Method for genome editing of wheat and its use

Abstract

To provide genome editing methods capable of efficiently introducing a deletion, insertion, or substitution into the SD 1 gene of wheat in a short period of time, and to provide wheat production methods capable of obtaining wheat having resistance to lodging by efficiently introducing a deletion, insertion, or substitution into the SD 1 gene of wheat in a short period of time.SOLUTION: Provided are a genome editing method of wheat, comprising introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means, and a method for producing wheat with SD1 gene mutation, comprising: introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means; and growing a tissue in which a deletion, insertion, or substitution has been introduced into the SD1 gene of wheat to obtain a plant body.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for genome editing of wheat, a method for producing wheat having an SD1 gene mutation, and wheat having an SD1 gene mutation. [Background technology]

[0002] Lodging, which causes a decrease in wheat yield and quality, is known to be correlated with wheat culm length (see, for example, non-patent documents 1 to 3). The "Green Revolution" introduced the semi-dwarfing gene Rht-B1 derived from wheat Norin 10 into varieties around the world through breeding, resulting in significant shortening of culms and an associated increase in yields on a global scale. The Rht-B1 gene codes for a protein involved in the reception of the plant growth hormone gibberellin, and the shortening of culms was brought about by the insensitivity to gibberellin. Later, the "Green Revolution" also took place in rice, but a different gene from that used in wheat was used. Unlike wheat, which is hexaploid, in rice, which is diploid, mutations in the Rht homologous gene result in extreme dwarfism and could not be used for breeding. In rice, a different SD1 gene was used. The SD1 gene encodes an enzyme for the biosynthesis of gibberellin, and in mutant SD1, the synthesis of this enzyme is suppressed, resulting in semi-dwarfism (see, for example, Patent Document 1). If the semi-dwarf wheat cultivar with the Rht gene mutation could be further shortened, further yield increases are expected. The SD1 gene is a candidate for this purpose, but the SD1 mutation has not yet been found in wheat. Furthermore, in recent years, genome editing techniques that can specifically modify target genes have been developed as new transformation techniques.

[0003] However, in wheat, which is a hexaploid, semi-dwarf transformants can only be obtained by disrupting all SD1 genes in the entire ABD genome. Therefore, producing semi-dwarf transformants using conventional techniques would require a very long period of time and was thought to be technically impossible (see, for example, non-patent document 4).

[0004] Therefore, a method for editing the wheat genome that can efficiently introduce deletions, insertions, or substitutions into the wheat SD1 gene in a short period of time, and a method for producing wheat with an SD1 gene mutation that can efficiently introduce deletions, insertions, or substitutions into the wheat SD1 gene in a short period of time to obtain wheat with lodging resistance, have not yet been provided, and there is a strong demand for their prompt provision. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2003-000260 A [Non-patent literature]

[0006] [Non-Patent Document 1] Journal of the Crop Science Society of Japan 2014 83:136-142 [Non-Patent Document 2] NARO Research Bulletin 2017 1:1-13 Creation and evaluation of the "Japanese Wheat Core Collection" [Non-Patent Document 3] Kanto Tokai Hokuriku Agriculture Research Results Information 2015 Kanto Tokai Paddy Field Crops Division [Technology] 9 Cultivation method for high protein content of hard wheat "Tamaizumi" [Non-Patent Document 4] Proc Natl Acad Sci US A. 2017 114:E913-E921 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to solve the above-mentioned conventional problems and achieve the following objectives: That is, the present invention aims to provide a wheat genome editing method capable of introducing a deletion, insertion, or substitution into the wheat SD1 gene efficiently in a short period of time, and a method for producing wheat having an SD1 gene mutation capable of introducing a deletion, insertion, or substitution into the wheat SD1 gene efficiently in a short period of time to obtain wheat with lodging resistance. [Means for solving the problem]

[0008] As a result of intensive research by the inventors to achieve the above-mentioned object, they have found that by adopting a wheat genome editing method comprising a step of introducing a deletion, insertion or substitution into the wheat SD1 gene by genome editing means, it is possible to provide a wheat genome editing method that can introduce a deletion, insertion or substitution into the wheat SD1 gene efficiently in a short period of time, and by adopting a method for producing wheat having an SD1 gene mutation that comprises a step of introducing a deletion, insertion or substitution into the wheat SD1 gene by genome editing means and a step of growing the tissue into which the deletion, insertion or substitution has been introduced into the wheat SD1 gene to obtain a plant body, it is possible to provide a wheat production method that can introduce a deletion, insertion or substitution into the wheat SD1 gene efficiently in a short period of time to obtain wheat with lodging resistance.

[0009] The present invention is based on the above findings by the present inventors, and the means for solving the above problems are as follows. <1> A method for genome editing of wheat, comprising the step of introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means. <2> This is a method for producing wheat having an SD1 gene mutation, comprising the steps of: introducing a deletion, insertion or substitution into the SD1 gene of wheat using a genome editing means; and growing the tissue into which the deletion, insertion or substitution has been introduced into the SD1 gene of wheat to obtain a plant body. <3> This is wheat having an SD1 gene mutation, characterized in that a deletion, insertion, or substitution has been introduced into the SD1 gene. Effect of the Invention

[0010] According to the present invention, it is possible to solve the above-mentioned problems in the conventional method, achieve the above-mentioned object, and provide a method for editing the wheat genome that can introduce a deletion, insertion or substitution into the SD1 gene of wheat efficiently in a short period of time, and a method for producing wheat that can introduce a deletion, insertion or substitution into the SD1 gene of wheat efficiently in a short period of time to obtain wheat with lodging resistance. [Brief description of the drawings]

[0011] [Figure 1A] FIG. 1A is a diagram showing a phylogenetic tree of the SD1 gene family in Example 1. [Figure 1B] FIG. 1B is a diagram showing the amino acid sequences of each SD1 in the wheat A, B, and D genomes in Example 1. [Figure 1C] Figure 1C is a diagram showing target sites for genome editing in Example 2. [Figure 2A] 2A is a diagram showing the results of in vitro digestion analysis in Example 3. Lane M shows a marker, lane 1 shows a DNA fragment containing targets 1 and 3, lane 2 shows the product of target 1, lane 3 shows the product of target 3, lane 4 shows a DNA fragment containing target 2, and lane 5 shows the product of target 2. [Figure 2B] FIG. 2B is a photograph showing the wheat shoot tip after exposure in Example 4. [Figure 2C]2C shows the results of CAPS analysis at the shoot apex stage for mutation introduction by the in planta method in Example 4. Lane M shows the marker, lanes #1 to #5 show DNA derived from the shoot apex of five samples for each target (with addition of restriction enzyme), lane WT(+) shows DNA derived from the shoot apex without mutation (with addition of restriction enzyme), and lane WT(-) shows DNA derived from the shoot apex without mutation (without addition of restriction enzyme). [Figure 3A] 3A shows the results of CAPS analysis of the A genome (upper row), B genome (middle row), and D genome (lower row) at the T0 (five-leaf) stage in Example 5. Lanes H1 to H16 indicate each sample, WT / D indicates Wild-Type / Digested, and WT / U indicates Wild-Type / Untreated. [Figure 3B] FIG. 3B is a diagram showing the DNA sequencing results of each sample (H1, H3, H4, and H7) at the TO (5-leaf) stage in Example 5. [Figure 4A] FIG. 4A shows the results of CAPS analysis at the T1 plant (T1 seed) stage in Example 6. [Figure 4B] FIG. 4B is a diagram showing the results of DNA sequencing at the T1 plant (T1 seed) stage in Example 6. [Figure 4C] FIG. 4C shows the results of analysis of the expression level of the SD1 gene by RT-PCR at the T1 plant (T1 seed) stage in Example 7. [Figure 5A] FIG. 5A is a photograph showing the plant height of a wild-type line and a T2 plant in Example 8. [Figure 5B] FIG. 5B is a diagram showing the results of measuring the plant height of a wild-type line and a T2 plant in Example 8. [Figure 5C] FIG. 5C is a diagram showing the results of measuring the number and weight of seeds harvested from a wild-type line and a T2 plant in Example 8. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] (Wheat genome editing method) The wheat genome editing method of the present invention includes a step of introducing a deletion, insertion, or substitution into the wheat SD1 gene by genome editing means, and may further include other steps.

