buffer), standard substances for quality control, and internal standard substances for ensuring that operations and equipment are normal.

[0090] When the primer set of the present invention has the above-mentioned binding portion, the kit of the present invention can further include a solid phase carrier having at least a portion capable of binding to the above-mentioned binding portion. A specific example of the solid phase carrier is particularly preferably the above-mentioned detection device.

[0091] When the primer set of the present invention contains the labeling moiety and the labeling moiety is a labeling tag, it is preferable that the kit of the present invention further contains a labeling substance for labeling the labeling tag. EXAMPLES

[0092] A first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 was designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. abscessus.

[0093] A second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 was designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. bolletii.

[0094] A third primer set consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 was designed to specifically amplify DNA derived from Mycobacteroides abscessus subsp. massiliense.

[0095] A verification experiment was carried out to confirm whether these first to third primer sets can specifically amplify the target bacterial species. The verification method involved carrying out an amplification reaction by PCR using a PCR solution containing the primer set of the present invention, and analyzing the presence or absence of a nucleic acid amplification product to confirm that a correct nucleic acid amplification product was obtained. It was also confirmed that the Mycobacteroides abscessus complex subspecies could be appropriately identified and detected based on the presence or absence of a nucleic acid amplification product. Specific examples will be described in Examples 1 and 2.

[0096] <Example 1> The following PCR reaction solution was prepared according to the TaKaRa TaqHS perfect Mix manual, using primers consisting of SEQ ID NOs: 1 to 6 listed in Table 1. The primers used were a combination of SEQ ID NOs: 1 and 2 as the first primer set, a combination of SEQ ID NOs: 3 and 4 as the second primer set, and a combination of SEQ ID NOs: 5 and 6 as the third primer set.

[0097] [Table 3]

[0098] The templates used were purified genomic DNA prepared from Mycobacteroides abscessus subsp. abscessus ATCC19977, Mycobacteroides abscessus subsp. bolletii BD, and Mycobacteroides abscessus subsp. massiliense JCM15300. As a negative control, a PCR reaction solution of the same composition was prepared, except that 1 μl of sterile distilled water was used instead of the template DNA solution. The 5 μM primer solution was prepared by dissolving a given primer in sterile distilled water to a concentration of 5 μM.

[0099] The PCR reaction solution was placed in a real-time PCR device (Roche, LightCycler 96) and reacted at 94°C for 1 minute, after which a cycle of 94°C-5 seconds / 60°C-10 seconds / 72°C-15 seconds was repeated 50 times. The Cp value results are shown in Table 4.

[0100] [Table 4]

[0101] In the test using the first primer set, nucleic acid amplification was confirmed only when genomic DNA derived from Mycobacteroides abscessus subsp. abscessus was used as a template. In the test using the second primer set, nucleic acid amplification was confirmed only when genomic DNA derived from Mycobacteroides abscessus subsp. bolletii was used as a template. In the test using the third primer set, nucleic acid amplification was confirmed only when genomic DNA derived from Mycobacteroides abscessus subsp. massiliense was used as a template. In all cases using the primer sets, no nucleic acid amplification products were confirmed in the negative control. This confirmed that the three subspecies of Mycobacteroides abscessus complex can be identified and detected based on the presence or absence of nucleic acid amplification products corresponding to each primer set. In addition, the size of the nucleic acid amplification products was confirmed by agarose gel electrophoresis. When the first primer set was used with genomic DNA derived from Mycobacteroides abscessus subsp. abscessus as a template, a nucleic acid amplification product of 102 bp was observed. When the second primer set was used with genomic DNA derived from Mycobacteroides abscessus subsp. bolletii as a template, a nucleic acid amplification product of 122 bp was observed. When the third primer set was used with genomic DNA derived from Mycobacteroides abscessus subsp. massiliense as a template, a nucleic acid amplification product of 88 bp was observed.

[0102] <Comparative Example> The primer set described in JP 2019-97493 A (first primer: forward primer gttcggatcgcatggcgttgtgctg, reverse primer gggatgctgtgatcgaggtcggc, second primer: forward primer gagggcacgggagagaccaccggag, reverse primer ccatttcYctatcYcgcccg (Y is c or t)) was used under the same conditions as in Example 1. As a result, when genomic DNA derived from all Mycobacteroides abscessus complex subspecies (Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, Mycobacteroides abscessus subsp. massiliense) was used as a template, a nucleic acid amplification product was confirmed, and subspecies discrimination based only on the presence or absence of a nucleic acid amplification product was not possible, and for identification and detection, analysis of the size of the nucleic acid amplification product by agarose gel electrophoresis or the like was required.

