Method for regulating the growth of decapod crustaceans

Abstract

The present invention provides a means for regulating (accelerating or suppressing) growth of Decapoda crustaceans such as shrimp and crab. The method according to the present invention is for regulating growth of animals belonging to the order Decapoda and comprises a step for regulating (inhibiting or enhancing) functions of genes including at least one growth regulation-related gene selected from the group consisting of those involved in the mTOR pathway and the Akt pathway, and upstream and downstream factors thereof, and optionally further including at least one ecdysis-related gene selected from ecdysis-related factors, or functions of transcription products or translation products of said genes.

Description

[Technical Field]

[0001] The present invention relates to a method for regulating the growth of decapod crustaceans (shrimp, crabs, etc.), particularly a method for promoting growth. More specifically, the present invention relates to a method for regulating the growth of decapod crustaceans, particularly a method for promoting growth, which comprises inhibiting or enhancing the function of a specific gene or its transcription product or translation product. [Background technology]

[0002] Decapod crustaceans, such as shrimp and crabs, have long enjoyed the highest demand in Japan, where the world's first complete shrimp aquaculture technology was established. In recent years, demand for shrimp and other species has rapidly increased internationally, and shrimp aquaculture has attracted attention as a global growth industry. However, unlike the livestock industry, which has numerous specialized species for human consumption, shrimp aquaculture lacks established aquaculture varieties. To meet ever-increasing production demands, shrimp aquaculture is forced to operate under high-density conditions that would not exist in the natural environment. As a result, problems that have persisted since the dawn of shrimp aquaculture, such as reduced growth rates and mass mortality, persist to this day. There remains room for highly productive shrimp aquaculture by developing strong, fast-growing species or by developing growth methods. However, there is also a need for growth control methods for purposes such as miniaturizing harmful decapod crustaceans to make them more easily eaten by predators or reducing the energy used for growth to promote sexual maturity.

[0003] To date, methods proposed for improving the growth rate of decapod crustaceans such as shrimp and crabs include administering low-molecular-weight lignin and / or high-molecular-weight lignin (Patent Document 1), administering a peptide having a specific amino acid sequence (GHRP-6) (Patent Document 2), and administering a cholesterol fatty acid ester represented by a specific general formula (Patent Document 3).On the other hand, little is known about methods for improving the growth rate of decapod crustaceans by varying (suppressing or enhancing) the expression level of a gene, although it has been reported that, for example, suppressing the expression of the MIH (Molt-Inhibiting Hormone) gene in the freshwater prawn by RNAi can accelerate the molting cycle (Non-Patent Document 1). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] WO2018 / 079641 (corresponding to Patent No. 6344534) [Patent Document 2] WO2003 / 080102 (corresponding to Patent No. 4195865) [Patent Document 3] Japanese Patent Application Publication No. 9-084527 [Non-patent literature]

[0005] [Non-Patent Document 1] Qial et al. PLoS One. 2018; 13(6): e0198861. Summary of the Invention [Problem to be solved by the invention]

[0006] Conventional methods such as those described in Patent Documents 1 to 3 and Non-Patent Document 1 have room for improvement in terms of growth promotion effects (sustainability, stability, etc.).

[0007] An objective of the present invention is to provide a means for regulating the growth of decapod animals (decapod crustaceans), such as shrimp and crabs, for example, a means for promoting growth, which in particular involves varying the expression level of a gene. [Means for solving the problem]

[0008] The present inventors focused on genes involved in the mTOR signaling pathway (sometimes referred to herein as the "mTOR pathway"), which is involved in regulating environmental signals that affect the growth of organisms, such as TSC (Tuberous Sclerosis Complex) 1 / TSC2, which mediate the transmission of environmental signals. As described in the Examples below, the inventors used the mystery crayfish, a model organism of decapod crustaceans, to inhibit the function of TSC2 and other genes using siRNA-based RNAi techniques, and confirmed excellent growth-promoting effects. Furthermore, the present inventors also focused on AMPK (AMP-activated protein kinase), which is activated by a deterioration in the cellular energy availability, among genes involved in the mTOR signaling pathway. They also confirmed excellent growth-promoting effects by inhibiting the function of this gene. The present inventors further analyzed the relationship between the expression levels of upstream and downstream genes (factors) of other signaling pathways related to growth, such as the mTOR signaling pathway, the PDK1-Akt signaling pathway (sometimes referred to herein as the "Akt pathway"), and molting-related factors, in decapod crustaceans (mystery crayfish) using principal component analysis. As a result, they discovered a group of genes whose expression can be interpreted as promoting growth by suppressing their expression, or conversely, as inhibiting growth by enhancing their expression, as well as a group of genes whose expression can be interpreted as promoting growth by enhancing their expression, or conversely, as inhibiting growth by enhancing their expression. Based on these findings, the present inventors have completed the present invention, which relates to the regulation of the mTOR pathway, the Akt pathway, and their upstream factors, as well as molting-related factors, in both promoting and inhibiting growth in decapod crustaceans.

[0009] That is, in one aspect, the present invention provides the following. [Section 1] A method for regulating the growth of an animal belonging to the order Decapod, comprising a step of regulating the function of a gene including at least one growth regulation-related gene selected from the group consisting of the mTOR pathway, the Akt pathway, and their upstream and downstream factors, and optionally at least one molting-related gene selected from molting-related factors, or the function of a transcription product or translation product of the gene. [Section 2] Item 2. The method according to Item 1, wherein the gene comprises at least one growth regulation-related gene selected from the group consisting of Akt, AMPK, FOXO, p27, PDK, PTEN, TBC1D7, TSC1, and TSC2. [Section 3] Item 2. The method according to Item 1, wherein the gene comprises at least one molting-related gene selected from the group consisting of EcR, Kr-h1, Met, and MIH. [Section 4] Item 4. The method according to any one of Items 1 to 3, wherein the gene comprises at least one selected from the group consisting of AMPK, TSC1, TSC2, and PDK as a growth regulation-related gene, and the step comprises regulating the growth regulation-related gene or its transcription product or translation product so as to inhibit its function, thereby regulating the growth of the animal belonging to the order Decapod. [Section 5] Item 5. The method according to Item 4, wherein the growth regulation-related genes include at least AMPK and TSC1 and / or TSC2. [Section 6] Item 4. The method according to any one of Items 1 to 3, wherein the genes include at least Akt as a growth regulation-related gene, and the step comprises regulating the growth regulation-related gene or its transcription product or translation product so as to enhance its function, thereby regulating the growth of the animal belonging to the order Decapod. [Section 7] Item 4. The method according to any one of Items 1 to 3, wherein the gene includes at least Akt as a growth regulation-related gene, and the step comprises regulating the growth regulation-related gene or its transcription product or translation product so as to inhibit its function, thereby regulating the growth of the animal belonging to the order Decapod. [Section 8] Item 4. The method according to any one of Items 1 to 3, wherein the genes include at least PTEN as a growth regulation-related gene and at least MIH as a molting-related gene, and the step comprises regulating the growth regulation-related gene and the molting-related gene or their transcription products or translation products so as to inhibit their functions, thereby regulating the growth of the animal belonging to the order Decapod. [Section 9] Item 1, wherein the gene comprises at least one growth regulation-related gene selected from the group consisting of 4EBP, Akt, FGF1, FOXO, ILP, PTEN, Rheb, S6K1, TSC1 and TSC2, and optionally at least one molting-related gene selected from the group consisting of EcR, Kr-h1, Met and MIH. [Section 10] Item 10. The method according to any one of Items 1 to 5 and 7 to 9, wherein the regulation of the function of the gene or its transcription product or translation product is inhibition, which is achieved by suppressing expression of the gene by RNA interference (RNAi), antisense, or genome editing. [Section 11] An animal belonging to the order Decapod, in which the function of a gene, or the function of its transcription product or translation product, including at least one growth regulation-related gene selected from the group consisting of the mTOR pathway, the Akt pathway, and their upstream and downstream factors, and optionally at least one molting-related gene selected from molting-related factors, is regulated. [Section 12] Item 12. The animal of Item 11, wherein the gene comprises at least one growth regulation-related gene selected from the group consisting of Akt, AMPK, FOXO, p27, PDK, PTEN, TBC1D7, TSC1, and TSC2. [Section 13] Item 12. The animal of Item 11, wherein the gene comprises at least one molting-related gene selected from the group consisting of EcR, Kr-h1, Met, and MIH. [Section 14] Item 12. The animal of item 11, wherein the genes include at least one growth regulation-related gene selected from the group consisting of 4EBP, Akt, FGF1, FOXO, ILP, PTEN, Rheb, S6K1, TSC1 and TSC2, and optionally further at least one molting-related gene selected from the group consisting of EcR, Kr-h1, Met and MIH. [Section 15] The animal according to any one of claims 11 to 14, wherein the regulation of the function of the gene or its transcription product or translation product is inhibition, and the animal contains in its body a double-stranded RNA or vector for suppressing the expression of the gene by RNA interference (RNAi), a chromosome lacking the function of the gene, or an inhibitor of the translation product of the gene or its receptor. [Effects of the Invention]