[0013] <Step of introducing deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means> The process of introducing a deletion, insertion, or substitution into the SD1 gene of wheat using the genome editing means is not particularly limited, and any known genetic engineering technique can be used, such as the Agrobacterium method, electroporation, particle gun method, PEG-calcium phosphate method, liposome method, microinjection method, whisker method, plasma method, and laser injection method.

[0014] The Agrobacterium method is not particularly limited and can be appropriately selected depending on the purpose. For example, a genome editing means is introduced into Agrobacterium by electroporation, and the Agrobacterium is infected into the shoot apex, callus, scutellum, etc. of wheat.

[0015] <<Genome editing methods>> The genome editing means is not particularly limited and can be appropriately selected depending on the purpose. For example, a combination of a guide RNA or a nucleic acid encoding the guide RNA and a nucleic acid metabolic enzyme or a nucleic acid encoding the nucleic acid metabolic enzyme can be used. Among these, from the standpoint of genome editing efficiency, a combination of a guide RNA targeting the SD1 gene or a nucleic acid encoding a guide RNA targeting the SD1 gene and a nucleic acid metabolic enzyme or a nucleic acid encoding the nucleic acid metabolic enzyme is preferred, and a combination of a guide RNA targeting the SD1 gene and a nucleic acid metabolic enzyme is more preferred.

[0016] The amino acid sequence of SD1 is not particularly limited and can be appropriately selected depending on the purpose. For example, the amino acid sequence of SD1 may be a wheat ortholog of the amino acid sequence of rice SD1 (SEQ ID NO: 1).

[0017] Examples of wheat orthologs of the amino acid sequence of rice SD1 include TRIAE CS42 3AL TGACv1 194412 AA0632590.1 (sequence number 2), TRIAE CS42 3B TGACv1 223804 AA0787660.1 (sequence number 3), and TRIAE CS42 3DL TGACv1 249609 AA0852340.1 (sequence number 4), as well as homologs thereof.

[0018] The homolog is not particularly limited and can be appropriately selected depending on the purpose, but the sequence identity with the sequence of SEQ ID NO: 1 is preferably 70% or more, more preferably 75% or more, even more preferably 80% or more, and particularly preferably 85% or more, and the sequence identity with any of the sequences of SEQ ID NOs: 2 to 4 is preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, and particularly preferably 95% or more.

[0019] The lower limit of the length of the guide RNA is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 15 nucleotides or more, more preferably 16 nucleotides or more, even more preferably 17 nucleotides or more, particularly preferably 18 nucleotides or more, even more particularly preferably 19 nucleotides or more, and most preferably 20 nucleotides or more. The upper limit of the length of the guide RNA is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 30 nucleotides or less, more preferably 25 nucleotides or less, even more preferably 22 nucleotides or less, and particularly preferably 20 nucleotides or less. The guide RNA may comprise a guide sequence fused to a tracr sequence.

[0020] The guide RNA targeting the SD1 gene is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include those produced using the primer set below, those produced using a primer set having sequence identity to the sequence of the primer set below, a sequence represented by any of the target sequences 1 to 3 below, and a sequence having sequence identity to the sequence of the target sequences 1 to 3 below. Among these, those produced using primer set 2, those produced using a primer set having sequence identity to the sequence of primer set 2, target sequence 2, and sequences having sequence identity to the sequence of target sequence 2 are preferred.

[0021] The sequence identity is not particularly limited and can be appropriately selected depending on the purpose, but 80% or more sequence identity is preferable, 85% or more sequence identity is more preferable, 90% or more sequence identity is even more preferable, and 95% or more sequence identity is particularly preferable.

[0022] Primer set 1 (F): TAATACGACTCACTATAGCGCGGTGTACGACCTCCGGA (SEQ ID NO: 5) Primer set 1 (R): TTCTAGCTCTAAAACTCCGGAGGTCGTACACCGCG (SEQ ID NO: 6) Primer set 2 (F): TAATACGACTCACTATAGGGCTGGAGGTCCTCGTCGA (SEQ ID NO: 7) Primer set 2 (R): TTCTAGCTCTAAAACTCGACGAGGACCTCCAGCC (SEQ ID NO: 8) Primer set 3 (F): TAATACGACTCACTATAGACGTGGGCGTGCTGCGCAA (SEQ ID NO: 9) Primer set 3 (R): TTCTAGCTCTAAAACTTGCGCAGCACGCCCACGT (SEQ ID NO: 10)

[0023] Target sequence 1: CCGGTGTACGACCTCCGGAGGG (SEQ ID NO: 11) Target sequence 2: GGGCTGGAGGTCCTCGTCGACGG (SEQ ID NO: 12) Target sequence 3: GGGCTGGAGGTCCTCGTCGACGG (SEQ ID NO: 13)

[0024] The SD1 gene may be mutated by inserting a foreign DNA or by substitution between the cleaved sites through recombination.

[0025] The nucleic acid metabolic enzyme is not particularly limited and can be appropriately selected depending on the purpose, and examples of the nucleic acid metabolic enzyme include nuclease, deaminase, etc. The nucleic acid metabolic enzyme may contain one or more nuclear localization signals (NLS).

[0026] The nuclease is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include CAS nuclease of the CRISPR-CAS system, zinc finger nuclease, a protein expressing zinc finger nuclease activity, TAL effector nuclease (TALEN), TARGET AID, meganuclease, etc. The nuclease may be derived from a different biological species, and for example, genes of animals, plants, microorganisms, viruses, etc., or artificially synthesized genes can be used.

[0027] The CAS nuclease is not particularly limited and can be appropriately selected depending on the purpose. Examples of the CAS nuclease include type I CRISPR enzymes, type II CRISPR enzymes, and type III CRISPR enzymes, with Cas9, which is a type II CRISPR enzyme, being preferred. The Cas nuclease may be codon-optimized for expression in eukaryotic cells. The Cas nuclease may direct one or two strand cleavage at the location of the target sequence. In another aspect of the invention, the expression of a gene product is reduced, and the gene product is a protein.

[0028] The Cas9 is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include Cas9 from Streptococcus pneumoniae, Cas9 from Streptococcus pyogenes, Cas9 from Streptococcus thermophilus, and Cas9 from Staphylococcus aureus, with Cas9 from Streptococcus pyogenes being preferred. In addition, it may be a mutant Cas9 derived from these organisms, or a D10A mutant of Cas9 known to function as a nickase (a DNA cleavage enzyme that nicks only one DNA strand), or it may be a Cas9 homolog or ortholog.

[0029] The deaminase is not particularly limited as long as it has deaminating enzyme activity and can be appropriately selected depending on the purpose. It can be added to the CRISPR-CAS system from which the nuclease activity has been removed.

