Nucleic acid products and methods of administration thereof

Abstract

To provide nucleic acid products and methods of administration thereof.SOLUTION: The present invention relates in part to nucleic acids, including nucleic acids encoding proteins, therapeutics and cosmetics comprising the nucleic acids, methods for delivering the nucleic acids to cells, tissues, organs and patients, methods for inducing cells to express proteins using nucleic acids, methods, kits and devices for transfecting, gene-editing and reprogramming cells, and cells, organisms, therapeutics and cosmetics produced using these methods, kits and devices.SELECTED DRAWING: Figure 39

Description

[Technical field]

[0001] Priority This application claims the benefit of priority to U.S. patent application Ser. No. 62 / 116,232, filed Feb. 13, 2015, Ser. No. 62 / 195,462, filed Jul. 22, 2015, Ser. No. 62 / 242,383, filed Oct. 16, 2015, Ser. No. 62 / 245,726, filed Oct. 23, 2015, and Ser. No. 62 / 289,617, filed Feb. 1, 2016, the entire contents of which are incorporated herein by reference in their entireties.

[0002] FIELD OF THEINVENTION The present invention relates, in part, to methods, compositions, and articles of manufacture for producing and delivering nucleic acids to cells, tissues, organs, and patients, methods for expressing proteins in cells, tissues, organs, and patients, and cells, therapeutics, and cosmetics produced using these methods, compositions, and articles of manufacture.

[0003] Description of electronically submitted text files The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety. Computer-readable format copy of the sequence listing (File name: FAB-009PC_Sequence.txt, Date of recording: February 16, 2016, File size: 2.3 MB). [Background technology]

[0004] Synthetic RNA and Nucleic Acid Therapeutics Ribonucleic acid (RNA) is ubiquitous in both prokaryotic and eukaryotic cells, where it encodes genetic information in the form of messenger RNA, binds and transports amino acids in the form of transfer RNA, assembles amino acids into proteins in the form of ribosomal RNA, and performs numerous other functions including gene expression control in the form of microRNA and long non-coding RNA. RNA can be produced synthetically by methods including direct chemical synthesis and in vitro transcription and administered to patients for therapeutic use. However, previously described synthetic RNA molecules are unstable in human cells and induce strong innate immune responses. In addition, methods for efficient non-viral delivery of nucleic acids to patients, organs, tissues, and cells in vivo have not been previously described. Many shortcomings of existing synthetic RNA technologies and methods for delivery of nucleic acids make them undesirable for therapeutic or cosmetic use.

[0005] Cellular reprogramming and cell-based therapies Cells can be reprogrammed by exposing them to specific extracellular cues and / or by ectopic expression of specific proteins, microRNAs, etc. Several reprogramming methods have been described previously, but most that rely on ectopic expression require the introduction of foreign DNA, which may carry the risk of mutations. DNA-free reprogramming methods based on direct delivery of reprogramming proteins have been reported. However, these methods are too inefficient and unreliable for commercial use. In addition, RNA-based reprogramming methods have been described (e.g., Angel. MIT Thesis. 2008.1-56; Angel et al. PLoS ONE. 2010.5,107; Warren et al. Cell Stem Cell. 2010.7,618-630; Angel. MIT Thesis. 2011.1-89; and Lee et al. Cell. 2012.151,547-5). 58, the entire contents of which are incorporated herein by reference). However, existing RNA-based reprogramming methods, when performed on mature cells, are time-consuming, unreliable, and inefficient, require multiple transfections (resulting in significant expense and potential for error), can reprogram only a limited number of cell types, require the use of immunosuppressants, and require the use of multiple human-derived components, including blood-derived HSA and human fibroblast feeders. Many of the shortcomings of previously disclosed RNA-based reprogramming methods make them undesirable for research, therapeutic, or cosmetic use.

[0006] Gene editing Several naturally occurring proteins contain DNA-binding domains that can recognize specific DNA sequences, such as zinc fingers (ZFs) and transcription activator-like effectors (TALEs). Fusion proteins containing one or more of these DNA binding domains and the cleavage domain of the FokI endonuclease can be used to create double-stranded breaks in desired regions of DNA within a cell (see, e.g., U.S. Patent Application Publication No. US2012 / 0064620, U.S. Patent Application Publication No. US2011 / 0239315, U.S. Patent No. 8,470,973, U.S. Patent Application Publication No. US2013 / 0217119, U.S. Patent No. 8,420,782, U.S. Patent Application Publication No. US2011 / 0301073, U.S. Patent Application Publication No. US2011 / 0145940, U.S. Patent No. 8,450,471, U.S. Patent No. 8,440,431, U.S. Patent No. 8,440,432, and U.S. Patent Application Publication No. 2013 / 0122581, the contents of all of which are incorporated herein by reference). Other gene editing proteins include clustered regularly interspaced short palindromic repeats (CRISPR)-associated proteins. However, current methods for gene editing of cells are inefficient and involve the risk of uncontrolled mutagenesis, making them undesirable for research, therapeutic, and cosmetic use. Methods for DNA-free gene editing of somatic cells have not been previously explored, nor have methods for simultaneous or sequential gene editing and reprogramming of somatic cells. In addition, methods for direct gene editing of cells in patients (i.e., in vivo) have not been previously explored, and the development of such methods has been limited by a lack of acceptable targets, inefficient delivery, inefficient expression of the gene editing protein / proteins, inefficient gene editing by the expressed gene editing protein / proteins, due in part to poor binding of the DNA binding domain, excessive off-target effects, due in part to undirected dimerization of the FokI cleavage domain and poor specificity of the DNA binding domain, and other factors. Finally, the use of gene editing in antibacterial, antiviral, and anticancer therapy has not been previously explored.

[0007] Thus, there remains a need for improved methods and compositions for producing and delivering nucleic acids to cells, tissues, organs, and patients. Summary of the Invention

[0008] The invention provides, in part, compositions, methods, articles, and devices for delivering nucleic acids to cells, tissues, organs, and patients, methods for inducing cells to express proteins, methods, articles, and devices for making these compositions, methods, articles, and devices, and compositions and articles, including cells, biological, cosmetic, and therapeutic products, made using these compositions, methods, articles, and devices.Unlike previously reported methods, certain embodiments of the invention provide small amounts of nucleic acid to achieve significant and long-lasting protein expression in humans.

[0009] In various aspects, the present invention provides methods for determining safe and effective doses and administration of nucleic acid drugs in human subjects. The present invention is based on the surprising discovery of given parameters. In some aspects, a method for delivering a nucleic acid drug is provided, comprising administering an effective dose of the nucleic acid drug to a human subject in need thereof. In various embodiments, the nucleic acid drug comprises RNA comprising one or more non-standard nucleotides (also known as "modified RNA"). In other embodiments, the effective dose is an amount sufficient to substantially increase the amount of protein encoded by the nucleic acid drug in the human subject and / or to substantially avoid an immune response in the human subject, optionally mediated by the innate immune system.

[0010] In some aspects, methods are provided for expressing a protein of interest in a population of cells in a mammalian subject, comprising administering to said cells a non-viral transfection composition comprising an effective dose of RNA encoding the protein of interest, wherein the transfection composition is administered in an amount capable of expressing said protein in said cells for at least about 6 hours to about 5 days without substantial cytotoxicity. In some embodiments, the RNA contains one or more non-standard nucleotides that avoid substantial cytotoxicity.

[0011] In some embodiments, the effective dose is from about 100 ng to about 2000 ng (e.g., about 100 ng or less, or about 200 ng or less, or about 300 ng or less, or about 400 ng or less, or about 500 ng or less, or about 600 ng or less, or about 700 ng or less, or about 800 ng or less, or about 900 ng or less, or about 1000 ng or less, or about 1100 ng or less, or about 1200 ng or less, or about 1300 ng or less, or about 1400 ng or less, or about 1500 ng or less, or about 1600 ng or less, or about 1700 ng or less, or about 1800 ng or less, or about 1900 ng or less, or about 2000 ng or less). In other embodiments, the effective dose is less than about 100 ng. In certain embodiments, the effective dose is about 10 ng to about 100 ng (e.g., about 10 ng or less, or about 20 ng or less, or about 30 ng or less, or about 40 ng or less, or about 50 ng or less, or about 60 ng or less, or about 70 ng or less, or about 80 ng or less, or about 90 ng or less, or about 100 ng or less).

[0012] In some embodiments, the effective dose is from about 1.4 ng / kg to about 30 ng / kg (e.g., about 1.4 ng / kg or less, or about 2.5 ng / kg or less, or about 5 ng / kg or less, or about 10 ng / kg or less, or about 15 ng / kg or less, or about 20 ng / kg or less, or about 25 ng / kg or less, or about 30 ng / kg or less. In other embodiments, the effective dose is less than about 1.5 ng / kg. In certain embodiments, the effective dose is from about 0.14 ng / kg to about 1.4 ng / kg (e.g., about 0.14 ng / kg or less, or about 0.25 ng / kg or less, or about 0.5 ng / kg or less, or about 0.75 ng / kg or less, or about 1 ng / kg or less, or about 1.25 ng / kg or less, or about 1.4 ng / kg or less).

[0013] In some embodiments, the effective dose is about 350 ng / cm 2 ~about 7000ng / cm 2 (For example, about 350 ng / cm 2 or less, or about 500ng / cm 2 or less, or about 750 ng / cm 2 or less, or about 1000ng / cm 2 or less, or about 2000ng / cm 2 or less, or about 3000ng / cm 2 or less, or about 4000ng / cm 2 or less, or about 5000ng / cm 2 or less, or about 6000ng / cm 2 or less, or is about 7000ng / cm 2 In other embodiments, the effective dose is about 350 ng / cm or less. 2 In certain embodiments, the effective dose is less than about 35 ng / cm 2 ~about 350ng / cm 2 (For example, about 35 ng / cm 2or less, or about 50 ng / cm 2 or less, or about 75 ng / cm 2 or less, or about 100 ng / cm 2 or less, or about 150 ng / cm 2 or less, or about 200 ng / cm 2 or less, or about 250 ng / cm 2 or less, or about 300 ng / cm 2 or less, or about 350 ng / cm 2 Or less.

[0014] In some embodiments, the effective dose is about 0.28 picomolar to about 5.7 picomolar (e.g., about 0.28 picomolar or less, or about 0.5 picomolar or less, or about 0.75 picomolar or less, or about 1 picomolar or less, or about 2 picomolar or less, or about 3 picomolar or less, or about 4 picomolar or less, or about 5 picomolar or less, or about 5.7 picomolar or less). In other embodiments, the effective dose is less than about 0.28 picomolar. In certain embodiments, the effective dose is about 0.028 picomolar to about 0.28 picomolar (e.g., about 0.028 picomolar or less, or about 0.05 picomolar or less, or about 0.075 picomolar or less, or about 0.1 picomolar or less, or about 0.15 picomolar or less, or about 0.2 picomolar or less, or about 0.25 picomolar or less, or about 0.28 picomolar or less).

[0015] In some embodiments, the effective dose is about 0.004 picomoles / kg to about 0.082 picomoles / kg (e.g., about 0.004 picomoles / kg or less, or about 0.01 picomoles / kg or less, or about 0.02 picomoles / kg or less, or about 0.03 picomoles / kg or less, or about 0.04 picomoles / kg or less, or about 0.05 picomoles / kg or less, or about 0.06 picomoles / kg or less, or about 0.07 picomoles / kg or less, or about 0.08 picomoles / kg or less, or about 0.082 picomoles / kg or less). In other embodiments, the effective dose is less than about 0.004 picomoles / kg. In certain embodiments, the effective dose is from about 0.0004 picomoles / kg to about 0.004 picomoles / kg (e.g., about 0.0004 picomoles / kg or less, or about 0.001 picomoles / kg or less, or about 0.002 picomoles / kg or less, or about 0.003 picomoles / kg or less, or about 0.004 picomoles / kg or less).

[0016] In some embodiments, an effective dose is about 1 picomole / cm 2 ~ approx. 20 pmol / cm 2 (For example, about 1 picomole / cm 2 or less, or about 2 picomoles / cm 2 or less, or about 3 picomoles / cm 2 or less, or about 4 picomoles / cm 2 or less, or about 5 picomoles / cm 2 or less, or about 6 picomoles / cm 2 or less, or about 7 picomoles / cm 2 or less, or about 8 picomoles / cm 2 or less, or about 9 picomoles / cm 2 or less, or about 10 picomoles / cm 2 or less, or about 12 picomoles / cm 2 or less, or about 14 picomoles / cm 2or less, or about 16 picomoles / cm 2 or less, or about 18 picomoles / cm 2 or less, or about 20 picomoles / cm 2 In other embodiments, the effective dose is about 1 picomole / cm 2 In certain embodiments, the effective dose is less than about 0.1 picomoles / cm 2 ~1 picomole / cm 2 (For example, about 0.1 picomole / cm 2 or less, or about 0.2 picomoles / cm 2 or less, or about 0.3 picomoles / cm 2 or less, or about 0.4 picomoles / cm 2 or less, or about 0.5 picomoles / cm 2 or less, or about 0.6 picomoles / cm 2 or less, or about 0.7 picomoles / cm 2 or it or less than about 0.8 picomoles / cm 2 or less, or about 0.9 picomoles / cm 2 or less, or about 1 picomole / cm 2 or less).

[0017] In various embodiments, the nucleic acid drug is administered in a pharma- ceutically acceptable formulation, e.g., a formulation suitable for one or more of injection (e.g., subcutaneous injection, intradermal injection (including dermis or epidermis), subcutaneous injection, intramuscular injection, intraocular injection, intravitreal injection, intra-articular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection), and topical administration, and / or administration to the integumentary system (e.g., one or more of the epidermis (optionally selected from the stratum corneum, stratum lucidum, stratum granularis, stratum spinosum, and stratum basale), basement membrane, dermis (optionally selected from the papillary region and reticular region), subcutaneous tissue, and conjunctiva), and / or administration to the eye (e.g., one or more of the cornea, sclera, iris, lens, limbus, optic nerve, choroid, ciliary body, anterior segment, anterior chamber, and retina).

[0018] In various embodiments, the nucleic acid drug is formulated with one or more lipids to enhance cellular uptake of the nucleic acid drug, the lipids being optionally selected from Table 1. In other embodiments, the nucleic acid drug is formulated with one or more nanoparticles, optionally lipid or polymeric nanoparticles, to enhance cellular uptake of the nucleic acid drug, to enhance the duration of protein expression, or to otherwise enhance the safety and / or efficacy of the nucleic acid drug.