[0103] [Table 5]

[0104] <Example 2> A nucleic acid chromatography detection system for detecting multiplex-PCR products was constructed using primers containing SEQ ID NOs: 1 to 6 at the 3' end, as shown in Table 1. It was confirmed that this detection system can be used to distinguish and detect the three subspecies of Mycobacteroides abscessus complex.

[0105] (I) Primer structure To accommodate detection by nucleic acid chromatography, DNA consisting of the following tag sequence was linked to the 5' end of each primer via a divalent group represented by formula I above, which contains an azobenzene structure that inhibits polymerase reaction. At this time, a phosphate bond is formed between the end on the oxygen atom side (5' end) of the divalent group containing the azobenzene structure shown in formula I above and the phosphate group of the 3'-terminal nucleotide of the DNA consisting of the tag sequence, and a phosphate bond is formed between the end on the phosphate group side (3' end) of the divalent group and the hydroxyl group at the 5' position of deoxyribose of the 5'-terminal nucleotide of the primer portion of the primer.

[0106] An immobilization tag sequence of SEQ ID NO: 9 was added to the 5' end of the primer containing SEQ ID NO: 1 via an azobenzene structure. A labeling tag sequence of SEQ ID NO: 7 was added to the 5' end of the primer containing SEQ ID NO: 2, a labeling tag sequence of SEQ ID NO: 7 was added to the 5' end of the primer containing SEQ ID NO: 3, an immobilization tag sequence of SEQ ID NO: 10 was added to the 5' end of the primer containing SEQ ID NO: 4, an immobilization tag sequence of SEQ ID NO: 8 was added to the 5' end of the primer containing SEQ ID NO: 5, and a labeling tag sequence of SEQ ID NO: 7 was added to the 5' end of the primer containing SEQ ID NO: 6.

[0107] The primer combination including SEQ ID NOs: 1 and 2 was used as the first primer set, the primer combination including SEQ ID NOs: 3 and 4 was used as the second primer set, and the primer combination including SEQ ID NOs: 5 and 6 was used as the third primer set.

[0108] (II) Preparation of oligonucleotide-bound gold colloids Gold Colloid (40 nm, 9.0×10 10 (particle number / ml, British Biocell International) was mixed with the thiol group-containing oligonucleotide shown in SEQ ID NO:11 in Table 6 and incubated at 50° C. for 16 hours. The mixture was centrifuged at 6000 rpm for 15 minutes, the supernatant was removed, 0.05 M sodium chloride and 5 mM phosphate buffer (pH 7) were added and mixed, and then incubated again at 50° C. for 40 hours.

[0109] After incubation, centrifugation (6000 rpm, 15 minutes) was performed, the supernatant was removed, and 5 mM phosphate buffer (pH 7) was added. This buffer replacement was performed again. The prepared gold colloid solution was added uniformly to a glass fiber pad, and then dried in a vacuum dryer to obtain a conjugate pad.

[0110] (Thioyl-containing oligonucleotides) The thiol group-containing oligonucleotide is an oligonucleotide of SEQ ID NO: 11, and has a phosphate group at the 3' position of the 3' end and HO-(CH2) m It is bonded to the hydroxyl group of a compound represented by -SH (m is 6) through a phosphate ester bond.

[0111] (III) Preparation of a membrane with an immobilized tag capture means As tag capture means, a solution containing oligonucleotide probe 1 represented by SEQ ID NO: 12 in Table 6, a solution containing oligonucleotide probe 2 represented by SEQ ID NO: 13, and a solution containing oligonucleotide probe 3 represented by SEQ ID NO: 14 were applied to a nitrocellulose membrane (Hi-Flow180) manufactured by Merck Millipore in a line shape of 1 mm width perpendicular to the development direction using a dispenser. The membrane was then dried at 40°C for 30 minutes to obtain a membrane equipped with a tag capture means. The line coated with oligonucleotide probe 1 represented by SEQ ID NO: 12 was set as T1 line, the line coated with oligonucleotide probe 2 represented by SEQ ID NO: 13 as T2 line, and the line coated with oligonucleotide probe 3 represented by SEQ ID NO: 14 as T3 line.

