Methods and drugs for treating spinal muscular atrophy

Abstract

The present invention relates to a method for treating spinal muscular atrophy (SMA) comprising administering to a subject a therapeutically effective amount of a plasminogen pathway activator, as well as pharmaceutical compositions, products, and kits for treating spinal muscular atrophy comprising a plasminogen pathway activator.

Description

[Technical field]

[0001] The present invention relates to a method of treating spinal muscular atrophy (SMA) and related disorders, comprising administering to a subject suffering from SMA an effective amount of a component of the plasminogen activation pathway or a related compound, e.g., plasminogen, to repair damaged nerves and ameliorate clinical symptoms and signs. [Background technology]

[0002] Spinal Muscular Atrophy (SMA), also known as spinal muscular atrophy or spinal muscular atrophy, is a disease of muscle weakness and atrophy caused by the degeneration of motor neurons in the anterior horn of the spinal cord, and is an autosomal recessive genetic disease. The most common form of SMA is caused by mutations in the survival motor neuron (SMN) gene, and infantile SMA is the most severe form of this neurodegenerative disease. Symptoms include muscle weakness, hypotonia, weak cry, tendency to limp or fall, difficulty sucking or swallowing, accumulation of secretions in the lungs or throat, difficulty feeding, and susceptibility to respiratory infections. Legs tend to be weaker than arms, and developmental markers such as being unable to look up or sit up are not reached. In general, the earlier symptoms appear, the shorter life expectancy.

[0003] The progression of SMA is directly related to the rate at which motor neuron cells deteriorate and the degree of debilitation that results. Infants with severe SMA often die from respiratory disease due to weakening of the muscles that support breathing. Children with mild SMA live longer but may require extensive medical support.

[0004] SMA is an autosomal recessive genetic disease. Approximately 95% of SMA cases are caused by mutations in the SMN1 (Survival Motor Neuron 1) gene on chromosome 5, so it is also called 5q-type SMA. 5q-type SMA is classified into five subtypes depending on the age of onset of the patient and the severity of the disease: Type 0 patients are generally prevalent in fetuses or newborns. Fetal onset is manifested as reduced fetal movement, while newborns are manifested as loss of muscle reflexes, facial paralysis, atrial septal defect and joint contractures, and the most severe symptom is respiratory failure. The life expectancy of affected children is significantly reduced, with most surviving within 6 months. Type I patients are the infantile form, also known as Werdnig-Hoffman disease, and account for 50% of SMA patients. Patients show hypotonia, poor head control, and reduced or absent tendon reflexes within 6 months of age. Severe hypotonia manifests as "frog legs" when lying down, inability to control head, inability to sit upright, weak intercostal muscles, relatively small diaphragm muscles, patients often have poor swallowing function, respiratory muscle weakness, and therefore respiratory failure. Without assisted ventilation, 92% of children with type I SMA usually die of respiratory failure before 20 months of age. Type II patients, an intermediate type that accounts for about 20% of SMA patients, usually develops between 6 and 18 months of age, and at some stage in the developmental process, patients are able to sit on their own but cannot walk on their own. Such patients often suffer from complications such as scoliosis, joint contractures, and ankylosis of the mandibular joint. Scoliosis and intercostal muscle weakness often lead to severe lung disease. Cognitive abilities of these children are normal. Type III patients, also known as Kugelberg-Welander disease, are a juvenile form that accounts for approximately 30% of SMA patients, and patients usually develop symptoms within 18 months to 5 years of age and are able to walk with the help of auxiliary support. Unlike Type II SMA, most of these people do not have comorbidities such as scoliosis or respiratory muscle weakness, and cognition and life expectancy in this group are generally not affected by the disease. Type IV patients develop symptoms after puberty, have a gradual decline in motor skills, and account for approximately 5% of the total number of SMA patients. Similar to Type III, it is thought to develop in adulthood, usually after the 30s.Four percent of SMA cases are not caused by mutations in the SMN1 gene and are called non-5q SMA, meaning that the causative gene is not located in the SMN region of chromosome 5. Similar to 5q SMA, children with non-5q SMA have early symptoms of muscle weakness, but there are some differences, including distal rather than proximal muscle weakness, earlier distal joint contractures, diaphragmatic paralysis with earlier respiratory failure, and cerebellar degeneration. (Verhaart IEC, Robertson A, Wilson IJ, Aartsma-Rus A, Cameron S, Jones CC, Cook SF, Lochmuller H. Prevalence, incidence and carrier frequency of 5q-linked spinal muscular atrophy-a literature review. Orphanet J Rare Dis. 2017 Jul 4;12(1):124.; Sugarman EA, Nagan N, Zhu H, Akmaev VR, Zhou Z, Rohlfs EM, Flynn K, Hendrickson BC, Scholl T, Sirko-Osadsa DA, Allitto BA. Pan-ethnic carrier screening and prenatal diagnosis for spinal muscular atrophy. atrophy:clinical laboratory analysis of >72,400 specimens.Eur J Hum Genet.2012 Jan;20(1):27-32).

[0005] SMA is caused by the loss of function of the SMN1 gene due to inactivating mutations or deletions of the telomeric copies of the gene (SMN1) on two chromosomes. The SMN1 protein functions as a cofactor for RNA maturation and is required for the survival of all eukaryotic cells (Talbot and Tizzano (2017) Gene Ther 24(9):529-533). The SMN2 protein is nearly identical to SMN1, except for a single mutation that functions in splicing the RNA message. All SMA patients retain a copy of the centromeric gene (SMN2), and the copy number of the SMN2 gene in SMA patients generally negatively correlates with disease severity, i.e., the less severe the SMA, the more copies of SMN2 the patient has. Nevertheless, SMN2 cannot fully compensate for the loss of SMN1 function due to alternative splicing of exon 7 caused by a translationally silent C to T mutation in exon 7. Thus, the majority of transcripts produced by SMN2 lack exon 7 (Δ7 SMN2) and encode a rapidly truncated SMN protein with impaired function.

[0006] Clinically, SMA is usually diagnosed by clinical symptoms combined with testing for at least one copy of the SMN1 gene. In some cases, if SMN1 gene testing shows no abnormalities, other tests such as electromyography (EMG) and muscle biopsy can also help with the diagnosis. So far, treatment for SMA is limited to supportive care, including respiratory, nutritional, and rehabilitation treatments and care, and there are no drugs that can effectively treat the disease. Summary of the Invention

[0007] Through research, the present invention has discovered that plasminogen pathway activators such as plasminogen can significantly improve the symptoms of neuronal damage in SMA subjects, improve lung function, prolong survival, promote the transcription and expression of the SMN gene, increase SMN protein levels in brain tissue and muscle tissue, promote the expression of NF-κB protein in brain tissue and muscle tissue, promote the formation of mature NGF in brain tissue, and improve lung tissue damage, thereby effectively preventing and treating SMA.

[0008] In one aspect, the invention relates to a method of treating spinal muscular atrophy (SMA) (including types 0, I, II, III, IV and non-5q SMA) comprising administering to a subject suffering from a motor neuron disease such as SMA a therapeutically effective amount of one or more plasminogen pathway activators selected from components of the plasminogen activation pathway, compounds that can activate plasminogen directly or indirectly by activating upstream components of the plasminogen activation pathway, compounds that mimic the activity of plasminogen or plasmin, compounds that can upregulate expression of plasminogen or plasminogen activators, plasminogen analogs, plasmin analogs, tPA or uPA analogs and antagonists of fibrinolysis inhibitors.

[0009] In some specific embodiments, the plasminogen pathway activator has the following activity in a patient with spinal muscular atrophy (SMA) (including types 0, I, II, III, IV and non-5q SMA): 1. activity in reducing or ameliorating the severity of SMA; 2. activity in delaying the onset of SMA; 3. activity in inhibiting the progression of SMA; 4. activity in increasing the survival time of a subject; 5. activity in improving the quality of life of a subject and / or improving the mental status of a subject; 6. activity in reducing the number of SMA-related symptoms; 7. activity in reducing or ameliorating the severity of one or more symptoms associated with SMA; 8. activity in reducing the duration of SMA-related symptoms; 9. activity in preventing the recurrence of SMA-related symptoms; 10. activity in preventing the onset or recurrence of SMA symptoms. The plasminogen pathway activator has one or more activities selected from: 1. activity of suppressing seizures; 2. activity of suppressing the progression of SMA-related symptoms; 3. activity of improving lung function; 4. activity of improving blood oxygen saturation; 5. activity of promoting transcription and expression of the SMN gene; 6. activity of increasing the level of SMN protein in brain tissue and muscle tissue; 7. activity of promoting expression of NF-κB protein in brain tissue and muscle tissue; 8. activity of promoting the formation of mature NGF in brain tissue; 9. activity of reducing lung tissue damage; 10. activity of increasing muscle strength; 11. activity of reducing loss of motor neurons; 12. activity of promoting growth and development; and / or 13. activity of improving motor function. In some specific embodiments, the plasminogen pathway activator improves muscle atrophy, increases muscle strength, and / or improves muscle tone in a subject. In some specific embodiments, the plasminogen pathway activator extends the survival time of a subject. In some specific embodiments, the plasminogen pathway activator promotes transcription and / or expression of the SMN gene. In some specific embodiments, the plasminogen pathway activator promotes recovery of muscle function in a subject. In some specific embodiments, the plasminogen pathway activator promotes repair of spinal cord anterior horn neuron damage in a subject. In some specific embodiments, the plasminogen pathway activator promotes expression of NF-κB protein in a subject.In some specific embodiments, the plasminogen pathway activator promotes the formation of mature NGF in a subject.The plasminogen pathway activator promotes the formation of mature NGF in a subject.

[0010] In some embodiments, the plasminogen pathway activator is used in combination with one or more other agents and / or therapeutic methods, preferably including cell therapy (e.g., stem cell therapy) and gene therapy, e.g., antisense RNA, small molecule splicing modifiers, and the like.

[0011] In some embodiments, the plasminogen pathway activator is a component of the plasminogen activation pathway.

[0012] In some embodiments, the component of the plasminogen activation pathway is selected from plasminogen (abbreviated as PLG), recombinant human plasminogen, Lys-plasminogen, Glu-plasminogen, plasmin, plasminogen and plasmin variants and analogs containing one or more kringle domains and protease domains of plasminogen and plasmin, mini-plasminogen, mini-plasmin, micro-plasminogen, micro-plasmin, delta-plasmin, delta-plasmin, plasminogen activators, tPA, and uPA. In some particular embodiments, the fibrinolysis inhibitor antagonist is an antagonist of PAI-1, complement C1 inhibitor, α2-antiplasmin, or α2-macroglobulin, e.g., an antibody of PAI-1, complement C1 inhibitor, α2-antiplasmin, or α2-macroglobulin.

[0013] In some specific embodiments, the component of the plasminogen activation pathway is plasminogen. In some specific embodiments, the plasminogen comprises or has an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO:2, 6, 8, 10 or 12 and still has plasminogen activity. In some embodiments, the plasminogen activity is the proteolytic activity of the plasminogen. In some embodiments, the plasminogen activity is the lysine binding activity of plasminogen and substrate molecules. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen and the lysine binding activity of plasminogen and substrate molecules. In some embodiments, the plasminogen is a protein having 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-5, 1-4, 1-3, 1-2, or 1 amino acid added, deleted, and / or substituted based on sequence 2, 6, 8, 10, or 12, and having plasminogen proteolytic activity and / or lysine binding activity. In some specific embodiments, the plasminogen activity is plasminogen proteolytic activity. In some specific embodiments, the plasminogen is a protein comprising a plasminogen activity fragment and having plasminogen proteolytic activity and / or lysine binding activity. In some specific embodiments, the plasminogen activity fragment comprises or has a plasminogen serine protease domain or a plasminogen protease domain. In certain embodiments, the amino acid sequence of the plasminogen activating fragment is shown in SEQ ID NO:14.In certain embodiments, the plasminogen is Glu-plasminogen (full human plasminogen), Lys-plasminogen (full human plasminogen truncated between amino acids 76-77), miniplasminogen (containing Kringle 5 (K5) and a serine protease domain), microplasminogen (containing a serine protease domain), δ-plasminogen (containing Kringle 1 and a serine protease domain) or a variant thereof that retains plasminogen activity. In certain embodiments, the plasminogen is full human plasminogen or a variant or fragment thereof that still retains plasminogen activity. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen. In some embodiments, the plasminogen activity is the lysine binding activity of plasminogen and a substrate molecule. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen and the lysine binding activity of plasminogen and a substrate molecule. In some embodiments, the plasminogen is an orthologue of human plasminogen derived from a primate or rodent, or a variant or fragment that still retains the proteolytic and / or lysine-binding activity of plasminogen. In some embodiments, the plasminogen comprises the amino acid sequence shown in SEQ ID NO: 2, 6, 8, 10, or 12. In some embodiments, the plasminogen is human native plasminogen.