[0019] In various embodiments, the nucleic acid drug is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and an effective dose is about 4 mm 2 ~ approx. 1000mm 2 (For example, about 4 mm 2 or less, or about 5 mm 2 or less, or about 10 mm 2 or less, or about 25 mm 2 or less, or about 50 mm 2 or less, or about 75 mm 2 or less, or about 100 mm 2 or less, or about 125mm 2 or less, or about 150 mm 2 or less, or about 200 mm 2 or less, or about 500 mm 2 or less, or about 1000mm 2 or less) of the surface area of ​​the

[0020] In various embodiments, the nucleic acid drug is administered in a treatment regimen, optionally with additional agents or adjunctive therapies described herein, from about once per week to about once every 24 weeks (e.g., about once per week or less, or about once every 2 weeks or less, or about once every 3 weeks or less, or about once every 4 weeks or less, or about once every 5 weeks or less, or about once every 6 weeks or less, or about once every 7 weeks or less, or about once every 8 weeks or less, or about once every 9 weeks or less). or less every about 9 weeks, or once or less every about 9 weeks, or once or less every about 9 weeks, or once or less every about 10 weeks, or once or less every about 11 weeks, or once or less every about 12 weeks, or once or less every about 13 weeks, or once or less every about 14 weeks, or once or less every about 15 weeks, or once or less every about 20 weeks, or once or less every about 24 weeks). In other embodiments, the nucleic acid drug is administered in a treatment regimen, optionally with additional agents or adjunctive therapies described herein, from about once daily to about once weekly (e.g., about once daily or less, or about once every 2 days or less, or about once every 3 days or less, or about once every 4 days or less, or about once every 5 days or less, or about once every 6 days or less, or about once a week or less).

[0021] In various embodiments, the nucleic acid drug comprises an RNA that optionally includes one or more non-standard nucleotides having one or more substitutions at the 2C, and / or 4C, and / or 5C positions of a pyrimidine, or at the 6C, and / or 7N, and / or 8C positions of a purine. In various embodiments, the non-standard nucleotide is one of the non-standard nucleotides described herein. Examples of such cytidine include 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methyluridine, 5-methylpseudouridine, 5-hydroxymethyluridine, 5-hydroxymethylpseudouridine, 5-carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5-methoxyuridine, and 5-methoxypseudouridine. Additionally, the RNA comprising one or more non-canonical nucleotides may have one or more of a 5'-UTR comprising a Kozak consensus sequence, a 5'-UTR or a 3'-UTR comprising a sequence that increases RNA stability in vivo (e.g., an alpha globin or beta globin 5'-UTR or an alpha globin or beta globin 3'-UTR), a 3' poly(A) tail of about 20 nucleotides to about 250 nucleotides in length (e.g., about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, or about 100, or about 110, or about 120, or about 130, or about 140, or about 150, or about 160, or about 170, or about 180, or about 190, or about 200, or about 210, or about 220, or about 230, or about 240, or about 250 nucleotides in length).

[0022] Additionally, some embodiments of the methods described herein find use in various medical procedures, including, by way of example, treating diseases, disorders, and / or conditions of the integumentary system or altering, modifying, and / or altering (e.g., cosmetically) the integumentary system.

[0023] About 10 ng to about 2000 ng (e.g., about 10 ng or less, or about 20 ng or less, or about 50 ng or less, or about 100 ng or less, or about 200 ng or less, or about 300 ng or less, or about 400 ng or less, or about 500 ng or less, or about 600 ng or less, or about 700 ng or less, or about 800 ng or less, or about 900 ng or less, or about 1000 ng or less, Also contemplated are kits suitable for use in human therapy comprising a nucleic acid drug as described herein in a unit dosage form of about 1100 ng or less, or about 1200 ng or less, or about 1300 ng or less, or about 1400 ng or less, or about 1500 ng or less, or about 1600 ng or less, or about 1700 ng or less, or about 1800 ng or less, or about 1900 ng or less, or about 2000 ng or less) and an injection needle.

[0024] Additionally, in some aspects, the present invention provides pharmaceutical formulations comprising a nucleic acid drug as described herein and one or more of the vehicles (also known as "transfection reagents", e.g., lipids) as described herein, which are optionally suitable for one or more of subcutaneous injection, intradermal injection, subcutaneous injection, intramuscular injection, intraocular injection, intravitreal injection, intraarticular injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection, and local administration.

[0025] In some aspects, nucleic acid delivery patches are provided. In one aspect, an apparatus is provided for delivering nucleic acids using electric fields. Other aspects relate to methods and compositions for delivering nucleic acids to the skin. Yet other aspects relate to methods and compositions for expressing proteins in the skin.

[0026] In one aspect, the present invention provides methods and compositions for treating human diseases and conditions, including but not limited to preventative treatments, treatments for rare diseases, including but not limited to rare diseases of dermatology, and treatments used in medical dermatology and cosmetic medicine. In another aspect, the present invention provides cosmetics comprising nucleic acids. Yet another aspect provides compositions for modifying pigmentation. The present invention relates to methods and compositions for enhancing healing, for example, for the treatment of pigmentation disorders. Yet another aspect relates to methods and compositions for enhancing healing, including, but not limited to, healing in response to wounds or surgery. The compositions of the present invention may alter, modify, and / or change the appearance of members of the integumentary system of a subject, such as, but not limited to, skin, hair, and nails. Such alterations, modifications, and / or changes may be in the context of therapeutic methods and / or therapeutic uses as described herein, including, by way of non-limiting example, dermatological treatments and cosmetic procedures.

[0027] Furthermore, in various embodiments, the present invention relates to targeting various therapeutic proteins, including but not limited to dermatological applications. For example, in various embodiments, the compositions and methods of the present invention find use in methods of treatment mediated by increased expression of various soluble proteins, such as those described herein. In various embodiments, the nucleic acid drug encodes and / or increases the expression of one or more of circulating proteins, extracellular matrix proteins, engineered proteins, gene-edited proteins, protein or peptide hormones, enzymes, erythropoietin, darbepoetin alpha, NOVEPOETIN, elastin, collagen, antibodies or antibody fragments (e.g., neutralizing antibodies or antibody fragments), intracellular proteins, telomerase reverse transcriptase, membrane proteins, fusion proteins, receptors, ligand binding domains, protein inhibitors, or biologically active fragments, analogs or variants thereof. In other embodiments, administration of the nucleic acid drug may result in increased hematocrit, increased tissue elasticity, increased tissue strength, and increased skin hydration and / or water retention, hair growth, fat loss, DNA insertions, deletions, or mutations, conversion of a prodrug to an active drug, decreased tumor size and / or number, decreased plaque size and / or number, increased angiogenesis, decreased angiogenesis, increased vision, decreased pain, increased cardiac output (e.g., ejection fraction, and stroke volume), decreased heart rate abnormalities, decreased fibrosis, decreased appetite, decreased appetite, decreased appetite suppressant ... the effects of the present invention include one or more of the following: reduction in symptoms (anxiety, depression, anxiety, dizziness, numbness, tremors, and dizziness), reduction in erectile dysfunction, increased energy, increased lung function, increased kidney function, increased liver function, increased insulin sensitivity, decreased insulin sensitivity, reduced inflammation, increased tear production, improved hearing, increased hearing, reduced tinnitus, reduced sweating, partial or total clearance of infection, increased fertility, reduced fertility, inhibition or neutralization of proteins, recruitment or stimulation of one or more components of the immune system, lengthening of telomeres, inhibition of cellular senescence, increased replicative capacity, reprogramming, proliferation, differentiation, and increased differentiation potential.

[0028] In some aspects, RNA molecules with low toxicity and high translation efficiency are provided.In one aspect, a cell culture medium for high-efficiency in vivo transfection, reprogramming, and gene editing of cells is provided.Another aspect relates to a method for generating RNA molecules encoding reprogramming proteins.Yet another aspect relates to a method for generating RNA molecules encoding gene editing proteins.

[0029] In one aspect, the present invention provides a highly efficient gene editing protein comprising an engineered nuclease cleavage domain. In another aspect, the present invention provides a highly fidelity gene editing protein comprising an engineered nuclease cleavage domain. Other aspects relate to highly efficient gene editing proteins comprising an engineered DNA binding domain. Yet another aspect relates to highly fidelity gene editing proteins comprising an engineered DNA binding domain. Yet another aspect relates to gene editing proteins comprising engineered repeat sequences. Some aspects relate to methods for modifying the DNA sequence of a cell by transfecting the cell with or inducing the cell to express a gene editing protein. Other aspects relate to methods for modifying the DNA sequence of a cell present in an in vitro culture. Yet another aspect relates to methods for modifying the DNA sequence of a cell present in vivo.

[0030] In some embodiments, the present invention provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of a gene editing protein or a nucleic acid encoding a gene editing protein. In one embodiment, the gene editing protein is capable of modifying the DNA sequence of a cancer-associated gene. In another embodiment, the cancer-associated gene is the BIRC5 gene. Still other embodiments relate to therapeutic agents comprising nucleic acids and / or cells, and methods of using therapeutic agents comprising nucleic acids and / or cells, for treating, for example, type 1 diabetes, heart disease including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV / AIDS. In some embodiments, the nucleic acid comprises RNA. In other embodiments, the RNA comprises one or more non-standard nucleotides. In still other embodiments, the nucleic acid is delivered to the cell using a virus. In some embodiments, the virus is a replication competent virus, while in other embodiments, the virus is a replication incompetent virus.

[0031] Details of the invention are described in the accompanying description below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, exemplary methods and materials are described herein. Other features, objects, and advantages of the invention will become apparent from the description and from the claims. In this specification and the appended claims, the singular forms include the plural forms unless the context clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. [Brief description of the drawings]

[0032] [Figure 1] Shown are primary adult human dermal fibroblasts transfected with RNA encoding green fluorescent protein ("GFP") and containing the indicated nucleotides. [Diagram 2]Figure 2 shows the results of gene expression analysis of primary adult human dermal fibroblasts from Figure 1 using one-step real-time RT-PCR and primers designed to amplify human interferon-β mRNA. Data were normalized to untransfected samples ("negative"). GAPDH was used as a loading control. [Diagram 3] Figure 3 shows the results of gene expression analysis of cells transfected with RNA containing the indicated nucleotides, performed as in Figure 2. Data were normalized to untransfected samples ("negative"). GAPDH was used as a loading control. [Figure 4] Figure 2 shows the results of gene expression analysis of cells transfected with RNA containing the indicated nucleotides, using primers designed to amplify the indicated transcripts, performed as in Figure 2. Data were normalized to untransfected samples ("negative"). GAPDH was used as a loading control. [Diagram 5] Figure 3 shows the results of gene expression analysis of primary human epidermal keratinocytes transfected with RNA encoding NOVEPOETIN and containing the indicated nucleotides, performed as in Figure 2. Data were normalized to untransfected samples ("negative"). GAPDH was used as a loading control. [Figure 6] 1 shows an intradermal injection of a solution containing RNA encoding GFP into the ventral forearm of a healthy, 33 year old, 70 kg, male human subject. [Figure 7] Shown are areas of the ventral forearm of the subjects shown in Figure 6 after treatment with RNA containing 5-methoxyuridine and encoding GFP (injection sites 1-3) or COL7 (injection site 4). Images were taken immediately after the final injection. [Figure 8] The area of ​​FIG. 7 is shown 24 hours after injection. [Figure 9] 8 shows the results of fluorescence imaging of the region of FIG. 7 using the indicated fluorescence channels. The dose at each injection site is also shown. Images were taken 24 hours after injection. [Figure 10]8 shows the results of fluorescence imaging of the area of ​​FIG. 7 using the FITC fluorescence channel. The dose at each injection site is indicated. Images were taken 48 hours after injection. [Figure 11] 8 shows the results of quantitative fluorescence imaging of the region of FIG. 7 using the FITC fluorescence channel. The horizontal axis indicates time after injection. [Figure 12] Fluorescence imaging results are shown from an independent experiment in which the ventral forearm region of the subject shown in Figure 6 was treated with RNA containing 5-methoxyuridine and encoding GFP, with images taken 24 hours after injection. [Figure 13] 1 shows the results of an ELISA designed to detect darbepoetin alfa in the culture medium of primary human epidermal keratinocytes transfected with RNA encoding NOVEPOETIN, containing the indicated nucleotides. [Figure 14] 1 shows the results of an ELISA designed to detect darbepoetin alfa in the culture medium of primary human epidermal keratinocytes transfected with RNA encoding NOVEPOETIN, containing the indicated nucleotides. [Figure 15] 1 shows the results of an ELISA designed to detect darbepoetin alfa in the culture medium of primary human epidermal keratinocytes transfected with RNA encoding NOVEPOETIN, containing the indicated nucleotides. [Figure 16] Primary human dermal fibroblasts transfected with RNA encoding hTERT containing 5-methoxyuridine were fixed and stained with an antibody targeting hTERT 24 hours after transfection. [Figure 17] Shown are primary adult human dermal fibroblasts transfected with RNA encoding green fluorescent protein ("GFP") and prepared and stored as indicated. [Figure 18] A single dose of NOVECRIT induces a rapid increase and sustained levels of NOVEPOIETIN in serum. The Y-axis shows the concentration of NOVEPOIETIN protein (mU / mL). [Figure 19]1 shows that a single dose of NOVECRIT stimulated erythropoiesis and resulted in an increase in hematocrit for at least 14 days. The left panel shows % hematocrit on the Y-axis and the right panel shows % reticulocytes. [Figure 20] 1 shows a table summarizing TNFα, IL-6, and IFNα cytokine levels in plasma samples collected from the maximum tolerated dose of NOVECRIT in the male Sprague Dawley rat study of Example 35. [Figure 21] SURVEYOR assay using DNA from primary adult human skin fibroblasts transfected with RNA TALENs targeting the sequences TGAGCAGAAGTGGCTCAGTG (SEQ ID NO: 467) and TGGCTGTACAGCTACACCCC (SEQ ID NO: 468) located within the COL7A1 gene. The band present in the +RNA lane indicates editing of a region of the gene frequently involved in dystrophic epidermolysis bullosa. [Figure 22] SURVEYOR assay using DNA from primary adult human skin fibroblasts transfected with RNA TALENs targeting the sequences TTCCACTCCTGCAGGGCCCC (SEQ ID NO: 469) and TCGCCCTTCAGCCCGCGTTC (SEQ ID NO: 470) located within the COL7A1 gene. The band present in the +RNA lane indicates editing of a region of the gene frequently involved in dystrophic epidermolysis bullosa. [Figure 23] The immunogenicity of various synthetic RNA constructs in the context of gene editing (i.e., unmodified nucleotides "A, G, U, C", pseudouridine only "psU", 5-methylcytidine only "5mC", both pseudouridine and 5-methylcytidine "psU+5mC", and a negative control "negative") is shown. [Figure 24] Gene editing activity in cells transfected with various synthetic RNA constructs (i.e., unmodified nucleotides "A,G,U,C"; pseudouridine only "psU"; 5-methylcytidine only "5mC"; both pseudouridine and 5-methylcytidine "psU+5mC"; and negative control "negative") is shown. [Diagram 25]1 shows gene editing of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding a TALEN and a single-stranded DNA repair template ("RT") of the indicated length. The presence of a band at the position indicated by an asterisk ("*") indicates successful gene editing. [Figure 26] 1 shows gene editing of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding a TALEN and an 80 nt single-stranded DNA repair template ("RT") at the indicated ratios of RNA to repair template. The presence of a band at the position indicated with an asterisk ("*") indicates successful gene editing. [Figure 27] 1 shows gene correction of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding a TALEN and a single-stranded DNA repair template ("RT") of the indicated length. The presence of a band at the position indicated by an asterisk ("*") indicates successful gene correction. [Figure 28] 1 shows gene correction of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding a TALEN and an 80 nt single-stranded DNA repair template ("RT") at the indicated ratios of RNA to repair template. The presence of a band at the position indicated with an asterisk ("*") indicates successful gene correction. [Figure 29] 1 shows gene editing ("T7E1") and correction ("digestion") of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding a TALEN and an 80 nt single-stranded DNA repair template ("RT"). The presence of a band at the position indicated by an asterisk ("*") indicates successful gene editing ("T7E1") and correction ("digestion"). [Diagram 30] 1 shows the amount of BMP7 protein secreted by primary human dermal fibroblasts and primary human epidermal keratinocytes transfected with RNA encoding the indicated BMP7 mutants, as measured by ELISA. An asterisk ("*") indicates saturation of the ELISA assay. [Diagram 31] 1 shows the amount of parathyroid hormone secreted by primary human epidermal keratinocytes transfected with RNA encoding PTH, as measured by ELISA. [Diagram 32] 1 shows that repeated administration of NOVECRIT stimulated erythropoiesis and resulted in elevated hematocrit for at least 14 days. In each data set, the order of the histograms from left to right is Group 1, Group 2, Group 3, Group 4, and Group 5. [Diagram 33] An exemplary experimental design is provided for testing the effect of RNA encoding a BMP7 mutant on the prevention and treatment of diabetic nephropathy. [Diagram 34] 1 shows BMP7 protein levels in rats treated with RNA encoding BMP7 mutants as described in Example 42. Error bars indicate SEM (n=6). [Diagram 35] 1 shows urine volume, urine albumin, and urine creatinine levels in rats treated with RNA encoding BMP7 mutants as described in Example 42. In each data set, the order of the histograms from left to right is urine volume, urine creatinine, and urine albumin. [Diagram 36] 1 shows the effect of RNA encoding a BMP7 variant in treating diabetic nephropathy, as described in Example 42. In each data set, the order of the histograms from left to right is: Group 6 - Vehicle, and Group 7 - FTB-2 (BMP7 variant A). [Figure 37] Panels A-I show the results of gene expression analysis of human epidermal keratinocytes transfected with RNA encoding BDNF, BMP-2, BMP-6, IL-2, IL-6, IL-15, IL-22, LIF, or FGF-21. [Figure 38] 1 shows the results of gene expression analysis of human epidermal keratinocytes transfected with RNA encoding IL-15 or IL-15 and IL-15RA. [Figure 39]Figure 1 shows serum levels of FGF21, IL15, IL6, IL22, and Novepoietin after a single intradermal injection of various RNAs encoding these proteins as described in Example 45. Three rats were analyzed for each RNA tested. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0033] The present invention is based, in part, on the discovery of safe and effective administration strategies for nucleic acid drugs, including RNA, such as RNA containing non-standard (or "modified") nucleotides, in humans. The inventors believe that this is the first report of safe and effective administration of RNA molecules, such as those containing non-standard nucleotides, in humans. Despite reports in the art that very large amounts of RNA molecules are required for mammalian administration, the therapeutic effect achieved is minimal despite high doses (see, for example, U.S. Patent Publication No. 2013 / 0245103). Surprisingly, the inventors have administered synthetic RNA to humans and managed to achieve significant target protein expression with minimal immunological or other side effects.