[0010] By utilizing the growth regulation method for decapod crustaceans according to the present invention, it is possible to promote growth even in large-scale rearing environments such as aquaculture, or conversely, to suppress growth depending on the application. For example, high-growth decapod crustaceans can be obtained by knocking down a specific gene without genetic modification, which is preferable from the perspective of environmental conservation, and high-growth strains of decapod crustaceans can be obtained by genetic modification, in which the effect is passed down through generations. [Brief explanation of the drawings]

[0011] [Figure 1]FIG. 1 shows the results of Example 1 regarding the difference in growth between the TSC2 function inhibition group (TSC2RNAi) and the GFP function inhibition group (GFPRNAi) as a control group. [A] Comparison of body size between TSC2 function inhibition individuals (25 days after the start) and the control group (31 days after the start) (initial individual weights were 28 mg for both). [B] Changes in individual body weight over the number of days since the start of the experiment. Based on the results of individual body weight measurements taken one day after molting, the relationship between individual body weight and the number of days since the start of the experiment was analyzed by linear regression analysis. As a result, the regression coefficient, which indicates the daily growth rate, was approximately twice as high in the TSC2 function inhibition group as in the control group. [C] Changes in individual weight gain rate per molt. [D] Changes in molting interval per molt. [E] Changes in individual body weight per molt. In the TSC2 function inhibition group, the amount of molting growth increased and the molting occurred one molt earlier during the experimental period. *: n = 7–9; Students' t-test or Welch's t-test; P < 0.05. [Figure 2] Figure 2 is a photograph comparing the body size of the TSC1 and AMPK simultaneous functional inhibition group (TSC1 RNAi & KRNAi) (19 days after initiation) and the control group (GFP RNAi) (16 days after initiation) in Example 2 (both individual body weights at the start were 20 mg). [Figure 3] Figure 3 is a schematic diagram of the mTOR signaling pathway (adapted from Journal of Cell Science 122, 3589-3594. doi:10.1242 / jcs.051011). [Figure 4] FIG. 4 shows the relationship between the principal component scores of post-molt growth PC1 predicted from the state of the individual before molting using the mathematical model created in Example 4 and the actual principal component scores of post-molt growth PC1. [Figure 5] Figure 5 shows the correlation between gene expression levels and growth PC1 obtained in Example 4. [A] Correlation with candidate upstream ligands of the Akt pathway and the mTOR pathway. A significant correlation was observed only with the two factors, FGF1 and ILP, enclosed by dashed lines. [B] The gene expression dynamics of Rheb is shown as an example of a factor constituting the mTOR and Akt pathway that showed a particularly high correlation with growth PC1. [Figure 6] FIG. 6 is a path diagram model created based on the results of Tables 6 and 7 in Example 4, showing the relationship between the expression dynamics of each gene and growth. DETAILED DESCRIPTION OF THE INVENTION

[0012] -Growth regulation (promotion or inhibition) method- The method of the present invention for regulating the growth of an animal belonging to the order Decapod (sometimes referred to herein as the "target animal") (sometimes referred to herein as the "growth regulation method of the present invention") comprises a step of regulating the function of a specific gene or its transcription product or translation product (sometimes referred to herein as the "regulation step") (sometimes referred to herein as the "regulation step").

[0013] The growth regulation methods of the present invention include (I) a method for promoting the growth of a target animal (sometimes referred to herein as the "growth promotion method of the present invention") and (II) a method for suppressing the growth of a target animal (sometimes referred to herein as the "growth suppression method of the present invention"), which may vary depending on the embodiment and application of the present invention. The regulation step includes (i) a step for inhibiting the function of a specific gene or the like (sometimes referred to herein as the "inhibition step"), (ii) a step for enhancing the function of a specific gene or the like (sometimes referred to herein as the "enhancement step"), and (iii) a step for inhibiting the function of a specific gene or the like and enhancing the function of another specific gene or the like (sometimes referred to herein as the "suppression / enhancement step"), which may vary depending on the embodiment of the present invention. As will be described in detail below, specific genes or the like include (A) those whose function is inhibited to promote the growth of a target animal and, conversely, whose function is enhanced to suppress the growth of a target animal, and (B) those whose function is inhibited to suppress the growth of a target animal and, conversely, whose function is enhanced to promote the growth of a target animal. Therefore, the growth regulation method of the present invention includes, for example, (Ii) a growth promotion method including a step of inhibiting a specific gene, etc., (I-ii) a growth promotion method including a step of enhancing a specific gene, etc., (I-iii) a growth promotion method including a step of suppressing / enhancing a specific gene, i.e., a step of inhibiting a specific gene, etc. and a step of enhancing another specific gene, etc., (II-i) a growth inhibition method including a step of inhibiting a specific gene, etc., (II-ii) a growth inhibition method including a step of enhancing a specific gene, etc., (II-iii) a growth inhibition method including a step of suppressing / enhancing a specific gene, i.e., a step of inhibiting a specific gene, etc. and a step of enhancing another specific gene, etc.

[0014] The "target animals" (animals belonging to the order Decapod, decapod crustaceans) of the present invention are not particularly limited in type and include various decapod crustaceans known as shrimp, crabs, hermit crabs, crayfish, and the like. The mystery crayfish (Procambarus virginalis), a freshwater shrimp that is exceptionally easy to raise and breed among decapod crustaceans and used in the examples described below, has recently attracted attention as a model organism for decapod crustaceans and is a representative example of a target animal of the present invention. Preferred target animals include those that are important in aquaculture, such as kuruma prawns (Marsupenaeus japonicus), black tiger shrimp (Penaeus monodon), and whitenamei shrimp (Penaeus vannamei). In addition to red king shrimp, nephrops, swimming crabs, and king crabs, which are the subject of aquaculture, spiny lobsters are also relatively important target animals.

[0015] In the present invention, the term "specific gene" may include a "growth regulation-related gene." In the present invention, a "growth regulation-related gene" refers to a gene that is part of the "mTOR pathway, Akt pathway, and their upstream and downstream factors," which are involved in the cell division control mechanism or the growth-instructing mechanism. Examples of factors in the "mTOR pathway" include genes such as 4EBP, AMPK, mTOR, PRAS40, Raptor, Rheb, S6K1, TBC1D7, TSC1, and TSC2. Examples of factors in the "Akt pathway" include genes such as Akt, FOXO, PDK, and PTEN. Examples of "downstream factors of the mTOR pathway and Akt pathway" include genes such as p27, which controls the cell cycle. Examples of "upstream factors of the mTOR pathway and Akt pathway" include genes such as FGF1 and ILP (insulin-like peptide). For the genes of the mTOR pathway and its upstream factors, see Figure 3. The growth regulation-related gene may be any one kind or a combination of two or more kinds. Furthermore, the growth regulation-related gene may be at least one kind of gene selected from any one of "mTOR pathway factors," "Akt pathway factors," "upstream factors of the mTOR pathway and / or Akt pathway," and "downstream factors of the mTOR pathway and / or Akt pathway," or may be at least two kinds of genes selected from these multiple factors (at least one kind of gene for each factor).

