CRP-binding nucleic acid molecule, CRP detection sensor, CRP detection reagent, CRP detection method, and CRP-binding region

Abstract

To provide miniaturized CRP aptamers designed by a novel method.SOLUTION: The present invention relates to a CRP-binding nucleic acid molecule, a CRP detection sensor, a CRP detection reagent, a CRP detection method, and a CRP-binding region, the CRP-binding nucleic acid molecule consisting of a polynucleotide having a base sequence consisting of a specific sequence.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a CRP-binding nucleic acid molecule, a sensor for detecting CRP, a CRP detection reagent, a method for detecting CRP, and a CRP-binding region. [Background technology]

[0002] CRP (C-reactive protein) is known as a representative marker of inflammatory reactions. For the detection of CRP, an ELISA method using an antibody against CRP as an antigen has been reported (Patent Document 1).

[0003] Meanwhile, a method for detecting a target molecule using an aptamer is known. An aptamer is a nucleic acid ligand that binds to a target molecule, and the SELEX (Systematic Evolution of Ligands by Exponential enrichment) method is a common method for producing an aptamer (Patent Document 2). In the SELEX method, contact between a nucleic acid pool and the target molecule and amplification of the nucleic acid bound to the target molecule are regarded as one set of selection processing, and multiple rounds are repeated. In this way, a sequence capable of binding to the target molecule is selected as the target aptamer from the initial nucleic acid pool. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2011-209140 A [Patent Document 2] Patent No. 2763958 Summary of the Invention [Problem to be solved by the invention]

[0005] However, there is a demand to miniaturize aptamers due to factors such as reduced binding to target molecules due to structural diversity, the occurrence of errors during artificial synthesis of nucleic acids, and increased costs involved in synthesizing nucleic acids.

[0006] An object of the present invention is to provide a miniaturized CRP aptamer designed by a new method. [Means for solving the problem]

[0007] In order to achieve the above object, a first CRP (C-reactive protein)-binding nucleic acid molecule of the present invention is characterized in that it comprises a polynucleotide having a base sequence as set forth in any one of SEQ ID NOs: 3 to 11 below. SEQ ID NO: 3: CCCGGTTACAGATGATCAGGGG SEQ ID NO: 4: CCGGTTACAGATGATCAGGGGCATTCGA SEQ ID NO: 5: AGCCCGGTTACAGATGATCAGGGGCATTCGACAGGCT SEQ ID NO: 6: GTGATAAAAGCCCGGTTACAGATGATCAGGGG SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 9: GTGATAAAAGCCCGGTTACAGATGATCAG SEQ ID NO: 10: GTGATAAAAGCCCGGTTACAGATGATCAGG SEQ ID NO: 11: GTGATAAAAGCCCGGTTACAGATGATCAGGG

[0008] The second CRP-binding nucleic acid molecule of the present invention is characterized in that it comprises a polynucleotide of either (a) or (b) below: (a) a polynucleotide consisting of the base sequence of SEQ ID NO: 2 (b) a polynucleotide that binds to CRP and that has a base sequence in which one base has been deleted, substituted, inserted and / or added in the base sequence of (a) above; SEQ ID NO: 2: CGGTTACAGATGATCA

[0009] The CRP detection sensor of the present invention is characterized by comprising the CRP-binding nucleic acid molecule of the present invention.

[0010] The CRP detection reagent of the present invention is characterized by comprising the CRP-binding nucleic acid molecule of the present invention.

[0011] The method for detecting CRP of the present invention comprises the steps of contacting a sample with a nucleic acid molecule and detecting CRP in the sample, the nucleic acid molecule is the CRP-binding nucleic acid molecule of the present invention, In the detection step, CRP in the sample is bound to the nucleic acid molecule, and CRP in the sample is detected based on the binding.

[0012] The CRP-binding region of the present invention is characterized in that it consists of a polynucleotide of either (a) or (b) below: (a) a polynucleotide consisting of the base sequence of SEQ ID NO: 2 (b) a polynucleotide that binds to CRP and that has a base sequence in which one base has been deleted, substituted, inserted and / or added in the base sequence of (a) above; SEQ ID NO: 2: CGGTTACAGATGATCA Effect of the Invention

[0013] According to the present invention, it is possible to provide a miniaturized CRP aptamer designed by a new method. [Brief description of the drawings]

[0014]

Figure 1

Figure 2

Figure 3

[0015] The CRP-binding nucleic acid molecule of the present invention may be in an embodiment where the binding nucleic acid molecule contains a modified base in which the base is modified with a modifying group.

[0016] In the CRP-binding nucleic acid molecule of the present invention, the modified base may be a modified thymine base in which the thymine base has been modified with a modifying group.

[0017] (1)CRP-binding nucleic acid molecule (1-1) First CRP-binding nucleic acid molecule The first CRP (C-reactive protein)-binding nucleic acid molecule of the present invention is characterized in that it comprises a polynucleotide having a base sequence as set forth in any one of SEQ ID NOs: 3 to 11 below. SEQ ID NO: 3: CCCGGTTACAGATGATCAGGGG SEQ ID NO: 4: CCGGTTACAGATGATCAGGGGCATTCGA SEQ ID NO: 5: AGCCCGGTTACAGATGATCAGGGGCATTCGACAGGCT SEQ ID NO: 6: GTGATAAAAGCCCGGTTACAGATGATCAGGGG SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 9: GTGATAAAAGCCCGGTTACAGATGATCAG SEQ ID NO: 10: GTGATAAAAGCCCGGTTACAGATGATCAGG SEQ ID NO: 11: GTGATAAAAGCCCGGTTACAGATGATCAGGG

[0018] The nucleic acid molecule of the present invention can bind to CRP as described above. The CRP is not particularly limited, and its origin can be, for example, human or non-human animal. The non-human animal can be, for example, mouse, rat, monkey, rabbit, dog, cat, horse, cow, pig, etc. Information on the amino acid sequence of human CRP is registered, for example, in UniProt (http: / / www.uniprot.org / ) under accession number P02741.