[0034] In various embodiments, the present invention provides improved dosages, formulations, administration, and methods of use of nucleic acid drugs, including RNA, which may contain non-standard nucleotides (e.g., residues other than adenine, guanine, thymine, uracil, and cytosine, or standard nucleosides, nucleotides, deoxynucleosides, or deoxynucleotide derivatives thereof). In various embodiments, RNA containing non-standard nucleotides results in expression of a protein encoded by the RNA, which is often one of therapeutic benefit (sometimes referred to as a "target" or "protein of interest"). Moreover, this expression of the therapeutic protein is achieved with minimal or negligible toxicity.

[0035] In various aspects, the present invention is based on the surprising discovery of safe and effective dosage and administration parameters of nucleic acid drugs for human subjects.Nucleic acid drugs include dsDNA molecules, ssDNA molecules, RNA molecules, dsRNA molecules, ssRNA molecules, plasmids, oligonucleotides, synthetic RNA molecules, miRNA molecules, mRNA molecules, and siRNA molecules.In various embodiments, RNA includes non-standard nucleotides.

[0036] In some aspects, a method for delivering a nucleic acid drug is provided, comprising administering an effective dose of a nucleic acid drug to a human subject in need thereof, the nucleic acid drug comprising a synthetic RNA. In various embodiments, the effective dose is sufficient to substantially increase the amount of protein encoded by the nucleic acid drug in the human subject. For example, when the nucleic acid drug is a synthetic RNA comprising one or more modified nucleotides, the nucleic acid drug may result in higher protein expression than the level obtained with a nucleic acid drug that does not comprise one or more modified nucleotides (e.g., an RNA comprising standard nucleotides A, G, U, and C). In some embodiments, the nucleic acid drug results in about 2-fold, or about 3-fold, or about 4-fold, or about 5-fold, or about 10-fold, or about 15-fold, or about 20-fold, or about 25-fold, or about 30-fold, or about 35-fold, or about 40-fold, or about 45-fold, or about 50-fold, or about 100-fold increase in protein expression compared to the level obtained with a nucleic acid drug that does not comprise one or more modified nucleotides.

[0037] In some embodiments, nucleic acid drugs can provide sustained therapeutic effect, which is mediated by the sustained expression of target protein.For example, in some embodiments, therapeutic effect exists for about 1 day, or about 2 days, or about 3 days, or about 4 days, or about 5 days, or about 6 days, or about 7 days, or about 8 days, or about 9 days, or about 10 days, or about 14 days after administration.In some embodiments, this sustained effect eliminates the need for or reduces the amount of maintenance dose.

[0038] In some embodiments, nucleic acid drug provides sustained target protein level.For example, in some embodiments, target protein is present (e.g., in measurable amounts, e.g., in the serum of the patient to whom nucleic acid drug is administered) for about 1 day, or about 2 days, or about 3 days, or about 4 days, or about 5 days, or about 6 days, or about 7 days, or about 8 days, or about 9 days, or about 10 days, or about 14 days after administration.In some embodiments, this sustained effect eliminates or reduces the need for maintenance doses.

[0039] In various embodiments, nucleic acid drugs exert therapeutic effects without the nucleic acid drug itself being continuously present.In some embodiments, nucleic acid drugs are rapidly metabolized within about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, or about 1 week after administration, for example.

[0040] In various embodiments, an effective dose is an amount that substantially avoids cytotoxicity in vivo. In various embodiments, an effective dose is an amount that substantially avoids an immune response in a human subject. For example, the immune response may be an immune response mediated by the innate immune system. The immune response can be monitored using markers known in the art (e.g., cytokines, interferons, TLRs). In some embodiments, an effective dose obviates the need to treat a human subject with immunosuppressants (e.g., B18R) used to moderate residual toxicity. Thus, in some embodiments, the method can be administered to provide increased protein expression and reduced toxicity.

[0041] In some embodiments, the immune response is reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 99.9%, or more than about 99.9% compared to the immune response elicited by the corresponding unmodified nucleic acid. In some embodiments, the upregulation of one or more immune response markers is reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 99.9%, or more than about 99.9% compared to the upregulation of one or more immune response markers elicited by the corresponding unmodified nucleic acid. In some embodiments, the immune response marker comprises an mRNA or protein product of an interferon gene, such as the interferon alpha gene, IFNB1, TLR3, RARRES3, EIF2AK2, STAT1, STAT2, IFIT1, IFIT2, IFIT3, IFIT5, OAS1, OAS2, OAS3, OASL, ISG20, or a fragment, variant, analog, or family member thereof. In some embodiments, the immune response markers include mRNA or protein products of TNF genes, such as the TNFα gene, TNFRSF1A, TNFRSF1B, LTBR, ​​TNFRSF4, CD40, FAS, TNFRSF6B, CD27, TNFRSF8, TNFRSF9, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11A, TNFRSF11B, TNFRSF12A, TNFRSF13B, TNFRSF13C, TNFRSF14, NGFR, TNFRSF17, TNFRSF18, TNFRSF19, TNFRSF21, TNFRSF25, and EDA2R, or fragments, variants, analogs, or family members thereof.In some embodiments, the immune response marker comprises an mRNA or protein product of an interleukin gene, such as the IL-6 gene, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 or CXCL8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, IL-36, or a fragment, variant, analog, or family member thereof.

[0042] In some embodiments, cell death is about 10%, about 25%, about 50%, about 75%, about 85%, about 90%, about 95%, or greater than about 95% less than the cell death observed with the corresponding unmodified nucleic acid. Additionally, cell death may affect less than about 50%, about 40%, about 30%, about 20%, about 10%, about 5%, about 1%, about 0.1%, about 0.01%, or less than about 0.01% of cells contacted with the modified nucleic acid.

[0043] In some embodiments, a method is provided for expressing a protein of interest in a population of cells in a mammalian subject, comprising administering to said cells a non-viral transfection composition comprising an effective dose of RNA encoding the protein of interest, wherein the RNA contains one or more non-standard nucleotides to avoid substantial cytotoxicity, and wherein the transfection composition is administered in an amount capable of expressing said protein in said cells for at least about 5 days (e.g., about 5 days, or about 6 days, or about 7 days, about 8 days, or about 9 days, or about 10 days, or about 14 days) without substantial cytotoxicity. In some embodiments, a method is provided for expressing a protein of interest in a population of cells in a mammalian subject, comprising administering to said cells a non-viral transfection composition comprising an effective dose of RNA encoding the protein of interest, wherein the RNA contains one or more non-standard nucleotides to avoid substantial cytotoxicity, and wherein the transfection composition is administered in an amount capable of expressing said protein in said cells for at least about 6 hours (e.g., about 6 hours, or about 12 hours, or about 1 day, or about 2 days, or about 3 days, or about 4 days, or about 5 days) without substantial cytotoxicity.

[0044] In some embodiments, the effective dose of a nucleic acid drug, e.g., a synthetic RNA, is about 100 ng to about 2000 ng, or about 200 ng to about 1900 ng, or about 300 ng to about 1800 ng, or about 400 ng to about 1700 ng, or about 500 ng to about 1600 ng, or about 600 ng to about 1500 ng, or about 700 ng to about 1400 ng, or about 800 ng to about 1300 ng, or about 900 ng to about 1200 ng, or about 1000 ng to about 1100 ng, or about 50 0 ng to about 2000 ng, or about 500 ng to about 1500 ng, or about 500 ng to about 1000 ng, or about 1000 ng to about 1500 ng, or about 1000 ng to about 2000 ng, or about 1500 ng to about 2000 ng, or about 100 ng to about 500 ng, or about 200 ng to about 400 ng, or about 10 ng to about 100 ng, or about 20 ng to about 90 ng, or about 30 ng to about 80 ng, or about 40 ng to about 70 ng, or about 50 ng to about 60 ng.

[0045] In some embodiments, the effective dose of a nucleic acid drug, e.g., a synthetic RNA, is about 50 ng, or about 100 ng, or about 200 ng, or about 300 ng, or about 400 ng, or about 500 ng, or about 600 ng, or about 700 ng, or about 800 ng, or about 900 ng, or about 1000 ng, or about 1100 ng, or about 1200 ng, or about 1300 ng, or about 1400 ng, or about 1500 ng, or about 1600 ng, or about 1700 ng, or about 1800 ng, or about 1900 ng, or about 2000 ng or less.

[0046] In some embodiments, an effective dose of a nucleic acid drug, e.g., a synthetic RNA, is about 50 ng, or about 100 ng, or about 200 ng, or about 300 ng, or about 400 ng, or about 500 ng, or about 600 ng, or about 700 ng, or about 800 ng, or about 900 ng, or about 1000 ng, or about 1100 ng, or about 1200 ng, or about 1300 ng, or about 1400 ng, or about 1500 ng, or about 1600 ng, or about 1700 ng, or about 1800 ng, or about 1900 ng, or about 2000 ng.

[0047] In some embodiments, an effective dose of a nucleic acid drug, e.g., a synthetic RNA, is about 0.028 pmol, or about 0.05 pmol, or about 0.1 pmol, or about 0.2 pmol, or about 0.3 pmol, or about 0.4 pmol, or about 0.5 pmol, or about 0.6 pmol, or about 0.7 pmol, or about 0.8 pmol, or about 0.9 pmol, or about 1.0 pmol, or about 1.2 pmol, or about 1.4 pmol. 1, or about 1.6 pmol, or about 1.8 pmol, or about 2.0 pmol, or about 2.2 pmol, or about 2.4 pmol, or about 2.6 pmol, or about 2.8 pmol, or about 3.0 pmol, or about 3.2 pmol, or about 3.4 pmol, or about 3.6 pmol, or about 3.8 pmol, or about 4.0 pmol, or about 4.2 pmol, or about 4.4 pmol, or about 4.6 pmol, or about 4.8 pmol, or about 5.0 pmol, or about 5.5 pmol, or about 5.7 pmol.

[0048] In some embodiments, the nucleic acid drug, e.g., synthetic RNA, is administered at a concentration of about 0.1 nM, or about 0.25 nM, or about 0.5 nM, or about 0.75 nM, or about 1 nM, or about 2.5 nM, or about 5 nM, or about 7.5 nM, or about 10 nM, or about 20 nM, or about 30 nM, or about 40 nM, or about 50 nM, or about 60 nM, or about 70 nM, or about 80 nM, or about 90 nM, or about 100 nM, or about 110 nM, or about 120 nM, or about 150 nM, or about 175 nM, or about 200 nM.

[0049] In some embodiments, an effective dose of a nucleic acid drug is about 350 ng / cm 2 , or about 500 ng / cm 2 , or about 750 ng / cm 2 , or about 1000ng / cm 2 , or about 2000 ng / cm 2 , or about 3000 ng / cm 2 , or about 4000 ng / cm 2 , or about 5000ng / cm 2 , or about 6000 ng / cm 2 , or about 7000 ng / cm 2 In other embodiments, the effective dose is about 350 ng / cm 2 In certain embodiments, the effective dose is less than about 35 ng / cm 2 , or about 50 ng / cm 2 , or about 75 ng / cm 2 , or about 100 ng / cm 2 , or about 150 ng / cm 2 , or about 200 ng / cm 2 , or about 250 ng / cm 2 , or about 300 ng / cm 2 , or about 350 ng / cm 2 It is.

[0050] In some embodiments, an effective dose of a nucleic acid drug is about 35 ng / cm 2 ~about 7000ng / cm 2 , or about 50 ng / cm2 ~Approx. 5000ng / cm 2 , or about 100 ng / cm 2 ~About 3000ng / cm 2 , or about 500 ng / cm 2 ~about 2000ng / cm 2 , or about 750 ng / cm 2 ~Approx. 1500ng / cm 2 , or about 800 ng / cm 2 ~Approx. 1200ng / cm 2 , or about 900 ng / cm 2 ~Approx. 1100ng / cm 2 It is.

[0051] In some embodiments, an effective dose of a nucleic acid drug is about 1 picomole / cm 2 , or approximately 2 picomoles / cm 2 , or approximately 3 picomoles / cm 2 , or approximately 4 picomoles / cm 2 , or about 5 picomoles / cm 2 , or approximately 6 picomoles / cm 2 , or approximately 7 picomoles / cm 2 , or approximately 8 picomoles / cm 2 , or approximately 9 picomoles / cm 2 , or about 10 picomoles / cm 2 , or approximately 12 picomoles / cm 2 , or approximately 14 picomoles / cm 2 , or approximately 16 picomoles / cm 2 , or approximately 18 picomoles / cm 2 , or about 20 picomoles / cm 2 In other embodiments, the effective dose is about 1 picomole / cm 2 In certain embodiments, the effective dose is less than about 0.1 picomoles / cm 2 , or about 0.2 picomoles / cm 2 , or about 0.3 picomoles / cm 2 , or approximately 0.4 picomoles / cm 2 , or about 0.5 picomoles / cm 2 , or about 0.6 picomoles / cm 2 , or approximately 0.7 picomoles / cm 2, or about 0.8 picomoles / cm 2 , or about 0.9 picomoles / cm 2 , or approximately 1 picomole / cm 2 It is.