[0016] The "specific gene" in the present invention may include a "molting-related gene." In this embodiment, the specific gene may not include a growth regulation-related gene. The "molting-related gene" in the present invention refers to a gene that is a "molting-related factor" involved in the molting control mechanism. Examples of molting-related genes include E75, EcR, Kr-h1, Met, and MIH. The molting-related gene may be any one of these genes or a combination of two or more of them. The molting-related gene may be, for example, at least one selected from the group consisting of E75, EcR, Kr-h1, and Met, preferably Kr-h1.

[0017] In one embodiment of the present invention, the “specific gene” includes a “growth regulation-related gene” and can optionally further include a “molting-related gene.” In other words, the specific gene may include only at least one type of growth regulation-related gene, or may include both at least one type of growth regulation-related gene and at least one type of molting-related gene.

[0018] In one embodiment of the present invention, the “specific gene” includes a “molting-related gene” and can optionally further include a “growth regulation-related gene.” In other words, the specific gene may include only at least one molting-related gene, or may include both at least one molting-related gene and at least one growth regulation-related gene.

[0019] The "specific gene" in one embodiment of the present invention (sometimes referred to herein as "specific gene 0") comprises "at least one gene selected from the group consisting of 4EBP, Akt, AMPK, FGF1, FOXO, ILP, p27, PDK, PTEN, Rheb, S6K1, TBC1D7, TSC1, and TSC2" as a growth regulation-related gene, and can optionally further comprise "at least one gene selected from the group consisting of EcR, Kr-h1, Met, and MIH" as a molting-related gene. Specific gene 0 is a combination of "specific gene 1" and "specific gene 2," which will be described below.

[0020] In one embodiment of the present invention, a "specific gene" (sometimes referred to herein as "specific gene 1") includes at least one gene selected from the group consisting of Akt, AMPK, FOXO, p27, PDK, PTEN, TBC1D7, TSC1, and TSC2 as a growth regulation-related gene, and may optionally further include at least one gene selected from the group consisting of EcR, Kr-h1, Met, and MIH as a molting-related gene. Among the growth regulation-related genes included in specific gene 1, Akt, FOXO, PDK, and PTEN are factors of the Akt pathway, and p27 is a factor in the mTOR pathway and downstream of the Akt pathway. AMPK, TBC1D7, TSC1, and TSC2 are factors in the mTOR pathway. For details of specific gene 1, see Example 1 (Table 1), Example 2 (Table 2), and Example 3 (Table 3), etc., described later in this specification.

[0021] In one embodiment of the present invention, the "specific gene" (sometimes referred to herein as "specific gene 2") comprises at least one gene selected from the group consisting of 4EBP, Akt, FGF1, FOXO, ILP, PTEN, Rheb, S6K1, TSC1, and TSC2 as a growth regulation-related gene, and may optionally further comprise at least one gene selected from the group consisting of EcR, Kr-h1, Met, and MIH as a molting-related gene. Among the growth regulation-related genes included in specific gene 2, Akt, FOXO, and PTEN are factors of the Akt pathway; 4EBP, Rheb, S6K1, TSC1, and TSC2 are factors of the mTOR pathway; and FGF1 and ILP are upstream factors of the Akt pathway and the mTOR pathway. For details of specific gene 2, see Example 4 (Table 4, Figure 5) described later in this specification. Akt, FOXO, PTEN, and TSC2 fall under both specific genes 1 and 2, and can be treated as either specific gene 1 or specific gene 2 depending on their relationship with the technical concept of the present invention.

[0022] Specific genes (growth regulation-related genes and molting-related genes) include (A) genes whose function is inhibited to promote the growth of a target animal, or whose function is enhanced to suppress the growth of a target animal (these genes may be collectively referred to herein as "specific gene A"); and (B) genes whose function is inhibited to suppress the growth of a target animal, or whose function is enhanced to promote the growth of a target animal (these genes may be collectively referred to herein as "specific gene B"). Specific genes A include (A1) specific genes 1, including growth regulation-related genes such as AMPK, FOXO, p27, PDK, PTEN, TBC1D7, TSC1, and TSC2; and (A2) specific genes 2, including growth regulation-related genes such as 4EBP, FOXO, PTEN, S6K1, and TSC2, and molting-related genes such as Kr-h1 and MIH (these genes may be collectively referred to herein as "specific gene 2A"). Examples of specific genes B include (B1) growth regulation-related genes such as Akt and PTEN among specific genes 1, and (B2) growth regulation-related genes such as Akt, FGF1, ILP, Rheb, and S6K1, and molting-related genes such as EcR and Met among specific genes 2. Note that PTEN and S6K1 correspond to both specific genes A and B, and can be treated as either specific gene A or specific gene B depending on the embodiment (e.g., depending on the type of other specific gene used in combination or the number of molting events).

[0023] In one embodiment of the present invention, the specific gene preferably includes at least one growth regulation-related gene selected from the group consisting of AMPK, TSC1, TSC2, and PDK (i.e., the specific gene regulates the function of at least the AMPK gene, TSC1 gene, TSC2 gene, or PDK gene, or their transcription or translation products), because this enhances the effect on regulating the growth of the target animal (e.g., the effect of promoting the growth of the target animal when its function is inhibited). In this embodiment, the specific gene may be at least one selected from the group consisting of AMPK, TSC1, TSC2, and PDK (i.e., AMPK alone, TSC1 alone, TSC2 alone, PDK alone, or any combination thereof), or it may be a combination of AMPK, TSC1, TSC2, or PDK with another gene (e.g., at least one gene selected from the group consisting of Akt, FOXO, p27, PTEN, and TBC1D7 (specific gene 1 other than AMPK, TSC1, TSC2, and PDK), or specific gene 2). For this embodiment, reference can be made to Example 1 (Table 1) and Example 2 (Table 2) later in this specification.

[0024] In one embodiment of the present invention, the specific genes preferably include at least AMPK and TSC1 and / or TSC2 as growth regulation-related genes (i.e., the specific genes, etc., regulate the function of at least the AMPK gene, the TSC1 gene, and / or the TSC2 gene, or their transcription or translation products), because this improves the effect on regulating the growth of the target animal (e.g., the effect of promoting the growth of the target animal when its function is inhibited). AMPK is a factor (gene) that mediates the deterioration of the available energy status of cells, and an embodiment in which it is used in combination with TSC1 / TSC2, which mediate the transmission of environmental signals, is more preferred because it provides a better function of regulating (e.g., promoting) the growth rate of the target animal. For this embodiment, see Example 2 (Table 2) described later in this specification. In this embodiment, only AMPK and TSC1 and / or TSC2 may be used as specific genes, or AMPK, TSC1 and / or TSC2 may be used in combination with other genes (for example, at least one gene selected from the group consisting of Akt, FOXO, p27, PDK, PTEN and TBC1D7 (specific gene 1 other than AMPK, TSC1 and TSC2), or specific gene 2).

[0025] In one embodiment of the present invention, the specific gene preferably includes at least Akt as a growth regulation-related gene (i.e., the specific gene, etc., regulates the function of at least the Akt gene or its transcription or translation product) in order to regulate the growth of a subject animal (e.g., in terms of the effect of promoting the growth of a subject animal when the function is enhanced, or the effect of suppressing the growth of a subject animal when the function is inhibited). For this embodiment, see Example 1 (Table 1) described later in this specification.