[0030] The nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolic enzyme can be incorporated into a vector.

[0031] The type of the vector may be a circular plasmid, a linear DNA obtained by cutting a plasmid with a restriction enzyme or the like, a linear plasmid, a nucleic acid cassette fragment obtained by cutting out only the DNA fragment to be introduced, or a DNA fragment in which a nucleic acid of 0.8 kb or more and 1.2 kb or less is added to one or both ends of a cassette fragment. These DNA fragments may be DNA fragments amplified by PCR. In this case, the nucleic acid to be added is not particularly limited and may be a sequence derived from the vector, but is more preferably a sequence of the target site for introduction. The lower limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 0.5 kb or more, more preferably 0.8 kb or more, and even more preferably 1.0 kb or more. The upper limit of the length of the nucleic acid added to the end of the cassette fragment is preferably 3.0 kb or less, more preferably 2.0 kb or less, and even more preferably 1.5 kb or less.

[0032] Examples of the vector include pAL series (pAL51, pAL156, etc.), pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), tobacco mosaic virus (TMV), etc.

[0033] The method for inserting the target sequence into the vector is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method in which a purified nucleic acid is cleaved with an appropriate restriction enzyme, inserted into an appropriate restriction enzyme site or multicloning site of vector DNA, and ligated to the vector. In addition, the target sequence may be inserted into an intermediate vector by double cross-over recombination, or TA cloning, In-Fusion cloning, etc. may be used.

[0034] In addition to the nucleic acid encoding the guide RNA or the nucleic acid encoding the nucleic acid metabolic enzyme, for example, a promoter, an enhancer, an insulator, an intron, a terminator, a polyA addition signal, a selection marker gene, etc. can be linked to the vector.

[0035] The promoter may not be derived from a plant, as long as it functions in a plant or in plant cells and is constitutively expressed or can induce expression in a specific tissue or at a specific developmental stage of a plant. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2-35S omega promoter, the nopaline synthase gene promoter (Pnos), the ubiquitin promoter derived from maize, the actin promoter derived from rice, the PR protein promoter derived from tobacco, the ADH promoter, and the RuBisco promoter. The translation efficiency can be increased by using a sequence that enhances translation activity, for example, the omega sequence of the tobacco mosaic virus. In addition, proteins can be translated from multiple coding regions by inserting an IRES (internal ribosomal entry site) as a translation initiation region at the 3'-downstream side of the promoter and at the 5'-upstream side of the translation initiation codon.

[0036] The terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a polyA addition signal, and examples of such a terminator include the nopaline synthase (NOS) gene terminator, the octopine synthase (OCS) gene terminator, and the CaMV 35S terminator.

[0037] Examples of the selection marker gene include herbicide resistance genes (such as bialaphos resistance gene, glyphosate resistance gene (EPSPS), and sulfonylurea resistance gene (ALS)), drug resistance genes (such as tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, and neomycin resistance gene), fluorescent or luminescent reporter genes (such as luciferase, β-galactosidase, β-glucuronidase (GUS), and green fluorescent protein (GFP)), and enzyme genes such as neomycin phosphotransferase II (NPT II), and dihydrofolate reductase. However, according to the present invention, it is possible to prepare a transformant without introducing a selection marker gene.

[0038] The target sequence to be inserted into the vector may be of multiple types per vector, and the recombinant vector to be coated on the microparticle may also be of multiple types per microparticle. Alternatively, a recombinant vector containing a nucleic acid encoding the guide RNA and / or a nucleic acid encoding the nucleic acid metabolic enzyme and a recombinant vector containing a drug resistance gene may be prepared separately, mixed, coated on a microparticle, and then injected into plant tissue.

[0039] The number of target genes for genome editing may be two or more, and a vector may be constructed so that two or more target genes can be cleaved. In that case, two or more types of vectors may be prepared, and multiple guide RNAs may be inserted onto one plasmid so as to be expressed.

[0040] The guide RNA and the nucleic acid metabolic enzyme may be a combination that exists in nature, or may be a combination that does not exist in nature.

[0041] <<Method for introducing deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means>>

[0042] The tissue into which the deletion, insertion, or substitution is introduced into the wheat SD1 gene is not particularly limited and can be appropriately selected depending on the purpose. Examples of the tissue include the shoot apex, callus, and scutellum.

[0043] The method for introducing a deletion, insertion, or substitution into the SD1 gene of wheat is not particularly limited and can be selected appropriately depending on the purpose, but a method in which microparticles coated with the genome editing means are shot into the apex of the wheat stem is preferred.

[0044] The shoot apex includes the growing point at the tip of the stem (shoot apical meristem), as well as a growing point and tissue consisting of several leaf primordia arising from the growing point. In the present invention, only the hemispherical (dome-shaped) growing point from which the leaf primordia have been removed may be used as the shoot apex, or the shoot apex including the growing point and the leaf primordia or plant tissue including the shoot apex may be used; however, it is preferable to use the growing point from which the leaf primordia have been removed in order to obtain virus-free tissue.

[0045] The cells to be introduced are not particularly limited and can be appropriately selected depending on the purpose, but are preferably cells of the shoot apical meristem, more preferably L2 cells in the L2 layer in the shoot apical meristem, and even more preferably cells that transition to the germ cell lineage in the shoot apical meristem. The germ cell lineage is a general term for germ cells ranging from primordial germ cells, which are the source of germ cells, to the final products, egg cells and sperm cells, and the L2 layer is the second outer cell layer of the shoot apical meristem.

[0046] The shoot apex is not particularly limited and may be appropriately selected depending on the purpose, but is preferably the shoot apex of a mature seed embryo or the shoot apex of an immature embryo. The fully ripe seed embryo (fully ripe embryo) is the embryo of a fully ripe seed, and the fully ripe seed refers to a seed that has completed the ripening process after pollination and is fully ripe as a seed. Whether or not the ripening process has completed can be determined by whether or not the moisture content of the seed is 35% or less. The immature embryo is an embryo of an immature seed, and the immature seed is a seed that is not fully matured. As described above, whether a seed is immature or not can be determined based on the degree of maturity of the seed (whether the moisture content of the seed is greater than 35%).

[0047] The shoot apex of the immature embryo is not particularly limited and can be appropriately selected depending on the purpose, but is preferably an apex of an embryo 8 to 35 days after pollination, more preferably an apex of an embryo 10 to 20 days after pollination, and even more preferably an apex of an embryo 15 to 20 days after pollination.

[0048] The seeds are not particularly limited and can be appropriately selected depending on the purpose. Examples of the seeds include natural seeds and artificial seeds, with natural seeds being preferred. Examples of the natural seeds include seeds obtained by cultivating (or culturing) under natural or similar conditions, seeds obtained by greenhouse cultivation, and seeds obtained from tissue cultures such as in vitro seedlings. The artificial seeds include those that will be developed in the future, so long as they can obtain transformable shoot tips.

[0049] The method for exposing the shoot apex is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method of removing endosperm, coleoptile, leaf primordia, and excess scutellum from ripe or immature seeds. Specifically, the shoot apex is exposed by removing the coleoptile and leaf primordia from ripe or immature seeds, and then the endosperm and excess scutellum are excised, and the embryo and scutellum including the exposed shoot apex are placed on an agar medium with the shoot apex facing upward.