[0052] In some embodiments, an effective dose of a nucleic acid drug is about 0.1 picomoles / cm 2 ~ approx. 20 pmol / cm 2 , or about 0.2 picomoles / cm 2 ~ approx. 15 pmoles / cm 2 , or about 0.5 picomoles / cm 2 ~ approx. 10 picomoles / cm 2 , or about 0.8 picomoles / cm 2 ~ approx. 8 pmol / cm 2 , or approximately 1 picomole / cm 2 ~ approx. 5 pmol / cm 2 ,or Approximately 2 picomoles / cm 2 ~ approx. 4 pmol / cm 2 It is.

[0053] In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is administered in a pharma- ceutically acceptable formulation. In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is formulated for one or more of injection and local administration. As an example, the nucleic acid drug, e.g., synthetic RNA, may be formulated for injection into a target tissue, e.g., a site of disease (for example, a tumor, by way of non-limiting example). In various embodiments, the injection includes delivery via a patch. In some embodiments, the delivery is mediated by electrical stimulation. In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is formulated for administration into one or more of the epidermis (optionally selected from the stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, and stratum basale), basement membrane, dermis (optionally selected from the papillary region and reticular region), subcutaneous tissue, conjunctiva, cornea, sclera, iris, lens, limbus, optic nerve, choroid, ciliary body, anterior segment, anterior chamber, and retina. In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is formulated for one or more of subcutaneous injection, intradermal injection, subcutaneous injection, intramuscular injection, intraocular injection, intravitreal injection, intraarticular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection, and local administration. In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is formulated for intradermal (ID) injection into one or more of the dermis or epidermis. In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is administered in a manner that affects one or more of keratinocytes and fibroblasts (e.g., causes these cells to express one or more therapeutic proteins).

[0054] Thus, the present invention provides various formulations as described herein. Additionally, in some embodiments, the formulations described herein find use in various delivery and / or treatment methods of the present invention. For example, the formulations can include vesicles, such as liposomes (Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy). (See, for example, The Journal of Infectious Disease, and Cancer, Lopez-Berestein, and Fidler (eds.), Liss, New York, pp. 353-365 (1989)). In various embodiments, the formulation comprises an aqueous suspension of liposomes. Representative liposome components are listed in Table 1, and are given by way of example and not by way of limitation. In various embodiments, one or more, or two or more, or three or more, or four or more, or five or more of the lipids in Table 1 are combined in the formulation.

[0055] [Table 1-1] [Table 1-2]

[0056] In some embodiments, the liposome comprises Lipofectamine 3000. In some embodiments, the liposome comprises a liposome as described in U.S. Pat. No. 4,897,355 or 7,479,573 or International Patent Publication No. WO / 2015 / 089487, or Felgner, PL et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7417, the entire contents of each of which are incorporated herein by reference in their entirety.

[0057] In some embodiments, the liposome comprises N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA). In some embodiments, the liposome comprises dioleoylphosphatidylethanolamine (DOPE).

[0058] In one embodiment, the liposome comprises one or more polyethylene glycol (PEG) chains selected from any of PEG200, PEG300, PEG400, PEG600, PEG800, PEG1000, PEG1500, PEG2000, PEG3000, and PEG4000. In some embodiments, the PEG is PEG2000. In some embodiments, the liposome comprises 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) or a derivative thereof.

[0059] In some embodiments, the formulation comprises one or more of N-(carbonyl-ethoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine (MPEG2000-DSPE), fully hydrogenated phosphatidylcholine, cholesterol, lipofectamine 3000, cationic lipid, polycationic lipid, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folic acid (polyethylene glycol)-5000] (FA-MPEG5000-DSPE).

[0060] In one embodiment, the formulation comprises about 3.2 mg / mL N-(carbonyl-ethoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine (MPEG2000-DSPE), about 9.6 mg / mL fully hydrogenated phosphatidylcholine, about 3.2 mg / mL cholesterol, about 2 mg / mL ammonium sulfate, and histidine as a buffer, and about 0.27 mg / mL 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folic acid (polyethylene glycol)-5000] (FA-MPEG5000-DSPE) is added to the lipid mixture. In another embodiment, the nucleic acid is complexed by combining about 1 μL of Lipofectamine 3000 per about 1 μg of nucleic acid and incubating at room temperature for at least about 5 minutes. In one embodiment, Lipofectamine 3000 is a solution containing lipids at a concentration of about 1 mg / mL. In some embodiments, the nucleic acid is encapsulated by combining about 10 μg of liposome formulation per about 1 μg of nucleic acid and incubating at room temperature for about 5 minutes.

[0061] In some embodiments, the formulation comprises one or more nanoparticles. In one embodiment, the nanoparticles are polymeric nanoparticles. In various embodiments, the formulation comprises one or more of a diblock copolymer, a triblock copolymer, a tetrablock copolymer, and a multiblock copolymer. In various embodiments, the formulation comprises one or more of a polymeric nanoparticle comprising a polyethylene glycol (PEG)-modified polylactic acid (PLA) diblock copolymer (PLA-PEG), and a PEG-polypropylene glycol-PEG-modified PLA-tetrablock copolymer (PLA-PEG-PPG-PEG).

[0062] In some embodiments, the formulation comprises one or more lipids described in WO / 2000 / 027795, the entire contents of which are incorporated herein by reference.

[0063] In one embodiment, the therapeutic agent comprises one or more ligands, hi another embodiment, the therapeutic agent comprises at least one of androgen, CD30 (TNFRSF8), a cell penetrating peptide, CXCR, estrogen, epidermal growth factor, EGFR, HER2, folate, insulin, insulin-like growth factor I, interleukin 13, integrin, progesterone, stromal derived factor 1, thrombin, vitamin D, and transferrin, or a biologically active fragment or variant thereof.

[0064] The active compositions of the present invention may include typical pharmaceutical preparations. The administration of these compositions according to the present invention may be via any common route, as long as the target tissue is available via that route. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal, or intravenous injection, or by direct injection into diseased tissue, e.g., cancerous tissue. The agents disclosed herein may also be administered by catheter system. Such compositions are usually administered as pharma- ceutically acceptable compositions as described herein.

[0065] Administration of the compositions described herein may be, for example, by injection, topical administration, ocular administration, and nasal administration. Injection may in some embodiments be coupled to electrical forces (e.g., electroporation using instruments that find use in electrochemotherapy (e.g., CLINIPORATOR, IGEA Srl, Carpi [MO], Italy). Topical administration may be, but is not limited to, creams, lotions, ointments, gels, sprays, solutions, and the like. Topical administration may further include penetration enhancers, such as, but not limited to, surfactants, fatty acids, bile acids, chelating agents, non-chelating non-surfactants, polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether, fatty acids and / or salts in combination with bile acids and / or salts, lauric acid, capric acid, and sodium salts in combination with UDCA. Topical administration may further include fragrances, colorants, sunscreens, antibacterial agents, and / or moisturizing agents. The compositions described herein may be administered to at least one area, including but not limited to, the forehead, scalp, hair follicles, hair, upper eyelids, lower eyelids, eyebrows, eyelashes, infraorbital area, periorbital area, temples, nose, bridge of the nose, cheeks, tongue, nasolabial folds, lips, periocular area, jawline, ears, neck, chest, forearms, upper arms, palms, hands, fingers, nails, back, abdomen, flanks, buttocks, thighs, calves, feet, toes, etc.

[0066] Routes of administration include, for example, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectal, inhalation, or topical (particularly to the ear, nose, eye, or skin). In some embodiments, administering is performed by oral or parenteral injection.

[0067] Upon formulation, solutions may be administered in a manner compatible with the dosage formulations, as described herein, and in such amount as is therapeutically effective. Formulations include injectable solutions, drug release capsules, and the like. The pharmaceutical composition may be easily administered in a variety of dosage forms, including as an aqueous solution. For parenteral administration in an aqueous solution, for example, the solution is generally suitably buffered and the liquid diluent is first rendered isotonic, for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Preferably, a sterile aqueous medium is used, as known to those skilled in the art, particularly in light of the present disclosure.

[0068] In various embodiments, the nucleic acid drug, e.g., RNA comprising one or more non-standard nucleotides, and / or a formulation comprising the same, is optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and an effective dose is about 4 mm 2 ~about 150mm 2 (For example, about 4 mm 2 or less, or about 5 mm 2 or less, or about 6 mm 2 or less, or about 7 mm 2 or less, or about 8 mm 2 or less, or about 10 mm 2 or less, or about 20 mm 2 or less, or about 50 mm 2 or less, or about 100 mm 2 or less, or about 150 mm 2 In various embodiments, the nucleic acid drug, e.g., RNA comprising one or more non-standard nucleotides, and / or a formulation comprising same, is optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and an effective dose is administered to a surface area of ​​about 4 mm or less. 2 , or about 5 mm 2 , or about 6 mm 2 , or about 7 mm 2 , or about 8 mm 2 , or about 10 mm 2 , or about 20 mm 2 , or about 50 mm 2 , or about 100 mm 2 , or about 150 mm 2In various embodiments, the nucleic acid drug, e.g., RNA comprising one or more non-standard nucleotides, and / or a formulation comprising the same, is optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and an effective dose is administered to a surface area of ​​about 4 mm 2 , or about 5 mm 2 , or about 6 mm 2 , or about 7 mm 2 , or about 8 mm 2 , or about 10 mm 2 , or about 20 mm 2 , or about 50 mm 2 , or about 100 mm 2 , or about 150 mm 2 is administered to a surface area of

[0069] In various embodiments, the nucleic acid drug, e.g., RNA comprising one or more non-standard nucleotides, and / or a formulation comprising the same, is optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and the effective dose (weight RNA / surface area of ​​injection) is about 35 ng / cm. 2 ~about 7000ng / cm 2 In various embodiments, the nucleic acid drug, e.g., RNA containing one or more non-standard nucleotides, and / or formulations containing same, are optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and the effective dose (weight RNA / surface area of ​​injection) is about 35 ng / cm 2 , or about 50 ng / cm 2 , or about 75 ng / cm 2 , or about 100 ng / cm 2 , or about 125 ng / cm 2 , or about 150 ng / cm 2 , or about 175 ng / cm 2 , or about 200 ng / cm 2 , or about 225 ng / cm 2 , or about 250 ng / cm 2 , or about 500 ng / cm 2 , or about 1000ng / cm 2 , or about 2000 ng / cm2 , or about 5000ng / cm 2 , or about 7000 ng / cm 2 In various embodiments, the nucleic acid drug, e.g., RNA containing one or more non-standard nucleotides, and / or formulations containing same, are optionally administered locally by one or more of subcutaneous injection, intradermal injection, subcutaneous injection, and intramuscular injection, and the effective dose (weight RNA / surface area of ​​injection) is about 35 ng / cm 2 , or about 50 ng / cm 2 , or about 75 ng / cm 2 , or about 100 ng / cm 2 , or about 125 ng / cm 2 , or about 150 ng / cm 2 , or about 175 ng / cm 2 , or about 200 ng / cm 2 , or about 225 ng / cm 2 , or about 250 ng / cm 2 , or about 500 ng / cm 2 , or about 1000ng / cm 2 , or about 2000 ng / cm 2 , or about 5000ng / cm 2 , or about 7000 ng / cm 2 It is.

[0070] The pharmaceutical formulation may further include a delivery reagent (also known as a "transfection reagent," also known as a "vehicle," also known as a "delivery vehicle"), and / or an excipient. Delivery agents, excipients, and methods for their preparation and use, including methods for preparing and administering pharmaceutical formulations to patients (also known as "subjects"), are well known in the art and described in numerous publications, including, for example, U.S. Patent Application Publication No. 2008 / 0213377, which is incorporated herein by reference in its entirety.

[0071] For example, the compositions of the present invention can be in the form of pharma- ceutically acceptable salts, including, for example, those described in J. Pharma. Sci. 66, 2-19 (1977), and The Handbook of Pharmaceutical Salts, Properties, Selection, and Use. P.H. Stahl and C.G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, the entireties of which are incorporated herein by reference. Non-limiting examples of pharma- ceutically acceptable salts include sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methyl ... benzoate, o-acetoxybenzoate, naphthalene-2-benzoate, isobutyrate, phenylbutyrate, α-hydroxybutyrate, butyne-1,4-dicarboxylate, hexyne-1,4-dicarboxylate, caprate, caprylate, silicate, glycolate, heptanoate, hippurate, malate, hydroxymaleate, malonate, mandelate, mesylate, nicotinate, phthalate, terephthalate, propiolate, propionate, phenylpropionate, sebacate, suberate, p-bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-hydroxyethylsulfonate, methylsulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, naphthalene-1,5-sulfonates, xylene sulfonates, and tartrates; hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc; ammonia and unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, organic amines such as dicyclohexylamine; tributylamine, pyridine, N-methyl, N-ethylamine, diethylamine, triethylamine, mono-, bis-, or tris-(2-OH-lower alkylamines) such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine; N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)-amines such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine and lysine. ,

[0072] The pharmaceutical composition may include excipients, including liquids such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Pharmaceutical excipients may be, for example, saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary agents, stabilizers, thickeners, lubricants, and colorants may be used. In one embodiment, the pharma- ceutically acceptable excipients are sterile when administered to a subject. Suitable pharmaceutical excipients further include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, nonfat dry milk, glycerol, propylene, glycol, water, ethanol, and the like. The present disclosure Any of the compositions described herein, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[0073] Suitable dosage forms for parenteral administration (e.g., subcutaneous, intradermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intraarticular, and infusion) include, for example, solutions, suspensions, dispersions, emulsions, etc. It may also be prepared in the form of a sterile solid composition (e.g., a lyophilized composition) that can be dissolved or suspended in a sterile injectable medium immediately before use. These may contain, for example, suspending or dispersing agents known in the art.

[0074] In some embodiments, the formulations described herein may comprise albumin and a nucleic acid molecule.

[0075] In some embodiments, the present invention relates to a cosmetic composition. In one embodiment, the cosmetic composition comprises albumin. In another embodiment, the albumin is treated with an ion exchange resin or activated charcoal. In yet another embodiment, the cosmetic composition comprises a nucleic acid molecule. In a further embodiment, the cosmetic composition comprises both albumin and a nucleic acid molecule. Still other embodiments relate to cosmetic treatment articles comprising the cosmetic composition contained in a device configured to deliver the composition to a patient. Still other embodiments relate to a device configured to deliver the cosmetic composition to a patient. In one embodiment, the nucleic acid molecule encodes a member of the group of elastin, collagen, tyrosinase, melanocortin 1 receptor, keratin, filaggrin, antibodies, and hyaluronic acid synthase, or biologically active fragments, variants, analogs, or family members thereof.