[0026] In one embodiment of the present invention, the specific genes preferably include at least PTEN or another growth regulation-related gene (preferably included in specific gene 2) and MIH, or PTEN and MIH or another molting-related gene, in order to regulate the growth of the target animal (e.g., in terms of the effect of promoting the growth of the target animal when the function is inhibited). For this embodiment, see Example 3 described later in this specification.

[0027] The means for regulating (inhibiting or enhancing) the function of a specific gene, etc. are not particularly limited, and various well-known, conventional, or publicly known means can be used, and appropriate conditions can be set depending on the means selected.

[0028] Methods for inhibiting the function of a specific gene itself include, for example, genome editing technologies (CRISPR-Cas system, TALEN, ZFN) or other genetic recombination technologies (classical homologous recombination, etc.). For example, when using the CRISPR-Cas system, appropriate elements depending on the system (RNAs such as crRNA, tracrRNA, sgRNA, etc. corresponding to the base sequence of the specific gene, and Cas proteins (Cas9, Cas3, etc.) or mRNAs, vectors, etc. for expressing them) can be administered to individual animals, embryos, eggs, etc. of a target animal by an appropriate method (injection, electroporation, addition to culture medium, etc.) using an appropriate cell delivery method (liposomes, etc.) as needed, thereby introducing a mutation (insertion, deletion, substitution, and / or addition of at least one base) into a specific gene on a chromosome and causing its function to be impaired. The above-mentioned RNAs, vectors, and other necessary elements can be designed and prepared according to standard methods. Depending on the type of specific gene, there may be multiple copies of the same gene in the genome (present at multiple locations). In such cases, the functions of all of the multiple genes may be deleted, or only a portion of the multiple genes (at least one) may be deleted.

[0029] Methods for inhibiting the function of a specific gene's transcript (mRNA) include, for example, RNA interference (RNAi) and conventional antisense methods, which degrade the transcript of a specific gene or inhibit its translation into protein. To suppress the expression of a specific gene, the RNAi method uses (a) siRNA (synthetic double-stranded RNA) containing a partial base sequence of the specific gene's mRNA and its complementary base sequence, which can be incorporated into the RNA-induced silencing complex (RISC) to induce mRNA degradation of the specific gene; (b) a vector for generating shRNA, which is a hairpin RNA for delivering siRNA; and (c) a vector for generating miRNA, which inhibits the translation of the specific gene's mRNA into protein by binding to the 3' end of RISC. On the other hand, conventional antisense methods use nucleic acids containing a base sequence complementary to the specific gene's mRNA. When using RNAi or antisense methods, appropriate elements such as those described above depending on the method can be administered to the target animal by appropriate means (e.g., injection) in combination with an appropriate cell delivery means (e.g., liposomes) as needed. The above-mentioned RNA, vector, and other necessary elements can be designed and prepared according to conventional methods.

[0030] Examples of means for inhibiting the function of a translation product (protein) of a specific gene include compounds, antibodies (neutralizing antibodies), aptamers, and other inhibitors that inhibit the function of the translation product protein by binding to the translation product itself, or compounds, antibodies (neutralizing antibodies), aptamers, and other inhibitors that inhibit the function of the translation product protein by binding to other proteins that interact with the translation product protein (e.g., receptor proteins, proteins that combine to form complexes, etc.). Inhibitors such as the above-mentioned compounds, antibodies, and aptamers can be administered to individual target animals by appropriate methods (e.g., injection, medicated bath (addition to an aquarium), etc.). Known compounds, antibodies, aptamers, and other inhibitors for inhibiting the function of a protein of a specific gene may be used (e.g., those whose inhibitory effect on a specific gene, etc., in animals other than the target animal has been confirmed), or they may be newly created using standard methods such as design, immunization, and screening.

[0031] Examples of means for enhancing the function of a specific gene itself include overexpression of the specific gene by using an expression vector (such as a viral vector plasmid or an expression plasmid) into which the specific gene has been inserted, by inserting a high-expression promoter into the promoter region of the specific gene in the genome using genome editing techniques such as those described above, or by incorporating an additional specific gene into a specific region (target sequence) in the genome (for example, increasing the number of genes from one to two or more). Appropriate elements (such as RNA, protein, mRNA, and expression vectors) for these methods can be designed and prepared according to standard methods, and can be administered to individual animals, embryos, eggs, etc. of the target animal and introduced into the cells by an appropriate method (such as injection, electroporation, or addition to culture medium) in combination with an appropriate cell delivery means (such as liposomes) if necessary.

[0032] One method for enhancing the function of a transcription product (mRNA) of a specific gene is, for example, to administer the mRNA itself to an individual animal, embryo, egg, or the like of a target animal by an appropriate method (injection, electroporation, addition to culture medium, etc.), optionally in combination with an appropriate cell delivery means (liposomes, etc.), so that it is translated within the cells into which it is introduced. The above-mentioned expression vectors, mRNA, and other necessary elements can be designed and prepared according to standard methods.

[0033] Examples of methods for enhancing the function of a translation product (protein) of a specific gene include methods using compounds, antibodies (agonists), aptamers, and other enhancers (agonists) that exhibit a function equivalent to that of the translation product protein by binding to other proteins that interact with the translation product protein (e.g., receptor proteins, proteins that combine to form complexes, etc.). Enhancers (agonists) such as the above-mentioned compounds, antibodies, and aptamers can be administered to individual target animals by appropriate methods (e.g., injection, medicated bath (addition to an aquarium), etc.). Enhancers (agonists) such as compounds, antibodies, and aptamers that exhibit a function equivalent to that of the protein of a specific gene may be known compounds (including those that have been shown to enhance a specific gene, etc., in animals other than the target animal), or they may be newly prepared using standard methods such as design, immunization, and screening.

[0034] The form in which the modulation (inhibition and / or enhancement) step is performed on a target animal is not particularly limited, and the modulation step can be performed in an appropriate state (egg, embryo, individual, etc.) or stage (molting stage of an individual, etc.) depending on the type of target animal. Furthermore, when elements necessary for performing the modulation step, such as a predetermined siRNA, vector, etc. in RNA interference when the modulation is inhibition; elements for modifying (deleting, etc.) a specific gene in the genome by genome editing technology, etc., such as a predetermined RNA, protein, vector, etc. in the CRISPR-Cas system; inhibitors of the protein of the specific gene or other proteins that interact with it; expression vectors into which the specific gene has been inserted when the modulation is enhancement; elements for modifying (inserting, etc.) a specific gene or its promoter, etc. in the genome by genome editing technology, etc., such as a predetermined RNA, protein, vector, etc. in the CRISPR-Cas system; mRNA of the specific gene; enhancers (agonists) for other proteins that interact with the specific gene, etc., are administered to an individual target animal, the timing, frequency, interval, administration site, etc. of the administration can be appropriately adjusted taking into consideration the effects of the invention. For example, the administration of the above-mentioned elements can be carried out at one or more timings in the life cycle of the target animal, such as before the first molt, before the second molt (between the first and second molts), before the third molt (between the second and third molts), etc., depending on the type of specific gene selected. The number of administrations may be one time per timing, or multiple times at appropriate intervals, taking into consideration, for example, the durability of the effects of the invention. The dosage (amount injected into the body, concentration in the culture medium or aquarium, etc.) can be set so as to achieve the desired growth regulation (promotion or inhibition) effect, taking into consideration, for example, the size of the individual. The administration site (route) may be systemic or local, depending on the site where the specific gene is expressed.