[0050] The means for removing the coleoptiles and leaf primordia, or the seed coat and cotyledons, is not particularly limited as long as it is capable of removing the coleoptiles and leaf primordia, or the seed coat and cotyledons under a stereomicroscope, and examples thereof include a puncturing instrument such as a needle with a diameter of about 0.2 mm, tweezers, a pipette, a syringe, and cutting instruments such as a scalpel and a cutter. The endosperm and the excess scutellum can be removed using a cutting tool such as a scalpel. In order to obtain a virus-free shoot apex, it is preferable to replace the scalpel with a new sterile scalpel at the final stage of cutting out the shoot apex. In this case, a virus-free transformant can be obtained.

[0051] <<Method of coating microparticles with genome editing techniques>> In the method of injecting microparticles coated with the genome editing means into the apex of wheat, the microparticles coated with the genome editing means can be obtained by coating a microparticle with the genome editing means. The microparticles (microcarriers) are not particularly limited and can be appropriately selected depending on the purpose. From the viewpoint of increasing the penetrating power into cells at the time of injection, however, it is preferable to use microparticles having a high specific gravity, which are chemically inactive and unlikely to cause harm to living organisms, such as metal microparticles, ceramic microparticles, and glass microparticles. The metal fine particles are not particularly limited and may be appropriately selected depending on the purpose. Examples of the metal fine particles include simple metal fine particles and alloy fine particles. The metal particles are preferably gold particles, tungsten particles, or the like.

[0052] The lower limit of the average particle size of the fine particles is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 0.3 μm or more, more preferably 0.4 μm or more, even more preferably 0.5 μm or more, and particularly preferably 0.6 μm. The upper limit of the average particle size of the microparticles is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 1.5 μm or less, more preferably 1.4 μm or less, even more preferably 1.3 μm or less, particularly preferably 1.2 μm or less, even more particularly preferably 1.1 μm, and most preferably 1.0 μm or less. The average particle size is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a number average particle size.

[0053] The shape of the fine particles is not particularly limited and can be appropriately selected depending on the purpose. Examples of the shape include spherical, cubic, rod-like, and plate-like shapes, with the spherical shape being preferred.

[0054] The method of coating is not particularly limited and can be appropriately selected depending on the purpose. The method of coating can be, for example, washing and sterilizing the microparticles, and then coating the microparticles, nucleic acid (recombinant vector, linear DNA, RNA, etc.) and / or protein, CaCl 2 For example, spermidine or the like is added while stirring using a vortex mixer or the like to coat (cover) the microparticles with nucleic acid and / or protein, and then the microparticles are washed with ethanol or phosphate buffered saline (PBS, etc.).

[0055] The microparticles can be applied as uniformly as possible to the macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench. In the case of protein-coated microparticles, it is preferable to use a hydrophilic macrocarrier film.

[0056] The hydrophilic macrocarrier film may be prepared by attaching a hydrophilic film to the macrocarrier film, or by applying a hydrophilic coating to the macrocarrier film. Methods for making a film hydrophilic include those that use surfactants, photocatalysts, and hydrophilic polymers.

[0057] The hydrophilic polymer is not particularly limited and can be appropriately selected depending on the purpose. Examples of the hydrophilic polymer include polymers of hydrophilic monomers such as polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethane ammonium.

[0058] The coverage of the fine particles is not particularly limited and can be appropriately selected depending on the purpose. The coverage may be the entire surface of the fine particles or a part of the surface.

[0059] The means for shooting the microparticles is not particularly limited as long as it can shoot the microparticles into the plant cells, and examples thereof include a particle gun (gene gun) in the particle gun method. In terms of the efficiency of introduction into the plant body, a method of introducing the genome editing means into a mature seed embryo or an immature seed embryo using the particle gun method is preferable. The particle gun method is a method in which the genome editing means is coated on the microparticles and shot into cell tissue, and is effective when the infection efficiency of Agrobacterium is low, such as in monocotyledonous plants.

[0060] The genome editing method using the particle gun method is not particularly limited and can be appropriately selected according to the purpose, for example, a method in which a macrocarrier film coated with microparticles, a plate on which a target mature embryo or an immature embryo's shoot tip is placed, is placed in a particle gun device, and high-pressure gas is fired from a gas acceleration tube toward the macrocarrier film. The macrocarrier film stops at a stopping plate, but the microparticles coated on the macrocarrier film pass through the stopping plate and penetrate into the target placed under the stopping plate, and the target gene is introduced.

[0061] The high pressure gas is not particularly limited and can be appropriately selected depending on the purpose. For example, helium is included.

[0062] The particle gun device is not particularly limited and can be appropriately selected depending on the purpose. Examples of the particle gun device include Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD).

[0063] The upper limit of the distance between the stopping plate and the target shoot apex is, for example, preferably 9 cm or less, more preferably 8 cm or less, even more preferably 7 cm or less, and particularly preferably 6 cm or less. The lower limit of the distance between the stopping plate and the target shoot apex is, for example, preferably 2 cm or more, more preferably 3 cm or more, and even more preferably 4 cm or more.

[0064] The gas pressure of the particle gun device depends on the type of fine particles, and is preferably, for example, 1,100 to 1,600 psi, and more preferably 1,200 to 1,500 psi.

[0065] The lower limit of the number of times that the fine particles are shot at the shoot apex is preferably 2 times or more, more preferably 3 times or more, and even more preferably 4 times or more. The upper limit of the number of times that the fine particles are shot at the shoot tip is preferably 20 times or less, more preferably 15 times or less, and even more preferably 10 times or less.

[0066] In the genome editing method of the present invention, in a cell bombarded with microparticles, the guide RNA, the nucleic acid metabolic enzyme, or the nucleic acid encoding these, etc., contained in the genome editing means are released from the microparticles, and in the case of nucleic acid, the nucleic acid is transferred to the nucleus and expresses the nucleic acid metabolic enzyme, which cuts the genomic DNA, and a mutation occurs during the repair process to obtain a genome-edited cell. In the case of nucleic acid metabolic enzyme, the nucleic acid is transferred to the nucleus (organelle) by a nuclear transport signal (which may be an organelle transport signal) and cuts the DNA, thereby causing genome editing. In the cells bombarded with the microparticles, the genome editing means is released from the microparticles, and the nucleic acid or the like is integrated into the genome DNA to obtain a transformed cell. However, when a nucleic acid that grows in a plasmid form such as a geminivirus or an artificial chromosome is introduced, transformation without integration may occur.

[0067] <Other processes> The other steps are not particularly limited and can be appropriately selected depending on the purpose. For example, there can be mentioned a water absorption step before the exposure of the stem apex.

[0068] -Water absorption process before the shoot tip is exposed- Before the shoot apex is exposed, ripe or immature seeds can be imbibed with water. If necessary, vernalization (breaking dormancy) can be performed before imbibing with water. Water absorption can be achieved by soaking the seeds in water and incubating them. Alternatively, the seeds may be incubated on an agar medium after removing the endosperm and other components. The water absorption temperature is preferably 15 to 25°C. At this time, the water may be exchanged one or more times. The water absorption period is preferably until the root starts to elongate (roots of 1 mm or less) or until new leaf primordia are formed. In terms of the water absorption time, it is less than 16 hours after water absorption, and preferably 12 hours, depending on the dormancy state of the seeds. This water absorption process softens the seeds, making it easier to expose the shoot apex.

[0069] The vernalization treatment is not particularly limited and can be appropriately selected depending on the purpose. For example, the treatment can be performed at 4° C. for 2 days.

[0070] (Method for producing wheat with SD1 gene mutation) The method for producing wheat having an SD gene mutation of the present invention includes a step of introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means, and a step of growing the tissue into which the deletion, insertion, or substitution has been introduced into the SD1 gene of wheat to obtain a plant body, and may further include other steps.