[0112] [Table 6]

[0113] (IV) Preparation of a lateral flow type nucleic acid detection device The lateral flow type nucleic acid detection device was produced in accordance with the detection device shown in the schematic diagram of FIG. That is, a polypropylene backing sheet (Lohmann) was used as the substrate 5, a conjugate pad prepared in (II) above was used as the conjugate pad 2, a membrane (solid phase carrier) 1 provided with the oligonucleotide probes 1, 2, and 3 prepared in (III) above as tag capture means in three parts 61, 62, and 63, respectively, a glass fiber sample pad was used as the sample pad 3, and a cellulose absorbent pad was used as the absorbent pad 4. These were laminated together as shown in Fig. 2 to prepare a lateral flow type nucleic acid detection device 10. The part 61 holding the oligonucleotide probe 1 was designated as the T1 line, the part 62 holding the oligonucleotide probe 2 was designated as the T2 line, and the part 63 holding the oligonucleotide probe 3 was designated as the T3 line.

[0114] (V) multiplex-PCR The above first to third primer sets were used to prepare the following PCR reaction mixture according to the TaKaRa TaqHS perfect Mix manual.

[0115] [Table 7]

[0116] The template DNA used was DNA purified from the acid-fast bacteria species listed in Table 8 (Tables 8-1 and 8-2). As a negative control, a PCR reaction solution of the same composition was prepared, except that 1 μL of sterile distilled water was used instead of the template DNA solution. The 5 μM Fw primer solution and 5 μM Rv primer solution were prepared by dissolving the designated primers in sterile distilled water to a concentration of 5 μM.

[0117] The PCR reaction solution was placed in a real-time PCR device (LightCycler 96, Roche) and reacted at 94°C for 1 minute, after which a cycle of 94°C-5 seconds / 60°C-10 seconds / 72°C-15 seconds was repeated 35 times. The results are shown in Table 8.

[0118] The Mycobacteroides abscessus complex subspecies used in the study were identified separately using next-generation sequencing (NGS) analysis (Lipworth S, et al. Antimicrob Agents Chemother. 2018;63 pii: e01204-18. doi: 10.1128 / AAC.01204-18.).

[0119] (VI) Detection using a nucleic acid chromatography detection system The reaction solution after PCR under the above conditions was applied to a lateral flow type nucleic acid detection device 10 to attempt detection of the nucleic acid amplification product. Specifically, 5 μL of the reaction solution after PCR was added to the sample pad 3 on the device 10, and 80 μL of a developing solution (citric acid buffer containing a surfactant) was further added to develop the reaction solution. After 10 minutes at room temperature, the presence or absence of coloring of the T1, T2, and T3 lines of the portions 61, 62, and 63 including the tag capture means immobilized in a line shape on the membrane 1 was visually confirmed.

[0120] Confirmation of coloration of the T1 line indicates that a nucleic acid amplification product derived from Mycobacteroides abscessus subsp. massiliense has been obtained, confirmation of coloration of the T2 line indicates that a nucleic acid amplification product derived from Mycobacteroides abscessus subsp. abscessus has been obtained, and confirmation of coloration of the T3 line indicates that a nucleic acid amplification product derived from Mycobacteroides abscessus subsp. bolletii has been obtained. The results are shown in Table 8. In Table 8, if coloration was observed, it is indicated as "+", and if coloration was not observed, it is indicated as "-".

[0121] [Table 8-1]

[0122] [Table 8-2]

[0123] As a result of the test, it was confirmed that the constructed chromatographic detection system can appropriately identify and detect Mycobacteroides abscessus subsp. abscessus, Mycobacteroides abscessus subsp. bolletii, and Mycobacteroides abscessus subsp. massiliense solely based on the presence or absence of nucleic acid amplification products corresponding to each primer set, and that there was no cross-reaction with other mycobacterial species. [Industrial Applicability]

[0124] The primer set, kit, and method of the present invention are useful as a simple method for identifying and detecting subspecies of Mycobacteroides abscessus complex. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