[0019] In the present invention, "binding to CRP" also means, for example, having a binding ability to CRP or having a binding activity to CRP. The binding between the nucleic acid molecule of the present invention and the CRP can be determined, for example, by surface plasmon resonance (SPR) analysis. For the analysis, for example, ProteON (trade name, BioRad) can be used. Since the nucleic acid molecule of the present invention binds to CRP, it can be used, for example, to detect CRP. The nucleic acid molecule of the present invention is also called an aptamer.

[0020] The nucleic acid molecule of the present invention may be composed of, for example, DNA, RNA, or DNA and RNA. When the nucleic acid molecule of the present invention is composed of DNA, the nucleic acid molecule of the present invention can be referred to as, for example, a DNA molecule or a DNA aptamer.

[0021] The constituent unit of the nucleic acid molecule is, for example, a nucleotide residue. Examples of the nucleotide residue include a deoxyribonucleotide residue and a ribonucleotide residue. Examples of the nucleic acid molecule of the present invention include DNA composed only of deoxyribonucleotide residues, and DNA containing one or several ribonucleotide residues. In the latter case, "one or several" is not particularly limited, and is, for example, 1 to 3 in the polynucleotide.

[0022] The polynucleotide may contain, for example, a modified base. The modified base is not particularly limited, and may be, for example, a base obtained by modifying a natural base (non-artificial base), and preferably has the same function as the natural base. The natural base is not particularly limited, and may be, for example, a purine base having a purine skeleton, a pyrimidine base having a pyrimidine skeleton, etc. The purine base is not particularly limited, and may be, for example, adenine (a) or guanine (g). The pyrimidine base is not particularly limited, and may be, for example, cytosine (c), thymine (t), uracil (u), etc. The modification site of the base is not particularly limited. When the base is a purine base, the modification site of the purine base may be, for example, the 7th and 8th positions of the purine skeleton. When the base is a pyrimidine base, the modification site of the pyrimidine base may be, for example, the 5th and 6th positions of the pyrimidine skeleton. In the pyrimidine skeleton, when "=O" is bonded to the carbon at position 4 and a group other than "-CH3" or "-H" is bonded to the carbon at position 5, it can be called a modified uracil or modified thymine. The polynucleotide may contain, for example, only one type of the modified base, or may contain two or more types of the modified bases.

[0023] In the nucleic acid molecules of the present invention, for example, the underlined thymines shown in the following SEQ ID NOs: 3 to 11 may be modified bases. SEQ ID NO:3: CCCGG TT ACAGA T GA T CAGGGG SEQ ID NO:4: CCGG TT ACAGA T GA T CAGGGGCA TT CGA SEQ ID NO:5: AGCCCGG TT ACAGA T GA T CAGGGGCA TT CGACAGGC T SEQ ID NO: 6: GTGA T AAAAGCCCGG TT ACAGA T GA TCAGGGG SEQ ID NO: 7: GTGA T AAAAGCCCGG TT ACAGA T GA T CAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAG T GA T AAAAGCCCGG TT ACAGA T GA T CAGGGGC SEQ ID NO: 9: GTGA T AAAAGCCCGG TT ACAGA T GA T CAG SEQ ID NO: 10: GTGA T AAAAGCCCGG TT ACAGA T GA T CAGG SEQ ID NO: 11: GTGA T AAAAGCCCGG TT ACAGA T GA T CAGGG

[0024] The nucleic acid molecule of the present invention includes, for example, the nucleotide sequence of SEQ ID NO: 2, which is a putative binding region described below. Therefore, in the nucleic acid molecule of the present invention, the thymine corresponding to the nucleotide sequence of SEQ ID NO: 2 may be a modified nucleotide. SEQ ID NO:2:CGG TT ACAGA T GA T CA

[0025] That is, in the nucleic acid molecules of the present invention, for example, the underlined thymines shown in the following SEQ ID NOs: 6 to 11 may be modified bases. SEQ ID NO: 6: GTGATAAAAGCCCGG TT ACAGA T GA T CAGGGG SEQ ID NO: 7: GTGATAAAAGCCCGG TT ACAGA T GA T CAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGG TT ACAGA T GA T CAGGGGC SEQ ID NO: 9: GTGATAAAAGCCCGG TT ACAGA T GA T CAG SEQ ID NO: 10: GTGATAAAAGCCCGG TT ACAGA T GA T CAGG SEQ ID NO: 11: GTGATAAAAGCCCGG TT ACAGA T GA T CAGGG

[0026] A specific example of the modified base is, for example, a thymidine nucleotide residue modified with an adenine residue, and is represented by the following formula (1) (hereinafter, also referred to as "KS9"). However, without being limited thereto, for example, a thymidine nucleotide residue modified with a substituted adenine residue, and may be represented by the following formula (2) (hereinafter, also referred to as "KK10"), etc. For the KS9 and KK10, for example, reference can be made to International Publication No. 2017 / 081926. However, the present invention is not limited thereto.

[0027] [ka]

[0028] [ka]

[0029] In the polynucleotides of SEQ ID NOs: 3 to 11, for example, the underlined thymine is preferably the KS9 nucleotide residue.