[0071] The process of introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means is as described above. - A process of growing tissue into which a deletion, insertion or substitution has been introduced into the SD1 gene of wheat, and obtaining a plant body -

[0072] The growing method is not particularly limited and can be appropriately selected depending on the purpose. For example, the method includes growing the shoot apex, callus, scutellum, and other tissues of the mature or immature embryos that have been subjected to the introduction treatment on an agar medium for about one month and then transplanting them into soil. In the case of introduction into the shoot apex, a transformant can be obtained by growing the plant in a normal medium without applying selective pressure using drugs (not including antibiotics, plant hormones, etc.), but a drug resistance gene may also be further introduced. In the genome editing method of the present invention, a genome-edited individual can also be selected by simultaneously introducing a nuclease and a drug resistance gene. When a drug resistance gene is introduced, the transformed cells can be selectively cultured using a drug. As a selective drug suitable for shoot apex culture, for example, the sulfonylurea herbicide chlorosulfuron (resistance can be acquired by introducing a mutant ALS gene (acetobutyric acid synthase gene)) is known.

[0073] When a drug resistance gene is introduced, the drug resistance gene may be on the same vector as the target gene or the nuclease gene, or on a different vector. When the drug resistance gene is inserted on a different vector, if they are integrated into different chromosomes, there is an advantage that the plant individual into which the target gene has been introduced or the genome-edited plant individual and the plant individual having the drug resistance gene can be separated by self-pollination or backcrossing to obtain progeny.

[0074] <Other processes> - A process for selecting genome-edited plants from plants - The method for selecting a genome-edited plant from the plant is not particularly limited and can be appropriately selected depending on the purpose. Examples of the method include a method in which DNA is extracted from the individual after the introduction or the grown individual after the introduction, and an individual in which the target gene has been genome-edited is selected by PCR and / or electrophoresis, Southern blotting, or CAPS analysis, a method in which the presence or absence of RNA expressed from the target gene is examined, and a method in which the presence or absence of protein expressed from the target gene is examined. The presence or absence of the RNA can be confirmed, for example, by RT-PCR, etc. It may also be detected by Northern blotting. The presence or absence of the protein can be confirmed, for example, by staining of plant sections, electrophoresis, ELISA, RIA, dot immunobinding assay, and / or Western blotting.

[0075] -The process of growing genome-edited plants- The method for growing the genome-edited plant body is not particularly limited and can be appropriately selected depending on the purpose. For example, the germinated seeds can be grown in an artificial climate chamber at 20°C under a long-day environment (16 hL / 8 hD).

[0076] By the above-mentioned method, a genome-edited plant can be produced and the plant can be grown. Furthermore, the plant produced in this manner stably expresses the trait of the target gene or the genome-edited gene, or the expression of the target gene is suppressed, and the trait is normally inherited (transmitted) to progeny.

[0077] The genome editing efficiency of wheat can be determined by extracting DNA from the individual after the introduction or from grown individuals after the introduction, and detecting whether or not the target gene has been genome-edited by PCR and / or electrophoresis, Southern blotting, or CAPS analysis. The genome editing efficiency is calculated from the number of explants used for the introduction and the number of grown individuals in which the target gene has been genome-edited.

[0078] The in planta transformation method is generally a transformation method that does not involve tissue culture manipulation, and is a method in which cells at the meristem site of a plant are transformed while the plant is still growing. However, in this specification, the in planta transformation method is used to mean that it includes only tissue culture methods that use shoot apex culture, and does not include methods that involve other tissue culture manipulations. The in plant method has the same meaning.

[0079] (Wheat with SD1 gene mutation) Wheat having an SD1 gene mutation of the present invention can be obtained by the above-mentioned wheat genome editing method or the above-mentioned method for producing wheat having an SD1 gene mutation. The wheat having an SD1 gene mutation of the present invention has a deletion, insertion, or substitution introduced into the SD1 gene. The wheat having the SD1 gene mutation preferably has a deletion, insertion or substitution introduced into the SD1 gene in the entire ABD genome.

[0080] The upper limit of the culm length of wheat having the SD1 gene mutation is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 85 cm or less, more preferably 80 cm or less, and even more preferably 75 cm or less. The lower limit of the culm length of wheat having the SD1 gene mutation is not particularly limited and can be appropriately selected depending on the purpose, but is preferably 60 cm or more. EXAMPLES

[0081] Examples of the present invention will be described below, but the present invention is not limited to these examples.

[0082] <Example 1: Obtaining the wheat SD1 gene sequence> Protein sequence information of wheat GA20ox was obtained using the Gramene database (http: / / www.gramene.org / ) and compared with rice GA20ox1, GA20ox2, GA20ox3, and GA20ox4. A phylogenetic tree was constructed using the neighbor-joining method, and the phylogenetic tree was classified into four clades consisting of wheat (A, B, and D genomes) and rice proteins (Figure 1A). The bootstrap value was calculated at 1,000. The amino acid sequences of SD1 in the wheat A, B, and D genomes, TRIAE CS42 3AL TGACv1 194412 AA0632590.1 (SEQ ID NO: 2), TRIAE CS42 3B TGACv1 223804 AA0787660.1 (SEQ ID NO: 3), and TRIAE CS42 3DL TGACv1 249609 AA0852340.1 (SEQ ID NO: 4), showed 77-78% identity with rice SD1 (SEQ ID NO: 1) (Figure 1B).

[0083] <Example 2: Selection of target sequence for genome editing> As shown in Figure 1C, wheat SD1 consists of three exons, and targets 1 to 3, represented by target sequence 1, target sequence 2, and target sequence 3 below, were determined as target sites for genome editing from sequences common to each SD1 gene in the wheat A, B, and D genomes (Figure 1C). Targets 1 and 3 were designed in exon 1, and target 2 was designed in exon 2. Target sequences 1, 2, and 3 were each designed so that a restriction enzyme recognition sequence was adjacent to the PAM sequence.

[0084] Target sequence 1: CCGGTGTACGACCTCCGGAGGG (SEQ ID NO: 11) Target sequence 2: GGGCTGGAGGTCCTCGTCGACGG (SEQ ID NO: 12) Target sequence 3: GGGCTGGAGGTCCTCGTCGACGG (SEQ ID NO: 13)

[0085] <Example 3: In vitro digestion analysis> The efficiency of the designed sgRNA was confirmed by in vitro digestion.

[0086] <<Example 3-1: Amplification of DNA fragments containing target sequences by PCR>> Using wheat genomic DNA, sequences common to the A, B, and D genomes were selected, and PCR fragments of approximately 300 bp containing each target site were amplified. The PCR reaction solution contained 20 ng of genomic DNA, 0.25 U of TaKaRa LA Taq with GC buffer (registered trademark, TaKaRa), 5.0 μL of 2X GC Buffer I, 2.5 mM dNTPs, and 2.5 pmol of each of the following primer pairs, and was filled up to a total of 10 μL with sterile distilled water.

[0087] Primer sequence (F) (targets 1 and 3): TCCCAGCATTGACCCGTTCG (SEQ ID NO: 14) Primer sequence (R) (targets 1 and 3): ACACCTGGAAGAACCCGTGC (SEQ ID NO: 15) Primer sequence (F) (target 2): CGGACAGCAGCTCCATCATG (SEQ ID NO: 16) Primer sequence (R) (Target 2): GGTGTCGCCGATGTTGATGA (SEQ ID NO: 17)

[0088] <<Example 3-2: Preparation of sgRNA>> sgRNA was prepared using the GeneArt™ Precision gRNA synthesis kit (Thermo Fisher Scientific, USA) according to the kit's protocol. The following primer sets were used for sgRNA targets 1, 2, and 3.