[0035] The degree to which the function of a specific gene, etc. is regulated (inhibited and / or enhanced) is not particularly limited, and can be regulated by using appropriate means and conditions so that the desired effect of the present invention is achieved. When the function of a specific gene, etc. is inhibited, for example, the specific gene may be knocked out by genome editing, etc., i.e., the function of the specific gene, etc. is completely inhibited (100% suppressed), or the specific gene may be knocked down by genome editing, RNAi method, antisense method, etc., i.e., the function of the specific gene, etc. is inhibited to a certain extent (suppressed in the range of more than 0% and less than 100%). For example, if the expression level of the transcription product or translation product of a specific gene in a subject animal (treatment group) to which the growth regulation (promotion or inhibition) method of the present invention has been applied is (1) statistically significantly reduced, and / or (2) reduced to 1% or less, 5% or less, 10% or less, 20% or less, 30% or less, 40% or less, 50% or less, 60% or less, 70% or less, 80% or less, 90% or less, or 95% or less, compared to a subject animal (control group) to which the growth regulation (promotion or inhibition) method of the present invention has not been applied, it can be evaluated that the function of a specific gene, etc. has been inhibited (i.e., the effect of the present invention in this embodiment has been achieved). On the other hand, when enhancing the function of a specific gene, etc., the function of the specific gene, etc. can be evaluated as being enhanced (i.e., the effect of the present invention in this embodiment is being achieved) if the expression level of the transcription product or translation product of the specific gene in the target animals (treatment group) to which the growth regulation method of the present invention has been applied is (1) statistically significantly increased, and / or (2) increased by 110% or more, 120% or more, 140% or more, 150% or more, 160% or more, 180% or more, 2-fold (200%) or more, 4-fold or more, 5-fold or more, 6-fold or more, 8-fold or more, 10-fold or more, or 100-fold or more, compared to the target animals (control group) to which the growth regulation (promotion or inhibition) method of the present invention has not been applied.

[0036] The respective effects of the "growth-promoting method of the present invention" or "growth-suppressing method of the present invention" can be more directly achieved if at least one of the following (1) or (2) is observed during at least one of the following periods: the period from administration to the first (first) molt thereafter, the period between the first molt and the next (second) molt, the period between the second molt and the next (third) molt, etc. As an example, if administration is performed between the first and second molts in the life cycle of the target animal, "the first (first) molt thereafter after administration" refers to the second molt in the life cycle of the target animal. The longer the following items are observed after administration, the longer the duration of the effect of the present invention can be evaluated. <Growth promotion method> (1) The number of days until molting (or between molts) in the treated group is statistically significantly shorter than that in the control group. (2) The rate of increase in individual body weight and / or length (total length, carapace length, etc.) after molting (or between molts) in the treated group is statistically significantly higher than that in the control group. <Growth suppression method> (1) The number of days until molting (or between molts) in the treated group is statistically significantly longer than in the control group. (2) The rate of increase in individual body weight and / or length (total length, carapace length, etc.) after molting (or between molts) in the treated group is statistically significantly lower than that in the control group.

[0037] The growth regulation (promotion or suppression) method of the present invention may, if necessary, include steps other than the regulation (inhibition and / or enhancement) step described above. Examples of such steps include culturing eggs or embryos of target animals that have undergone a regulation step, or rearing (including farming) individual target animals born from such eggs or embryos or that have undergone other regulation steps, in order to confirm the growth regulation effect of the regulation step or to actually obtain target animals to which the growth regulation method has been applied. The embodiments of the culturing, rearing (farming), and other steps in this case are basically the same as those for general target animals, and, depending on the growth regulation, the amount of food, rearing density, and the like can be appropriately adjusted.

[0038] -Target animals after application of growth regulation (promotion or inhibition) methods- An animal belonging to the order Decapod according to the present invention (sometimes referred to in this specification as an "animal to which the method has been applied") is a target animal to which (obtained by applying) the growth regulation (promotion or inhibition) method of the present invention as described above has been applied, and in which the function of a specific gene (e.g., a specific gene or its transcription product or translation product) has been regulated (inhibited and / or enhanced).

[0039] An animal that has undergone the method of the present invention has characteristics that reflect the growth regulation (promotion or inhibition) method of the present invention that has been applied. For example, if the growth regulation method of the present invention employs a means for inhibiting the function of a specific gene itself (such as genome editing technology), as described above, the animal that has undergone the method will contain a chromosome in which the function of the specific gene is deleted. If the growth regulation method of the present invention employs a means for inhibiting the function of the transcription product (mRNA) of a specific gene (such as RNA interference), the animal that has undergone the method will contain double-stranded RNA (siRNA) for inhibiting the expression of the specific gene, or other elements for inhibiting the expression of the specific gene (such as vectors). If the growth regulation method of the present invention employs a means for inhibiting the function of the translation product (protein) of a specific gene (such as RNA interference), the animal that has undergone the method will contain an inhibitor, such as a compound, antibody, or aptamer, that inhibits the function of the protein. On the other hand, when the growth regulation method of the present invention employs a means for enhancing the function of a specific gene itself, as described above, the animal to which the method has been applied contains an expression vector for the specific gene in its body, a chromosome into which a base sequence containing the specific gene derived from the expression vector has been incorporated, or a chromosome into which a high-expression promoter for the specific gene has been inserted or into which the specific gene has been additionally incorporated using genome editing technology or the like. When the growth regulation method of the present invention employs a means for enhancing the function of the transcription product (mRNA) of the specific gene in its body, the animal to which the method has been applied contains the mRNA of the specific gene in its body (at an overexpressed level). When the growth regulation method of the present invention employs a means for enhancing the function of the translation product (protein) of the specific gene in its body, the animal to which the method has been applied contains an enhancer (agonist), such as a compound, antibody, or aptamer, that has the same function as the protein of the specific gene. Note that "inside" may refer to either "inside the cells" or "outside the cells" (e.g., in body fluids) of the animal to which the method has been applied, depending on the various embodiments described above.

[0040] The above-mentioned characteristic substances contained in the animals to which the method has been applied, which reflect the growth regulation (promotion or inhibition) method, can be detected quantitatively or qualitatively according to standard methods. The animals to which the method has been applied have the function of a specific gene or the like inhibited or enhanced, but as described above in relation to the growth regulation method of the present invention, the degree to which the function of the specific gene or the like is inhibited or enhanced is not particularly limited, as long as the desired effect of the present invention is achieved.

[0041] For example, if the expression level of the transcription product or translation product of a specific gene in an individual (test individual) of an animal belonging to the order Decapod is statistically significantly decreased or increased compared to target animals (control group, wild group) of the same or similar age and molting cycle and to which the growth regulation (promotion or inhibition) method of the present invention has not been applied, the test individual can be determined to be an animal to which the function of a specific gene, etc. has been inhibited or enhanced, i.e., the effect of the present invention has been achieved.

[0042] In particular, (a) individuals, embryos, eggs, etc. that have a chromosome lacking the function of a specific gene or a chromosome into which a specific gene has been incorporated to the extent that a growth-promoting or growth-suppressing effect is observed, which has not been reported to exist in nature (non-artificially), (b) individuals that contain artificially synthesized (possibly including non-natural nucleic acids) RNA such as siRNA for inhibiting the function of the mRNA of a specific gene, vectors, etc., or mRNA for enhancing the function of the mRNA of a specific gene, and (c) individuals that contain inhibitors such as compounds, antibodies, aptamers, etc. for inhibiting the function of the protein of a specific gene, or enhancers (agonists) such as compounds, antibodies, aptamers, etc. for enhancing the function of the protein of a specific gene, can be considered to be animals to which the method of the present invention has been applied. [Example]

[0043] Hereinafter, more specific embodiments of the growth regulation (promotion or inhibition) method of the present invention, animals to which the method has been applied, etc. will be disclosed as examples, but the technical scope of the present invention is not limited to the specific embodiments disclosed as examples. Those skilled in the art will understand that, based on the description of the entire specification (including the drawings) and the technical ideas of the present invention extracted therefrom, the embodiments disclosed as examples can be expanded or modified into various other embodiments to suit the intended uses and effects, or that, as necessary, technical features of prior art (publicly known inventions) can be further combined or used in combination with prior art (publicly known inventions).