[0014] In certain embodiments, the plasminogen pathway activator is administered systemically or locally, e.g., intravenously, intramuscularly, intrathecally, nasal inhalation, aerosol inhalation, nasal drops, or eye drops. In some embodiments, the subject is a human. In some embodiments, the subject is deficient or deficient in plasminogen. In some embodiments, the deficient or deficient is congenital, inherited, and / or localized. In some embodiments, the plasminogen is administered daily at a dose of 0.0001-2000 mg / kg, 0.001-800 mg / kg, 0.01-600 mg / kg, 0.1-400 mg / kg, 1-200 mg / kg, 1-100 mg / kg, 10-100 mg / kg (calculated per kilogram of body weight), or 0.0001-2000 mg / cm. 2 , 0.001-800mg / cm 2 , 0.01-600mg / cm 2 , 0.1-400mg / cm 2 , 1-200mg / cm 2 , 1-100mg / cm 2 , 10-100mg / cm 2 (calculated per square centimeter of body surface area) administered daily, every 2 days, or every 3 days consecutively.

[0015] In some embodiments, the SMA is type 0, type I, type II, type III, type IV, or non-5q SMA.

[0016] In one aspect, the present application also relates to pharmaceutical compositions, medicaments, formulations, kits, and articles of manufacture for the treatment of spinal muscular atrophy (SMA) comprising the above-mentioned plasminogen pathway activators, e.g., the above-mentioned components of the plasminogen activation pathway, such as the above-mentioned plasminogen.

[0017] In some embodiments, the pharmaceutical compositions, agents, and formulations include a pharma- ceutically acceptable carrier and a plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as the plasminogens described above. In some embodiments, the kit or product includes one or more containers containing the pharmaceutical composition, agent, or formulation. In some embodiments, the kit or product further includes a label or protocol, which instructs how to treat spinal muscular atrophy using a plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as the plasminogens described above. In some embodiments, the kit or product further includes one or more additional containers containing other agents. In some embodiments, the SMA is type 0, type I, type II, type III, type IV, or non-5q SMA.

[0018] In one aspect, the present application also relates to a plasminogen pathway activator, such as a plasminogen, as described above, for use in treating spinal muscular atrophy (SMA). In some embodiments, the SMA is type 0, type I, type II, type III, type IV, or non-5q SMA.

[0019] In one aspect, the present application also relates to the use of the above plasminogen pathway activator, such as the above plasminogen, in the treatment of spinal muscular atrophy (SMA). In some embodiments, the above SMA is type 0, type I, type II, type III, type IV, or non-5q SMA.

[0020] In one aspect, the present application also relates to the use of a therapeutically effective amount of the plasminogen pathway activator (e.g., a component of the plasminogen activation pathway, such as the plasminogen) in the preparation of pharmaceutical compositions, medicaments, formulations, kits, and articles of manufacture for treating spinal muscular atrophy (SMA).

[0021] In some embodiments, the plasminogen pathway activator is one or more plasminogen pathway activators selected from components of the plasminogen activation pathway, compounds that can activate plasminogen directly or indirectly by activating upstream components of the plasminogen activation pathway, compounds that mimic the activity of plasminogen or plasmin, compounds that can upregulate the expression of plasminogen or plasminogen activators, plasminogen analogs, plasmin analogs, tPA or uPA analogs, and antagonists of fibrinolysis inhibitors.

[0022] In certain embodiments, the component of the plasminogen activation pathway is selected from plasminogen, recombinant human plasminogen, Lys-plasminogen, Glu-plasminogen, plasmin, plasminogen and plasmin variants and analogs containing one or more kringle domains and protease domains of plasminogen and plasmin, mini-plasminogen, mini-plasmin, micro-plasminogen, micro-plasmin, delta-plasmin, delta-plasmin, plasminogen activators, tPA, and uPA. In certain embodiments, the antagonist of the fibrinolysis inhibitor is an antagonist of PAI-1, complement C1 inhibitor, alpha 2 antiplasmin, or alpha 2 macroglobulin, e.g., an antibody of PAI-1, complement C1 inhibitor, alpha 2 antiplasmin, or alpha 2 macroglobulin.

[0023] In some embodiments, the plasminogen pathway activator is a component of the plasminogen activation pathway.

[0024] In some embodiments, the component of the plasminogen activation pathway is selected from plasminogen (abbreviated as PLG), recombinant human plasminogen, Lys-plasminogen, Glu-plasminogen, plasmin, plasminogen and plasmin variants and analogs containing one or more kringle domains and protease domains of plasminogen and plasmin, mini-plasminogen, mini-plasmin, micro-plasminogen, micro-plasmin, delta-plasmin, delta-plasmin, plasminogen activators, tPA, and uPA. In some particular embodiments, the fibrinolysis inhibitor antagonist is an antagonist of PAI-1, complement C1 inhibitor, α2-antiplasmin, or α2-macroglobulin, e.g., an antibody of PAI-1, complement C1 inhibitor, α2-antiplasmin, or α2-macroglobulin.

[0025] In some specific embodiments, the component of the plasminogen activation pathway is plasminogen. In some specific embodiments, the plasminogen comprises or has an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO:2, 6, 8, 10 or 12 and still has plasminogen activity. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen. In some embodiments, the plasminogen activity is the lysine binding activity of plasminogen and substrate molecules. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen and the lysine binding activity of plasminogen and substrate molecules. In some embodiments, the plasminogen is a protein having 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-5, 1-4, 1-3, 1-2, or 1 amino acid added, deleted, and / or substituted based on sequence 2, 6, 8, 10, or 12, and having plasminogen proteolytic activity and / or lysine binding activity. In some specific embodiments, the plasminogen activity is plasminogen proteolytic activity. In some specific embodiments, the plasminogen is a protein comprising a plasminogen activity fragment and having plasminogen proteolytic activity and / or lysine binding activity. In some specific embodiments, the plasminogen activity fragment comprises or has a plasminogen serine protease domain or a plasminogen protease domain. In certain embodiments, the amino acid sequence of the plasminogen activating fragment is shown in SEQ ID NO:14.In certain embodiments, the plasminogen is Glu-plasminogen (full human plasminogen), Lys-plasminogen (full human plasminogen truncated between amino acids 76-77), miniplasminogen (containing Kringle 5 (K5) and a serine protease domain), microplasminogen (containing a serine protease domain), δ-plasminogen (containing Kringle 1 and a serine protease domain) or a variant thereof that retains plasminogen activity. In certain embodiments, the plasminogen is full human plasminogen or a variant or fragment thereof that still retains plasminogen activity. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen. In some embodiments, the plasminogen activity is the lysine binding activity of plasminogen and a substrate molecule. In some embodiments, the plasminogen activity is the proteolytic activity of plasminogen and the lysine binding activity of plasminogen and a substrate molecule. In some embodiments, the plasminogen is an orthologue of human plasminogen derived from a primate or rodent, or a variant or fragment that still retains the proteolytic and / or lysine-binding activity of plasminogen. In some embodiments, the plasminogen comprises the amino acid sequence shown in SEQ ID NO: 2, 6, 8, 10, or 12. In some embodiments, the plasminogen is human native plasminogen.

[0026] In some embodiments, the plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as plasminogen, described above, is used in combination with one or more other drugs or therapeutic methods. In some embodiments, the plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as plasminogen, is administered systemically or locally, e.g., intravenously, intramuscularly, intrathecally, by nasal inhalation, aerosol inhalation, nose drops, or eye drops.

[0027] In some embodiments, the pharmaceutical compositions, medicaments, and formulations include a pharma- ceutically acceptable carrier and a plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as plasminogen. In some embodiments, the kits and articles of manufacture include one or more containers containing the pharmaceutical composition, medicament, or formulation. In some embodiments, the kit or article of manufacture further includes a label or protocol, the label or protocol instructing how to treat spinal muscular atrophy using a plasminogen pathway activator, e.g., a component of the plasminogen activation pathway, such as plasminogen.

[0028] In some embodiments, the kit or article of manufacture further comprises one or more additional containers that contain other agents.

[0029] In some embodiments, the SMA is type 0, type I, type II, type III, type IV, or non-5q SMA.

[0030] The present invention expressly covers all combinations of the technical features belonging to the embodiments of the present invention, and the technical configurations after the combinations are expressly disclosed in this application as if the above technical configurations were separately expressly disclosed. Moreover, the present invention also expressly covers the combinations between each embodiment and their elements, and the technical configurations after the combinations are expressly disclosed in this specification. [Brief description of the drawings]

[0031] [Figure 1] 1 shows the results of electromyogram amplitude of motor nerves before and after treatment of a patient with SMA type II described in Example 1. As a result, compared with before treatment, the amplitude of action potentials of the patient's tibial nerve and common peroneal nerve increased to various degrees. This result indicates that plasminogen can improve the conduction function of peripheral neurons in patients with SMA type II and ameliorate neuromuscular damage. [Diagram 2]2 shows the results of electromyogram amplitude of motor nerves of upper and lower limbs of a patient before and after treatment described in Example 2. Compared with before treatment, the amplitude of action potentials of the left femoral nerve, right ulnar nerve, bilateral common peroneal nerve and tibial nerve of the patient increased to various degrees. This result indicates that plasminogen can improve the conduction function of peripheral neurons of SMA type II patients and improve neuromuscular damage. [Diagram 3] 3 shows the results of electromyogram amplitude of motor nerves of upper and lower limbs of a patient before and after treatment described in Example 3. Compared with before treatment, the amplitude of action potentials of median nerve, tibial nerve, common peroneal nerve, and ulnar nerve of both sides of the patient increased to various degrees. This result shows that plasminogen can improve the conduction function of peripheral neurons of SMA type II patients and improve neuromuscular damage. [Figure 4] 4A-B are diagrams showing the survival curve and statistical results of survival time of SMNΔ7 SMA mice after administration of plasminogen. A is the statistical result of the survival curve, and B is the statistical result of the survival time. The statistical result of the survival curve showed that plasminogen can significantly improve the survival curve of SMNΔ7 SMA mice, and the difference was statistically significant (P=0.029). The statistical result of the survival time showed that the median survival time of mice in the solvent group was 14 days, and all mice died on the 15th day, and the median survival time of the administration group was 16 days, and all mice died on the 17th day, and the difference in statistical analysis was significant (P=0.03). This indicates that plasminogen can extend the survival time of SMA model mice. [Diagram 5] Figure 5 shows the qPCR detection results of SMN gene in the spinal cord of SMNΔ7 SMA mice after plasminogen administration. The results showed that there was a certain level of SMN gene transcription in the spinal cord of mice in the blank control group, the SMN gene transcription level of mice in the vehicle group was lower than that of mice in the blank control group, and the SMN gene transcription level of mice in the administration group was significantly higher than that of mice in the vehicle group and the blank control group. This result suggests that plasminogen can promote the transcription of SMN gene. [Figure 6]Figure 6 shows the results of Western blot detection and quantitative analysis of optical density of brain NF-κB protein in SMNΔ7 SMA mice after administration of plasminogen. The results showed that the brains of mice in the blank control group had a certain amount of NF-κB protein, the levels of NF-κB protein in the brains of mice in the solvent group were lower than those of mice in the blank control group, and the levels of NF-κB protein in the brains of mice in the treatment group were significantly higher than those of mice in the solvent group, and the statistical difference was close to significance (P=0.05). This result suggests that plasminogen can promote the increase of NF-κB protein levels in the brain tissue of SMNΔ7 SMA mice. [Figure 7] Figure 7 shows the results of Western blot detection and quantitative analysis of optical density of NF-κB protein in representative hindlimb muscles of SMNΔ7 SMA mice after plasminogen administration. The results showed that there was a certain amount of NF-κB protein in the muscles of mice in the blank control group, the level of NF-κB protein in the muscles of mice in the vehicle group was lower than that of mice in the blank control group, and the level of NF-κB protein in the muscles of mice in the administration group was significantly higher than that of mice in the vehicle group, and the statistical difference was significant (* represents P<0.05). This result suggests that plasminogen can promote the increase of NF-κB protein levels in the muscles of SMNΔ7 SMA mice. [Figure 8] Figure 8 shows the representative Western blot detection results of brain SMN protein and quantitative analysis results of optical density (OD) values ​​of SMNΔ7 SMA mice after plasminogen administration. The results showed that the brains of mice in the blank control group expressed a certain amount of SMN protein, the expression level of SMN protein in mice in the solvent group was lower than that in mice in the blank control group, and the expression level of SMN protein in mice in the treatment group was significantly higher than that in mice in the solvent group. This result suggests that plasminogen can promote the expression of SMN protein in the brains of SMNΔ7 SMA mice. [Figure 9]9 shows the results of Western blot detection of SMN protein in representative hindlimb muscles of SMNΔ7 SMA mice after administration of plasminogen and quantitative analysis of optical density (OD) values. The results showed that the muscles of mice in the blank control group expressed a certain amount of SMN protein, the expression level of SMN protein in the muscles of mice in the solvent group was lower than that of mice in the blank control group, and the expression level of SMN protein in the muscles of mice in the administration group was significantly higher than that of mice in the solvent group. This result suggests that plasminogen can promote the expression of SMN protein in the muscles of SMNΔ7 SMA mice. [Figure 10] Figure 10 shows the Western blot detection results of the hindbrain tissue of SMA mice after plasminogen administration and the quantitative analysis results of the NGF / Pro-NGF optical density (OD) ratio. The results showed that the brain tissue of the mice in the blank control group had a certain NGF / Pro-NGF ratio, and the NGF / Pro-NGF ratio of the brain tissue of the mice in the administration group was significantly higher than that of the mice in the vehicle group, and the statistical difference was highly significant (*** represents P<0.001). This result suggests that plasminogen can promote the conversion of ProNGF to NGF in the brain tissue of SMA model mice and promote the formation of mature NGF. [Figure 11] FIG. 11 shows the results of H&E staining of representative lung tissues of SMA mice after plasminogen administration. As a result, the terminal bronchiolar epithelial cells of the lung tissues of the mice in the blank control group were arranged in an orderly manner and could be clearly distinguished; the size of the alveolar space was uniform, the alveolar septum was not thickened, and no infiltration of inflammatory cells was observed around the blood vessels; the respiratory bronchiolar epithelium of the lung tissues of the mice in the vehicle group was sloughed off, the alveolar ducts and alveolar sacs were enlarged, the alveolar septum was widened, the alveoli were collapsed and the structure was disordered, and eosinophils, foam cells, and lymphocytes were present around the pulmonary blood vessels; the respiratory bronchiolar epithelium of the lung tissues of the mice in the treatment group was arranged in an orderly manner, the alveolar ducts and alveolar sacs were enlarged, and the alveolar space was evenly enlarged, but the alveolar wall composed of a single layer of alveolar epithelium was observed. This suggests that plasminogen can ameliorate the lung tissue damage in SMA model mice. Detailed Description of the Invention