[0076] In some embodiments, the present invention provides a treatment regimen. The inventors have discovered that the doses and administrations described herein can produce substantial protein expression effects rapidly (e.g., in about 6, or about 12, or about 24, or about 36, or about 48 hours). Moreover, these effects can persist for about 7 days or longer. In some embodiments, the method provides for administration of a nucleic acid drug, e.g., an RNA comprising one or more non-standard nucleotides, about once a week to about once every 20 weeks.

[0077] In some embodiments, the nucleic acid drug, e.g., the RNA comprising one or more non-standard nucleotides, is administered about once a week for at least two weeks (e.g., 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 weeks). In some embodiments, the nucleic acid drug, e.g., the RNA comprising one or more non-standard nucleotides, is administered about once every other week for at least one month (e.g., 1, or 2, or 3, or 4, or 5, or 6, or 12 months). In some embodiments, the nucleic acid drug, e.g., the RNA comprising one or more non-standard nucleotides, is administered monthly or about once every other month. In some embodiments, the nucleic acid drug, e.g., the RNA comprising one or more non-standard nucleotides, is administered for at least two months, or at least four months, or at least six months, or at least nine months, or at least one year.

[0078] In some embodiments, a nucleic acid drug, e.g., an RNA comprising one or more non-standard nucleotides, is administered about once a week, or about once every 2 weeks, or about once every 3 weeks, or about once every 4 weeks, or about once every 5 weeks, or about once every 6 weeks, or about once every 7 weeks, or about once every 8 weeks, or about once every 9 weeks, or about once every 10 weeks, or about once every 11 weeks, or about once every 12 weeks, or about once every 13 weeks, or about once every 14 weeks, or about once every 15 weeks, or about once every 20 weeks, or about once every 24 weeks.

[0079] In some embodiments, nucleic acid drugs, such as R The NA is administered about once a week, or about once every 2 weeks, or about once every 3 weeks, or about once every 4 weeks, or about once every 5 weeks, or about once every 6 weeks, or about once every 7 weeks, or about once every 8 weeks, or about once every 9 weeks, or about once every 10 weeks, or about once every 11 weeks, or about once every 12 weeks, or about once every 13 weeks, or about once every 14 weeks, or about once every 15 weeks, or about once every 20 weeks, or about once every 24 weeks or less.

[0080] Certain proteins have long half-lives and can persist in tissues for hours, days, weeks, months, or years. For example, it has now been discovered that certain methods of treating a patient can result in the accumulation of one or more proteins, including, for example, one or more beneficial proteins. Accordingly, certain embodiments relate to a method for treating a patient, comprising delivering a series of doses of a nucleic acid encoding one or more proteins to the patient. In one embodiment, the nucleic acid comprises an RNA comprising one or more non-standard nucleotides. In another embodiment, a first dose is given at a first time point. In yet another embodiment, a second dose is given at a second time point. In a further embodiment, the amount of at least one of the one or more proteins in the patient at the second time point is greater than the amount of said protein at the first time point. In yet another embodiment, the method results in the accumulation of said protein in the patient.

[0081] In various embodiments, the present invention relates to nucleic acid drugs, in various embodiments, RNAs that contain one or more non-standard nucleotides. Certain non-standard nucleotides, when incorporated into RNA molecules, can reduce the toxicity of the RNA molecules, in part, and without being bound by theory, by interfering with the binding of proteins that detect foreign nucleic acids, such as protein kinase R, Rig-1, and proteins of the oligoadenylate synthetase family. Non-standard nucleotides that have been reported to reduce the toxicity of RNA molecules when incorporated into RNA include pseudouridine, 5-methyluridine, 2-thiouridine, 5-methylcytidine, N6-methyladenosine, and certain combinations thereof. However, the chemical properties of non-standard nucleotides that can enable non-standard nucleotides to reduce the in vivo toxicity of RNA molecules are still unknown up to this point. Furthermore, the incorporation of large amounts of most non-standard nucleotides, such as 5-methyluridine, 2-thiouridine, 5-methylcytidine, and N6-methyladenosine, may reduce the efficiency with which RNA molecules can be translated into proteins, limiting the use of RNA molecules containing these nucleotides in applications requiring protein expression.In addition, although pseudouridine can be completely substituted for uridine in RNA molecules without reducing the efficiency with which synthetic RNA molecules can be translated into proteins, in certain situations, such as when performing frequent repeated transfection, synthetic RNA molecules containing only adenosine, guanosine, cytidine, and pseudouridine may exhibit excessive toxicity.

[0082] It has now been discovered, and in some embodiments the invention relates to, that RNA molecules containing one or more non-standard nucleotides, including one or more substitutions at positions 2C and / or 4C and / or 5C in the case of pyrimidines, or at positions 6C and / or 7N and / or 8C in the case of purines, may be less toxic than synthetic RNA molecules containing only standard nucleotides, due in part to the ability of substitutions at these positions to interfere with recognition of the synthetic RNA molecule by proteins that detect foreign nucleic acids, and further, that substitutions at these positions may have minimal impact on the efficiency with which the synthetic RNA molecule can be translated into protein, due in part to the fact that substitutions at these positions do not sufficiently interfere with base pairing and base stacking interactions.

[0083] [ka]

[0084] Examples of non-standard nucleotides containing one or more substitutions at positions 2C and / or 4C and / or 5C in the case of pyrimidines, or at positions 6C and / or 7N and / or 8C in the case of purines include 2-thiouridine, 5-azauridine, pseudouridine, 4-thiouridine, 5-methyluridine, 5-methylpseudouridine, 5-aminouridine, 5-aminopseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methoxyuridine, 5-methoxypseudouridine, 5-hydroxymethyluridine, 5-hydropyridine, 5-amino ... roxymethylpseudouridine, 5-carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5-methyl-5-azauridine, 5-amino-5-azauridine, 5-hydroxy-5-azauridine, 5-methylpseudouridine, 5-aminopseudouridine, 5-hydroxypseudouridine, 4-thio-5-azauridine, 4-thiopseudouridine, 4-thio-5-methyluridine, 4-thio-5-aminouridine, 4-thio-5-hydroxyuridine, 4-thio-5-methyl-5 -Azauridine, 4-thio-5-amino-5-azauridine, 4-thio-5-hydroxy-5-azauridine, 4-thio-5-methylpseudouridine, 4-thio-5-aminopseudouridine, 4-thio-5-hydroxypseudouridine, 2-thiocytidine, 5-azacytidine, pseudoisocytidine, N4-methylcytidine, N4-aminocytidine, N4-hydroxycytidine, 5-methylcytidine, 5-aminocytidine, 5-hydroxycytidine, 5-methoxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-hydroxycytidine, Lumilcytidine, 5-methyl-5-azacytidine, 5-amino-5-azacytidine, 5-hydroxy-5-azacytidine, 5-methylpseudoisocytidine, 5-aminopseudoisocytidine, 5-hydroxypseudoisocytidine, N4-methyl-5-azacytidine, N4-methylpseudoisocytidine, 2-thio-5-azacytidine, 2-thiopseudoisocytidine, 2-thio-N4-methylcytidine, 2-thio-N4-aminocytidine, 2-thio-N4-hydroxycytidine, 2-thio-5-methylcytidine, 2-thio-5-aminocytidine,2-thio-5-hydroxycytidine, 2-thio-5-methyl-5-azacytidine, 2-thio-5-amino-5-azacytidine, 2-thio-5-hydroxy-5-azacytidine, 2-thio-5-methylpseudoisocytidine, 2-thio-5-aminopseudoisocytidine, 2-thio-5-hydroxypseudoisocytidine, 2-thio-N4-methyl-5-azacytidine, 2-thio-N4-methylpseudoisocytidine, N4-methyl-5-methylcytidine, N4-methyl-5-aminocytidine, N4-methyl-5-hydroxycytidine, N4-methyl-5-methyl-5-azacytidine, N4-methyl-5-amino-5-azacytidine, N4- Methyl-5-hydroxy-5-azacytidine, N4-methyl-5-methylpseudoisocytidine, N4-methyl-5-aminopseudoisocytidine, N4-methyl-5-hydroxypseudoisocytidine, N4-amino-5-azacytidine, N4-aminopseudoisocytidine, N4-amino-5-methylcytidine, N4-amino-5-aminocytidine, N4-amino-5-hydroxycytidine, N4-amino-5-methyl-5-azacytidine, N4-amino-5-amino-5-azacytidine, N4-amino-5-hydroxy-5-azacytidine, N4-amino-5-methylpseudoisocytidine, N4-amino-5-aminopseudoiso, Cytidine, N4-amino-5-hydroxypseudoisocytidine, N4-hydroxy-5-azacytidine, N4-hydroxypseudoisocytidine, N4-hydroxy-5-methylcytidine, N4-hydroxy-5-aminocytidine, N4-hydroxy-5-hydroxycytidine, N4-hydroxy-5-methyl-5-azacytidine, N4-hydroxy-5-amino-5-azacytidine, N4-hydroxy-5-hydroxy-5-azacytidine, N4-hydroxy-5-methylpseudoisocytidine, N4-hydroxy-5-aminopseudoisocytidine , N4-hydroxy-5-hydroxypseudoisocytidine, 2-thio-N4-methyl-5-methylcytidine, 2-thio-N4-methyl-5-aminocytidine, 2-thio-N4-methyl-5-hydroxycytidine, 2-thio-N4-methyl-5-methyl-5-azacytidine, 2-thio-N4-methyl-5-amino-5-azacytidine, 2-thio-N4-methyl-5-hydroxy-5-azacytidine, 2-thio-N4-methyl-5-methylpseudoisocytidine, 2-thio-N4-methyl-5-aminopseudoisocytidine, 2-thio-N4-methyl-5-hi 2-thio-N4-amino-5-azacytidine, 2-thio-N4-aminopseudoisocytidine, 2-thio-N4-amino-5-methylcytidine, 2-thio-N4-amino-5-aminocytidine, 2-thio-N4-amino-5-hydroxycytidine, 2-thio-N4-amino-5-methyl-5-azacytidine, 2-thio-N4-amino-5-amino-5-azacytidine, 2-thio-N4-amino-5-hydroxy-5-azacytidine, 2-thio-N4-amino-5-methylpseudoisocytidine, 2-thio-N4-amino-5 -aminopseudoisocytidine, 2-thio-N4-amino-5-hydroxypseudoisocytidine, 2-thio-N4-hydroxy-5-azacytidine, 2-thio-N4-hydroxypseudoisocytidine, 2-thio-N4-hydroxy-5-methylcytidine, N4-hydroxy-5-aminocytidine, 2-thio-N4-hydroxy-5-hydroxycytidine, 2-thio-N4-hydroxy-5-methyl-5-azacytidine, 2-thio-N4-hydroxy-5-amino-5-azacytidine, 2-thio-N4-hydroxy-5-hydroxy-5-azacytidine,2-thio-N4-hydroxy-5-methylpseudoisocytidine, 2-thio-N4-hydroxy-5-aminopseudoisocytidine, 2-thio-N4-hydroxy-5-hydroxypseudoisocytidine, N6-methyladenosine, N6-aminoadenosine, N6-hydroxyadenosine, 7-deazaadenosine, 8-azaadenosine, N6-methyl-7-deazaadenosine, N6-methyl-8-azaadenosine, 7-deaza-8-azaadenosine, N6-methyl-7-deaza-8-azaadenosine, N6-amino-7-deazaadenosine, N6 Examples of uridine include, but are not limited to, N6-amino-8-azaadenosine, N6-amino-7-deaza-8-azaadenosine, N6-hydroxyadenosine, N6-hydroxy-7-deazaadenosine, N6-hydroxy-8-azaadenosine, N6-hydroxy-7-deaza-8-azaadenosine, 6-thioguanosine, 7-deazaguanosine, 8-azaguanosine, 6-thio-7-deazaguanosine, 6-thio-8-azaguanosine, 7-deaza-8-azaguanosine, 6-thio-7-deaza-8-azaguanosine, and 5-methoxyuridine.

[0085] In some embodiments, the invention relates to one or more non-standard nucleotides selected from 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine. In some embodiments, at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of the non-standard nucleotides are 5-hydroxycytidine. , 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine.

[0086] In some embodiments, at least about 50%, or at least about 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of the cytidine residues are non-standard nucleotides selected from 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine.

[0087] In some embodiments, at least about 20%, or about 30%, or about 40%, or about 50%, or at least about 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of the uridine residues are non-standard nucleotides selected from 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine.

[0088] In some embodiments, at least about 10% (e.g., 10%, or about 20%, or about 30%, or about 40%, or about 50%) of the guanosine residues are non-standard nucleotides, and the non-standard nucleotide is optionally 7-deazaguanosine. In some embodiments, the RNA contains about 50% or less 7-deazaguanosine in place of guanosine residues.

[0089] In some embodiments, the RNA does not contain non-standard nucleotides in place of adenosine residues.

[0090] It should be noted that alternative nomenclature systems exist for certain non-standard nucleotides, for example, in certain circumstances 5-methylpseudouridine can be referred to as "3-methylpseudouridine" or "N3-methylpseudouridine" or "1-methylpseudouridine" or "N1-methylpseudouridine".

[0091] A nucleotide containing the prefix "amino" can refer to any nucleotide that contains a nitrogen atom bound to an atom at a given position of the nucleotide, e.g., 5-aminocytidine can refer to 5-aminocytidine, 5-methylaminocytidine, and 5-nitrocytidine. Similarly, a nucleotide containing the prefix "methyl" can refer to any nucleotide that contains a carbon atom bound to an atom at a given position of the nucleotide, e.g., 5-methylcytidine can refer to 5-methylcytidine, 5-ethylcytidine, and 5-hydroxymethylcytidine, a nucleotide containing the prefix "thio" can refer to any nucleotide that contains a sulfur atom bound to an atom at a given position of the nucleotide, and a nucleotide containing the prefix "hydroxy" can refer to any nucleotide that contains an oxygen atom bound to an atom at a given position of the nucleotide, e.g., 5-hydroxyuridine can refer to 5-hydroxyuridine and a uridine having a methyl group bonded to an oxygen atom that is bonded to the atom at the 5C position of uridine.