[0089] Primer set 1 (F): Target 1: TAATACGACTCACTATAGCGCGGTGTACGACCTCCGGA (SEQ ID NO: 5) Primer set 1(R): Target 1: TTCTAGCTCTAAAACTCCGGAGGTCGTACACCGCG (SEQ ID NO: 6) Primer set 2 (F): Target 2: TAATACGACTCACTATAGGGCTGGAGGTCCTCGTCGA (SEQ ID NO: 7) Primer set 2 (R): Target 2: TTCTAGCTCTAAAACTCGACGAGGACCTCCAGCC (SEQ ID NO: 8) Primer set 3 (F): Target 3: TAATACGACTCACTATAGACGTGGGCGTGCTGCGCAA (SEQ ID NO: 9) Primer set 3 (R): Target 3: TTCTAGCTCTAAAACTTGCGCAGCACGCCCACGT (SEQ ID NO: 10)

[0090] <<Example 3-3: Preparation of CRISPR / Cas9RNP>> Cas9 protein (0.2 μg) and sgRNA (0.2 μg) were mixed and incubated at 25° C. for 10 minutes. Then, 1,4-bis(3-oleoylamidopropyl)piperazine and histone H1 protein mixture (ratio 3:1) (1 μL) was added and incubated at 25° C. for 5 minutes. The Cas9 protein used was prepared by producing recombinant SpCas9 protein using Escherichia coli, then disrupting the cells and purifying the protein.

[0091] <<Example 3-4: In vitro digestion>> The DNA fragment (100-200 ng) containing the CRISPR / Cas9RNP and target sequence 1, 2, or 3 was mixed with 1.0 μL of CutSmart buffer (registered trademark, New England BioLabs) to make a total of 10 μL, and incubated at 37° C. for 1 hour. The reaction was stopped by heating at 100° C. for 5 minutes. The products were electrophoresed on a 3% agarose gel, and the DNA fragment containing target sequence 1 was hardly degraded (lane 2 in Fig. 2A), the DNA fragment containing target sequence 3 was slightly degraded (lane 3 in Fig. 2A), and the DNA fragment containing target sequence 2 was completely degraded (lane 5 in Fig. 2A). These results suggest that CRISPR / Cas9RNP, which cleaves target 2, is efficient in in vitro digestion.

[0092] <Example 4: Confirmation of mutation introduction at the shoot apex stage by in plant method> In order to examine the efficiency of mutation introduction in plants, mutation introduction at the shoot apex stage was examined for the above targets 1, 2, and 3 by the in plant method using a particle gun.

[0093] <<Example 4-1: Preparation of mature embryos>> The fully ripe wheat seeds (Haruyokoi) were immersed in bleach (6% hypochlorous acid, Kao Corporation), shaken at 25°C for 10 minutes, and then washed with sterile water in a clean bench. After washing, the seeds were placed on a Kimtowel moistened with sterile water and incubated at 4°C for 2 days to break dormancy. They were then incubated at 25°C for approximately 12 hours and used in the following experiment.

[0094] <<Example 4-2: Exposure of shoot apex in fully mature seed embryo>> Under a stereomicroscope, the coleoptile and the first to third leaf primordia of the embryo part of the germinated seed were removed using the tip of a needle (0.20 mm in diameter). Then, the endosperm and excess scutellum were removed using a sterilized knife to completely expose the shoot apex. A photograph showing the exposed wheat shoot apex is shown in Figure 2B. In Figure 2B, the GFP gene was introduced into the shoot apex. The introduced gene was a plasmid DNA (pUC-based plasmid) containing the fluorescent reporter gene GFP (S65T). The gene was designed to be expressed under the control of the maize ubiquitin promoter and the first intron. The terminator was the nopaline synthase (NOS) gene terminator. The embryos with the shoot apex completely exposed were placed on MS-maltose medium (4.3 g / L MS salt, ×1 MS vitamin (Sigma), 30 g / L maltose, 0.98 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 7.0 g / L phytagel (registered trademark, Sigma-Aldrich, pH 5.8) so as to form a circle with a diameter of 1.0 cm from the center of the plate (30 pieces / plate).

[0095] <<Example 4-3: Preparation of gold particles>> 90 mg of gold particles with an average particle size of 0.6 μm (InBio Gold, Australia) was weighed out, 500 μL of 70% ethanol was added, and the mixture was thoroughly suspended by vortexing. The gold particles were then precipitated by centrifugation, and the ethanol was removed. Then, 500 μL of RNA-free water was added to obtain an RNA-free gold particle solution.

[0096] <<Example 4-4: Preparation of sgRNA>> The procedure was the same as in Example 3-2.

[0097] <<Example 4-5: Preparation of CRISPR / Cas9RNP-gold particles>> Cas9 protein (12 μg), sgRNA (5 μg), RNase Inhibitor (40 U) (registered trademark, TaKaRa), and CutSmart Buffer (5 μL) (registered trademark, New England BioLabs) were mixed and incubated at 25° C. for 10 minutes to prepare CRISPR / Cas9RNP. The Cas9 protein used was prepared by producing recombinant SpCas9 protein using Escherichia coli, then disrupting the cells and purifying the protein. Then, 1,4-bis(3-oleoylamidopropyl)piperazine and histone H1 protein mixture (ratio 3:1) (5 μL) was added and incubated at 25 °C for 5 minutes, and further, the gold particles (270 μg) with an average particle size of 0.6 μm were added and incubated on ice for 10 minutes. Then, centrifugation was performed, and RNA-free water (20 μL) was added again to the gold particles from which the supernatant was removed. 6 μL was poured into the center of a macrocarrier (manufactured by Bio-Rad) in a clean bench and air-dried.

[0098] <<Example 4-6: Gene transfer>> Using a particle gun (Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD)), the gold particles were shot three times per petri dish. The pressure during shooting was about 94.9 kgf / cm2 (1,350 psi), and the distance to the target tissue was 6 cm. After shooting, the specimen was left to stand overnight at 22°C in a dark place.

[0099] <<Example 4-7: Examination of mutation introduction using CRISPR / Cas9 in shoot apical tissue>> To confirm the mutagenesis by the in planta particle bombardment (iPB) method, genomic DNA was extracted from the shoot apex two days after iPB and confirmed by CAPS analysis. For each target, five shoot apexes were sampled and analyzed as one sample (e.g., #1) (#1 to #5 in Figure 2C).

[0100] <<<Example 4-7-1: Extraction of genomic DNA>>> Shoot tips were removed from the plants using a needle, and 10 μL of buffer (0.1 M Tris-HCl (pH 9.5), 1 M KCl, 10 mM EDTA) was added thereto, followed by heating at 95° C. for 10 minutes, which was then used as a PCR template.

[0101] <<<Example 4-7-2: Amplification of DNA fragments containing target sequences by PCR>>> The procedure was the same as in Example 3-1.

[0102] <<<Example 4-7-3: Confirmation of mutation introduction by cleaved amplified polymorphic sequences (CAPS)>>> 2 μL of the PCR amplified DNA fragment, 0.5 μL of CutSmart Buffer, and 0.2 μL of restriction enzymes (Target 1: BspEI; Target 2: SalI; Target 3: FspI) (registered trademark, New England BioLabs) were filled up to 5 μL with sterile water and digested at 37° C. for 5 hours. The digested products were electrophoresed on a 3% agarose gel, and no mutations were found in the samples of Target 1 and Target 3 (upper and lower rows of Fig. 2C). In lane 4 (M4) of Target 2, residual DNA fragments were found (middle row of Fig. 2C). From the above, it was found that genome editing was efficient when the target sequence of Target 2 was used in the in plant method.