[0032] The term "Spinal Muscular Atrophy" (or Spinal Muscular Atrophy, SMA) refers to a disease caused by loss of function of the SMN1 gene due to inactivating mutations or deletions in the SMN1 gene on two chromosomes. Symptoms of SMA include muscle weakness, hypotonia, weak cry, weak cough, tendency to limp or fall, difficulty slurping or swallowing, difficulty breathing, accumulation of secretions in the lungs or throat, clenched fists and sweaty hands, flapping / shaking tongue, head that often tilts to one side (even when lying down), tendency for legs to be weaker than arms, legs that often appear as "frog legs", difficulty feeding, increased susceptibility to respiratory infections, bowel / bladder weakness, lower than normal weight, inability to sit unsupported, inability to walk or crawl, and multiple congenital contractures (joint contractures) associated with hypotonia, loss of reflexes, and loss of anterior horn cells.

[0033] As used herein, the term "treating spinal muscular atrophy (SMA)" or "treatment of spinal muscular atrophy (SMA)" refers to any of the following: 1. the effect of reducing or ameliorating the severity of SMA; 2. the effect of delaying the onset of SMA; 3. the effect of inhibiting the progression of SMA; 4. the effect of increasing the survival time of the subject; 5. the effect of improving the quality of life of the subject and / or improving the mental state of the subject; 6. the effect of reducing the number of SMA-related symptoms; 7. the effect of reducing or ameliorating the severity of one or more symptoms associated with SMA; 8. the effect of reducing the duration of SMA-related symptoms; 9. the effect of preventing the recurrence of SMA-related symptoms; 10. the effect of inhibiting the onset or seizure of SMA symptoms; 11. the effect of preventing the onset or seizure of SMA-related symptoms; 12. the effect of preventing the onset or seizure of SMA-related symptoms; 13. the effect of preventing the onset or seizure of SMA-related symptoms; 14. the effect of preventing the onset or seizure of SMA-related symptoms; 15. the effect of preventing the onset or seizure of SMA-related symptoms; 16. the effect of preventing the onset or seizure of SMA-related symptoms; 17. the effect of preventing the onset or seizure of SMA-related symptoms; 18. the effect of preventing the onset or seizure of SMA-related symptoms; 19. the effect of preventing the onset or seizure of SMA-related symptoms; 20. the effect of preventing the onset or seizure of SMA-related symptoms; 21. the effect of preventing the onset or seizure of SMA-related symptoms; 22. the effect of preventing the onset or seizure of SMA-related symptoms; 23. the effect of preventing the onset or seizure of SMA- The present invention includes obtaining one or more effects selected from the following: 1. an effect of inhibiting the progression of the disease; 2. an effect of improving pulmonary function; 13. an effect of improving blood oxygen saturation; 14. an effect of promoting the transcription and expression of the SMN gene; 15. an effect of increasing the level of SMN protein in brain tissue and muscle tissue; 16. an effect of promoting the expression of NF-κB protein in brain tissue and muscle tissue; 17. an effect of promoting the formation of mature NGF in brain tissue; 18. an effect of reducing damage to lung tissue; 19. an effect of increasing muscle strength; 20. an effect of reducing muscle atrophy; 21. an effect of reducing loss of motor neurons; 22. an effect of promoting growth and development; and / or 23. an effect of improving motor function.

[0034] In some embodiments, the plasminogen activation pathway components or associated compounds thereof of the present application, such as plasminogen as described above, enhance transcription and / or expression of the SMN gene. In some embodiments, the plasminogen activation pathway components or associated compounds thereof of the present application, such as plasminogen as described above, increase expression of the SMN protein in a human subject in need thereof.

[0035] In some embodiments, the plasminogen activation pathway components or related compounds thereof, such as plasminogen, of the present application can be used alone or in combination with other agents to treat or prevent diseases caused by inactivating mutations or deletions in the SMN gene and / or diseases associated with loss or deficiency of SMN gene function, including, but not limited to, spinal muscular atrophy (SMA).

[0036] In some embodiments, the present application relates to methods of treating diseases, such as SMA, caused by inactivating mutations or deletions in the SMN gene and / or associated with loss or defects in the SMN gene, comprising administering to a subject a therapeutically effective amount of a component of the plasminogen activation pathway or a related compound thereof, such as plasminogen, hi some embodiments, the present application relates to methods of treating SMA, comprising administering to a subject a therapeutically effective amount of plasminogen.

[0037] In some embodiments, the present application provides a subject with a therapeutically effective amount of: 1. an activity that reduces or improves the severity of SMA; 2. an activity that delays the onset of SMA; 3. an activity that inhibits the progression of SMA; 4. an activity that extends the survival time of the subject; 5. an activity that improves the quality of life of the subject and / or improves the mental state of the subject; 6. an activity that reduces the number of SMA-associated symptoms; 7. an activity that reduces or improves the severity of one or more symptoms associated with SMA; 8. an activity that reduces the duration of SMA-associated symptoms; 9. an activity that prevents the recurrence of SMA-associated symptoms; 10. an activity that inhibits the onset or attack of SMA symptoms; 11. an activity that inhibits the progression of SMA-associated symptoms; 12. an activity that improves pulmonary function; 13. The present invention relates to a method of treating SMA, comprising administering plasminogen having one or more activities selected from: 1. activity of improving blood oxygen saturation; 14. activity of promoting transcription and expression of the SMN gene; 15. activity of increasing the level of SMN protein in brain tissue and muscle tissue; 16. activity of promoting expression of NF-κB protein in brain tissue and muscle tissue; 17. activity of promoting the formation of mature NGF in brain tissue; 18. activity of reducing damage to lung tissue; 19. activity of increasing muscle strength; 20. activity of reducing muscle atrophy; 21. activity of reducing loss of motor neurons; 22. activity of promoting growth and development; and / or 23. activity of improving motor function.

[0038] The fibrinolytic system, also called the fibrinolytic system, is a system of a series of chemicals involved in the process of fibrinolysis (fibrinolysis), mainly including plasminogen (PLG), plasmin, plasminogen activators, and fibrinolysis inhibitors. Plasminogen activators include tissue-type plasminogen activator (t-PA) and urokinase-type plasminogen activator (u-PA). t-PA is a serine protease and is synthesized by vascular endothelial cells. t-PA activates plasminogen, a process that mainly occurs in fibrin. Urokinase-type plasminogen activator (u-PA) is produced by renal tubular epithelial cells and vascular endothelial cells and can directly activate plasminogen without the need for fibrin as a cofactor. Plasminogen (PLG) is synthesized in the liver. When blood clots, PLG is adsorbed in large quantities to the fibrin net and activated to plasmin by the action of t-PA or u-PA to promote fibrinolysis. Plasminase (PL) is a serine protease that degrades fibrin and fibrinogen, hydrolyzes various coagulation factors V, VIII, X, VII, XI, II, etc., converts plasminogen to plasmin, hydrolyzes complement, etc. Fibrinolysis inhibitors include plasminogen activator inhibitor (PAI) and α2-antithyplasmin (α2-AP). There are two main forms of PAI, PAI-1 and PAI-2, which can specifically bind to t-PA in a 1:1 ratio and inactivate t-PA while activating PLG. α2-AP is synthesized in the liver and binds to PL in a 1:1 ratio to form a complex, thereby inhibiting PL activity. FXIII covalently binds α2-AP to fibrin, thereby weakening the susceptibility of fibrin to PL. Substances that inhibit the activity of the fibrinolysis system in vivo include PAI-1, complement C1 inhibitor, α2-antiplasmin, and α2-macroglobulin.

[0039] The term "plasminogen pathway activator" or "PLG pathway activator" of the present invention covers components of the plasminogen activation pathway, compounds that can activate plasminogen directly or indirectly by activating upstream components of the plasminogen activation pathway, compounds that mimic the activity of plasminogen or plasmin, compounds that can upregulate the expression of plasminogen or plasminogen activators, plasminogen analogs, plasmin analogs, tPA or uPA analogs and antagonists of fibrinolysis inhibitors.

[0040] As used herein, the term "component of the plasminogen activation pathway" or "component of the PLG activation pathway" refers to 1. Plasminogen, Lys-plasminogen, Glu-plasminogen, micro-plasminogen, delta-plasminogen, their variants or analogs; 2. Plasmin and its variants or analogues; and 3. Plasminogen activators, including, for example, tPA and uPA, as well as tPA or uPA variants and analogs that contain one or more domains of tPA or uPA, such as one or more of the kringle domain and the proteolytic domain.

[0041] The term "antagonist of a fibrinolysis inhibitor" covers antagonists of PAI-1, complement C1 inhibitor, alpha2-antiplasmin or alpha2-macroglobulin, for example antibodies of PAI-1, complement C1 inhibitor, alpha2-antiplasmin or alpha2-macroglobulin.

[0042] The above-mentioned "variants" of plasminogen, plasmin, tPA and uPA include all naturally occurring genetic variants of human and other mammalian forms of these proteins, as well as proteins having, for example, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1 amino acid added, deleted and / or substituted and still having plasminogen activity, plasmin activity, tPA or uPA activity. For example, a "variant" of plasminogen, plasmin, tPA or uPA includes, for example, mutants of these proteins resulting from substitution of 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-5, 1-4, 1-3, 1-2, 1 conservative amino acids.

[0043] The "plasminogen variant" of the present invention covers those that include or have a protein having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in sequence 2, 6, 8, 10 or 12 and have plasminogen proteolytic activity and / or lysine binding activity. For example, the "plasminogen variant" of the present invention can be a protein in which 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1 amino acid is added, deleted and / or substituted based on sequence 2, 6, 8, 10 or 12 and still has plasminogen proteolytic activity and / or lysine binding activity. In particular, the plasminogen variants of the present invention include all naturally occurring genetic variants of human and other mammalian forms of these proteins, as well as mutants of these proteins obtained by conservative substitution of, for example, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 1-5, 1-4, 1-3, 1-2, 1 amino acids.

[0044] The plasminogen of the present invention may be an orthologue of human plasminogen derived from a primate or rodent, or a variant which still retains the proteolytic and / or lysine-binding activity of plasminogen, such as the plasminogen shown in sequences 2, 6, 8, 10 or 12, e.g., the human native plasminogen shown in sequence 2.

[0045] The above-mentioned "analogs" of plasminogen, plasmin, tPA and uPA include compounds that provide substantially the same effect as plasminogen, plasmin, tPA or uPA, respectively.