[0092] Thus, certain embodiments relate to RNA comprising one or more non-standard nucleotides, where the RNA molecule comprises one or more nucleotides comprising one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. Other embodiments relate to therapeutic agents comprising one or more RNA molecules comprising one or more non-standard nucleotides, where the one or more RNA molecules comprising one or more non-standard nucleotides comprise one or more nucleotides comprising one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. In one embodiment, the therapeutic agent comprises a transfection reagent. In another embodiment, the transfection reagent comprises a cationic lipid, a liposome, or a micelle. In yet another embodiment, the liposome or micelle comprises folic acid, and the therapeutic composition has anti-cancer activity. In another embodiment, the one or more nucleotides are selected from the group consisting of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-aminopseudouridine, pseudoisocytidine, N4-methylcytidine, 2-thiocytidine, N4-methyl ... The cytidine may comprise at least one of the following: 5-azacytidine, 5-hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine, 5-methylpseudoisocytidine, 7-deazaadenosine, 7-deazaguanosine, 6-thioguanosine, and 6-thio-7-deazaguanosine.In another embodiment, the one or more nucleotides comprise at least one of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, and 5-aminopseudouridine, and at least one of pseudoisocytidine, N4-methylcytidine, 2-thiocytidine, 5-azacytidine, 5-hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine, and 5-methylpseudoisocytidine. In yet another embodiment, the one or more nucleotides are selected from the group consisting of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5-hydroxypseudouridine, and at least one of 5-methylpseudouridine, 5-aminopseudouridine, pseudoisocytidine, N4-methylcytidine, 2-thiocytidine, N4-methylcytidine, 5-aminocytidine, and at least one of 5-aminocytidine, ... In yet another embodiment, the one or more nucleotides include at least one of pseudouridine, 5-azacytidine, 5-hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine, and 5-methylpseudoisocytidine, and at least one of 7-deazaguanosine, 6-thioguanosine, 6-thio-7-deazaguanosine, and 5-methoxyuridine. In yet another embodiment, the one or more nucleotides further include pseudouridine or 4-thiouridine or 5-methyluridine or 5-aminouridine or 4-thiopseudouridine or 5-methylpseudouridine or 5-aminopseudouridine. In yet another embodiment, the one or more nucleotides further include 7-deazaadenosine.In another embodiment, the one or more nucleotides include pseudoisocytidine and 7-deazaguanosine and 4-thiouridine. In yet another embodiment, the one or more nucleotides include pseudoisocytidine or 7-deazaguanosine and 4-thiouridine. In yet another embodiment, the one or more nucleotides include 5-methyluridine, 5-methylcytidine, and 7-deazaguanosine. In a further embodiment, the one or more nucleotides include pseudouridine or 5-methylpseudouridine, 5-methylcytidine, and 7-deazaguanosine. In another embodiment, the one or more nucleotides include pseudoisocytidine, 7-deazaguanosine, and pseudouridine. In one embodiment, the RNA comprising one or more non-standard nucleotides is present in vivo.

[0093] Certain non-standard nucleotides can be incorporated into RNA molecules by RNA polymerases commonly used for in vitro transcription more efficiently than other non-standard nucleotides, due in part to the tendency of these non-standard nucleotides to participate in standard base-pairing and base-stacking interactions and to interact with RNA polymerases in a manner similar to the manner in which the corresponding standard nucleotides interact with RNA polymerases.As a result, certain nucleotide mixtures containing one or more non-standard nucleotides can be beneficial, in part because they can provide higher amounts of RNA from in vitro transcription reactions containing these nucleotide mixtures.Therefore, certain embodiments relate to nucleotide mixtures containing one or more nucleotides containing one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. For nucleotide mixtures, (the numbers before each nucleotide indicate the representative fraction of the non-canonical nucleotide triphosphate in an in vitro transcription reaction, e.g., pseudoisocytidine of 0.2 refers to a reaction containing adenosine-5′-triphosphate, guanosine-5′-triphosphate, uridine-5′-triphosphate, cytidine-5′-triphosphate, and pseudoisocytidine-5′-triphosphate, and pseudoisocytidine-5′-triphosphate is present in the reaction in an amount approximately equal to 0.2 times the total amount of pseudoisocytidine-5′-triphosphate + cytidine-5′-triphosphate present in the reaction, with the amount measured on either a molar or mass basis; (Two or more numbers before the dot indicate a representative fraction range) 1.0 pseudouridine, 0.1-0.8 2-thiouridine, 0.1-0.8 5-methyluridine, 0.2-1.0 5-hydroxyuridine, 0.2-1.0 5-methoxyuridine, 0.1-1.0 5-aminouridine, 0.1-1.0 4-thiouridine, 0.1-1.0 2-thiopseudouridine, 0.1-1.0 4-thiopseudouridine, 0.1-1.0 5-hydroxypseudouridine, 0.2-1 5-methylpseudouridine, 0.2-1 5-methoxypseudouridine, 0.1-1.0 5-aminopseudouridine, 0.2-1.0 2-thiocytidine, 0.1-0.8 pseudoisocytidine, 0.2-1.0 5-methylcytidine, 0.2-1.0 5-hydroxycytidine, 0.2-1.0 5-hydroxymethylcytidine, 0.2-1.0 5-methoxycytidine, 0.1-1.0 5-aminocytidine, 0.2-1.0 N4-methylcytidine, 0.2-1.0 5-methylpseudoisocytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 5-aminopseudoisocytidine, 0.2-1.0 N5-methylcytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 5-aminopseudoisocytidine, 0.2-1.0 N6-methylcytidine, 0.2-1.0 5-methylpseudoisocytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 5-aminopseudoisocytidine, 0.2-1.0 N7-methylcytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 5-aminopseudoisocytidine, 0.2-1.0 N8-methylcytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 N9-methylcytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 N1-methylcytidine, 0.2-1.0 5-hydroxypseudoisocytidine, 0.2-1.0 N2-aminopseudoisocytidine, 0.2-1.0 N3-methylcyt Examples of suitable azaguanosine include, but are not limited to, 0 N4-methylpseudoisocytidine, 0.2-1.0 2-thiopseudoisocytidine, 0.2-1.0 7-deazaguanosine, 0.2-1.0 6-thioguanosine, 0.2-1.0 6-thio-7-deazaguanosine, 0.2-1.0 8-azaguanosine, 0.2-1.0 7-deaza-8-azaguanosine, 0.2-1.0 6-thio-8-azaguanosine, 0.1-0.5 7-deazaadenosine, and 0.1-0.5 N6-methyladenosine.

[0094] In various embodiments, the RNA compositions or synthetic polynucleotide compositions (which may be prepared, for example, by in vitro transcription) that include one or more non-standard nucleotides contain substantially or completely standard nucleotides at positions that have adenine or "A" in the genetic code. The term "substantially" in this context refers to at least 90%. In these embodiments, In some embodiments, the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) 7-deazaguanosine and the corresponding standard nucleotide "G" at the "G" position of the genetic code, where the standard and non-standard nucleotides at the G position may be within a range of 5:1 to 1:5, or in some embodiments, within a range of 2:1 to 1:2. In these embodiments, the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) one or more (e.g., two, three, or four) of 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, and the standard nucleotide "C" at the "C" position of the genetic code, where the standard and non-standard nucleotides at the C position may be within a range of 5:1 to 1:5, or in some embodiments, within a range of 2:1 to 1:2. In some embodiments, the level of non-standard nucleotides at the "C" position is as described in the preceding paragraph. In these embodiments, the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) one or more (e.g., two, three, or four) of 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine at the "U" position of the genetic code, as well as the standard nucleotide "U", and the ratio of standard and non-standard nucleotides at the "U" position may be within a range of 5:1 to 1:5, or in some embodiments, within a range of 2:1 to 1:2. In some embodiments, the level of non-standard nucleotides at the "U" position is as described in the preceding paragraph.

[0095] It has now been discovered that combining certain non-standard nucleotides can be beneficial, in part because the non-standard nucleotides can provide an additional contribution that reduces the toxicity of the RNA molecule. Thus, certain embodiments relate to nucleotide mixtures in which the nucleotide mixture contains two or more of the non-standard nucleotides, such as, for example, the nucleotide mixture contains both pseudoisocytidine and 7-deazaguanosine, or the nucleotide mixture contains both N4-methylcytidine and 7-deazaguanosine. In one embodiment, the nucleotide mixture contains two or more of the non-standard nucleotides, each of the non-standard nucleotides being present in the mixture at the fraction. For example, the nucleotide mixture contains 0.1-0.8 pseudoisocytidine and 0.2-1.0 7-deazaguanosine, or the nucleotide mixture contains 0.2-1.0 N4-methylcytidine and 0.2-1.0 7-deazaguanosine, etc.

[0096] In certain circumstances, for example, when it is not necessary or desirable to maximize the yield of an in vitro transcription reaction, other nucleotide fractions may be used. The representative percentages and ranges of fractions above refer to nucleotide triphosphate solutions of normal purity (greater than 90% purity). Larger fractions of these and other nucleotides can be used by purifying the nucleotide triphosphate solution using existing chemical purification techniques, such as high pressure liquid chromatography (HPLC), or by using nucleotide triphosphate solutions of higher purity than can be achieved by other means, for example, greater than about 95% purity, or greater than about 98% purity, or greater than about 99% purity, or greater than about 99.5% purity. In one embodiment, nucleotides with multiple isomers are purified to enrich for the desired isomer.

[0097] Another embodiment is to produce a nucleotide sequence by contacting a cell with an RNA molecule that contains one or more non-standard nucleotides, including one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. In one embodiment, the present invention relates to a method for inducing a cell in vivo to express a protein of interest. Yet another embodiment relates to a method for transfecting, reprogramming, and / or gene editing a cell in vivo by contacting the cell with an RNA molecule containing one or more non-standard nucleotides, including one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. In one embodiment, the RNA molecule is produced by in vitro transcription. In one embodiment, the RNA molecule encodes one or more reprogramming factors. In another embodiment, the one or more reprogramming factors include an Oct4 protein. In another embodiment, the cell is further contacted with an RNA molecule encoding a Sox2 protein. In yet another embodiment, the cell is further contacted with an RNA molecule encoding a Klf4 protein. In yet another embodiment, the cell is further contacted with an RNA molecule encoding a c-Myc protein. In yet another embodiment, the cell is further contacted with an RNA molecule encoding a Lin28 protein.

[0098] Enzymes such as T7 RNA polymerase may preferentially incorporate standard nucleotides in in vitro transcription reactions that contain both standard and non-standard nucleotides. As a result, an in vitro transcription reaction that contains a particular fraction of non-standard nucleotides may yield RNA that contains a different, often lower, fraction of the non-standard nucleotide than the fraction of the non-standard nucleotides that were present in the reaction. Thus, in certain embodiments, reference to a fraction of nucleotide incorporation (e.g., "a synthetic RNA molecule that contains 50% pseudoisocytidine" or "0.1-0.8 pseudoisocytidine") can refer to both RNA molecules that contain the given fraction of nucleotides and RNA molecules synthesized in a reaction that contain a given fraction of nucleotides (or nucleotide derivatives, e.g., nucleotide-triphosphates), even though such a reaction may yield RNA that contains a different fraction of nucleotides than the fraction of the non-standard nucleotides that were present in the reaction.

[0099] Different nucleotide sequences can code for the same protein by utilizing alternative codons. Thus, in certain embodiments, reference to a nucleotide incorporation fraction can refer to both an RNA molecule that contains a given fraction of nucleotides, and an RNA molecule that encodes the same protein as a different RNA molecule, where the different RNA molecule contains a given fraction of nucleotides.

[0100] Certain embodiments relate to kits that contain one or more materials required to carry out the invention. In one embodiment, the kit contains one or more synthetic RNA molecules. In one embodiment, the kit contains one or more synthetic RNA molecules encoding one or more reprogramming factors and / or gene editing proteins. In another embodiment, the one or more synthetic RNA molecules contain one or more non-standard nucleotides containing one or more substitutions at positions 2C and / or 4C and / or 5C for pyrimidines, or at positions 6C and / or 7N and / or 8C for purines. In another embodiment, the kit contains one or more of a transfection medium, a transfection reagent, a complex formation medium, and a matrix solution. In one embodiment, the matrix solution contains fibronectin and / or vitronectin, or recombinant fibronectin and / or recombinant vitronectin. In one embodiment, one or more of the components of the kit are present as multiple aliquots. In one embodiment, the kit contains an aliquot of a nucleic acid transfection reagent complex. In another embodiment, the kit contains aliquots of nucleic acid transfection reagent complexes provided in solid form, e.g., as frozen or lyophilized pellets. In yet another embodiment, the kit includes aliquots of culture medium, each aliquot containing a transfection reagent-nucleic acid complex that is stabilized by either chemical treatment or freezing.

[0101] Transfection in general, and reprogramming in particular, can be difficult and time-consuming techniques that can be repetitive and prone to errors.However, these techniques are often performed manually due to the lack of automated transfection equipment.Therefore, certain embodiments relate to a system that can transfect, reprogram, and / or gene-edit cells in vivo in an automated or semi-automated manner.

[0102] It has now been discovered that non-standard nucleotide members of the 5-methylcytidine demethylation pathway, when incorporated into synthetic RNA, can increase the efficiency with which the synthetic RNA can be translated into protein in vivo and can reduce the toxicity of the synthetic RNA in vivo. These non-standard nucleotides include, for example, 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine (also known as "cytidine-5-carboxylic acid"). Accordingly, certain embodiments relate to nucleic acids. In some embodiments, the nucleic acid is present in vivo. In one embodiment, the nucleic acid is a synthetic RNA molecule. In another embodiment, the nucleic acid comprises one or more non-standard nucleotides. In one embodiment, the nucleic acid comprises one or more non-standard nucleotide members of the 5-methylcytidine demethylation pathway. In another embodiment, the nucleic acid comprises at least one of 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine or derivatives thereof. In further embodiments, the nucleic acid comprises at least one of pseudouridine, 5-methylpseudouridine, 5-hydroxyuridine, 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N4-acetylcytidine, and 7-deazaguanosine or a derivative thereof.

[0103] 5-Methylcytidine demethylation pathway [ka]

[0104] Certain embodiments relate to proteins. Other embodiments relate to nucleic acids encoding proteins. In one embodiment, the protein is a protein of interest. In another embodiment, the protein is selected from a reprogramming protein and a gene editing protein. In one embodiment, the nucleic acid is a plasmid. In another embodiment, the nucleic acid is present in a virus or in a viral vector. In a further embodiment, the virus or viral vector is replication incompetent. In yet another embodiment, the virus or viral vector is replication competent. In one embodiment, the virus or viral vector comprises at least one of an adenovirus, a retrovirus, a lentivirus, a herpesvirus, an adeno-associated virus, or naturally occurring or engineered variants thereof, and an engineered virus.

[0105] It has also been discovered that certain combinations of non-standard nucleotides may be particularly effective in increasing the efficiency with which synthetic RNA can be translated into proteins in vivo and in reducing the toxicity of synthetic RNA in vivo, such as 5-methyluridine and 5-methylcytidine, 5-hydroxyuridine and 5-methylcytidine, 5-hydroxyuridine and 5-hydroxymethylcytidine, 5-methyluridine and 7-deazaguanosine, 5-methylcytidine and 7-deazaguanosine, 5-methyluridine, 5-methylcytidine and 7-deazaguanosine, and 5-methyluridine, 5-hydroxymethylcytidine and 7-deazaguanosine. Thus, certain embodiments relate to nucleic acids comprising at least two of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine and 7-deazaguanosine, or one or more derivatives thereof. Other embodiments relate to nucleic acids that include at least three of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. Other embodiments relate to nucleic acids that include all of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. In one embodiment, the nucleic acid includes one or more 5-methyluridine residues, one or more 5-methylcytidine residues, and one or more 7-deazaguanosine residues, or one or more 5-methyluridine residues, one or more 5-hydroxymethylcytidine residues, and one or more 7-deazaguanosine residues.