[0030] When the nucleic acid molecule of the present invention has, for example, the thymidine nucleotide residue, the polynucleotide can be synthesized using, for example, a nucleotide triphosphate represented by the following formula (3) (hereinafter, also referred to as "KS9 monomer") as a monomer molecule. In the synthesis of the polynucleotide, for example, the monomer molecule is bound to another nucleotide triphosphate via a phosphodiester bond.

[0031] [ka]

[0032] The nucleic acid molecule of the present invention may contain, for example, a modified nucleotide. The modified nucleotide may be a nucleotide having the modified base described above, a nucleotide having a modified sugar in which the sugar residue is modified, or a nucleotide having both the modified base and the modified sugar.

[0033] The number of the modified bases is not particularly limited. In the polynucleotide, the number of the modified bases is, for example, 1 or more. Furthermore, all of the bases may be the modified bases.

[0034] The nucleic acid molecule of the present invention may contain, for example, one or several artificial nucleic acid monomer residues. Examples of the artificial nucleic acid monomer residues include PNA (peptide nucleic acid), LNA (locked nucleic acid), ENA (2'-O, 4'-C-Ethylene-bridged Nucleic Acids), etc. The nucleic acid in the monomer residue is, for example, the same as described above.

[0035] The nucleic acid molecule of the present invention is preferably, for example, nuclease resistant. The nucleic acid molecule of the present invention preferably has, for example, the modified nucleotide residue and / or the artificial nucleic acid monomer residue for nuclease resistance. For example, the nucleic acid molecule of the present invention may have several tens of kDa of PEG (polyethylene glycol) or deoxythymidine bound to the 5'-end or 3'-end for nuclease resistance.

[0036] The nucleic acid molecule of the present invention may further have, for example, an additional sequence. For example, the additional sequence is preferably bound to at least one of the 5'-end and 3'-end of the nucleic acid molecule, more preferably to the 3'-end. The additional sequence is not particularly limited. The length of the additional sequence is not particularly limited, and is, for example, 1 to 200 bases long, 1 to 50 bases long, 1 to 25 bases long, or 18 to 24 bases long. The constituent unit of the additional sequence is, for example, a nucleotide residue, such as a deoxyribonucleotide residue or a ribonucleotide residue. The additional sequence is not particularly limited, and is, for example, a polynucleotide such as DNA consisting of deoxyribonucleotide residues or DNA containing ribonucleotide residues. Specific examples of the additional sequence include polydT, polydA, and the like.

[0037] The nucleic acid molecule of the present invention can be used, for example, by immobilizing it on a carrier. The nucleic acid molecule of the present invention is preferably immobilized, for example, at either the 5'-end or the 3'-end, more preferably at the 3'-end. When immobilizing the nucleic acid molecule of the present invention, for example, the nucleic acid molecule may be directly or indirectly immobilized on the carrier. In the latter case, it is preferable to immobilize it via the additional sequence, for example.

[0038] The nucleic acid molecule of the present invention may further have, for example, a labeling substance, and specifically, the labeling substance may be bound to the nucleic acid molecule. The nucleic acid molecule bound to the labeling substance may be, for example, the nucleic acid sensor of the present invention. The labeling substance may be bound to at least one of the 5' end and the 3' end of the nucleic acid molecule. The labeling with the labeling substance may be, for example, binding or chemical modification. The labeling substance is not particularly limited, and examples thereof include enzymes, fluorescent substances, dyes, isotopes, drugs, toxins, and antibiotics. Examples of the enzyme include luciferase and NanoLuc luciferase. Examples of the fluorescent substance include fluorophores such as pyrene, TAMRA, fluorescein, Cy3 dye, Cy5 dye, FAM dye, rhodamine dye, Texas Red dye, JOE, MAX, HEX, and TYE, and examples of the dye include Alexa dyes such as Alexa488 and Alexa647. The labeling substance may be linked directly to the nucleic acid molecule, or indirectly via a linker. The linker is not particularly limited and may be, for example, a polynucleotide linker.

[0039] The method for producing the nucleic acid molecule of the present invention is not particularly limited, and the molecule can be synthesized by, for example, a nucleic acid synthesis method using chemical synthesis, a genetic engineering technique, or a known method.

[0040] As described above, the nucleic acid molecule of the present invention exhibits binding to the CRP. Therefore, the use of the nucleic acid molecule of the present invention is not particularly limited as long as it utilizes the binding to the CRP. The nucleic acid molecule of the present invention can be used in various methods, for example, in place of an antibody against the CRP.

[0041] According to the nucleic acid molecule of the present invention, CRP can be detected. The method for detecting CRP is not particularly limited, and for example, the detection can be performed by detecting the binding between CRP and the nucleic acid molecule with reference to the detection method described below.

[0042] (1-2) Second CRP-binding nucleic acid molecule The second CRP-binding nucleic acid molecule of the present invention is characterized in that it comprises a polynucleotide of either (a) or (b) below: (a) a polynucleotide consisting of the base sequence of SEQ ID NO: 2 (b) a polynucleotide that binds to CRP and that has a base sequence in which one base has been deleted, substituted, inserted and / or added in the base sequence of (a) above; SEQ ID NO: 2: CGGTTACAGATGATCA

[0043] For the second CRP-binding nucleic acid molecule of the present invention, the same explanation as for the first CRP-binding nucleic acid molecule of the present invention can be referred to.

[0044] The nucleic acid molecule of the present invention may be a molecule consisting of the polynucleotide (a) or (b) above, or may be a molecule containing the polynucleotide.