[0103] <Example 5: Confirmation of mutation introduction at the T0 (5-leaf) stage> <<Examples 5-1 to 5-6>> Preparation of mature embryos, exposure of the shoot apex in fully ripe seed embryos, preparation of gold particles, preparation of sgRNA, preparation of CRISPR / Cas9RNP-gold particles, and gene transfer were performed in the same manner as in Examples 4-1 to 4-6.

[0104] <<Example 5-7: Examination of mutation introduction by CRISPR / Cas9 at the T0 (5-leaf) stage>> To confirm the introduction of mutations at T0 (five leaves) after the iPB method, the plants were grown until they had five leaves after iPB using target 2, and genomic DNA was extracted from the plants and subjected to CAPS analysis.

[0105] <<<Examples 5-7-1 to 5-7-2>>> Amplification of a DNA fragment containing a target by PCR was carried out in the same manner as in Examples 4-7-1 and 4-7-2.

[0106] <<<Example 5-7-3: Confirmation of mutation introduction by cleaved amplified polymorphic sequences (CAPS)>>> 2 μL of the DNA fragment amplified by PCR, 0.5 μL of CutSmart Buffer, and 0.2 μL of the restriction enzyme (SalI) (registered trademark, New England BioLabs) were filled up to 5 μL with sterile water and digested at 37° C. for 5 hours. The digestion products were confirmed by electrophoresis on a 3% agarose gel.

[0107] As described above, CRISPR / Cas9RNP was introduced into the shoot apical tissue by the iPB method, genomic DNA was extracted from the 5th leaf after growth, DNA fragments were prepared using primers specific to the A, B, and D genomes (SEQ ID NOs: 16, 18 to 20) below, and the introduction of mutations into each genomic DNA was confirmed by the CAPS method. For each genome, 16 samples (H1 to H16) were analyzed. CAPS analysis of the A, B, and D genomes confirmed that some of them had residual fragments due to the introduction of mutations (Figure 3A). Among them, the DNA sequences of H1, H3, H4, and H7 were confirmed by the Sanger method (Figure 3B, SEQ ID NOs: 21 to 32). Many of these were substitutions with single-base insertions, but a 3-base deletion (SEQ ID NO: 25) was confirmed in the H3-D genome, and a 73-base deletion was confirmed in the H7-A genome. In this way, it was confirmed that the introduction of mutations into the shoot apical tissue by the iPB method also caused mutations in the plant body that was generated by subsequent differentiation.

[0108] A genome (F): CGGACAGCAGCTCCATCATG (SEQ ID NO: 16) A genome (R): CTGATACGAGCAGCAGTAGC (SEQ ID NO: 18) B genome (F): CGGACAGCAGCTCCATCATG (SEQ ID NO: 16) B genome (R): GCAAGGAAGGTGACCCAATT (SEQ ID NO: 19) D genome (F): CGGACAGCAGCTCCATCATG (SEQ ID NO: 16) D Genome (R): AGCAACGCTGAGAGAGGAGT (SEQ ID NO: 20)

[0109] <Example 6: Confirmation of mutation introduction at the T1 plant (T1 seed) stage> In order to confirm whether the mutations introduced into the plant obtained in Example 6 were inherited by the T1 seeds, the T1 seeds were germinated, and genomic DNA was extracted from the first leaves that grew therefrom. In the same manner as in Example 6, DNA fragments were prepared using primers specific to the A, B, and D genomes, and the introduction of mutations into each genomic DNA was confirmed by the CAPS method. In plant H7_1, the CAPS analysis confirmed the presence of residual fragments in all of the A, B, and D genomes (Fig. 4A). The sequences were confirmed by the Sanger method, and it was confirmed that there was an insertion substitution of one adenine base in the A genome (sequence number 33), an insertion substitution of one thymine base in the B genome (sequence number 34), and an insertion substitution of one adenine base in the D genome (sequence number 35) (Fig. 4B).

[0110] <Example 7: Confirmation of expression level of SD1 gene by RT-PCR at T1 plant (T1 seed) stage> The T1 seeds were germinated, transplanted into soil and grown, and then RNA was extracted from five leaves that showed differences in leaf growth, and the expression of the SD1 gene was confirmed by RT-PCR. RNA was extracted using the RNeasy Mini kit (Qiagen), and cDNA was prepared using PrimeScript II Reverse Transcriptase (TaKaRa). The PCR reaction solution contained 20 ng of genomic DNA, 0.25 U of TaKaRa LA Taq with GC buffer (registered trademark, TaKaRa), 5.0 μL of 2X GC Buffer I, 2.5 mM dNTPs, and 2.5 pmol of each of the following primer pairs, and was filled up to a total of 10 μL with sterile distilled water.

[0111] Primer (SD1; F): TCATCAACATCGGCGACACC (SEQ ID NO: 36) Primer (SD1; R): GCACGTGGGCTGGTCCCGACA (SEQ ID NO: 37) Primer (18s rRNA; F): GTGACGGGTGACGGAGAATT (SEQ ID NO: 38) Primer (18s rRNA; R): GACACTAATGCGCCCGGTAT (SEQ ID NO: 39)

[0112] The RT-PCR amplified products were confirmed by electrophoresis using a 3% agarose gel (FIG. 4C). Target 2 targets exon 2 of SD1. The primers for RT-PCR were designed to amplify exon 3, sandwiching an intron, downstream of the mutation site in exon 2 (Fig. 4C). As described above, RT-PCR was performed using cDNA that was reverse transcribed from RNA extracted from five leaves of the WT and mutant with different growth patterns. Similar bands were confirmed for the positive control 18s rRNA in both the WT and the mutant, but while a clear band was present in the WT for SD1, no band was detected in the mutant.

[0113] Table 1 shows the efficiency of mutation introduction in the wheat genome editing method. CRISPR / Cas9RNP, which introduces mutations into target 2 of the SD1 gene, was introduced into the shoot apical tissue of 232 mature seeds. Of the five leaves at T0, mutation introduction was confirmed in 16 (6.7%). Of those, mutations were observed in two (0.9%) of the T1 seeds (Table 1).

[0114] [Table 1]

[0115] <Example 8: Confirmation of culm length and yield in T2 plants> T2 seeds (sd1 mutant) obtained from the T1 plants of Example 7 and germinated seeds of the original variety "Haruyokoi" were grown at 20°C in a long-day environment (16hL / 8hD) in an artificial climate chamber for approximately 120 days, and the plant height of the T2 plants is shown in Figures 5A and 5B. The two strains on the left in Figure 5A are sd1 mutants (sd1), and the two strains on the right are wild-type strains (WT: Haruyokoi). The left bar in Figure 5B is sd1 mutants (sd1), and the right bar is wild-type strain (WT: Haruyokoi).

[0116] The number and weight of seeds harvested from the T2 plants and the number and weight of seeds of the original cultivar, "Haruyokoi," were measured and are shown in FIG. 5C. As shown in Figures 5A and 5B, although the sd1 mutant becomes semi-dwarf, the results in Figure 5C indicate that there is no difference in seed yield (number of seeds and weight) compared to the original cultivar, Haruyokoi.