[0046] The above "variants" and "analogs" of plasminogen, plasmin, tPA and uPA cover "variants" and "analogs" of plasminogen, plasmin, tPA and uPA that contain one or more domains (e.g., one or more kringle domains and a proteolytic domain). For example, "variants" and "analogs" of plasminogen cover plasminogen variants and analogs that contain one or more plasminogen domains (e.g., one or more kringle (k) domains and a proteolytic domain (also called serine protease domain or plasminogen protease domain)), such as mini-plasminogen. "Variants" and "analogs" of plasmin cover plasmin "variants" and "analogs" such as mini-plasmin and delta-plasmin that contain one or more plasmin domains (e.g., one or more kringle domains and a proteolytic domain).

[0047] Whether the above-mentioned "variants" or "analogs" of plasminogen, plasmin, tPA or uPA have the activity of plasminogen, plasmin, tPA or uPA, respectively, or whether they exert substantially the same effect as plasminogen, plasmin, tPA or uPA, respectively, can be measured by the level of activated plasmin activity using methods known in the art, such as enzymography, ELISA (enzyme-linked immunosorbent assay) and FACS (fluorescence-activated cell sorting). For example, the measurement can be performed with reference to the methods described in the following documents:Ny,A.,Leonardsson,G.,Hagglund,A.C,Hagglof,P.,Ploplis,V.A.,Carmeliet,P. and Ny,T. (1999). Ovulation inplasminogen-deficient mice. Endocrinology 140,5030-5035;Silverstein RL, Leung LL, Harpel PC, Nachman RL (November 1984). “Complex formation of platelet thrombospondin with plasminogen. Modulation of activation by tissue activator”. J. Clin. Invest. 74 (5): 1625-33;Gravanis I, Tsirka SE (February 2008). “Tissue-type plasminogen activator as a therapeutic target in stroke”. Expert Opinion on Therapeutic Targets. 12 (2): 159-70;Geiger M, Huber K, Wojta J, Stingl L, Espana F, Griffin JH, Binder BR (Aug 1989). “Complex formation between urokinase and plasma protein C inhibitor in vitro and in vivo”. Blood. 74 (2): 722-8。

[0048] In some embodiments of the present invention, the "component of the plasminogen activation pathway" of the present invention is plasminogen, which is Glu-plasminogen, Lys-plasminogen, miniplasminogen, microplasminogen, delta-plasminogen or a variant thereof that retains plasminogen activity. In some embodiments, the plasminogen is natural or synthetic human plasminogen or a conservative mutant or fragment thereof that still retains plasminogen activity and / or lysine binding activity. In some embodiments, the plasminogen is an orthologue of human plasminogen from a primate or rodent or a conservative mutant or fragment thereof that still retains plasminogen activity and / or lysine binding activity. In some embodiments, the amino acid sequence of the plasminogen comprises or has an amino acid sequence as shown in sequence 2, 6, 8, 10 or 12. In some embodiments, the plasminogen is human full-length plasminogen. In some embodiments, the plasminogen is human full-length plasminogen as shown in sequence 2.

[0049] "A compound capable of directly activating plasminogen or indirectly activating plasminogen by activating an upstream component of the plasminogen activation pathway" refers to any compound capable of directly activating plasminogen or indirectly activating plasminogen by activating an upstream component of the plasminogen activation pathway, including, for example, tPA, uPA, streptokinase, saruplase, alteplase, reteplase, tenecteplase, anistreplase, monteplase, lanoteplase, pamiteplase, and staphylokinase.

[0050] The "antagonist of fibrinolysis inhibitors" of the present invention is a compound that antagonizes, weakens, blocks, or prevents the action of fibrinolysis inhibitors, such as PAI-1, complement C1 inhibitor, α2-antiplasmin, and α2-macroglobulin. Said antagonists are antibodies to PAI-1, complement C1 inhibitor, α2-antiplasmin or α2-macroglobulin, or for example antisense RNA or miniRNA that blocks or downregulates the expression of PAI-1, complement C1 inhibitor, α2-antiplasmin or α2-macroglobulin, or compounds that occupy the binding site of PAI-1, complement C1 inhibitor, α2-antiplasmin or α2-macroglobulin but do not have the function of PAI-1, complement C1 inhibitor, α2-antiplasmin or α2-macroglobulin, or compounds that block the binding and / or activity domains of PAI-1, complement C1 inhibitor, α2-antiplasmin or α2-macroglobulin.

[0051] Plasmin is an important component of the plasminogen activation system (PA system). It is a broad-spectrum protease that can hydrolyze several components of the extracellular matrix (ECM), including fibrin, gelatin, fibronectin, laminin, and proteoglycans. Plasmin can also activate some pro-matrix metalloproteinases (pro-MMPs) to become active matrix metalloproteinases (MMPs). Thus, plasmin is an important upstream regulator of extracellular proteolysis. Plasmin is formed by proteolysis of two physiological PAs: tissue-type plasminogen activator (tPA) or urokinase plasminogen activator (uPA). Plasminogen is present at relatively high relative levels in plasma and other body fluids, and traditionally, it has been believed that the regulation of the PA system is mainly achieved by the synthesis and activity levels of PAs. The synthesis of PA system components is tightly regulated by different factors, such as hormones, growth factors, and cytokines. In addition, there are specific physiological inhibitors of plasmin and PAs. The main inhibitor of plasmin is α2-antiplasmin. The activity of PAs is simultaneously inhibited by plasminogen activator inhibitor-1 (PAI-1) of uPA and tPA, and is regulated by plasminogen activator inhibitor-2 (PAI-2), which mainly inhibits uPA. Some cells have a uPA-specific cell surface receptor (uPAR) with direct hydrolytic activity.

[0052] Plasminogen is a single-chain glycoprotein consisting of 791 amino acids with a molecular weight of approximately 92 kDa. It is synthesized mainly in the liver and is present in large amounts in extracellular fluids. The plasminogen content in plasma is approximately 2 μM. Thus, plasminogen is a large potential source of proteolytic activity in tissues and body fluids. There are two molecular forms of plasminogen: glutamate-plasminogen (Glu-plasminogen) and lysine-plasminogen (Lys-plasminogen). The naturally secreted and undegraded form of plasminogen has one amino-terminal (N-terminal) glutamic acid and is therefore called glutamate-plasminogen. However, in the presence of plasmin, glutamate-plasminogen is hydrolyzed to lysine-plasminogen at Lys76-Lys77. Compared to glutamate-plasminogen, lysine-plasminogen has a higher affinity for fibrin and can be activated by PAs at a higher rate. The Arg560-Val561 peptide bond of the two forms of plasminogen is cleaved by uPA or tPA, leading to the formation of the disulfide-linked double-chain protease plasmin. The amino-terminal part of plasminogen contains five homologous tricycles, the so-called kringles, and the carboxyl-terminal part contains the protease domain. Some kringles contain a lysine-binding site that mediates the specific interaction of plasminogen with fibrin and its inhibitor α2-AP. The most recently discovered plasminogen is a 38 kDa fragment, containing kringlel-4, which is a potent inhibitor of angiogenesis. This fragment, named angiostatin, is generated from several protease-hydrolyzed plasminogens.

[0053] The main substrate of plasmin is fibrin, and fibrin lysis is a key point to prevent the formation of pathological thrombi. Plasmin also has substrate specificity for several components of the ECM, including laminin, fibronectin, proteoglycan, and gelatin, indicating that plasmin plays an important role in ECM reconstruction. Indirectly, plasmin also degrades other components of the ECM by converting some protease precursors, including MMP-1, MMP-2, MMP-3, and MMP-9, into active proteases. Therefore, it may be proposed that plasmin is an important upstream regulator of extracellular protein hydrolysis. Plasmin also has the ability to activate some latent forms of growth factors. In vitro, plasmin can also hydrolyze components of the complement system to release chemotactic complement fragments.

[0054] "Plasmin" is a very important enzyme present in blood, which hydrolyzes fibrin clots into fibrin degradation products and D-dimers.

[0055] "Plasminogen" is the proenzyme form of plasmin, which, based on the sequence in swiss prot, is calculated as the amino acid sequence of natural human plasminogen including the signal peptide (Sequence 4), and consists of 810 amino acids, has a molecular weight of about 90 kD, is synthesized mainly in the liver, and is a glycoprotein that can circulate in the blood, and the cDNA sequence encoding said amino acid sequence is as shown in Sequence 3. Full-sized plasminogen contains seven domains: a serine protease domain located at the C-terminus, a Pan Apple (PAp) domain located at the N-terminus, and five Kringle domains (Kringle 1-5). With reference to the sequence in swiss prot, the signal peptide comprises residues Met1-Gly19, PAp comprises residues Glu20-Val98, Kringle1 comprises residues Cys103-Cys181, Kringle2 comprises residues Glu184-Cys262, Kringle3 comprises residues Cys275-Cys352, Kringle4 comprises residues Cys377-Cys454, and Kringle5 comprises residues Cys481-Cys560. According to the NCBI data, the serine protease domain comprises residues Val581-Arg804.

[0056] Glu-plasminogen is a natural full-size plasminogen, and consists of 791 amino acids (not including a signal peptide consisting of 19 amino acids). The cDNA sequence encoding this sequence is as shown in sequence 1, and its amino acid sequence is as shown in sequence 2. In vivo, Lys-plasminogen is formed by hydrolysis at the 76th-77th amino acid positions of Glu-plasminogen, and is, for example, as shown in sequence 6, and the cDNA sequence encoding this amino acid sequence is as shown in sequence 5. Delta-plasminogen (δ-plasminogen) is a fragment of full-size plasminogen lacking the Kringle2-Kringle5 structure, and contains only Kringle1 and the serine protease (structural) domain (also called the proteolytic domain or plasminogen protease domain). There is a literature that reports the amino acid sequence of delta-plasminogen (sequence 8), and the cDNA sequence encoding this amino acid sequence is, for example, sequence 7. Mini-plasminogen consists of Kringle5 and serine protease domains, and the literature reports residues Val443-Asn791 (starting with the Glu residue of the Glu-plasminogen sequence without the signal peptide), and its amino acid sequence is as shown in sequence 10, and the cDNA sequence encoding this amino acid sequence is as shown in sequence 9. However, the literature reports that micro-plasminogen only contains a serine protease domain, and its amino acid sequence is residues Ala543-Asn791 (the Glu residue of the Glu-plasminogen sequence without the signal peptide is the starting amino acid), and patent document CN102154253A discloses that it contains residues Lys531-Asn791 (the Glu residue of the Glu-plasminogen sequence without the signal peptide is the starting amino acid), and the sequence of this patent can be referred to patent document CN102154253A, whose amino acid sequence is as shown in sequence 12, and the cDNA sequence encoding the amino acid sequence is as shown in sequence 11.

[0057] In the present invention, "plasmin", "fibrinplasmin", and "fibrillar protein plasmin" can be used interchangeably and have the same meaning. "Plasminogen", "profibrinoleicin", and "fibrillar protein plasminogen" can be used interchangeably and have the same meaning.

[0058] In this application, the term "insufficiency" of plasminogen refers to the content or activity of plasminogen in the subject's body being lower than that of a normal person, and being sufficiently low to affect the subject's normal physiological function. The term "deficiency" of plasminogen refers to the content or activity of plasminogen in the subject's body being significantly lower than that of a normal person, the activity or expression being extremely low, and the normal physiological function can only be maintained by external supply.

[0059] Those skilled in the art can understand as follows. All technical configurations of plasminogen in the present invention can be applied to plasmin, so the technical configurations described in the present invention cover plasminogen and plasmin. In the circulation process, plasminogen takes a closed inactive conformation, but when it binds to a thrombus or cell surface, it becomes active plasmin with an open conformation under the mediation of plasminogen activator (PA). The active plasmin further hydrolyzes fibrin clots into fibrin degradation products and D-dimers, thereby dissolving the thrombus. Among them, the PAp domain of plasminogen contains an important epitope that maintains plasminogen in an inactive closed conformation, but the KR domain can bind to lysine residues on receptors and substrates. Several types of enzymes as plasminogen activators have already been known, including tissue plasminogen activator (tPA), urokinase plasminogen activator (uPA), kallikrein, and coagulation factor XII (Hagemann factor), etc.