[0045] The polynucleotide (a) may be a polynucleotide that includes the base sequence of SEQ ID NO:2, or may be a polynucleotide that consists of the base sequence of SEQ ID NO:2.

[0046] In the nucleic acid molecule of the present invention, for example, the underlined thymine shown in SEQ ID NO:2 below may be a modified base. SEQ ID NO:2:CGG TT ACAGA T GA T CA

[0047] For example, when the nucleic acid molecule of the present invention contains multiple polynucleotides, it is preferable that the multiple polynucleotide sequences are linked to form a single-stranded polynucleotide. For example, the multiple polynucleotide sequences may be directly linked to each other, or may be indirectly linked to each other via a linker. It is preferable that the polynucleotide sequences are directly or indirectly linked at each end. When the nucleic acid molecule of the present invention contains multiple polynucleotide sequences, the number of the sequences is not particularly limited, and is, for example, 2 or more, 2 to 20, 2 to 10, 2, or 3.

[0048] The length of the linker is not particularly limited, and may be, for example, 1 to 200 bases, 1 to 24 bases, 1 to 20 bases, 3 to 12 bases, or 5 to 9 bases. The constituent unit of the linker is, for example, a nucleotide residue, such as a deoxyribonucleotide residue or a ribonucleotide residue. The linker is not particularly limited, and may be, for example, a polynucleotide such as DNA consisting of deoxyribonucleotide residues or DNA containing ribonucleotide residues. Specific examples of the linker include polydeoxythymine (poly dT), polydeoxyadenine (poly dA), and poly dAdT, which is a repeat sequence of A and T, and preferably poly dT or poly dAdT.

[0049] In the nucleic acid molecule of the present invention, the polynucleotide is preferably a single-stranded polynucleotide. The single-stranded polynucleotide is preferably capable of forming, for example, a stem structure and a loop structure by self-annealing. The polynucleotide is preferably capable of forming, for example, a stem-loop structure, an internal loop structure, and / or a bulge structure.

[0050] The nucleic acid molecule of the present invention may be, for example, double-stranded. In the case of double-stranded, for example, one single-stranded polynucleotide contains either the polynucleotide (a) or (b), and the other single-stranded polynucleotide is not limited. The other single-stranded polynucleotide may be, for example, a polynucleotide containing a base sequence complementary to either the polynucleotide (a) or (b). When the nucleic acid molecule of the present invention is double-stranded, it is preferable to dissociate it into single-stranded polynucleotides, for example, by denaturation prior to use. In addition, it is preferable that the dissociated single-stranded polynucleotide of either the (a) or (b) forms a stem structure and a loop structure, for example, as described above.

[0051] The constituent unit of the nucleic acid molecule of the present invention is, for example, a nucleotide residue. The length of the nucleic acid molecule is not particularly limited. The lower limit of the length of the nucleic acid molecule is, for example, 15 bases, 35 bases, 55 bases, or 75 bases. The upper limit of the length of the nucleic acid molecule is, for example, 1000 bases, 200 bases, 100 bases, 90 bases, or 80 bases. The length of the nucleic acid molecule ranges, for example, from 15 to 1000 bases, from 35 to 200 bases, from 55 to 90 bases, or from 75 to 80 bases.

[0052] (2)CRP binding region The CRP-binding region of the present invention is characterized in that it consists of a polynucleotide of either (a) or (b) below: (a) a polynucleotide consisting of the base sequence of SEQ ID NO: 2 to 11 (b) a polynucleotide that binds to CRP and that has a base sequence in which one base has been deleted, substituted, inserted and / or added in the base sequence of (a) above; SEQ ID NO: 2: CGGTTACAGATGATCA SEQ ID NO: 3: CCCGGTTACAGATGATCAGGGG SEQ ID NO: 4: CCGGTTACAGATGATCAGGGGCATTCGA SEQ ID NO: 5: AGCCCGGTTACAGATGATCAGGGGCATTCGACAGGCT SEQ ID NO: 6: GTGATAAAAGCCCGGTTACAGATGATCAGGGG SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 9: GTGATAAAAGCCCGGTTACAGATGATCAG SEQ ID NO: 10: GTGATAAAAGCCCGGTTACAGATGATCAGG SEQ ID NO: 11: GTGATAAAAGCCCGGTTACAGATGATCAGGG

[0053] For the polynucleotide of (a) or (b), see the explanation for the CRP-binding nucleic acid molecule mentioned above.

[0054] The CRP-binding region of the present invention can, for example, specifically bind to CRP.

[0055] The CRP-binding region of the present invention is, for example, a region that binds to CRP in the nucleic acid molecule of the present invention. However, the CRP-binding region of the present invention is not limited thereto, and may be a CRP-binding region in any nucleic acid molecule.

[0056] Any of the above nucleic acid molecules may contain one or more CRP-binding regions of the present invention.

[0057] (3) CRP detection sensor As described above, the detection sensor of the present invention is a sensor for detecting CRP, and is characterized by including the nucleic acid molecule of the present invention. The detection sensor of the present invention only needs to include the nucleic acid molecule of the present invention, and other configurations are not particularly limited. By using the detection sensor of the present invention, for example, the nucleic acid molecule and the CRP can be bound to each other, so that the CRP can be detected as described above.

[0058] The detection sensor of the present invention further includes, for example, a carrier, and the nucleic acid molecule is disposed on the carrier. The nucleic acid molecule is preferably immobilized on the carrier. The nucleic acid molecule is immobilized on the carrier, for example, as described above. The method of using the detection sensor of the present invention is not particularly limited, and the nucleic acid molecule of the present invention and the detection method of the present invention can be used.