[0106] It has further been discovered that synthetic RNA molecules containing certain fractions of certain non-standard nucleotides and combinations thereof may exhibit particularly high translation efficiency and low toxicity in vivo. Accordingly, certain embodiments relate to nucleic acids comprising at least one of one or more uridine residues, one or more cytidine residues, and one or more guanosine residues, and comprising one or more non-standard nucleotides. In one embodiment, about 20% to about 80% of the uridine residues are 5-methyluridine residues. In another embodiment, about 30% to about 50% of the uridine residues are 5-methyluridine residues. In a further embodiment, about 40% of the uridine residues are 5-methyluridine residues. In one embodiment, about 60% to about 80% of the cytidine residues are 5-methylcytidine residues. In another embodiment, about 80% to about 100% of the cytidine residues are 5-methylcytidine residues. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues. In yet another embodiment, about 20% to about 100% of the cytidine residues are 5-hydroxymethylcytidine residues. In one embodiment, about 20% to about 80% of the guanosine residues are 7-deazaguanosine residues. In another embodiment, about 40% to about 60% of the guanosine residues are 7-deazaguanosine residues. In a further embodiment, about 50% of the guanosine residues are 7-deazaguanosine residues. In one embodiment, about 20% to about 80%, or about 30% to about 60%, or about 40% of the cytidine residues are N4-methylcytidine and / or N4-acetylcytidine residues. In another embodiment, each cytidine residue is a 5-methylcytidine residue. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues and / or 5-hydroxymethylcytidine residues and / or N4-methylcytidine residues and / or N4-acetylcytidine residues and / or one or more derivatives thereof. In yet another embodiment, about 40% of the uridine residues are 5-methyluridine residues, about 20% to about 100% of the cytidine residues are N4-methylcytidine and / or N4-acetylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues.In one embodiment, about 40% of the uridine residues are 5-methyluridine residues and about 100% of the cytidine residues are 5-methylcytidine residues. In another embodiment, about 40% of the uridine residues are 5-methyluridine residues and about 50% of the guanosine residues are 7-deazaguanosine residues. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues and about 50% of the guanosine residues are 7-deazaguanosine residues. In a further embodiment, about 100% of the uridine residues are 5-hydroxyuridine residues. In one embodiment, about 40% of the uridine residues are 5-methyluridine residues, about 100% of the cytidine residues are 5-methylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. In another embodiment, about 40% of the uridine residues are 5-methyluridine residues, about 20% to about 100% of the cytidine residues are 5-hydroxymethylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. In some embodiments, less than 100% of the cytidine residues are 5-methylcytidine residues. In other embodiments, less than 100% of the cytidine residues are 5-hydroxymethylcytidine residues. In one embodiment, each uridine residue of the synthetic RNA molecule is a pseudouridine residue or a 5-methylpseudouridine residue. In another embodiment, about 100% of the uridine residues are pseudouridine and / or 5-methylpseudouridine residues, in a further embodiment, about 100% of the uridine residues are pseudouridine and / or 5-methylpseudouridine residues, about 100% of the cytidine residues are 5-methylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues.

[0107] Other non-standard nucleotides that can be used in place of or in combination with 5-methyluridine include, but are not limited to, pseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methoxyuridine, 5-methoxypseudouridine, 5-carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5-hydroxymethyluridine, 5-hydroxymethylpseudouridine, and 5-methylpseudouridine (also known as "1-methylpseudouridine," also known as "N1-methylpseudouridine"), or one or more derivatives thereof. Other non-standard nucleotides that can be used in place of or in combination with 5-methylcytidine and / or 5-hydroxymethylcytidine include, but are not limited to, pseudoisocytidine, 5-methylpseudoisocytidine, 5-hydroxymethylcytidine, 5-formylcytidine, 5-carboxycytidine, 5-methoxycytidine, N4-methylcytidine, N4-acetylcytidine, or one or more derivatives thereof. In certain embodiments, for example, when only a single transfection, injection, or delivery is performed, or when the cells, tissues, organs, or patients to be transfected, injected, or delivered are not particularly susceptible to transfection-related toxicity or innate immune signaling, the fraction of non-standard nucleotides can be reduced. Reducing the fraction of non-standard nucleotides can be beneficial, in part, because by reducing the fraction of non-standard nucleotides, the cost of the nucleic acid can be reduced. In certain situations, for example, when minimal immunogenicity of the nucleic acid is desired, the fraction of non-standard nucleotides can be increased.

[0108] Enzymes such as T7 RNA polymerase may preferentially incorporate standard nucleotides in in vitro transcription reactions that contain both standard and non-standard nucleotides. As a result, an in vitro transcription reaction that contains a certain fraction of non-standard nucleotides may yield RNA that contains a different, often lower, fraction of the non-standard nucleotide than the fraction of the non-standard nucleotide that was present in the reaction. Thus, in certain embodiments, reference to a nucleotide incorporation fraction (e.g., "50% 5-methyluridine") can refer to both the nucleic acid that contains the given fraction of nucleotides and the nucleic acid synthesized in the reaction that contains the given fraction of nucleotides (or nucleotide derivatives, e.g., nucleotide-triphosphates), even though such a reaction may yield a nucleic acid that contains a different fraction of nucleotides than the fraction of the non-standard nucleotide that was present in the reaction. In addition, different nucleotide sequences can encode the same protein by utilizing alternative codons. Thus, in certain embodiments, reference to a nucleotide incorporation fraction can refer to both the nucleic acid that contains the given fraction of nucleotides and the nucleic acid that is synthesized in the reaction that contains the given fraction of nucleotides. The term can refer to both a nucleic acid that encodes a given quality, and the different nucleic acids contain a given fraction of nucleotides.

[0109] Certain embodiments relate to nucleic acids comprising a 5' cap structure selected from cap 0, cap 1, cap 2, and cap 3, or derivatives thereof. In one embodiment, the nucleic acid comprises one or more UTRs. In another embodiment, the one or more UTRs increase the stability of the nucleic acid. In a further embodiment, the one or more UTRs comprise an alpha globin or beta globin 5' UTR. In yet another embodiment, the one or more UTRs comprise an alpha globin or beta globin 3' UTR. In yet another embodiment, the synthetic RNA molecule comprises an alpha globin or beta globin 5' UTR and an alpha globin or beta globin 3' UTR. In one embodiment, the 5' UTR comprises a Kozak sequence substantially similar to a Kozak consensus sequence. In another embodiment, the nucleic acid comprises a 3' poly(A) tail. In a further embodiment, the 3' poly(A) tail is about 20 nt to about 250 nt, or about 120 nt to about 150 nt in length. In further embodiments, the 3' poly(A) tail is about 20 nt, or about 30 nt, or about 40 nt, or about 50 nt, or about 60 nt, or about 70 nt, or about 80 nt, or about 90 nt, or about 100 nt, or about 110 nt, or about 120 nt, or about 130 nt, or about 140 nt, or about 150 nt, or about 160 nt, or about 170 nt, or about 180 nt, or about 190 nt, or about 200 nt, or about 210 nt, or about 220 nt, or about 230 nt, or about 240 nt, or about 250 nt in length.

[0110] Certain embodiments relate to methods for making nucleic acid drugs, such as RNA that contain one or more non-standard nucleotides, which generate substantially stable RNA.

[0111] In various embodiments, the methods and compositions find use in methods for treating, preventing, or ameliorating a disease, disorder, and / or condition. For example, in some embodiments, the described methods of in vivo delivery, including various effective doses, administration strategies, and formulations, are used in therapeutic methods.

[0112] In various embodiments, the present methods and compositions find use in methods for altering, modifying, and / or altering tissue (eg, cosmetically).

[0113] In various embodiments, the methods and compositions include using nucleic acid drugs, including synthetic RNA, to diagnose, treat, prevent, or ameliorate a disease, disorder, and / or condition described herein. In various embodiments, the methods and compositions include using nucleic acid drugs, including synthetic RNA, to alter, modify, and / or change tissue (e.g., cosmetically).

[0114] Generally speaking, in various embodiments, a synthetic RNA as described herein is administered to a human at a particular dose as described herein, and the synthetic RNA includes a sequence (sometimes referred to as a target sequence) that encodes a protein of interest, which may be a therapeutic protein.

[0115] Synthetic RNAs containing only standard nucleotides can bind to pattern recognition receptors, be recognized as pathogen-associated molecular patterns, and induce a strong immune response in cells that may result in translational block, secretion of inflammatory cytokines, and cell death. It has now been discovered that synthetic RNAs containing certain non-standard nucleotides can evade detection by the innate immune system and can be translated into proteins with high efficiency, for example, in humans. At least one of the non-standard nucleotides described herein, such as 5-methylcytidine, 5-hydroxycytidine, 5-hydroxymethyl ... It has further been discovered that synthetic RNAs comprising members of the group cytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-formyluridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-methoxypseudouridine, and 5-formylpseudouridine can avoid detection by the innate immune system and can be translated into proteins with high efficiency, for example, in humans. Accordingly, certain embodiments relate to methods for inducing cells to express a protein of interest, comprising contacting the cells with synthetic RNA. Other embodiments relate to methods for transfecting cells with synthetic RNA, comprising contacting the cells with a solution comprising one or more synthetic RNA molecules. Still other embodiments relate to methods for treating a patient, comprising administering synthetic RNA to the patient. In one embodiment, the synthetic RNA comprises at least one of the non-standard nucleotides described herein, such as a member of the group of 5-methylcytidine, 5-hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-formyluridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-methoxypseudouridine, and 5-formylpseudouridine. In another embodiment, the synthetic RNA encodes a protein of interest. Representative RNAs may contain combinations and levels of standard and non-standard nucleotides as described elsewhere herein, including those relating to the expression of any protein of interest described herein. In yet another embodiment, the method results in the expression of a protein of interest. In a further embodiment, the method results in the expression of a protein of interest in the skin of a patient.

[0116] Other embodiments relate to methods for delivering a nucleic acid to a cell in vivo. Still other embodiments relate to methods for inducing a cell in vivo to express a protein of interest. Still other embodiments relate to methods for treating a patient. In one embodiment, the method comprises disrupting the stratum corneum. In another embodiment, the method comprises contacting a cell with a nucleic acid. In yet another embodiment, the method results in a cell that internalizes the nucleic acid. In a further embodiment, the method results in a cell that expresses the protein of interest. In yet another embodiment, the method results in expression of the protein of interest in the patient. In yet another embodiment, the method results in amelioration of one or more of the patient's symptoms. In yet another embodiment, the patient is in need of the protein of interest. In yet another embodiment, the patient is deficient in the protein of interest.

[0117] Yet another embodiment relates to a method for treating a patient comprising delivering a composition to the patient. In one embodiment, the composition comprises albumin treated with an ion exchange resin or activated charcoal. In another embodiment, the composition comprises one or more nucleic acid molecules. In yet another embodiment, at least one of the one or more nucleic acid molecules encodes a protein of interest. In one embodiment, the method results in expression of a protein in the skin of the patient. In another embodiment, the method results in expression of a therapeutically or cosmetically effective amount of the protein of interest in the patient. In yet another embodiment, the method comprises administering a steroid. In a further embodiment, the steroid is a member of the group of hydrocortisone and dexamethasone.

[0118] Some embodiments relate to therapeutic compositions and / or methods comprising a nucleic acid molecule encoding one or more proteins, at least one of which is an extracellular matrix protein. Still other embodiments relate to a nucleic acid molecule encoding one or more proteins. In one aspect, the present invention relates to a cosmetic composition comprising a nucleic acid molecule comprising the one or more proteins, wherein at least one of the one or more proteins is an extracellular matrix protein.

[0119] Pigmentation disorders can cause severe symptoms in patients. It has now been discovered that pigmentation disorders can be treated by delivering a nucleic acid encoding tyrosinase to a patient. Accordingly, certain embodiments relate to methods for treating pigmentation disorders. Other embodiments relate to methods for altering pigmentation in a patient. In one embodiment, the method comprises delivering a nucleic acid encoding tyrosinase to a patient. Other embodiments relate to cosmetic compositions comprising a nucleic acid encoding tyrosinase. Still other embodiments relate to therapeutic compositions comprising a nucleic acid encoding tyrosinase. Still other embodiments relate to methods for increasing ultraviolet light absorption in a patient's skin. In one embodiment, the method comprises delivering a nucleic acid encoding tyrosinase to a patient. In another embodiment, the method results in an increase in ultraviolet light absorption in a patient's skin. Still other embodiments relate to methods for reducing photodamage of a human skin upon exposure to ultraviolet light. In one embodiment, the method results in a reduction in photodamage of a human skin upon exposure to ultraviolet light. Still other embodiments relate to methods for treating xeroderma pigmentosum. In one embodiment, the method comprises delivering a nucleic acid encoding tyrosinase to a patient. Still other embodiments relate to methods for treating epidermolysis bullosa. In one embodiment, the method comprises delivering to the patient a nucleic acid encoding one or more of keratin 5, keratin 14, plectin, integrin family members, laminin, laminin subunits, collagen XVII, collagen VII, or biologically active fragments, variants, analogs, or family members thereof. In one embodiment, the method comprises delivering to the patient a nucleic acid encoding collagen VII. In another embodiment, the method comprises delivering to the patient a nucleic acid encoding a melanocortin 1 receptor. Still other embodiments relate to methods for treating xerosis. In one embodiment, the method comprises delivering to the patient a nucleic acid encoding a hyaluronic acid synthase. In another embodiment, the patient has been diagnosed with atopic dermatitis. In yet another embodiment, the patient has been diagnosed with ichthyosis. Certain embodiments relate to methods for treating cosmetic conditions.Other embodiments relate to methods for inducing tissue healing. In one embodiment, the method comprises delivering a nucleic acid encoding a hyaluronic acid synthase to a patient. In another embodiment, the cosmetic condition is a member of the group of wrinkles, sagging skin, thin skin, discoloration, and dry skin. In yet another embodiment, the patient has undergone cataract surgery. In some embodiments, the nucleic acid is synthetic RNA. In other embodiments, the method results in the improvement of one or more of the patient's symptoms. Other embodiments relate to methods for treating an indication by delivering a nucleic acid encoding a protein or peptide to a cell or patient. Still other embodiments relate to compositions comprising a nucleic acid encoding a protein or peptide. Indications that can be treated using the methods and compositions of the invention, as well as proteins and peptides that can be encoded by the compositions of the invention, are set forth in Table 2A and / or Table 2B and are provided by way of example and not by way of limitation. In one embodiment, the indication is selected from Table 2A and / or Table 2B. In another embodiment, the protein or peptide is selected from Table 2A and / or Table 2B. In yet another embodiment, the indication and the protein or peptide are selected from the same row of Table 2A and / or Table 2B. In a further embodiment, the protein of interest is a member of the group UCP1, UCP2, and UCP3. Other embodiments relate to methods for inducing cells to express multiple proteins of interest. In one embodiment, the protein of interest comprises at least two members of the group of lipase, UCP1, UCP2, and UCP3. In another embodiment, the protein of interest comprises lipase and a member of the group of UCP1, UCP2, and UCP3. In another embodiment, the protein is a gene editing protein. In yet another embodiment, the gene editing protein targets a gene that is at least partially responsible for a disease phenotype. In yet another embodiment, the gene editing protein targets a gene that encodes a protein selected from Table 2A and / or Table 2B. Still another. In embodiments, the gene-editing protein corrects or deletes a mutation that is at least partially responsible for a disease phenotype, either alone or in combination with one or more other molecules or gene-editing proteins.