[0060] The "plasminogen active fragment" in the present application includes: 1) an active fragment, also called a lysine-binding fragment, capable of binding to a target sequence of a substrate in a plasminogen protein, for example, a fragment containing Kringle 1, Kringle 2, Kringle 3, Kringle 4, and / or Kringle 5 (for the structure of plasminogen, see Aisina RB, Mukhametova L I. Structure and function of plasminogen / plasmin system [J]. Russian Journal of Bioorganic Chemistry, 2014, 40 (6): 590-605); 2) an active fragment that exerts a proteolytic function in a plasminogen protein, for example, a fragment containing plasminogen activity (proteolytic function) shown in sequence 14; and 3) a fragment having both an activity of binding to a target sequence of a substrate (lysine-binding activity) and a plasminogen activity (proteolytic function) in a plasminogen protein. In some embodiments of the present application, the plasminogen is a protein comprising a plasminogen active fragment as shown in sequence 14. In some embodiments of the present application, the plasminogen is a protein comprising a lysine binding fragment comprising Kringle 1, Kringle 2, Kringle 3, Kringle 4 and / or Kringle 5. In some embodiments, the plasminogen active fragment of the present invention comprises a protein comprising sequence 14 or an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99% identity to sequence 14. Thus, plasminogen according to the present invention includes proteins containing the plasminogen active fragment but still retaining the activity of the plasminogen.In some embodiments, the plasminogen of the present application comprises Kringle 1, Kringle 2, Kringle 3, Kringle 4, and / or Kringle 5, or a protein having at least 80%, 90%, 95%, 96%, 97%, 98%, 99% identity to Kringle 1, Kringle 2, Kringle 3, Kringle 4, or Kringle 5 but still has lysine binding activity.

[0061] At present, the methods for measuring plasminogen and its activity in blood include tissue plasminogen activator activity (t-PAA), plasma tissue plasminogen activator antigen (t-PAAg), plasma tissue plasminogen activity (plgA), plasma tissue plasminogen antigen (plgAg), plasma tissue plasminogen activator inhibitor activity, plasma tissue plasminogen activator inhibitor antigen, and plasma plasmin-antiplasmin complex (PAP). The most common method is the chromogenic substrate method: streptokinase (SK) and luminescent substrate are added to the plasma of the subject, and the PLG in the subject's plasma becomes PLM under the action of SK, which acts on the luminescent substrate, and then measured by a spectrophotometer, and the increase in absorbance is directly proportional to the activity of plasminogen. In addition, immunochemical methods, gel electrophoresis, immunoturbidimetry, radial immunodiffusion, etc. can also be used to measure plasminogen activity in blood.

[0062] "Ortholog" refers to a homologue between different species, including both protein and DNA homologues, also called a direct lineage gene. It specifically refers to a protein or gene that is evolved from the same ancestral gene between different species. The plasminogen of the present invention includes human native plasminogen, and further includes orthologs or orthologs of plasminogens with plasminogen activity derived from different species.

[0063] A "conservative substitution variant" is a variant in which a given amino acid residue is modified but does not change the overall conformation and function of a protein or enzyme, including but not limited to those that substitute an amino acid in the amino acid sequence of a parent protein with an amino acid of similar properties (e.g., acidic, alkaline, hydrophobic, etc.). Amino acids with similar properties are known. For example, arginine, histidine, and lysine are hydrophilic alkaline amino acids and can be substituted for each other. Similarly, isoleucine is a hydrophobic amino acid and can be substituted by leucine, methionine, or valine. Therefore, the similarity of two proteins or amino acid sequences with similar functions may vary. For example, they have a similarity (identity) of 70% to 99% based on the MEGALIGN algorithm. "Conservative substitution variants" further include polypeptides or enzymes with an amino acid identity of 60% or more based on the BLAST or FASTA algorithm, preferably 75% or more, most preferably 85% or more, and most preferably 90% or more, and have the same or essentially similar properties or functions compared to the natural or parent protein or enzyme.

[0064] "Isolated" plasminogen is plasminogen protein that has been separated and / or recovered from its natural environment. In some embodiments, the plasminogen is (1) purified to greater than 90%, greater than 95%, or greater than 98% purity (by weight), e.g., greater than 99% (by weight), as determined by the Lowry method; (2) purified to at least 15 residues of N-terminal or internal amino acid sequence as determined by a spinning cup sequencer; or (3) purified to homogeneity, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing or non-reducing conditions with Coomassie brilliant blue or silver staining. Isolated plasminogen includes plasminogen produced from recombinant cells by bioengineering techniques and separated by at least one further purification step.

[0065] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length, including genetically encoded and non-genetically encoded amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having modified peptide backbones. The terms also include fusion proteins, including, but not limited to, fusion proteins with heterologous amino acid sequences, fusions containing leader sequences of heterologous and homologous origin (with or without an N-terminal methionine residue); and the like.

[0066] The definition of "percentage (%) amino acid sequence identity" of a reference peptide sequence is the percentage of amino acid residues in a candidate sequence that are the same as those in a reference polypeptide sequence, after introducing gaps, if necessary, to achieve the maximum percentage sequence identity, without considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percentage amino acid sequence identity can be achieved by several means within the skill of the art, for example by publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm that achieves the maximum alignment requirements for the full size of the sequences to be compared. However, for the purposes of the present invention, the percentage amino acid sequence identity is obtained by the sequence comparison computer software ALIGN-2.

[0067] When comparing amino acid sequences by using ALIGN-2, the % amino acid sequence identity of a given amino acid sequence A to a given amino acid sequence B (or alternatively, a given amino acid sequence A that has or contains a certain % amino acid sequence identity to, with, or for a given amino acid sequence B) is calculated as follows: Fraction X / Y×100

[0068] where X is the number of amino acid residues that the sequence alignment program ALIGN-2 evaluates as identical and matching in its alignment of A and B, and Y is the total number of amino acid residues in B. It should be understood as follows: if the length of amino acid sequence A and the length of amino acid sequence B are not equal, then the % amino acid sequence identity of A to B will be different from the % amino acid sequence identity of B to A. Unless otherwise stated, all % amino acid sequence identity values ​​used in this text are as described in the previous paragraph and are obtained by the ALIGN-2 computer program.

[0069] The terms "individual," "subject," and "patient" are used interchangeably herein and refer to mammals, including, but not limited to, murines (rats, mice), non-human primates, humans, dogs, cats, ungulates (e.g., horses, cattle, sheep, pigs, goats), and the like.

[0070] A "therapeutically effective amount" or "effective amount" is an amount of plasminogen that, when administered to a mammal or other subject for use in treating a disease, is capable of achieving said prevention and / or treatment of the disease. The "therapeutically effective amount" will vary according to the plasminogen used, the severity of the disease and / or symptoms, and the age, weight, etc., of the subject to be treated.

[0071] The term "treatment" of a disease state includes inhibiting or arresting the development of the disease state or its clinical symptoms, or alleviating the disease state or symptoms, resulting in the temporary or permanent regression of the disease state or its clinical symptoms.

[0072] The term "muscle strength" refers to the strength of muscle contraction during voluntary movement of the limbs, or the strength of the muscle during active movement. Depending on the status of muscle strength, muscle strength is usually divided into the following grades 0 to 5. In grade 0, there is complete paralysis and muscle contraction cannot be measured; in grade 1, only muscle contraction can be detected, but movement is not possible; in grade 2, the limb can move parallel on the bed, but cannot resist its own gravity, i.e., it cannot be lifted off the surface of the bed; in grade 3, the limb can overcome gravity and lift off the bed, but cannot resist resistance; in grade 4, the limb can move against external resistance, but incompletely; in grade 5, muscle strength is normal.

[0073] The term "muscle tone" refers to muscle tension in a relaxed state at rest. Muscle tone is the basis for maintaining various postures and normal movements of the body. Muscle tone is manifested in various ways, for example, the muscle tension of each part of the body when lying down and resting is called resting muscle tone. When the body is standing, no significant muscle contraction is visible, but the muscles in the front and back of the body also maintain a certain tension to maintain the standing posture and stability of the body, which is called postural muscle tone. Muscle tone during movement is called kinetic muscle tone, which is an important factor for ensuring continuous and smooth muscle movement (without tremors, spasms, or convulsions). In pathological conditions, muscle tone increases or decreases, affecting the normal posture and movement of the human body.

[0074] Preparation of the Plasminogen of the Invention For therapeutic use, plasminogen may be isolated and purified from nature or may be synthesized by standard chemical peptide synthesis techniques. When polypeptides are synthesized by chemical methods, the synthesis may be performed in liquid phase or solid phase. Solid phase polypeptide synthesis (SPPS), in which the C-terminal amino acid of the sequence is attached to an insoluble support and the remaining amino acids in the sequence are added in order, is suitable for the chemical synthesis of plasminogen. Various forms of SPPS, e.g., Fmoc and Boc, can be used to synthesize plasminogen. The techniques used for solid-phase synthesis are described in: Barany and Solid-Phase Peptide Synthesis; pages 3-284, The Peptides: Analysis, Synthesis, Biology. Volume 2: Special Methods in Peptide Synthesis, Part A., Merrifield, et al. J. Am. Chem. Soc., 85: 2149-2156 (1963); Stewart et al., Solid Phase Peptide Synthesis, 2nd ed. Pierce Chem. Co., Rockford, Ill. (1984); and Ganesan A. 2006 Mini Rev. Med Chem. 6: 3-10 and Camarero JA et al. 2005 Protein Pept Lett. 12: 723-8. Briefly, small insoluble porous beads are treated with functional units on which the peptide chain is built. After repeated coupling / deprotection cycles, the free N-terminal amine of the attached solid phase is coupled with a single N-protected amino acid unit, which is then deprotected to expose a new N-terminal amine for linking with another amino acid. The peptide remains immobilized on the solid phase and is then excised.

[0075] The plasminogen of the present invention is produced by standard recombinant methods. For example, a nucleic acid encoding plasminogen is inserted into an expression vector and operably linked to control sequences in the expression vector. Expression control sequences include, but are not limited to, a promoter (e.g., a naturally associated promoter or a heterologous promoter), a signal sequence, an enhancer element, and a transcription termination sequence. Control of expression can be a eukaryotic promoter system in a vector, which is transformed or transfected into a eukaryotic host cell (e.g., COS or CHO cells). Once the vector is introduced into a suitable host, the host is maintained under conditions suitable for high level expression of the nucleotide sequence and for collection and purification of the plasminogen.

[0076] Suitable expression vectors usually replicate in the host cell either free or as an integrated part of the host cell chromosomal DNA. Usually, expression vectors contain a selection marker (e.g., ampicillin resistance, hygromycin resistance, tetracycline resistance, kanamycin resistance, or neomycin resistance) which is useful for detecting those cells which have been transformed in vitro with the desired DNA sequence.

[0077] Escherichia coli is an example of a prokaryotic host cell for cloning a polynucleotide encoding plasminogen. Other suitable microbial hosts include bacilli, such as Bacillus subtilis and other Enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts, expression vectors can be generated, which usually contain expression control sequences (e.g., origins of replication) compatible with the host cell. There are also many known promoters, such as the lactose promoter system, the tryptophan (trp) promoter system, the β-lactamase promoter system, or the phage lambda-derived promoter system. Promoters generally control expression and may further include sequences such as ribosome binding sites to initiate transcription and translation when controlling gene sequences, as needed.

[0078] Other microorganisms, such as yeast, can also be used for expression. Yeast (e.g., Saccharomyces (S. cerevisiae) and Pichia are examples of suitable yeast host cells, in which suitable carriers include expression control sequences (e.g., promoters), origins of replication, termination sequences, etc., as necessary. Exemplary promoters include 3-phosphoglycerate kinase and other glycolytic enzymes. Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes for maltose and galactose utilization.

[0079] In addition to microorganisms, mammalian cells (e.g., mammalian cells cultured in in vitro cell culture) can also be used to express and produce the plasminogen (e.g., a polynucleotide encoding plasminogen) of the present invention. See, e.g., Winnacker, From Genes to Clones, VCH Publishers, NY, NY (1987). Suitable mammalian host cells include CHO cell lines, various Cos cell lines, HeLa cells, myeloma cell lines, and transformed B cells or hybridomas. Expression vectors for use in these cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and required processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription terminator sequences. Examples of suitable expression control sequences are promoters derived from rabbit immunoglobulin genes, SV40, adenovirus, bovine papilloma virus, cytomegalovirus, and the like. See Co et al., J. Immunol. 148:1149 (1992).

[0080] Once synthesized (chemically or recombinantly), the plasminogen according to the invention can be purified by standard procedures in the art, such as ammonium sulfate precipitation, affinity columns, column chromatography, high performance liquid chromatography (HPLC), gel electrophoresis, etc. The plasminogen is essentially pure, e.g., at least about 80% to 85% pure, at least about 85%-90% pure, at least about 90%-95% pure, or 98%-99% pure or even more pure, e.g., free of contaminants, such as cell debris, large molecules other than plasminogen, etc.

[0081] Drug combinations Plasminogen of the desired purity is mixed with pharmaceutical carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th ed., Osol, A. ed. (1980)) as required to form a lyophilized formulation or aqueous solution to obtain the therapeutic combination. Acceptable carriers, excipients, and stabilizers are non-toxic to subjects at the required dosages and concentrations, and further include buffers such as phosphates, citrates, and other organic acids. Antioxidants include ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethylenediamine chloride; benzalkonium chloride). chloride), benzethonium chloride; phenol, butanol or benzyl alcohol; alkyl parahydroxybenzoic acid esters, such as methyl or propyl parahydroxybenzoic acid ester; pyrocatechol; resorcinol; cyclohexanol; 3-pentanol; m-cresol; low molecular weight polypeptides (those having less than about 10 residues); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, aspartic acid, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates include glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, fucose or sorbitol; salt forming counterions, such as sodium; metal complexes (such as zinc-protein complexes); and / or non-ionic surfactants, such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG).