[0059] (4) Detection reagents and kits The detection reagent of the present invention is characterized by containing the CRP-binding nucleic acid molecule of the present invention. The detection reagent of the present invention is not limited in any other configuration as long as it contains the nucleic acid molecule of the present invention. By using the detection reagent of the present invention, for example, the detection of the CRP can be performed as described above.

[0060] The detection reagent of the present invention may include the sensor of the present invention as the nucleic acid molecule of the present invention, for example. The detection reagent of the present invention may further include a labeling substance, and the labeling substance may be bound to the nucleic acid molecule. For the labeling substance, for example, the explanation for the nucleic acid molecule of the present invention can be used. Furthermore, the detection reagent of the present invention may include a carrier, and the nucleic acid molecule may be immobilized on the carrier. For the carrier, for example, the explanation for the nucleic acid molecule of the present invention can be used.

[0061] The detection reagent of the present invention may contain other components in addition to the nucleic acid molecule of the present invention. Examples of the components include the carrier, buffer solution, and instruction manual.

[0062] In the detection reagent of the present invention, for example, the nucleic acid molecule and other components such as the buffer solution may be contained in separate containers, or may be contained in the same container, either mixed or unmixed. When the nucleic acid molecule and the other components are contained in separate containers, the detection reagent of the present invention can also be called a detection kit.

[0063] (4) Detection method As described above, the detection method of the present invention includes a step of contacting a sample with a nucleic acid molecule and detecting CRP in the sample, the nucleic acid molecule being the CRP-binding nucleic acid molecule of the present invention, and in the detection step, the CRP in the sample is bound to the nucleic acid molecule, and the CRP in the sample is detected by the binding. The detection method of the present invention is characterized by using the nucleic acid molecule of the present invention, and other steps and conditions are not particularly limited. In addition, the detection method of the present invention may use the CRP detection sensor of the present invention as the nucleic acid molecule of the present invention.

[0064] According to the present invention, since the nucleic acid molecule of the present invention specifically binds to CRP, for example, by detecting the binding between CRP and the nucleic acid molecule, CRP in a sample can be specifically detected. Specifically, since the detection method of the present invention can detect, for example, the presence or absence of CRP in a sample or the amount of CRP, it can be said that it is also possible to perform qualitative or quantitative analysis. In addition, since the detection method of the present invention can perform, for example, qualitative or quantitative analysis, it can also be called an analysis method.

[0065] In the present invention, the sample is not particularly limited and may be, for example, saliva, urine, plasma, serum, or the like.

[0066] The sample may be, for example, a liquid sample or a solid sample. The sample is preferably a liquid sample, for example, because it is easy to contact with the nucleic acid molecule and easy to handle. In the case of a solid sample, for example, a mixture, an extract, a dissolution solution, etc. may be prepared using a solvent, and the mixture may be used. The solvent is not particularly limited, and examples thereof include water, physiological saline, and a buffer solution.

[0067] The detection step includes, for example, a contact step of contacting the sample with the nucleic acid molecule to bind the CRP in the sample to the nucleic acid molecule, and a binding detection step of detecting the binding between the CRP and the nucleic acid molecule. The detection step further includes, for example, a step of detecting the presence or absence or amount of CRP in the sample based on the result of the binding detection step.

[0068] In the contact step, the method of contacting the sample with the nucleic acid molecule is not particularly limited. The contact between the sample and the nucleic acid molecule is preferably performed in a liquid, for example. The liquid is not particularly limited, and examples thereof include water, physiological saline, and buffer solutions.

[0069] In the contact step, the contact conditions between the sample and the nucleic acid molecule are not particularly limited. The contact temperature is, for example, 4 to 37° C. or 18 to 25° C., and the contact time is, for example, 10 to 120 minutes or 30 to 60 minutes.

[0070] In the contact step, the nucleic acid molecule may be, for example, an immobilized nucleic acid molecule immobilized on a carrier, or an unimmobilized free nucleic acid molecule. In the latter case, the nucleic acid molecule is contacted with the sample, for example, in a container. The nucleic acid molecule is preferably an immobilized nucleic acid molecule, for example, because it is easy to handle. The carrier is not particularly limited, and examples thereof include a substrate, beads, a container, etc., and the container includes, for example, a microplate, a tube, etc. The immobilization of the nucleic acid molecule is, for example, as described above.

[0071] The binding detection step is a step of detecting the binding between the CRP and the nucleic acid molecule in the sample, as described above. By detecting the presence or absence of the binding between the two, for example, the presence or absence of CRP in the sample can be detected (qualitative), and by detecting the degree of binding between the two (amount of binding), for example, the amount of CRP in the sample can be detected (quantitative).

[0072] If the binding between the CRP and the nucleic acid molecule cannot be detected, it can be determined that CRP is not present in the sample, whereas if the binding is detected, it can be determined that CRP is present in the sample.

[0073] The method for detecting the binding between the CRP and the nucleic acid molecule is not particularly limited. For example, the method may be a conventionally known method for detecting binding between substances, and a specific example is the above-mentioned SPR. In addition, the binding may be, for example, the detection of a complex between the CRP and the nucleic acid molecule. EXAMPLES

[0074] Next, examples of the present invention will be described. However, the present invention is not limited to the following examples. Commercially available reagents were used according to their protocols unless otherwise indicated.

[0075] [Example 1] As a candidate aptamer, an aptamer having binding activity against CRP was used, and the structure of the candidate aptamer was estimated, a miniaturized aptamer sequence was designed, the structure of the miniaturized aptamer was estimated, a score was calculated, and miniaturized aptamer sequences having a score equal to or greater than a predetermined value were extracted.