[0117] Examples of aspects of the present invention include the following. <1> A method for genome editing of wheat, comprising the step of introducing a deletion, insertion, or substitution into the SD1 gene of wheat by genome editing means. <2> The step of introducing a deletion, insertion, or substitution into the SD1 gene of wheat is a step of shooting microparticles coated with the genome editing means into the apex of wheat. <1> This is a method for genome editing of wheat described in. <3> The genome editing means comprises either a guide RNA targeting the SD1 gene or a nucleic acid encoding the guide RNA targeting the SD1 gene, and either a nucleic acid metabolic enzyme or a nucleic acid encoding the nucleic acid metabolic enzyme. <1> from <2> 1. A method for genome editing of wheat according to any one of claims 1 to 9. <4> The nucleic acid metabolic enzyme is a nuclease or a deaminase. <3> This is a method for genome editing of wheat described in. <5> The average particle size of the fine particles is 0.3 μm or more and 1.5 μm or less. <2> from <4> 1. A method for genome editing of wheat according to any one of claims 1 to 9. <6> The wheat shoot apex is the shoot apex of the mature seed embryo, and the shoot apex of the mature seed embryo is the shoot apex exposed by removing endosperm, coleoptile, leaf primordia, and excess scutellum from the mature seed. <2> from <5> 1. A method for genome editing of wheat according to any one of claims 1 to 9. <7> The wheat shoot apex is an apex of an immature embryo, and the apex of the immature embryo is an apex exposed by removing endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination. <2> from <5> 1. A method for genome editing of wheat according to any one of claims 1 to 9. <8> This is a method for producing wheat having an SD1 gene mutation, comprising the steps of: introducing a deletion, insertion or substitution into the SD1 gene of wheat using a genome editing means; and growing the tissue into which the deletion, insertion or substitution has been introduced into the SD1 gene of wheat to obtain a plant body. <9> The step of introducing a deletion, insertion, or substitution into the SD1 gene of wheat is a step of shooting microparticles coated with the genome editing means into the apex of wheat. <8> This is a method for genome editing of wheat described in. <10> The method further comprises the step of selecting a genome-edited plant from the plant. <8> from <9> The present invention relates to a method for producing wheat having an SD1 gene mutation described in any one of the above. <11> The method further comprises the step of growing the genome-edited plant. <8> from <10> The present invention relates to a method for producing wheat having an SD1 gene mutation described in any one of the above. <12> This is wheat having an SD1 gene mutation, characterized in that a deletion, insertion, or substitution has been introduced into the SD1 gene. <13> In the ABD whole genome, a deletion, insertion, or substitution is introduced into the SD1 gene, <12> The wheat described in is <14> The culm length is 85 cm or less. <12> from <13> The wheat according to any one of the preceding claims.

Claims

1. A genome editing method for semi-dwarf wheat, comprising a step of introducing a deletion, insertion, or substitution into the SD1 gene of semi-dwarf wheat having a mutation in the Rht gene by genome editing means.

2. The genome editing method for semi-dwarf wheat described in claim 1, wherein the process of introducing a deletion, insertion, or substitution into the SD1 gene of semi-dwarf wheat having a mutation in the Rht gene is a process of shooting microparticles coated with the genome editing means into the apex of the semi-dwarf wheat having a mutation in the Rht gene.

3. The genome editing method for semi-dwarf wheat described in any one of claims 1 to 2, wherein the genome editing means includes either a guide RNA targeting the SD1 gene of a semi-dwarf wheat having a mutation in the Rht gene, or a nucleic acid encoding the guide RNA targeting the SD1 gene of a semi-dwarf wheat having a mutation in the Rht gene, and either a nucleic acid metabolic enzyme, or a nucleic acid encoding the nucleic acid metabolic enzyme.

4. The genome editing method for semi-dwarf wheat described in claim 3, wherein the nucleic acid metabolic enzyme is a nuclease or a deaminase.

5. A genome editing method for semi-dwarf wheat according to any one of claims 2 to 4, wherein the average particle size of the microparticles is 0.3 μm or more and 1.5 μm or less.

6. A genome editing method for semi-dwarf wheat according to any one of claims 2 to 5, wherein the shoot apex of the semi-dwarf wheat having a mutation in the Rht gene is the shoot apex of a ripe seed embryo, and the shoot apex of the ripe seed embryo is the shoot apex exposed by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from a ripe seed.

7. The genome editing method for semi-dwarf wheat according to any one of claims 2 to 5, wherein the shoot apex of the semi-dwarf wheat having a mutation in the Rht gene is the shoot apex of an immature embryo, and the shoot apex of the immature embryo is an exposed shoot apex obtained by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination.

8. A genome editing method for semi-dwarf wheat described in any one of claims 1 to 7, comprising introducing a deletion, insertion, or substitution into the SD1 gene in the entire ABD genome.

9. A genome editing method for semi-dwarf wheat described in any of claims 3 to 8, wherein the guide RNA is a sequence represented by SEQ ID NO: 11 or a sequence having 90% or more sequence identity to the sequence represented by SEQ ID NO: 11, a sequence represented by SEQ ID NO: 12 or a sequence having 90% or more sequence identity to the sequence represented by SEQ ID NO: 12, or a sequence represented by SEQ ID NO: 13 or a sequence having 90% or more sequence identity to the sequence represented by SEQ ID NO:

13.

10. A genome editing method for semi-dwarf wheat described in any of claims 1 to 9, comprising the step of introducing a deletion, insertion, or substitution into the SD1 gene of semi-dwarf wheat having a mutation in the Rht gene, thereby obtaining semi-dwarf wheat having a culm length of 75 cm or less.

11. A method for producing a semi-dwarf wheat having a mutation in an Rht gene, comprising: introducing a deletion, insertion, or substitution into an SD1 gene of the semi-dwarf wheat by a genome editing means; A method for producing semi-dwarf wheat having an SD1 gene mutation, comprising the steps of: growing tissue in which a deletion, insertion, or substitution has been introduced into the SD1 gene of the semi-dwarf wheat having a mutation in the Rht gene, and obtaining a plant body.

12. A method for producing semi-dwarf wheat having an SD1 gene mutation as described in claim 11, wherein the step of introducing a deletion, insertion, or substitution into the SD1 gene of the semi-dwarf wheat having a mutation in the Rht gene is a step of shooting microparticles coated with the genome editing means into the shoot apex of the semi-dwarf wheat having a mutation in the Rht gene.

13. A method for producing semi-dwarf wheat having an SD1 gene mutation described in any one of claims 11 to 12, further comprising a step of selecting a genome-edited plant body from the plant body.

14. A method for producing semi-dwarf wheat having the SD1 gene mutation described in claim 13, further comprising a step of growing the genome-edited plant body.

15. A method for producing semi-dwarf wheat having a mutation in the SD1 gene described in any of claims 11 to 14, wherein the semi-dwarf wheat having a mutation in the Rht gene is a semi-dwarf wheat having a mutation in the Rht-B1 gene.

16. A method for producing semi-dwarf wheat having an SD1 gene mutation described in any of claims 11 to 15, wherein the culm length of the semi-dwarf wheat having the SD1 gene mutation is 75 cm or less.

17. A mutant Rht gene has a mutation and a deletion, insertion, or substitution is introduced into the SD1 gene, Semi-dwarf wheat having a SD1 gene mutation, characterized by a culm length of 75 cm or less.

18. A semi-dwarf wheat as described in claim 17, wherein a deletion, insertion or substitution is introduced into the SD1 gene in the entire ABD genome.

Images