[0044] [Example 1] In this example, the RNAi method was used to knock down the TSC2, PDK, Akt, FOXO, and p27 genes (function inhibition group) contained in specific genes, or the GFP gene (control group (GFP function inhibition group)). For knockdown, ds (double-stranded) RNAs targeting the following base sequences of TSC2, PDK, Akt, FOXO, p27, and GFP, respectively, were used: "dsTSC2," "dsPDK," "dsAkt," "dsFOXO," "dsp27," and "dsGFP."

[0045] SEQ ID NO: 1: Target sequence of TSC2 5'- ATACAGCGAGCAATGCGAGTACTTGACCTTATGAGGCATCAAGAAACTCACAAAATAGGGGTATTGTATGTGGCTCAAAATCAAACTTCAGAACAAGAAATTTAAGGAATTCATGTGGTTCACTGCGTTACATGCATTTCCTTCAGGGTTTAGGTACAGTCCTTGAGCTGAACTCTGTATCACAAGATGAAGTATTCCTCGGTGGTCTTGACACCAAGGGTAACGATGGCAAGCTAG -3' SEQ ID NO: 2: PDK target sequence 5'- AAACGATGGACTTGGATTTTATCTTTGGCAAACTTATAGGAGAAGGAAGTTTCTCAAGCGTTTACCTTGCAAAGGACATACACACAAATCAGGAATATGCAGTTAAGGTTTGTGAAAAGCAGTTAATTATACGGGAGAAGAAAGTGCAGCAAATAACCAGGGAAAGGGATGTAATGAACCTACTCAACAGCAACCAGAACCCTACGGCTCCGTTTTTCGTTAAACTTTCTTACGCCTTCCAAGGAGA -3' SEQ ID NO: 3: Akt target sequence 5'- GGTGGTCCAGGTGATGTAAGAGAGGTTCAGAGTCATCCCTTCTATGTAACAATCAACTGGAAACTTCTTGAAGAAAAAAAGTTAACTCCACCATTCAAGCCACAAGTAACCAGCGAGACTGACACCCGGTACTTCGATCGA GAATTCACTGGAGAGTCTGTGCAGCTTACTCCACCTGATCAAGGGGAGCACCTTAATGTTATTGATGAAGAATCAGAATACTTGACTTTCAACCACTTCTCTTATCAGGACATTTTATCAACTCTTGGCAGCTCACTAGCA -3' SEQ ID NO: 4: Target sequence of FOXO 5'- CCCATGTCCCCTGGTATAGGTGGGTGGGGTGGCGAGTACTGGCCTCACCATGCTCACCAACATCCACACCCGCACGACCGCTATGCCGACCAACTGGTAGACTCCATGGGGGAGGGACTCAAGCTAGGACCGGACTCTTGGGGTGGCCCTGCTCGTCCGCCCAACCATCAGGACTGTATGAAACTATCCCAGCTCTCCC -3' SEQ ID NO: 5: target sequence of p27 5’- CAATGGCATGTTTGGATGATGAATACTCGTGGAGCCCGCCTTCAGAAGCGGAACTCAAAGTTATTGAGGCCAGACGGGAACGTAACAACAAGATATCATCCATAATGGGACAATATCTTCTAAAGGGATACAAAATGTTGGCTATAACATGCCCAGTTTGCGAGTGCATTTTGTTAGAGGATCGCATACAAAATAAATATTGCATCGGATGCAGTGAAGTTGATGCTGACACATGGAAGGACAATCCAGCGGTTAGTGAAGAAGCAGCCAGAAGAGCAGTGGAAGAAATTCA -3’ Sequence number 6: Target sequence of GFP (pAcGFP-N1) 5’- CACATGAAGCAGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACCATCTTCTTCGAGGATGACGGCAACTACAAGTCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATGGCAACATCCTGGGCAATAAGATGGAGTACAACTACAACGCCCACAATG -3’

[0046] The dsRNAs were injected into a designated number of mystery crayfish (groups shown in Table 1) and their growth (days until molting and post-molt weight gain) was monitored for approximately one month. The results are shown in Table 1 and Figure 1. Among the five genes tested, inhibition of TSC2 function demonstrated the most stable growth-promoting effect (Figure 1A). More specifically, inhibition of TSC2 function promoted both molting and increased growth per molt, resulting in a synergistic effect that approximately doubled growth rate (Figures 1B, C, and D). As a result, a significant increase in body size was observed, with individual weight increasing by 32% over normal levels, after only three molts (a period of less than 5% of the captive lifespan) (Figure 1E). It is expected that inhibition of TSC2 function will ultimately result in a significant increase in body size in decapod crustaceans. Furthermore, inhibition of PDK, FOXO, and p27 functions also demonstrated growth-promoting effects. On the other hand, when Akt function was inhibited, the number of days until molting increased and growth rate slowed, suggesting that enhancing Akt function may have a growth-promoting effect on decapod crustaceans.

[0047] [Table 1]

[0048] From the results of this example, those skilled in the art will understand that the effects of the present invention will also be achieved with TSC1 and TBC1D7, which function by forming complexes with TSC2, and this is confirmed for TSC1 in the following Example 2.

[0049] [Example 2] Except for changing the target gene to TSC1, AMPK, or both, dsRNA was administered to mystery crayfish to knock down these target genes and observe their growth in the same manner as in Example 1. For knockdown, dsRNAs "dsTSC1" and "dsAMPK" were used, which target the following base sequences of TSC1 and AMPK, respectively.

[0050] SEQ ID NO: 7: Target sequence of TSC1 5'- CCCTGAATCGACACCCTTTACTCACCAATAAAGATCGGAAGCCAGTAANGTTGGCAGTCGCCGAACTGTTGCTGCATTGTGTAGCCTTAAAACTCAACACAAATGTAGGTAAGGACAACAGAGCCATCGTCTG CAGAGTTTAGAGGCCAGTTCTAGGTCCTTTGTCACCTNTAAAAAGGAACAAACCCCATTCAGTTTTCCTGATCAGTGCCAAGACTTGTTTAATAGAGTGGAAGCGATCTACCCTCCTCCAAAGTAAGTTGCAGC -3' SEQ ID NO: 8: Target sequence of AMPK 5'- TCAAGATTCTCAACCGCAAAACTATCAAGAATTTGGATATGGTCAGCAAGATAAAACGAGAAATAACAAATCTTAAATTGTTTCGTCATCCACATATCATTAAACTGTACCAGGTGATCAGCACACCTACAGATATCTTTATGGTGATGGAATATGCTTCAGGAGGAGAGCTTTTTGACTATATTAAGAAAAAAGGAAAGCTGAAGGAATCTGAAGCTCGCAGGTTCTT -3'

[0051] The results are shown in Table 2. Growth-promoting effects were observed when dsTSC1 and dsAMPK were used alone (1 μg) to knock down these genes, but when both were used together (0.5 μg each), growth-promoting effects were observed at lower doses. The TSC1 / TSC2 complex mediates the transmission of environmental deterioration, such as hypoxia, downstream of the mTOR pathway, while AMPK transmits the deterioration of the cell's available energy status downstream of the mTOR pathway. Therefore, it is speculated that inhibition of AMPK function tricks cells into believing that there is an abundance of energy available to them, thereby achieving growth promotion. Furthermore, it is speculated that double knockdown with TSC1 tricks cells into believing that both the environment and nutritional status are good, leading to further growth promotion. From the results of this example, those skilled in the art will understand that knockdown of TSC2 together with AMPK instead of TSC1 will also produce similarly excellent growth-promoting effects.