[0076] (Candidate aptamer) As a candidate aptamer, an aptamer having binding ability to CRP was used (SEQ ID NO: 1). The polynucleotide of SEQ ID NO: 1 is shown below.

[0077] Candidate aptamer (SEQ ID NO: 1) GGTTACGCCGCACATCAGTTTAGTGATAAAAGCC CGGTTACAGATGATCA GGGGCATTCGACAGGCTGGACATATC

[0078] (Prediction of the structure of candidate aptamers) In SEQ ID NO: 1, the putative binding region (SEQ ID NO: 2) is underlined. The putative binding region was estimated by FSBC (fast string-based clustering) according to the method described in the literature (Kato S, Ono T, Minagawa H, Horii K, Shiratori I, Waga I, et al. FSBC: fast string-based clustering for HT-SELEX data. BMC Bioinformatics. 2020 Jun 24; 21 (1): 263.). The putative binding region can also be referred to as a motif sequence.

[0079] Putative binding region (SEQ ID NO:2) CGGTTACAGATGATCA

[0080] For the candidate aptamers, the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region were each calculated.

[0081] The secondary structure was predicted by RNAsubopt according to the method described in Reference 1 below. The free energy was calculated from the thermal energy parameters of nucleic acids in RNAsubopt. References for the parameter file include, for example, References 2 and 3 below. Reference 1: Lorenz R, Bernhart SH, Hoener Zu Siederdissen C, Tafer H, Flamm C, Stadler PF, et al. ViennaRNA Package 2.0. Algorithms Mol Biol. 2011 Nov 24;6:26. Reference 2: DH Mathews, MD Disney, D. Matthew, JL Childs, SJ Schroeder, J. Susan, M. Zuker, DH Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292 Reference 3: DH Turner, DH Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282

[0082] The existence probability was calculated using the free energy in the secondary structure and the Boltzmann distribution formula. The Boltzmann distribution formula is shown in the following formula (1). The existence probability of state i can be calculated using formula (1).

number

[0083] The results are shown in Tables 1A to C. Tables 1A to C are tables showing the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region of the candidate aptamer. In the secondary structures shown in Tables 1A to C, "." (dot) indicates that the corresponding bases in the candidate aptamer do not form a base pair, and "(" and ")" (brackets) indicate that they form a base pair (hereinafter the same). Note that "does not form a base pair" can be rephrased as "forms a loop", and "forms a base pair" can be rephrased as "forms a stem". As shown in Tables 1A to C, 27 types of secondary structures were predicted for the candidate aptamers. In addition, 5 types of motif structures were predicted.

[0084] [Table 1A] [Table 1B] [Table 1C]

[0085] From the results in Table 1, the probability of occurrence of each of the five types of motif structures was further calculated.

[0086] The results are shown in Table 2. Table 2 shows the probability of existence for each of the five types of motif structures (motif structures 1 to 5). As shown in Table 2, the probability of existence for each of the five types of motif structures (motif structures 1 to 5) was calculated for the candidate aptamers.

[0087] [Table 2]

[0088] (Design of miniaturized aptamer sequences) Next, a shortened sequence was designed for each of the possible secondary structures of the putative binding region. In the following description, a shortened sequence in which m bases are deleted from the 5' end and n bases are deleted from the 3' end of the candidate aptamer is indicated as S(m,n). In this specification and drawings, the description of "S(m,n)" and combinations of the values ​​of m and n uniquely defines and discloses the corresponding sequence.

[0089] (Estimation of the structure of miniaturized aptamers) For each of the compact sequences (S(m,n)), the probability of presence of motif structures 1 to 5 was calculated in the same manner as described above.

[0090] (Score calculation) The calculated probability of presence of motif structures 1 to 5 in the shortened sequence (S(m,n)) was divided by the probability of presence of motif structures 1 to 5 in the candidate aptamer, respectively, to obtain the ratio (relative value of the probability of presence). The ratio was set as score 1, which is the score for each of motif structures 1 to 5.

[0091] In addition, for each of the miniaturized sequences (S(m,n)), the sum of the presence probabilities of motif structures 1 to 5 was calculated. This sum was divided by the sum of the presence probabilities of motif structures 1 to 5 in the candidate aptamer to obtain the ratio (relative value of the presence probability). The ratio was designated as score 2, which is the score for the combination of motif structures 1 to 5.

[0092] These results are shown in Figures 1A to 1F and 2. Figures 1A to 1E show the score 1 value for each of motif structures 1 to 5, respectively, Figure 1F shows the relationship between the length of the compacted sequence and the score 1 value, and Figure 2 shows the score 2 for the combination of motif structures 1 to 5. Figures 1A to 1E and 2 are heat maps showing the scores for each of the compacted sequences (S(m,n)), with the vertical direction showing the m value (0 to 34) and the horizontal direction showing the n value (0 to 26), and the shading of each square showing the score of the compacted sequence (S(m,n)). The shading of each square is set so that the scores are darker in the following order: 0 or more and less than 0.5, 0.5 or more and less than 1, 1 or more and less than 2, 2 or more and less than 4, and 4 or more. In Figure 2, "T" and "F" respectively show the results of the binding evaluation in Example 2 described later (T: binding, F: no binding).

[0093] As shown in Figures 1A to 1E, for each of motif structures 1 to 5, there were miniaturized aptamers whose score 1 value was 1 or greater, i.e., miniaturized aptamers whose probability of existence of motif structures 1 to 5 in the miniaturized sequence (S(m,n)) was greater than or equal to the probability of existence of motif structures 1 to 5 in the candidate aptamer.