[0082] The combination preparation of the present invention may contain one or more active compounds as required for the specific condition requiring treatment, preferably with complementary activities and no side effects, such as antihypertensive drugs, antiarrhythmic drugs, and antidiabetic drugs.

[0083] The plasminogen of the present invention can be encapsulated in microcapsules made, for example, by aggregation techniques or interfacial polymerization, can be incorporated, for example, into colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or can be incorporated into hydroxymethylcellulose or gel microcapsules and poly(methyl methacrylate) microcapsules in coarse emulsions. These techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).

[0084] The plasminogen of the present invention to be administered internally must be sterile, which is readily accomplished by filtration through sterile filtration membranes, prior to or after lyophilization and recombination.

[0085] The plasminogen of the present invention can be prepared in sustained release formulations. Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers having defined shapes and containing the glycoprotein, such as membranes or microcapsules. Examples of sustained release matrices include polyesters, aqueous gels (e.g., poly(2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater. Res., 15:167-277 (1981); Langer, Chem. Tech., 12:98-105 (1982)) or poly(vinyl alcohol), polylactide (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and ethyl-L-glutamic acid (Sidman, et al., Biopolymers 22:547 (1983)), non-degradable ethylene-vinyl acetate (Langer, et al., same source as above), or degradable lactic acid-hydroxyacetic acid copolymers, e.g., Lupron. Depot™ (injectable microspheres composed of lactic acid-hydroxyacetic acid copolymer and leuprolide acetate), and poly D-(-)-3-hydroxybutyrate. Polymers such as ethylene-ethyl acetate and lactic acid-hydroxyacetic acid can release molecules sustainedly for over 100 days, but some aqueous gels release proteins for a shorter period of time. Rational strategies can be designed to stabilize proteins depending on the mechanism involved. For example, if the aggregation mechanism is the exchange of sulfur disulfide bonds to form intermolecular SS bonds, stabilization can be achieved by modifying sulfhydryl residues, freeze-drying from acidic solutions, controlling humidity, using appropriate additives, and developing specific polymer matrix compositions.

[0086] Dosage and dosage Administration of the pharmaceutical compositions of the present invention can be achieved by different ways, such as intravenous, intraperitoneal, subcutaneous, intracranial, intrathecal, intraarterial (eg, via the carotid artery), and intramuscular administration.

[0087] Preparations for use in parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solutions, Ringer's dextrose, dextrose and sodium chloride, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolytic replenishers, and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, inert gases, and the like.

[0088] A medical practitioner may determine a dosage regimen based on various clinical factors. For example, as is known in the medical arts, the dosage regimen for any given patient is determined by several factors, including the patient's body type, body surface area, age, the specific compound being administered, sex, frequency and route of administration, overall health, and other drugs being administered at the same time. The dosage range of the plasminogen-containing pharmaceutical composition of the present invention may be about 0.0001-2000 mg / kg of subject body weight daily, or about 0.001-500 mg / kg (e.g., 0.02 mg / kg, 0.25 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 10 mg / kg, 50 mg / kg, etc.). For example, the dosage may be 1 mg / kg body weight or 50 mg / kg body weight or in the range of 1-50 mg / kg, or at least 1 mg / kg. Doses higher or lower than this illustrative range are also covered, particularly when the above factors are taken into account. Intermediate doses within the above range are also within the scope of the present invention. Subjects may receive such doses daily, every other day, weekly, or according to any schedule determined by empirical analysis. An exemplary dose schedule is 1-10 mg / kg for several consecutive days. During the administration of the drug of the present invention, it is necessary to evaluate the therapeutic effect and safety in real time.

[0089] Product or drug kit One embodiment of the present invention relates to a product or drug kit containing the plasminogen or plasmin of the present invention that can be used to treat cardiovascular disease caused by diabetes and its associated disorders. The product preferably includes a container, a label, or a protocol. Suitable containers are bottles, vials, syringes, etc. The container can be made of various materials, such as glass or plastic. The container contains a composition, the composition is effective to treat the disease or condition of the present invention, and has a sterile inlet (e.g., the container is an intravenous infusion pack or vial and includes a stopper that can be pierced by a hypodermic needle). At least one activator in the composition is plasminogen / plasmin. A label on or attached to the container describes the composition as being used to treat cardiovascular disease caused by diabetes and its associated disorders of the present invention. The product further includes a second container containing a pharmaceutical buffer, such as phosphate buffered saline, Ringer's solution, and glucose solution. It can further include other materials required from a commercial and user perspective, i.e., other buffers, diluents, filters, needles, and syringes. The article of manufacture also includes a protocol with instructions for use, including, for example, instructing a user of the composition to administer the plasminogen composition and other medications associated with treating the disease to a patient. EXAMPLES

[0090] The human plasminogen used in the following examples was derived from donor plasma and was obtained by purification from human donor plasma using process optimization based on the methods described in the literature [1-3], where the human Lys-fibroprotein plasminogen (Lys-plasminogen) and Glu-fibroprotein plasminogen (Glu-plasminogen) were greater than 98%.

[0091] All patients in the following Examples 1 to 7 signed an informed consent form to voluntarily receive the above-mentioned plasminogen purified from human plasma treatment, and the approval of the hospital ethics committee was obtained. The administration method and dosage were appropriately increased or decreased depending on the severity and progress of the disease. The administration method was aerosol inhalation or intravenous injection. The drug concentration for aerosol inhalation and intravenous injection was 5 mg / ml, and saline was used as the solvent.

[0092] Example 1 SMA type II The patient is a female, aged 38 months. At 10 months of age, she was unable to crawl and had weak legs, and her motor skills showed little improvement even after she turned 1 year. At 1 year and 9 months of age, she was diagnosed with SMA through genetic testing, and her muscle strength was grade 2, meaning that her lower limbs could not be supported, so she began taking salbutamol, methylcobalamin, and coenzyme Q10. By the age of 2 years, her limbs had degenerated to the point where she could not crawl, and she could only stand or sit for a short time. At 2 years and 2 months of age, she began mesenchymal stem cell therapy, which improved her balance slightly and made her less susceptible to illness, but she still could not stand. At 2 years and 11 months of age, she was injected with mouse nerve growth factor into acupoints, which improved her balance, enabled her lower limbs to be supported, and reached grade 3 in muscle strength tests. Medication status Intravenous injection; Dosage: 100-200 mg / intravenous injection; Frequency: once every 1 day, once every 2 days, or once every 3 days; One treatment course was 2 weeks; Each course of treatment was given 2-3 weeks apart. A total of 6 courses of treatment were given. The Expanded Hammersmith Functional Motor Scale (HFMSE) was designed to assess motor function in children with SMA types II and III, reflecting disease severity. It assesses the change in motor function, defined as the change from baseline, with higher scores indicating better motor function. [4-6] . Neuromyography is the primary method for diagnosing and identifying motor neuron disease, and the amplitude of the compound muscle action potential reflects nerve axonal damage. SMA is a degenerative motor neuron disease associated with massive motor neuron death, muscle weakness, and reduced or undetectable compound muscle action potential amplitude. [7] . Efficacy status HFMSE score: before treatment, it was 20, after the first treatment course, it was 21. before treatment, it was 23, after the second treatment course, it was 24. after the sixth treatment course, the score was 25. Motor function evaluation: Before treatment, the patient was unable to stand on his own, but after two treatment courses, the patient was able to stand with assistance, and after three treatment courses, the patient achieved assisted walking, and the patient's head control ability was also significantly improved. As the treatment progressed, the patient's motor function further improved, such as the assisted standing time was extended and the assisted walking distance was increased. Electromyogram: Compared to before treatment, the amplitude of action potentials in the bilateral tibial nerve, common peroneal nerve, and femoral nerve increased significantly after treatment (Figure 1). In addition, the patients' mental state improved significantly after administration, and their energy levels increased. No drug-related side effects were observed during treatment. The above results indicate that plasminogen can increase the HFMSE score of type II SMA patients, improve the motor function of the patients, and improve the neuromuscular function and mental status of the patients.

[0093] Example 2 SMA Type II Patients The patient is male and 30 months old. There were no abnormalities after birth. At 9 months, he was unable to stand alone, unable to turn over on his own, his hands sometimes trembling slightly, unable to grasp, and unable to lift his head. At 10 months, he was diagnosed with type II SMA by genetic testing. At 1-2 years of age, he started rehabilitation at a rehabilitation center, and once a week, he was able to continue sitting alone, grasp light objects with both hands, slowly stretch his calves, and turn over with help. At 2 years and 2 months of age, he was intravenously injected with bone marrow mesenchymal stem cells three times, 2 units each time, but no significant improvement was observed. At 2 years and 4 months of age, he was injected with neural stem cells twice, 2 units each time, and the improvement after injection was obvious. Current situation: He can sit alone, and when sitting alone, he can tilt his body slightly to the side and support his body with both hands, but cannot lift his arms. Head control has improved, he can turn his head quickly from side to side, and he can keep his head up with parent-assisted 4-point support. Your leg strength will improve and you will be able to kick your calves back and forth while still sitting in the seat. You will be able to lean on your parent and maintain an upright position with only a little knee support. Medication status The first dose was 50 mg intravenously, the second dose was 50 mg intravenously, and the third and fourth doses were 100 mg intravenously. The administration frequency was once every two days or once every three days for two weeks. Efficacy status The HFMSE score before medication was 2, and after the fourth dose, the HFMSE score was 8, and the patient was able to sit up and raise both hands by himself.Electromyography showed that the amplitude of the action potential of the left femoral nerve, right ulnar nerve, common peroneal nerve, and tibial nerve increased after treatment compared with before treatment (Figure 2). These results indicate that plasminogen can increase the HFMSE scores of patients with type II SMA, improve the patients' motor function, and improve neuromuscular function, and furthermore, no drug-related side effects were observed during treatment.

[0094] Example 3. SMA Type II Patients The patient is female and 24 months old. At 1 year old, she could stand with support but could not crawl with 4-point support. At 16 months old, electromyography showed neurogenic disorder and genetic testing diagnosed her as having SMA type II. Current status: Unstable in sitting alone, unable to sit on her own when lying down, able to stand with support, able to stand by leaning, able to walk with support, but condition may improve or worsen, difficult to raise arms. Medication status Intravenous injection; Dosage: 50mg-100mg / time; Frequency: once a day or once every 3 days; One treatment course is 2 weeks; Each course of treatment was given at 3-4 week intervals, for a total of 8 courses of treatment. Efficacy status HFMSE score: before treatment it was 23 and after the first course it was 24. There was an interval of about 2 months between the patient's first and second course of treatment. Before the second course of treatment it was 23 and after treatment it was 24. After the eighth course of treatment the score was 28. Motor function: The patient was unable to raise his hands above his head before taking the medication. After two treatment courses, the patient achieved standing independently and walking with assistance, and was able to raise both hands above his head. With continued medication, the patient's motor function further improved, and the actions of sitting independently, standing with support, and walking with support became stable and gradually longer in duration. Electromyogram: After treatment, the amplitudes of action potentials in the bilateral median nerve, tibial nerve, common peroneal nerve, and ulnar nerve all increased to various degrees (Figure 3). Furthermore, no drug-related side effects were observed during treatment. The above results indicate that plasminogen can increase the HFMSE scores of patients with type II SMA, improve the patients' motor function, and improve neuromuscular function.

[0095] Example 4: SMA Type II Patients The patient is male and 43 months old. At 12 months of age, electromyogram showed neurogenic damage, and at 14 months of age, genetic testing diagnosed him with SMA type II. At 24 months of age, he was unable to sit alone and could only lean forward to sit. At 29 months of age, he started taking salbutamol, methylcobalamin, and coenzyme q10, and his motor function gradually improved. At 36 months of age, mesenchymal stem cell therapy was started, and he received a total of five intravenous injections of mesenchymal stem cells. After the injection of mesenchymal stem cells, the patient's overall condition improved significantly, his mental state also improved, he was less likely to get tired or sick, but he was unable to stand. At 38 months of age, he received acupoint injections of mouse nerve growth factor, but there was no obvious effect. Medication status First: 50 mg intravenously; second: 50 mg intravenously; third: 100 mg intravenously; fourth: 150 mg intravenously, with each injection given 3 days apart for 2 weeks. Efficacy status After administration, the patient's right arm function improved and the patient was able to lift it 90 degrees without the help of his left hand, but the HFMSE score did not improve. No drug-related side effects were observed during treatment.