[0052] [Table 2]

[0053] [Example 3] Except for changing the target genes to PTEN and MIH, dsRNA was administered to mystery crayfish to knock down these target genes and observe their growth in the same manner as in Example 1. For knockdown, dsRNAs "dsPTEN" and "dsMIH" were used, which target the following base sequences of PTEN and MIH, respectively.

[0054] SEQ ID NO: 9: Target sequence of PTEN 5’- TGGCTACGACCTGGATCTCAGCTATATCACAGATCGTCTTATCGCCATGGGCTTCCCTGCTCAGAAGTTGGAGGGTGTCTACAGAAACCATATTGATGACGTATGCCGCTTCCTAGAAGACAGACACAAGGACCATTATAGAATATATAATTTGTGTTCTGAGAGAAATCGATCGTACGACGTAGCAAGATTCCATAACCGCGTTAGAACGTTCCCATTTGCTGACCACAATCCACCTCCTCTGATTGATATCGAGCCACTATGCAAAGATATGGCAGATTGGCTCAATGAAGATCAGAAAAATGTAGGCTGTTGTGCA -3’

[0055] Sequence number 10: Target sequence of MIH 5’- CCAGACCTGGAGAGGTTTCATACCTTAAGCTTGGTGCTGAGTTACCAGTAAGAGAAGAAGGTTCTACGAGTTGCTTGTGGAAGAGCACCAGAGCGGGTGTCAGTAGTGCTTCAAGACATGGTTAACCAAGCTGCTCAATGCTTCATTGTACGGAGAGTGTGGCTGGTGGTGGTGGTTGGGCTGCTGGTACACCAGACAGCGGCAAGGTATGTCTTCGAAGAATGTCCAGGAGTGATGGGCAACCGAGCCGTCCACGGCAAGGTGACCCGGGTTTGTGAGGATTGCTACAACGTCTTCAGGGACACTGAAGTCTTGGCTGGATGCAGGAAAGGCTGCTTTTCTAGTGAGATGTTCAAGCTTTGCCTCTTGGCTATGGAGCGCGTCGAGGAGTTTCCAGACTTCAAGAGATGGATTGGTATTCTTAACGCCGGTC -3’

[0056] The results are shown in Table 3. In this example, knockdown of only MIH resulted in a shortened molting interval and an increased tendency for molting growth during the first molt. Knocking down only PTEN resulted in a significant increase in molting growth during the first molt, whereas it significantly decreased during the second molt. In contrast, knockdown of both PTEN and MIH did not suppress growth during the second molt, and a significant growth-promoting effect was observed that exceeded that observed when MIH or PTEN was knocked down alone.

[0057] [Table 3]

[0058] [Example 4] Many quantitative traits, such as growth, are rarely related to a single gene, but are often the result of the combined action of multiple genes. For example, even if a growth-promoting signal is elevated, if another growth-inhibiting signal is stronger than the elevated signal, the overall strength of the growth signal will be negative, and growth is expected to be suppressed. Therefore, to identify genes involved in growth, it is necessary to capture the overall expression patterns of multiple genes and analyze their relationship with growth.

[0059] Based on this idea, in Example 4, we first sampled juvenile crayfish from a litter at a consistent molting cycle to obtain growth data and then performed real-time PCR to analyze the expression levels of candidate genes predicted to be related to growth. Taking advantage of the fact that crayfish growth is suppressed over time when they are reared individually, we sampled them at multiple times over time to obtain juvenile crayfish with different growth rates from genetically identical crayfish from the same litter. We focused on the mechanisms that integrate various cell growth and proliferation signals with environmental information at the cellular scale, and selected candidate genes primarily from upstream and downstream factors of the mTOR and Akt pathways, which contain factors demonstrated to be involved in growth control, as shown in Examples 1 to 3.

[0060] Next, based on the results of real-time PCR, genes with similar expression dynamics were summarized as principal component scores using principal component analysis. These principal component scores are a statistically estimated value that represents the overall expression pattern described above. Finally, a model explaining the relationship between these principal component scores and growth was derived using a generalized linear model. Among genes that showed high principal component loadings relative to the principal component scores correlated with growth, those with direct or indirect transcriptional regulatory functions were estimated to be highly likely to be growth-related genes.

[0061] [Breeding experiment] The experiment used juvenile mystery crayfish Procambarus virginalis, obtained from eggs laid on the same day. When molting was observed, individual weights were measured the following day. Individuals weighing over 20 mg were divided into two groups: one for growth observation and one for gene expression analysis. The former group was continued, while the latter group had their eyestalks collected three days after molting for RNA extraction.

[0062] [RNA extraction and reverse transcription] Total RNA was extracted from the samples and reverse transcribed to synthesize cDNA, which was diluted 100-fold and used as the sample for subsequent real-time PCR analysis.

[0063] [Real-time PCR] Real-time PCR was performed using commercially available real-time PCR reagents, including SYBR Green, and primers designed specifically for each gene. The primer list used is shown in Table 4 below. Equal volumes of all analytical samples were mixed and serially diluted in 2-fold increments from 20-fold or 30-fold to prepare cDNA standards. EF-1α was used as an internal control, and all measurements were quantified as relative values.

[0064] [Table 4]

[0065] [Growth Analysis] To examine gene expression at a certain point in time and determine whether it contributes to growth, it is necessary to be able to predict the growth of the most recent individual from the state of the individual at that time. Because the state of an individual can change in a captive experiment, an individual that has grown well does not necessarily show good growth at the next molt. Growth is preceded by changes in gene expression, and good or bad growth is the result. Therefore, when screening for growth-regulating genes, it is necessary to examine the gene expression of individuals that can be predicted with a certain level of accuracy to show good growth, rather than examining the gene expression of individuals that have shown good growth as a result after changes in gene expression have finished.

[0066] Based on this idea, in Example 4, a model was created to predict growth after the next molt from the individual body weight the day after molting, the number of days since transition to individual rearing, and the number of molts to date, as follows. Because the growth of decapod crustaceans is determined by the molt interval and the growth amount per molt, these were first combined into a single variable as principal component scores using principal component analysis. Next, a model was created using a generalized linear model to predict this principal component score from the individual body weight the day after the previous molt, the number of days since the start of individual rearing at that time, and the number of molts. R software version 4.0.2 was used for the subsequent analyses.

[0067] [Analysis of gene expression dynamics] As mentioned above, quantitative traits such as growth are rarely determined by the control of a single gene under natural conditions, and it is generally thought that they are the product of the collective expression of many genes. Based on this idea, the behavior of genes with similar expression dynamics was quantified using principal component analysis in the form of principal component scores.

[0068] Prior to this analysis, we identified ligand molecules that act as upstream factors of the Akt and mTOR pathways, acting as switches that activate these two pathways via receptors. Based on Figure 4 and previous literature containing similar information, we performed a reciprocal BLAST search to identify candidate molecules. We then performed a linear fit using the least squares method to the expression quantification results of these real-time PCR analyses and the principal component scores of growth principal component 1. Furthermore, we calculated Pearson's product-moment correlation coefficients and performed a t-test. Significant correlations were identified as potential ligand molecules that regulate growth via the Akt and mTOR pathways and were added to the principal component analysis described above.

[0069] [Creating a model showing the relationship between growth and gene expression dynamics] Finally, a model was constructed to explain the principal component scores obtained from the growth analysis by the principal component scores obtained from the gene expression analysis using a generalized linear model with a normal distribution and an identity link function. The partial regression coefficients of each variable were tested using the Wald test, and principal components with significant partial regression coefficients were considered to represent effective gene expression dynamics related to growth regulation.