[0094] As shown in FIG. 1F, motif structure 1 was distributed mainly in the range of about 20 to 75 for the length of the miniaturized sequence and 0.8 to 2.0 for the score 1 value, and was also distributed in the range of about 20 to 55 for the length of the miniaturized sequence and 0.05 to less than 0.8 for the score 1 value. Motif structure 2 was distributed mainly in the range of about 25 to 80 for the length of the miniaturized sequence and 0.8 to 1.5 for the score 1 value, and was also distributed in the range of about 25 to 35 and 60 to 75 for the length of the miniaturized sequence and 0.3 to less than 0.8 for the score 1 value. Motif structure 3 was distributed mainly in the range of about 60 to 70 for the length of the miniaturized sequence and 0.3 to 0.4 for the score 1 value. Motif structure 4 was distributed mainly in the range of about 25 to 80 for the length of the miniaturized sequence and 0.8 to 1.5 for the score 1 value, and was also distributed in the range of about 25 to 35 and 60 to 75 for the length of the miniaturized sequence and 0.3 to less than 0.8 for the score 1 value. Motif structure 5 was frequently found in the range of compact sequence lengths of approximately 45 to 75 and score 1 values ​​of 0.4 to 1.0.

[0095] Furthermore, as shown in Figure 2, even in the combinations of motif structures 1 to 5, there were miniaturized aptamers whose score 2 value was 1 or more, that is, miniaturized aptamers whose total probability of existence of motif structures 1 to 5 in the miniaturized sequence (S(m,n)) was greater than or equal to the total probability of existence of motif structures 1 to 5 in the candidate aptamer.

[0096] (Extraction of miniaturized aptamer sequences) Furthermore, from the shortened sequences (S(m,n)), shortened aptamer sequences having the score equal to or greater than a predetermined value were extracted.

[0097] 1A to 1E, the shortest sequence was selected from the shortened sequences that had a score of 1 (relative value of the probability of existence) of 1 or more for each of motif structures 1 to 5. The results are shown in Table 3.

[0098] [Table 3]

[0099] Furthermore, the shortest sequence was selected from the shortened sequences shown in Table 3. As a result, a shortened sequence corresponding to motif structure 3 (S(32,22); SEQ ID NO: 3) was extracted.

[0100] Furthermore, based on the results shown in FIG. 2, the shortest sequence was selected from among the truncated sequences for which the score 2 value was 1 or more in the combination of motif structures 1 to 5.

[0101] As a result, a shortened sequence (S(32,22); SEQ ID NO:3) was similarly extracted.

[0102] Furthermore, the truncated sequences having a score 2 value of 1.873 or more in Figure 2 are shown in Tables 4A to R (SEQ ID NOs: 12 to 394). All of SEQ ID NOs: 12 to 394 contained the truncated sequence (S(32,22); SEQ ID NO: 3) described above. [Table 4A] [Table 4B] [Table 4C] [Table 4D] [Table 4E] [Table 4F] [Table 4G] [Table 4H] [Table 4I] [Table 4J] [Table 4K] [Table 4L] [Table 4M] [Table 4N] [Table 4O] [Table 4P] [Table 4Q] [Table 4R]

[0103] In this embodiment, the method for determining a compact sequence for each possible motif structure of the putative binding domain can be represented by the following formulas (2) to (4).

number

[0104] Moreover, a method for predicting a shortened sequence for each motif structure and determining the shortest shortened sequence among them can be expressed by the following formulas (5) to (7).

number

[0105] As described above, by using an aptamer having binding activity against CRP as a candidate aptamer, it was possible to estimate the structure of the candidate aptamer, design a miniaturized aptamer sequence, estimate the structure of the miniaturized aptamer, calculate a score, and extract a miniaturized aptamer sequence whose score is equal to or greater than a predetermined value.

[0106] [Example 2] The miniaturized aptamer extracted in Example 1 was evaluated for its binding to CRP.

[0107] (Miniaturized Array) As the miniaturized sequences, polynucleotides (miniaturized sequences 1 to 6) shown in Table 5 below were synthesized. In the synthesis of miniaturized sequences 1 to 6, the nucleotide residues containing thymine shown underlined in Table 5 below were used as the nucleotide residue (KS9) shown in formula (1). Miniaturized sequence 1 was a sequence (S(22,22); SEQ ID NO:6) in which 15 bases to the left of the thymine on the 3'-most side were used as a primer region, based on the miniaturized sequence (S(32,22); SEQ ID NO:3) extracted in Example 1. Miniaturized sequence 2 is a sequence (S(22,21); SEQ ID NO:7) that is 1 base longer than miniaturized sequence 1, and miniaturized sequence 3 is a sequence (S(8,21); SEQ ID NO:8) that is 15 bases longer than miniaturized sequence 1. Miniaturized sequences 4 to 6 are sequences that are 1 to 3 bases shorter than miniaturized sequence 1, respectively.

[0108] [Table 5]

[0109] (Combination Evaluation) The binding properties of the miniaturized sequences 1 to 6 were analyzed by SPR.

[0110] A 20-base long polydeoxyadenine (poly dA) was added to the 3' end of the shortened sequence, and the sequence was used as the poly dA added sequence in SPR described below.

[0111] A CRP sample was prepared as follows. CRP (Human, manufactured by Acris Antibodies GmBH, product code: P100-0) was dissolved in sterilized distilled water to a concentration of 1 mg / mL, and the solution was used as a CRP sample. In the binding analysis described below, SB1T buffer was used to dilute the CRP sample. The composition of the SB1T buffer was 40 mmol / L HEPES, 125 mmol / L NaCl, 5 mmol / L KCl, 1 mmol / L MgCl2, and 0.05% Tween (registered trademark) 20, and the pH was 7.5.