[0096] Example 5. SMA Type II Patients The patient is male and 26 months old. At 10 months of age, he was diagnosed with SMA through genetic testing, and the copy number of SMN2 (survival motor neuron gene 2) was 3. At 12 months of age, he was no longer able to roll over in bed, could no longer support his body with his arms, and could only lie completely on the bed, and his fingers could not exert strength on their own. At 13 months of age, he started injecting umbilical cord mesenchymal stem cells, and after stem cell injection, his leg strength improved, his breathing improved, and his sleep quality improved. At 16 months of age, he started taking Chinese herbal medicine. After comprehensive treatment with mesenchymal stem cells, Chinese herbal medicine, and rehabilitation training, the patient was able to sit and balance on his own, but was unable to bend left and right or pick up toys from side to side. Leg strength was significantly improved, breathing improved, voice became louder, pectus excavatum was significantly improved, signs of rib valgus were improved, and strength of arms and hands was improved, but he was unable to pull up with an adult's hand. Arm lifting had regressed, and while he was previously able to lift his arms to the top of his head, he could only lift them to his face with the treatment described below. Medication status Two weeks of intravenous infusion, once every other day, four times in week 1, the doses were 10 mg, 20 mg, 30 mg, and 40 mg, respectively; four times in week 2, the doses were 50 mg, 50 mg, 100 mg, and 100 mg, respectively. Efficacy status After the second dose in the first week, calf and ankle strength increased. After 9 days of two weeks of treatment, hand and arm strength increased, and hand grasping strength increased by 50%. No drug-related side effects were observed during treatment. These results indicate that plasminogen can improve motor function in patients with type II SMA.

[0097] Example 6. Type I SMA Patients The patient is male and 11 months old. He was diagnosed with type I SMA through genetic testing at 6 months of age. At the time of diagnosis, the doctor explained that the average life cycle of patients with this type is 2 years, and the family did not take any treatment measures. Symptoms: Weak head support; upper limbs and arms were weak, could not lift, had little hand swing, weak grip, weak middle finger; lower limbs were weak, had little swing, could not move toes; could not sit alone, could not turn over on his own, had weak sucking power, had difficulty swallowing, blood oxygen monitoring was performed 24 hours a day, blood oxygen saturation was 92-97%, and the chest rose and fell weakly when breathing. Dosage Method Aerosol inhalation (2-3 times / day) + intravenous bolus injection (once every 3 days), the treatment cycle was 10 courses (2 weeks per treatment course). Each course of treatment was performed with an interval of 2 weeks. The aerosol inhalation dose was 5-10 mg, and the intravenous injection dose was 50-200 mg. The CHOP INTEND scale (Children's Hospital of Philadelphia Infant Test of Neuromuscular Disorders) was used to assess improvement in motor function in these patients with type 1 SMA, with higher scores indicating better motor function. [8] . Treatment effect Survival: After 10 courses of treatment, the patient is alive for over 25 months, exceeding the 10 month survival rate of most patients seen in natural history studies of SMA type 1 patients. [9] The study also revealed that after administration, the mental status and growth and development (height, weight, chest circumference) of SMA patients were significantly improved, muscle atrophy was also significantly improved in patients treated with plasminogen compared to patients of the same age who were not treated with plasminogen, and the typical signs of chest collapse in SMA were significantly improved. Furthermore, the study observed a significant improvement in the patients' sleep status after plasminogen administration. CHOP INTEND score: The CHOP INTEND score was 30 before treatment and increased to 50 after 5 courses of treatment. Due to some factors, the 5th and 6th treatment courses were spaced about 2 months apart, so the score dropped to 36 and was 44 after the 6th treatment course. There was a 2-month gap between the 6th and 7th treatment courses. Before the 7th treatment course, the score was 44 and after the medication, it was 45. After the 10th treatment course, the score was 46. Motor function: After the first treatment course, the patient was able to sit alone with head support for approximately 30 seconds. After the fourth treatment course, the time spent sitting alone was extended to approximately 30 seconds. As treatment progressed, the patient's motor function continued to improve, she was able to clench her hands tightly, lift her arms slightly voluntarily, and the frequency of leg movements and swings increased. Swallowing function: After administration, the patient experienced less choking coughs while eating and drinking, and his speech function improved. Respiratory function: On the second day of the first treatment course, the patient's blood oxygen saturation reached 97-98%, and occasionally 95-96%. After the second treatment course, the patient's respiratory power increased. After 10 treatment courses, the patient was over 25 months old and maintained a good respiratory status without ventilatory support. A natural history study of SMA type I showed that without ventilatory support, the survival rate at 20 months was only 8%.

[10] . The above results indicate that plasminogen can increase the CHOP INTEND score of type I SMA patients, improve motor function, and achieve breakthrough improvements in 30 seconds of unassisted standing and 30 seconds of head support exercise; furthermore, it can improve the patients' swallowing function and speech ability, improve the patients' signs of chest collapse, improve pulmonary function, increase blood oxygen saturation, and improve the patients' mental state and sleep.

[0098] Example 7 Non-5q SMA Patients The patient is a female, aged 40 months (3 years and 4 months). The onset of the disease was at 6 months of age, and at 1.5 years (18 months) she was diagnosed with non-5q SMA by genetic testing. She had lung infections and difficulty in expelling sputum, which caused her airway to become blocked, her breathing to become weak, and after intermittent use of a ventilator, she gradually became unable to leave the ventilator due to spontaneous respiratory failure, and used the ventilator for about 1.5 years. She lost her speech function, her face was paralyzed, she could not move, and her muscle strength grade was 0. Symptoms: Since the use of the ventilator, she used a sputum expeller, a sputum suction device, oxygen inhalation, aerosol (twice a day), and nutrition through the nose every day. The results of the electromyogram showed that the motor neurons of both the upper and lower limbs were severely damaged, and no action potentials were observed. Dosage regimen First treatment course (2 weeks): aerosol inhalation, 10 mg, 3 times a day, combined with intravenous injection of 50-100 mg, once every 3 days. The second course of treatment was administered two months after the end of the first course of treatment. Second to fourth treatment courses (there was a 2-week interval between each course): intravenous injection, once every 2 days, dose 150 mg to 250 mg. Treatment effect 1st course of treatment: Hand hanging time increased, amplitude increased, strength increased, left upper arm could move inward with the help of support, lower limbs could bend and stand with assistance for 30 minutes, facial expression increased, eyes could blink, mouth could twitch spontaneously. Second course of treatment: Able to swallow soup occasionally, sleep improved. Third course of treatment: Defecation was normal, the patient was able to shake head from side to side, and was able to hold head elevated for several seconds with assisted support. The wrist was somewhat more powerful, the fingertips could rotate periodically, and the left arm could swing autonomously over a larger range. Blood oxygen level remained at 97% and no longer required supplemental oxygen. Fourth treatment course: The coordination of the left arm improved, the range of motion of the right arm was small but the swing frequency became faster, the muscles of the lower limbs became softer and less stiff, the facial expression became more expressive, and bowel movements became spontaneous. Through treatment, the patient's mental state was significantly improved, his breathing ability was significantly improved, and the need for ventilatory support was gradually reduced. The results indicate that plasminogen can improve the motor function of non-5q SMA patients, including increasing the strength, amplitude, and range of limb movements, can increase the patient's facial expressions, improve the patient's pulmonary and respiratory function, reduce oxygen infusion, increase blood oxygen saturation, improve the patient's swallowing function, and improve the patient's sleep quality.

[0099] Examples 8-15 below are animal model dosing studies, where the plasminogen is still plasminogen protein purified from human donor plasma as described above.

[0100] FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1MsdTg(SMN2*delta7)4299Ahmb / J mutant mice (hereinafter referred to as SMNΔ7 SMA mice) have a homozygous mutation in the SMN1 gene and express the human SMN2 gene, and the clinical and pathological symptoms of the mice resemble those of human SMA. Breeding mice were purchased from Jackson Laboratory, USA (pedigree number: 005025).

[0101] Example 8 Plasminogen extends survival time of SMA model mice SMNΔ7 SMA mice were weighed at birth and randomly divided into vehicle (6 mice) and treatment (5 mice) groups based on body weight. Treatment began 3 days after birth. Mice in the vehicle group received 6 ml / kg of vehicle via intraperitoneal injection daily, and mice in the treatment group received 60 mg / kg of plasminogen via intraperitoneal injection daily. Survival of mice was recorded. The statistical results of survival curves showed that plasminogen could significantly improve the survival curves of SMNΔ7 SMA mice, and the difference was statistically significant (P=0.029). The statistical results of survival time showed that the median survival time of mice in the vehicle group was 14 days, and all mice died on the 15th day, and the median survival time of mice in the treatment group was 16 days, and all mice died on the 17th day, and the difference in statistical analysis was significant (P=0.03). This indicates that plasminogen can extend the survival time of SMA model mice. See Figures 4A and 4B.

[0102] Example 9 Plasminogen promotes transcription of the SMN gene in the spinal cord of SMA model mice Two 3-day-old SMNΔ7 SMA mice were taken, one as the vehicle group, which was administered 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once every morning and afternoon. One as the treatment group mouse, which was administered 30 μg / 6 μl of plasminogen by intraperitoneal injection once every morning and afternoon. One wild-type (FVB) mouse was used as the blank control group, which was administered 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once every morning and afternoon. The administration was performed for 9 consecutive days. The mice were sacrificed and the spinal cords were collected for qPCR detection of all SMN gene transcripts, the forward primer was F:GCGGCGGCAGTGGTGGCGGC (sequence 15) and the reverse primer was R:AGTAGATCGGACAGATTTTGCT (sequence 16). The results showed that there was a certain level of SMN gene transcription in the spinal cord of the mice in the blank control group, the SMN gene transcription level in the mice in the vehicle group was lower than that in the mice in the blank control group, and the SMN gene transcription level in the mice in the treatment group was significantly higher than that in the mice in the vehicle group and the mice in the blank control group (Figure 5). This result suggests that plasminogen can promote the transcription of the SMN gene.

[0103] Example 10 Plasminogen promotes increased NF-κB levels in the brain of SMA model mice Seven 3-day-old SMNΔ7 SMA mice were selected, four in the vehicle group, which received 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once daily in the morning and once daily in the afternoon for the first 9 days, and 6 μl of bovine serum albumin solution (10 mg / ml) by intraperitoneal injection once daily from the 10th day onwards. Three in the treatment group, which received 30 μg / 6 μl of plasminogen by intraperitoneal injection once daily in the morning and once daily in the afternoon for the first 9 days, and 60 μg / 6 μl of plasminogen by intraperitoneal injection once daily from the 10th day onwards. Four wild-type mice served as blank control groups, and were administered 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once every morning and afternoon for the first 9 days, and 6 μl of bovine serum albumin solution (10 mg / ml) was administered by intraperitoneal injection once every day from the 10th day. On the 12th day, the mice were sacrificed and brain tissue was collected, and brain tissue homogenates were prepared for Western blot detection of NF-κB protein. 10% gels were prepared according to the instructions of the SDS-PAGE gel preparation kit (Solarbio, P1320). Samples from each group were mixed uniformly with 4× loading buffer (TaKaRa, e2139) in a volume ratio of 3:1, heated at 100°C for 5 min, cooled and centrifuged for 2 min, and then 20 μL was taken for loading. The electrophoresis conditions were run at 30 V for 30 min, followed by running to the bottom of the gel at 100 V. After electrophoresis, the gel was peeled off and transferred to an activated PVDF membrane (GE, A29433753), and the electrophoresis conditions were 15 V for 2.5 h.The transferred PVDF membrane was immersed in a blocking solution (5% skim milk solution), blocked overnight in a refrigerator at 4 °C, washed four times with TBST (0.01 M Tris-NaCl, pH 7.6 buffer), added rabbit anti-mouse NF-κB antibody (Cell Signaling Technology, 8242) and incubated at room temperature for 3 hours, washed four times with TBST, added goat anti-rabbit IgG (HRP) antibody (Abcam, ab6721) secondary antibody, incubated at room temperature for 1 hour, washed four times with TBST, placed on a clean imaging plate, added Immobilon Western HRP Substrate (MILLIPORE, WBKLS0100) for color development, photographed with a biomolecular imager, and quantitatively analyzed by obtaining the optical density value of each band with Image J. Nuclear factor kappa-B (NF-κB) is an important nuclear transcription factor. Members of the NF-κB family mainly include RelA (p65), c-Rel, RelB, NF-κB1 (p50 protein and its precursor p105), and NF-κB2 (p52 protein and its precursor p100), and each member can function by forming homologous or heterodimers. The most common form in mammalian cells is the p65 / p50 dimer, in which p65 and p50 are bound. In unstimulated cells, NF-κB transcription factors are retained in the cytoplasm because they are bound to the inhibitory IκB (Inhibitor of kappa B) protein. Stimulation of upstream signals induces phosphorylation of IκB protein under the action of IKK (IκB kinase), which is recognized by the ubiquitin ligase complex and promotes degradation of IκB protein in a proteasome-dependent manner, releasing NF-κB to enter the cell nucleus and initiate the expression of target genes.