[0070] In Example 4, a correlation analysis was performed prior to the principal component analysis, and a significant positive correlation was observed between FGF1 and ILP and the principal component score of growth principal component 1 (growth PC1), suggesting that these are potential candidate molecules (Figure 5A). Based on this, in the present invention, these two factors were positioned as upstream growth factors and included as target factors in the principal component analysis.

[0071] Linearizing the data distribution is an important task for convenience in parameter estimation and testing. Principal component scores can take both positive and negative values, but when they are negative, the exponential relationship cannot be linearized by logarithmic conversion. For this reason, in this study, we followed Zar's (Data transformations. In: Biostatistical analysis. Prentice Hall, Englewood Cliffs, pp. 236-243, 1984) approach to parameter estimation by adding a constant term and then logarithmizing the data. The results are shown in Table 5.

[0072] [Table 5]

[0073] Based on these results, the logarithmic growth PC1 principal component score and growth PC1 principal component score after molting can be estimated from the state of the individual before molting using the following equations.

[0074] ln(c - S PC1 ) = 1.24 - 4.15 M + 1.25 ln W·M + 0.18 D·M - 0.05 ln W·D·M

[0075] where S PC1 is the principal component score of growth PC1, M is the number of moltings since the start of individual rearing, W is the individual body weight, D is the number of days since the start of individual rearing, and c is a constant term that takes a value greater than the principal component score with the largest absolute value (in this case, the maximum value + 1). Therefore, the principal component score of growth PC1 S PC1 is calculated as follows:

[0076] S PC1 = -exp(1.24 - 4.15 M + 1.25 ln W·M + 0.18 D·M - 0.05 ln W·D·M) + c

[0077] Several models were examined, including those with and without linearization by logarithmization, and the AIC and coefficient of determination R 2This model was judged to be the best based on the numerical values. PC1 The correspondence between the values ​​estimated from the rearing history and the actual values ​​is shown in Figure 4. It shows that it is possible to estimate the quality of growth with a certain degree of accuracy from the rearing history.

[0078] From these findings, the degree of growth that can occur in individuals sampled for gene expression analysis using this model can be calculated based on the principal component score S of growth PC1 from the rearing history up to the time of sampling. PC1 By matching the calculated principal component scores with the expression dynamics of each gene, we were able to identify genes whose expression levels change in relation to growth.

[0079] The results of the principal component analysis in Example 4 (principal component loadings and cumulative explanation rates) are shown in Table 6, and the analysis results of the gene expression principal components correlated with growth PC1 are shown in Table 7. A path diagram model, created based on these results, showing the relationship between the expression dynamics of each gene and growth is shown in Figure 6. Gene expression principal component 2 (gene expression PC2) and gene expression PC3, which have large standardized coefficients (Table 7), are shown to have a strong influence on growth. Furthermore, it is shown that the expression levels of various factors have a positive correlation (principal component loading of 0.3 or more) or a negative correlation (principal component loading of -0.3 or less) with gene expression PC2 and gene expression PC3. Factors whose expression levels are shown to have a positive correlation with gene expression PC2 or gene expression PC3 have the effect of promoting growth by enhancing the expression of that gene, while factors whose expression levels are shown to have a negative correlation have the effect of promoting growth by inhibiting the expression of that gene. It can be understood that these factors, either in combination or alone, exert the growth-promoting effect of the present invention. For example, the use of Akt (growth-inhibiting effect due to expression inhibition, i.e., growth-promoting effect due to expression enhancement) and the use of FOXO and TSC2 (growth-promoting effect due to expression inhibition) are shown in Example 1. The use of MIH (growth-promoting effect due to expression inhibition) is shown in Example 3. Furthermore, the mTOR pathway contains molecules that are predicted to be rate-limiting factors that show a high correlation with growth. For example, Rheb has a high correlation with growth and is predicted to be such a rate-limiting factor (Figure 5B). The TSC1 / TSC2 complex inhibits Rheb, and the results showing that growth is promoted by inhibiting TSC1 or TSC2, etc., using RNAi (Examples 1 and 2) are consistent with the prediction that Rheb is a rate-limiting factor.

[0080] [Table 6]

[0081] [Table 7]

Claims

1. At least one growth regulation-related gene selected from the group consisting of AMPK, TBC1D7, TSC1, TSC2, Rheb, Akt, FOXO, PDK, PTEN, and p27; Optionally, MIH as a molting-related gene and A method for regulating the growth of an animal belonging to the order Decapod, comprising the step of regulating the function of a gene comprising the abovementioned formula (I), or the function of a transcription product or translation product of said gene.

2. The method of claim 1, wherein the gene includes at least one selected from the group consisting of AMPK, TBC1D7, TSC1, TSC2 and PDK as a growth regulation-related gene, and the process includes regulating the growth regulation-related gene or its transcription product or translation product so as to inhibit its function, thereby regulating the growth of an animal belonging to the order Decapod.

3. The method of claim 2, wherein the growth regulation-related genes include at least AMPK and TSC1 or TSC2.

4. The method according to claim 1, wherein the genes include at least Rheb or Akt as growth regulation-related genes, and the process includes regulating the growth regulation-related genes or their transcription or translation products so as to enhance their function, thereby regulating the growth of an animal belonging to the order Decapod.

5. The method according to claim 1, wherein the genes include at least Rheb or Akt as growth regulation-related genes, and the process includes regulating the growth regulation-related genes or their transcription or translation products so as to inhibit their function, thereby regulating the growth of an animal belonging to the order Decapod.

6. The method according to claim 1, wherein the genes include at least PTEN as a growth regulation-related gene and at least MIH as a molting-related gene, and the step includes regulating the growth regulation-related gene and the molting-related gene or their transcription products or translation products so as to inhibit their function, thereby regulating the growth of an animal belonging to the order Decapod to promote its growth.

7. The method according to any one of claims 1 to 3 and 5 to 6, wherein the regulation of the function of the gene or its transcription product or translation product is inhibition, and is carried out by suppressing expression of the gene by RNA interference (RNAi), antisense, or genome editing.

8. At least one growth regulation-related gene selected from the group consisting of AMPK, TBC1D7, TSC1, TSC2, Rheb, Akt, FOXO, PDK, PTEN, and p27; Optionally, MIH as a molting-related gene and An animal belonging to the order Decapod, in which the function of a gene comprising the gene, or the function of its transcription or translation product, is regulated.

9. The animal described in claim 8, wherein the gene includes at least one selected from the group consisting of AMPK, TBC1D7, TSC1, TSC2 and PDK as a growth regulation-related gene, and is regulated to inhibit the function of the growth regulation-related gene or its transcription product or translation product, and is regulated to promote the growth of the animal belonging to the Decapod order.

10. The animal of claim 9 , wherein the growth regulation-related genes include at least AMPK and TSC1 or TSC2.

11. The animal described in claim 8, wherein the genes include at least Rheb or Akt as growth regulation-related genes, are regulated to enhance the function of the growth regulation-related genes or their transcription products or translation products, and are regulated to promote growth of the animal belonging to the Decapod order.

12. The animal described in claim 8, wherein the genes include at least Rheb or Akt as growth regulation-related genes, and are regulated to inhibit the function of the growth regulation-related genes or their transcription products or translation products, and are regulated to suppress the growth of an animal belonging to the Decapod order.

13. The animal described in claim 8, wherein the genes include at least PTEN as a growth regulation-related gene and at least MIH as a molting-related gene, and are regulated to inhibit the function of the growth regulation-related genes and molting-related genes or their transcription products or translation products, and are regulated to promote the growth of an animal belonging to the Decapod order.

14. The animal according to any one of claims 8 to 10 and 12 to 13, wherein the regulation of the function of the gene or its transcription product or translation product is inhibition, and the animal comprises in its body a double-stranded RNA or a vector for suppressing expression of the gene by RNA interference (RNAi), a chromosome lacking the function of the gene, or an inhibitor of the translation product of the gene or its receptor.

Images