[0112] For binding analysis, ProteOn XPR36 (BioRad) was used according to the manufacturer's instructions.

[0113] First, a streptavidin-immobilized chip (trade name ProteOn NLC Sensor Chip, BioRad) was set in the ProteOn XPR36 as a sensor chip dedicated to the ProteOn. 5 μmol / L of biotinylated polydT was injected into the flow cell of the sensor chip using ultrapure water (DDW) and allowed to bind until the signal intensity (RU: Resonance Unit) was saturated. The biotinylated polydT was prepared by biotinylating the 5' end of a 20-base-long deoxythymidine. Then, 200 nmol / L of the polydA addition sequence was injected into the flow cell of the chip using SB1T buffer at a flow rate of 25 μL / min for 80 seconds and allowed to bind until the signal intensity was saturated. Next, 5 nmol / L of each sample was injected using SB1T buffer at a flow rate of 50 μL / min for 300 seconds, and then SB1T buffer was run under the same conditions to perform washing. The start of sample injection was set as 0 seconds, and the signal intensity after the sample injection was measured. The SPR was performed under conditions of 25°C.

[0114] The results are shown in Figure 3 and Table 5. Figure 3 is a graph showing the binding of the miniaturized sequences to 1.25 nmol / L, 2.5 nmol / L, 5 nmol / L, 10 nmol / L, and 20 nmol / L CRP, where (A) shows the results for miniaturized sequence 3, (B) for miniaturized sequence 2, (C) for miniaturized sequence 1, and (D) for miniaturized sequence 6. The horizontal axis indicates the elapsed time (seconds) after the start of injection of the sample, and the vertical axis indicates the signal intensity (RU). As shown in Figure 17, miniaturized sequences 2 and 3 showed binding to CRP. On the other hand, miniaturized sequences 1 and 6 both had signal intensities of almost 0 and showed no binding.

[0115] Furthermore, as shown in Table 5, miniaturized sequences 2 and 3 exhibited binding ability to CRP, whereas miniaturized sequences 1 and 4 to 6 did not exhibit binding ability.

[0116] These results demonstrated that miniaturized sequences 2 and 3 bind to CRP with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0117] As shown in Table 5, the miniaturized sequences 2 and 3, which showed binding to CRP, had a score 2 value of 1.873 in the combination of the motif structures 1 to 5 shown in Figure 2. On the other hand, the miniaturized sequences 1 and 4 to 6, which did not show binding to CRP, had score 2 values ​​of less than 1.873 and 1.080 or less in the combination of the motif structures 1 to 5 shown in Figure 2.

[0118] This suggests that in the extraction of the miniaturized aptamer sequences in Example 3, if miniaturized sequences having score 2 values ​​of, for example, 1.873 or more, 1.8 or more, 1.7 or more, 1.6 or more, 1.5 or more, 1.4 or more, 1.3 or more, 1.2 or more, 1.1 or more, and greater than 1.08 are extracted, it will be possible to design miniaturized sequences that exhibit binding to CRP.

[0119] Similarly, the binding of the candidate aptamer was analyzed by SPR, and it was found that the candidate aptamer binds to CRP with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0120] As described above, the miniaturized aptamer extracted in Example 1 was subjected to a CRP binding evaluation. As a result, it was possible to design an aptamer capable of binding with excellent specificity with a difference of one base even in a sequence in which a primer region for synthesizing by an enzymatic method was added for the miniaturized aptamer extracted in Example 1. Furthermore, it was suggested that if a miniaturized sequence having a score 2 value of a predetermined value or more is extracted in the extraction of the miniaturized aptamer sequence in Example 1, it is possible to design a miniaturized sequence that exhibits binding ability to CRP.

[0121] Although the present invention has been described above with reference to the embodiments and examples, the present invention is not limited to the above-mentioned embodiments and examples. Various modifications that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

Claims

1. A CRP (C-reactive protein) binding nucleic acid molecule, comprising a polynucleotide having the base sequence of SEQ ID NO: 7 or 8 below. SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGGTTACAGATGATCAGGGGC

2. A CRP-binding nucleic acid molecule comprising a polynucleotide having the base sequence of SEQ ID NO:

7. SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC

3. The CRP-binding nucleic acid molecule according to claim 1 or 2, wherein the binding nucleic acid molecule comprises a modified base in which the base is modified with a modifying group.

4. The CRP-binding nucleic acid molecule according to claim 3, wherein the modified base is a modified thymine base in which the thymine base has been modified with a modifying group.

5. A sensor for detecting CRP, comprising the CRP-binding nucleic acid molecule according to any one of claims 1 to 4.

6. A CRP detection reagent comprising a CRP-binding nucleic acid molecule according to any one of claims 1 to 4.

7. contacting a sample with a nucleic acid molecule and detecting CRP in the sample; The nucleic acid molecule is a CRP-binding nucleic acid molecule according to any one of claims 1 to 4, A method for detecting CRP, comprising the steps of: binding CRP in the sample to the nucleic acid molecule in the detection step; and detecting CRP in the sample through the binding.

8. A CRP binding region, characterized in that it consists of a polynucleotide having the base sequence of SEQ ID NO: 7 or 8 below. SEQ ID NO: 7: GTGATAAAAGCCCGGTTACAGATGATCAGGGGC SEQ ID NO: 8: CGCACATCAGTTTAGTGATAAAAGCCCGGTTACAGATGATCAGGGGC

Images