[11] NF-κB is found in almost all animal cells and is involved in the cellular response to external stimuli, playing an important role in processes such as cellular inflammatory and immune responses. NF-κB is also associated with synaptic plasticity and memory.

[12] . The results showed that the brains of the mice in the blank control group had a certain amount of NF-κB protein, the levels of NF-κB protein in the brains of the mice in the vehicle group were lower than those of the mice in the blank control group, and the levels of NF-κB protein in the brains of the mice in the treatment group were significantly higher than those of the mice in the vehicle group, and the statistical difference was close to significance (P=0.05) (Figure 6). This result suggests that plasminogen can promote the increase of NF-κB protein levels in the brain tissues of SMNΔ7 SMA mice.

[0104] Example 11 Plasminogen promotes increased NF-κB levels in muscles of SMA model mice Muscles were collected from the mice sacrificed in Example 10 above, and Western blot detection of NF-κB protein was performed according to the method described in Example 10 above. The results showed that there was a certain amount of NF-κB protein in the muscles of the mice in the blank control group, the level of NF-κB protein in the muscles of the mice in the vehicle group was lower than that of the mice in the blank control group, and the level of NF-κB protein in the muscles of the mice in the treatment group was significantly higher than that of the mice in the vehicle group, and the statistical difference was significant (* represents P<0.05) (Figure 7). This result suggests that plasminogen can promote the increase of NF-κB protein levels in the muscles of SMNΔ7 SMA mice.

[0105] Example 12 Plasminogen promotes increased SMN protein levels in brain tissue of SMA model mice Two 3-day-old SMNΔ7 SMA mice were taken, one of which was the vehicle group mouse, and was administered 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once every morning and afternoon. The other mouse was the treatment group mouse, and was administered 30 μg / 6 μl of plasminogen by intraperitoneal injection once every morning and afternoon. Two wild-type (FVB) mice were used as blank control groups, and were administered 6 μl of bovine serum albumin solution (5 mg / ml) by intraperitoneal injection once every morning and afternoon. Nine days after treatment, the mice were sacrificed and brain tissue was collected, and brain tissue homogenates were prepared for Western blot detection of SMN protein. 12% gels were prepared according to the SDS-PAGE gel preparation instructions. The samples of each group were mixed uniformly with 4× loading buffer (TaKaRa, e2139) at a volume ratio of 3:1, heated at 100°C for 5 min, cooled and centrifuged for 2 min, and then 20 μL was taken for loading. The electrophoresis conditions were run at 30 V for 30 min, followed by running to the bottom of the gel at 100 V. After electrophoresis, the gel was peeled off and transferred to an activated PVDF membrane (GE, A29433753), and the electrophoresis conditions were 15 V for 2.5 h. The transferred PVDF membrane was immersed in a blocking solution (5% skim milk solution), blocked overnight in a refrigerator at 4 °C, washed four times with TBST (0.01 M Tris-NaCl, pH 7.6 buffer), added rabbit anti-mouse SMN antibody (Proteintech, 11708-1-AP) and incubated at room temperature for 3 hours, washed four times with TBST, added goat anti-rabbit IgG (HRP) antibody (Abcam, ab6721) secondary antibody, incubated at room temperature for 1 hour, washed four times with TBST, placed on a clean imaging plate, added Immobilon Western HRP Substrate (MILLIPORE, WBKLS0100) for color development, photographed with a biomolecular imager, and quantitatively analyzed by obtaining the optical density value of each band with Image J. As a result, the brains of mice in the blank control group expressed a certain amount of SMN protein, the expression level of SMN protein in mice in the vehicle group was lower than that in mice in the blank control group, and the expression level of SMN protein in mice in the treatment group was significantly higher than that in mice in the vehicle group (Figure 8). This result suggests that plasminogen can promote the expression of SMN protein in the brains of SMNΔ7 SMA mice.

[0106] Example 13 Plasminogen promotes increased SMN protein levels in muscle of SMA model mice Hindlimb muscle tissue was collected from the mice sacrificed in Example 12, and tissue homogenates were prepared, followed by Western blot detection of SMN protein using the detection method described in Example 12. As a result, the muscles of the mice in the blank control group expressed a certain amount of SMN protein, the expression level of SMN protein in the muscles of the mice in the vehicle group was lower than that of the mice in the blank control group, and the expression level of SMN protein in the muscles of the mice in the treatment group was significantly higher than that of the mice in the vehicle group (Figure 9). This result suggests that plasminogen can promote the expression of SMN protein in the muscles of SMNΔ7 SMA mice.

[0107] Example 14 Plasminogen promotes the formation of mature NGF in brain tissue of SMA model mice Brain tissues were collected from mice sacrificed in Example 12, and tissue homogenates were prepared for Western blot detection of NGF protein. 12% gels were prepared according to the instructions for SDS-PAGE gel preparation. Samples from each group were mixed uniformly with 4x loading buffer (TaKaRa, e2139) at a volume ratio of 3:1, heated at 100°C for 5 minutes, cooled and centrifuged for 2 minutes, and then 20μL was taken and loaded. The electrophoresis conditions were run at 30V for 30 minutes, followed by running to the bottom of the gel at 100V. After electrophoresis, the gel was peeled off and transferred to an activated PVDF membrane (GE, A29433753), and the electrophoresis conditions were 15V for 2.5 hours. The transferred PVDF membrane was immersed in a blocking solution (5% skim milk solution), blocked overnight in a refrigerator at 4 °C, washed four times with TBST (0.01 M Tris-NaCl, pH 7.6 buffer), added rabbit anti-mouse NGF antibody, incubated at room temperature for 3 hours, washed four times with TBST, added goat anti-rabbit IgG (HRP) antibody (Abcam, ab6721) secondary antibody, incubated at room temperature for 1 hour, washed four times with TBST, placed on a clean imaging plate, added Immobilon Western HRP Substrate (MILLIPORE, WBKLS0100) for color development, photographed with a biomolecular imager, and quantitatively analyzed by obtaining the optical density value of each band with Image J. Nerve growth factor (NGF) is an important member of the neurotrophic factor family. It is synthesized in vivo in the form of a precursor that contains a signal peptide, a leader peptide, and a mature peptide. Research has reported that the precursor of nerve growth factor NGF (Pro-NGF) plays an opposing role to the NGF that is formed by cleavage. Pro-NGF can promote apoptosis of neurons. Mature NGF is involved in the regulation of processes such as neuronal growth, development, differentiation, survival, and repair after injury, and also plays an important role in regulating the functional expression of central and peripheral neurons.

[12] NGF / ProNGF ratio = NGF optical density (OD) / ProNGF optical density (OD) value. The results showed that the brain tissue of the mice in the blank control group had a certain NGF / Pro-NGF ratio, and the NGF / Pro-NGF ratio in the brain tissue of the mice in the treatment group was significantly higher than that in the mice in the vehicle group, and the statistical difference was highly significant (*** indicates P<0.001) (Figure 10). This result suggests that plasminogen can promote the conversion of ProNGF to NGF and promote the formation of mature NGF in the brain tissue of SMA model mice.

[0108] Example 15 Plasminogen ameliorates lung tissue damage in SMA model mice Lung tissue was collected from the mice sacrificed in Example 12 and fixed in 10% neutral formalin fixative for 24 hours. The fixed lung tissue was dehydrated in an alcohol gradient, permeabilized with xylene, and then embedded in paraffin. The sections were 5 μm thick, and the sections were deparaffinized and rehydrated, then stained with hematoxylin and eosin (H&E staining), fractionated with 1% hydrochloric acid ethanol, blued with ammonia water, further dehydrated in an alcohol gradient, mounted, and observed under an optical microscope at 200x magnification. The results showed that the terminal bronchiolar epithelial cells in the lung tissue of the mice in the blank control group were arranged in an orderly manner and could be clearly distinguished; the size of the alveolar cavity was uniform, the alveolar septum was not thickened, and no infiltration of inflammatory cells was observed around the blood vessels; the respiratory bronchiolar epithelium in the lung tissue of the mice in the vehicle group was sloughed off, the alveolar ducts and alveolar sacs were enlarged, the alveoli were collapsed and the structure was disordered, and eosinophils, foam cells and lymphocytes were present around the pulmonary blood vessels; the respiratory bronchiolar epithelium in the lung tissue of the mice in the treatment group was arranged in an orderly manner, the alveolar ducts and alveolar sacs were enlarged, and the alveolar cavity was evenly enlarged, but the alveolar wall composed of a single layer of alveolar epithelium was observed (Figure 11). This suggests that plasminogen can improve the lung tissue damage in SMA model mice. References: [1] KENNETH C. ROBBINS, LOUIS SUMMARIA, DAVID ELWYN et al. Further Studies on the Purification and Characterization of Human Plasminogen and Plasmin.Journal of Biological Chemistry, 1965, 240 (1) :541-550. [2]Summaria L, Spitz F, Arzadon L et al. Isolation and characterization of the affinity chromatography forms of human Glu- and Lys-plasminogens and plasmins. J Biol Chem. 1976 Jun 25;251(12):3693-9. [3]HAGAN JJ, ABLONDI FB, DE RENZO EC. Purification and biochemical properties of human plasminogen.J Biol Chem. 1960 Apr; 235:1005-10. [4] Main M, Kairon H, Mercuri E, Muntoni F. The Hammersmith functional motor scale for children with spinal muscular atrophy: a scale to test ability and monitor progress in children with limited ambulation. Eur J Paediatr Neurol. 2003;7(4):155-9. [5] O'Hagen JM, Glanzman AM, McDermott MP, Ryan PA, Flickinger J, Quigley J, Riley S, Sanborn E, Irvine C, Martens WB, et al. An expanded version of the Hammersmith Functional Motor Scale for SMA II and III patients.NeuromusculDisorder. 2007;17(9–10):693–7. [6] Mercuri E, Messina S, Battini R, Berardinelli A, Boffi P, Bono R, Bruno C, Carboni N, Cini C, Colitto F, et al. Reliability of the Hammersmith functional motor scale for spinal muscular atrophy in a multicentric study. NeuromuscularDisorder. 2006;16(2):93-8. [7] Ke11y JJ, Thibodeau L, Andros PA. Use of electrophysiological tests to measure disease progression in ALS therapeutictrials[J]. Muscle Nerve,1990,13(3):471. [8] Glanzman AM, Mazzone E, Main M, Pelliccioni M, Wood J, Swoboda KJ, et al. The Children's Hospital of Philadelphia Infant Test of Neuromuscular Disorders (CHOP INTEND): test development and reliability. NeuromusculDisorder 2010; 20:155-1 [9] SitharaRamdas, Laurent Servais. New treatments in spinal muscular atrophy: an overview of currently available data. Expert OpinPharmacother. 2020 Feb;21(3):307-315.

[10] Linda P. Lowes, Lindsay N. Alfano, W. David et al. Impact of Age and Motor Function in a Phase 1 / 2A Study of Infants with SMA Type 1 Receiving Single-Dose Gene Replacement Therapy. Pediatr Neurol. 2019 Sep; 98:39-45.

[11] Lenardo M J, Baltimore D. NF-κB: A pleiotropic mediator of inducible and tissue-specific gene control[J]. Cell, 1989, 58(2):227-229.

[12] Aloe L, Rocco M L, Bianchi P, et al. Nerve growth factor: from the early discoveries to the potential clinical use[J]. Journal of Translational Medicine, 2012, 10(1).

Claims

1. A pharmaceutical composition for treating spinal muscular atrophy (SMA) in a subject suffering from SMA, comprising plasminogen, wherein the plasminogen comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO:2, and has plasminogen proteolytic activity.

2. The pharmaceutical composition of claim 1 , wherein the plasminogen stimulates transcription and / or expression of the SMN gene.

3. The pharmaceutical composition of claim 1 or 2, wherein the plasminogen improves muscle strength in a subject.

4. The pharmaceutical composition of any one of claims 1 to 3, wherein the plasminogen extends the survival time of a subject.

5. The pharmaceutical composition of any one of claims 1 to 4, wherein the plasminogen improves muscle tone in a subject.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the plasminogen promotes expression of NF-κB protein in a subject.

7. The pharmaceutical composition of any one of claims 1 to 6, wherein the plasminogen promotes growth and development in a subject.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the plasminogen is used in combination with one or more other drugs or therapeutic methods.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the plasminogen is administered intravenously, intramuscularly, intrathecally, by nasal inhalation, aerosol inhalation, nose drops or eye drops.

10. 2. The pharmaceutical composition of claim 1, wherein the plasminogen is Glu-plasminogen or Lys-plasminogen.

Images