1. A primer set for distinguishing and detecting Mycobacteroides abscessus abscessus from Mycobacteroides abscessus bolletii and Mycobacteroides abscessus massiliense, comprising: A polynucleotide having the following (a) or (d) at its 3' end: (a) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (d) a polynucleotide consisting of a base sequence in which thymine (T) at any position in the base sequence of SEQ ID NO: 1 is replaced with uracil (U); A forward primer (A) comprising A polynucleotide having the following structure (e) or (h) at the 3' end: (e) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (h) A polynucleotide consisting of the base sequence of SEQ ID NO: 2 in which thymine (T) at any position is replaced with uracil (U). and a reverse primer (B) comprising the first primer set:

2. The primer set according to claim 1, wherein one of the forward primer and the reverse primer further comprises a labeling portion which is a tag or a labeling substance capable of binding to a labeling substance, and the other further comprises a binding portion which is a tag capable of binding to at least a portion of a solid phase carrier.

3. A kit for distinguishing and detecting Mycobacteroides abscessus abscessus from Mycobacteroides abscessus boreti and Mycobacteroides abscessus massiliens, comprising the primer set described in claim 2 and a solid phase support having at least a portion capable of binding to the binding portion.

4. A method for detecting and distinguishing Mycobacteroides abscessus abscessus from Mycobacteroides abscessus boreti and Mycobacteroides abscessus massiliens by analyzing the presence or absence of a nucleic acid amplification product obtained using the primer set described in claim 1 or 2.

5. A primer set for distinguishing and detecting Mycobacteroides abscessus bolletii from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus massiliense, A polynucleotide having the following (i) or (l) at the 3' end: (i) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (l) A polynucleotide consisting of a base sequence in which thymine (T) at any position in the base sequence of SEQ ID NO: 3 is replaced with uracil (U). and a forward primer (C) comprising A polynucleotide having the following structure (m) or (p) at the 3' end: (m) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (p) a polynucleotide consisting of a base sequence in which thymine (T) at any position in the base sequence of SEQ ID NO: 4 is replaced with uracil (U); A second primer set consisting of a reverse primer (D) comprising: Primer set.

6. The primer set according to claim 5, wherein one of the forward primer and the reverse primer further comprises a labeling portion which is a tag or a labeling substance capable of binding to a labeling substance, and the other of the forward primer and the reverse primer further comprises a binding portion which is a tag capable of binding to at least a portion of a solid phase carrier.

7. A kit for distinguishing and detecting Mycobacteroides abscessus boretii from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus massiliens, comprising the primer set described in claim 6 and a solid phase support having at least a portion capable of binding to the binding portion.

8. A method for detecting and distinguishing Mycobacteroides abscessus boretii from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus massiliens by analyzing the presence or absence of a nucleic acid amplification product obtained using the primer set described in claim 5 or 6.

9. A primer set for distinguishing and detecting Mycobacteroides abscessus massiliense from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus bolletii, A polynucleotide having the following (q) or (t) at its 3' end: (q) a polynucleotide consisting of the base sequence of SEQ ID NO:5; (t) a polynucleotide consisting of a base sequence in which thymine (T) at any position in the base sequence of SEQ ID NO:5 is replaced with uracil (U); A forward primer (E) comprising A polynucleotide having the following structure (u) or (y) at the 3' end: (u) a polynucleotide consisting of the base sequence of SEQ ID NO: 6; (y) a polynucleotide consisting of a base sequence in which thymine (T) at any position in the base sequence of SEQ ID NO:6 is replaced with uracil (U); A third primer set consisting of a reverse primer (F) comprising: Primer set.

10. The primer set according to claim 9, wherein one of the forward primer and the reverse primer further comprises a labeling portion which is a tag or a labeling substance capable of binding to a labeling substance, and the other of the forward primer and the reverse primer further comprises a binding portion which is a tag capable of binding to at least a portion of a solid phase carrier.

11. A kit for distinguishing and detecting Mycobacteroides abscessus massiliens from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus boreti, comprising the primer set described in claim 10 and a solid phase support having at least a portion capable of binding to the binding portion.

12. A method for detecting and distinguishing Mycobacteroides abscessus massiliens from Mycobacteroides abscessus abscessus and Mycobacteroides abscessus boreti by analyzing the presence or absence of a nucleic acid amplification product obtained using the primer set described in claim 9 or 10.

Images