[0120] In various embodiments, the present invention contemplates precursor and / or mature forms and / or isoforms and / or mutants of any of the proteins disclosed in Table 2A and / or Table 2B, and targeting of such proteins. In some embodiments, any of the precursor and / or mature forms and / or isoforms and / or mutants have enhanced secretion compared to the corresponding wild-type protein. In some embodiments, any of the precursor and / or mature forms and / or isoforms and / or mutants have altered half-life (e.g., serum, plasma, intracellular) - e.g., longer or shorter half-life. In some embodiments, this is relative to the wild-type.

[0121] [Table 2A-1] [Table 2A-2] [Table 2A-3] [Table 2A-4] [Table 2A-5] [Table 2A-6] [Table 2A-7] [Table 2A-8]

[0122] Additional exemplary objects of the present invention include the cosmetic objects set forth in Table 6 of International Patent Publication No. WO2013 / 151671, the entire contents of which are incorporated herein by reference.

[0123] In various embodiments, the agents of the invention are used in methods for affecting the human integumentary system. The compositions and methods may be used to alter biological and / or physiological processes. For example, to reduce sagging skin, to increase skin thickness, to increase skin volume, to reduce the number, length and / or depth of wrinkles, to increase skin firmness, firmness, tone and / or elasticity, to increase skin hydration and ability to retain moisture, water flow and osmotic balance, to increase skin lipid levels, to increase extracellular matrix and / or adhesion and communication polypeptides, to increase skin energy production, utilization and conservation, to improve oxygen availability, to improve skin cell longevity, to improve skin cell immune defense, heat shock stress response, antioxidant defense capacity to neutralize free radicals and / or toxic defense, to improve UV protection and recovery, to improve skin cell communication and skin cell nerve stimulation communication, to improve cell cohesion / adhesion, to improve calcium mineral and other mineral metabolism, and to improve cell turnover. , may be used to improve the circadian rhythm of cells.

[0124] Furthermore, in some embodiments, the compositions may be used to treat, control, or prevent diseases, disorders, and / or conditions, and / or may alter, modify, or change the appearance of members of the integumentary system of a subject suffering from a disease, disorder, and / or condition, including, but not limited to, acne vulgaris, summer acne, acne confluent, cosmetic acne, acne fulminans, keloid nuchal acne, mechanical acne, drug-induced acne, miliary necrotizing acne, gangrenous acne, erythematous acne, actinic keratosis, acne vulgaris, summer acne, acne confluent, cosmetic acne, acne fulminans, keloid nuchal acne ... Acne, keloid acne nuchal, mechanical acne, drug-induced acne, miliary necrotizing acne, gangrenous acne, erythematous acne, acute urticaria, allergic contact dermatitis, alopecia areata, angioedema, tinea pedis, atopic dermatitis, autosensitization dermatitis, infantile acne, hair loss, blastomycosis, blackheads, birthmarks, and other skin pigmentation problems, pimples, bruises, insect bites and stings, burns, cellulitis, scrub mites, chloracne, cholinergic or stress urticaria, chronic urticaria, cold urticaria, confluent reticular papillomatosis, corns, cysts, pityriasis capitis, dermatitis herpetiformis, dermatographia, dyshidrotic eczema, diaper rash, Dry skin, dyshidrosis, ectodermal dysplasias such as hypohidrotic ectodermal dysplasia and X-linked hypohidrotic ectodermal dysplasia, eczema, epidermodysplasia verruciformis, erythema nodosum, exfoliative acne, exercise-induced anaphylaxis, folliculitis, excess sebum, folliculitis, ephelidonia, chilblains, tinea unguium, hair density, hair growth rate, haloacne, alopecia, miliaria rubra, hematoma, herpes simplex infections (e.g., non-genital), hidradenitis suppurativa, urticaria, hyperhidrosis, hyperpigmentation, hypohidrotic ectodermal dysplasia, hypopigmentation, impetigo, ingrowth of hair, heat urticaria, ingrown nails, childhood or neonatal acne, pruritus, irritant contact skin inflammation, jock itch, keloids, keratosis pilaris, lichen planus, lichen sclerosus, lupus miliaris disseminatus facialis, melasma, lentigines, molluscum contagiosum, nail growth rate, nail health, neurodermatitis, nummular eczema, occupational acne, oily acne, onychomycosis, physical urticaria, pilonidal cyst, pityriasis rosea, tinea versicolor, poison ivy, pomade acne, pseudofolliculitis barbae or nuchal acne keloid, psoriasis, psoriatic arthritis, pressure urticaria or delayed pressure urticaria, stings such as cuts and abrasions, rash, rare urticaria or water urticaria, rhinoplasty, ringworm, rosacea, Rothmund-Thomson syndrome, loose skin, scabies, scarring, seborrhea,These include, but are not limited to, seborrheic dermatitis, shingles, skin cancer, skin tags, solar urticaria, spider bites, stretch marks, sunburn, tar acne, tropical acne, thinning skin, verruca versicolor, transient acantholytic dermatosis, miliaria acne necrotica or miliary gangrenous acne, dull skin, varicose veins, venous eczema, vibratory angioedema, vitiligo, warts, Weber-Christian disease, wrinkles, X-linked hypohidrotic ectodermal dysplasia, xerotic eczema, yeast infections, as well as the general signs of aging.

[0125] In some embodiments, methods of treating, controlling, or preventing dry skin with the compositions are provided. In some embodiments, profilaggrin (a protein converted to filaggrin) is the protein of interest (e.g., when treating ichthyosis vulgaris).

[0126] In some embodiments, methods are provided for treating, controlling, or preventing any one of the various types of psoriasis (e.g., plaque psoriasis, guttate psoriasis, pustular psoriasis, inverse psoriasis, and erythrodermic psoriasis). In various embodiments, the protein of interest is any product of psoriasis susceptibility genes 1-9 (PSORSI-PSORS9).

[0127] Various embodiments relate to the treatment, control, or prevention of eczema (e.g., atopic dermatitis, nummular eczema, dyshidrotic eczema, seborrheic dermatitis, irritant contact dermatitis, allergic contact dermatitis, dyshidrosis, venous eczema, dermatitis herpetiformis, neurodermatitis, autosensitization dermatitis, and dry eczema), optionally targeting one or more of the following: filaggrin, three genetic variants associated with eczema, OVO-like 1 (OVOL1), actin-like 9 (ACTL9), and kinesin family member 3A (KIF3A), and the genes brain-derived neurotrophic factor (BDNF) and tachykinin, precursor 1 (TAC1).

[0128] Urticarial papules or urticaria, including, but not limited to, acute urticaria, chronic urticaria and angioedema, physical urticaria, pressure urticaria or delayed pressure urticaria, cholinergic or stress urticaria, cold urticaria, heat urticaria, solar urticaria, oligo or water urticaria, vibratory angioedema, exercise-induced anaphylaxis, and dermagraphia, may be treated with the present compositions, for example, by targeting PLCG-2.

[0129] Various embodiments relate to the treatment, control, or prevention of rosacea, including but not limited to erythematotelangiectatic rosacea, papulopustular rosacea, rhinophytic rosacea, and ocular rosacea. Optionally, cathelicidin antimicrobial peptide (CAMP) and / or kallikrein-related peptidase 5 (also known as corneal tryptic enzyme (SCTE)) are proteins of interest.

[0130] In some embodiments, the composition provides a method of treating, controlling, or preventing acne. For example, acne may include, but is not limited to, acneiform rash, summer acne, acne congenita, cosmetic acne, acne fulminans, acne keloids on the neck, mechanical acne, acne medicamentosa, acne miliaris gangrenosa, acne gangrenosa, acne erythematous, acne infantum, blackheads, acne chlorinosa, acne exfolia, acne halo, acne pediatrica or acne neonatalis, lupus miliaris disseminatus faciens, occupational acne, acne oili, acne pomade, acne tar, acne tropicalis, acne necrosis or acne miliaris gangrenosa, pseudofolliculitis barbae or acne keloids on the neck, and hidradenitis suppurativa. In these embodiments, the protein of interest may be one or more matrix metalloproteinases (MMPs), such as matrix metalloproteinase-1 (MMP-1 or interstitial collagenase), matrix metalloproteinase-9 (MMP-9), and matrix metalloproteinase-13 (MMP-13).

[0131] In a further embodiment, vitiligo is treated with the composition, for example, where the NLR family, pyrin domain-containing 1 gene (NALP1) gene is targeted.

[0132] In some embodiments, the compositions of the present invention find use in the treatment, control, or prevention of hypohidrotic ectodermal dysplasia (HED), for example, via the ectodysplasin A gene (EDA), receptor (EDAR), and receptor-associated death domain (EDARADD).

[0133] In some embodiments, the compositions find use in the treatment, control, or prevention of hair loss or thinning (e.g., male pattern baldness or androgenetic alopecia (AGA)), optionally wherein one or more of the following may be a protein of interest: androgen receptor (AR), ectodysplasin A2 receptor (EDA2R), and lysophosphatidic acid receptor 6 (P2RY5).

[0134] The compositions further find use in methods of treating, controlling, or preventing scars and stretch marks, for example, with collagen, ribosomal s6 kinase, secreted phosphoprotein 1 (also known as osteopontin), or transforming growth factor beta 3.

[0135] Additionally, epidermodysplasia verruciformis (also known as Lutz-Lewandowski epidermodysplasia) is a rare autosomal recessive genetic skin disorder that may be treated with the compositions of the invention, for example, by targeting the transmembrane channel-like 6 (EVER1) or transmembrane channel-like 8 (EVER2) genes.

[0136] In some embodiments, sagging, thinning, or wrinkled skin can be prevented by, for example, the use of collagen, elastin, fibroblast growth factor 7, TIMP metallopeptidase inhibitors, matrix metallopeptidases, superoxide dismutase, and other extracellular matrix proteins. The present compositions may treat, control, or prevent diseases by targeting one or more proteins of interest, such as proteins, proteases, and proteoglycans.

[0137] Further embodiments are used for example in tanning of the skin via melanocyte stimulating hormone and / or proopiomelanocortin.

[0138] In some embodiments, the composition may be used for wound treatment. In some embodiments, the method of treating, controlling, or preventing wounds with the composition may include additional steps, such as, but not limited to, debridement, sharp debridement (surgical removal of dead or infected tissue from the wound), to remove necrotic tissue, optionally including chemical debridement agents such as enzymes, cleansing the wound bed to facilitate wound healing and closure, and applying wound dressings (e.g., wound dressings containing hydrogels (e.g., AQUASORB, DUODERM), wound dressings containing hydrocolloids, to provide a moist, warm environment for the wound and to promote tissue repair and healing. dressings (e.g., AQUACEL, COMFEEL), foam-containing wound dressings (e.g., LYOFOAM, SPYROSORB), and alginate-containing wound dressings (e.g., ALGISITE, CURASORB), administration of growth factors, e.g., becaplermin, to stimulate cell division and proliferation and to promote wound healing, and (iv) soft tissue wound coverage (skin grafts may be required to obtain coverage of clean, non-healing wounds (e.g., autologous skin grafts, cadaveric skin grafts, bioengineered skin substitutes (e.g., APLIGRAF, DERMAGRAFT)).

[0139] In various embodiments, the nucleic acid drugs described herein can be used in a variety of cosmetic / plastic surgery procedures, including, but not limited to, skin grafts, and surgical procedures involving cosmetic or plastic surgery (e.g., facial plastic surgery procedures including, but not limited to, blepharoplasty, rhinoplasty, rhytidectomy, genioplasty, facial implants, otoplasty, hair transplants, cleft lip and cleft palate repair, and / or body plastic surgery procedures including, but not limited to, abdominoplasty, brachioplasty, thigh lift, breast reduction, breast augmentation, body contouring, liposuction, hand surgery).

[0140] In various embodiments, various cancers (e.g., colorectal, gallbladder, lung, pancreatic, and gastric cancers) are treated, controlled, or prevented with the compositions. In some embodiments, skin cancers are treated with the compositions. For example, the skin cancer is one or more of actinic keratosis, basal cell carcinoma, melanoma, Kaposi's sarcoma, and squamous cell carcinoma. In some embodiments, the compositions of the present invention are used as adjuvants to complete peripheral and deep margin assessments, Mohs surgery, radiation (e.g., external beam radiation therapy or brachytherapy), chemotherapy (including but not limited to, local chemotherapy with, e.g., imiquimod or 5-fluorouracil), and cryotherapy. The compositions further find use in treating various stages of cancer, including skin cancer (e.g., basal cell carcinoma (BCC), squamous cell carcinoma (SCC), and melanoma), such as stages of the American Joint Committee on Cancer (AJCC) TNM system (e.g., one or more of TX, T0, Tis, T1, T1a, T1b, T2, T2A, T2B, T3, T3a, T3b, T4, T4a, T4b, NX, N0, N1, N2, N3, M0, M1a, M1b, M1c) and / or staging systems (e.g., stage 0, stage IA, stage IB, stage IIA, stage IIB, stage IIC, stage IIIA, stage IIIB, stage IIIC, stage IV).

[0141] Representative cancers and / or tumors of the present invention include basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, cancer of the brain and central nervous system, breast cancer, peritoneal cancer, cervical cancer, choriocarcinoma, colorectal cancer, connective tissue cancer, cancer of the digestive system, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer (including gastrointestinal cancer), glioblastoma, and hepatoma. ic carcinoma, hepatocellular carcinoma, intraepithelial neoplasia, kidney or renal cancer, laryngeal cancer, leukemia, liver cancer, lung cancer (e.g., small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous cell carcinoma of the lung), melanoma, myeloma, neuroblastoma, oral cancer (lips, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, cancer of the respiratory system, salivary gland cancer, sarcoma, skin cancer, squamous cell carcinoma, and stomach cancer. cancer), testicular cancer, thyroid cancer, uterine or endometrial cancer, cancer of the urinary system, vulvar cancer, lymphomas including Hodgkin's lymphoma and non-Hodgkin's lymphoma, and B-cell lymphomas including low grade lymphoma / follicular non-Hodgkin's lymphoma (NHL), small lymphocytic (SL) NHL, intermediate grade / follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoma NHL, high grade small non-cleaved cell NHL, bulky mass disease NHL, These include, but are not limited to, mantle cell lymphoma, AIDS-related lymphoma, Waldenstrom's macroglobulinemia, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloblastic leukemia, as well as other carcinomas and sarcomas, as well as post-transplant lymphoproliferative disorder (PTLD), and abnormal blood vessel proliferation associated with phacomatosis, edema (such as that associated with brain tumors), and Meigs' syndrome.

[0142] In various embodiments, one or more rare diseases are treated, controlled, or prevented with the compositions, examples of which include erythropoietic protoporphyria, Hailey-Hailey disease, epidermolysis bullosa (EB), xeroderma pigmentosum, Ehlers-Danlos syndrome, cutis laxa, protein C & protein S deficiency, Alport syndrome, striated palmoplantar keratoderma, lethal acantholytic EB, pseudoxanthoma elasticum (PXE), ichthyosis vulgaris, pemphigus vulgaris, and basal cell nevus syndrome.

[0143] In various embodiments, the compositions are used to treat, control, or prevent one or more inflammatory diseases or conditions, such as inflammation, acute inflammation, chronic inflammation, respiratory diseases, atherosclerosis, restenosis, asthma, allergic rhinitis, atopic dermatitis, septic shock, rheumatoid arthritis, inflammatory bowel disease, inflammatory pelvic disease, pain, ocular inflammatory diseases, celiac disease, Leigh's syndrome, glycerol kinase deficiency, familial eosinophilia (FE), autosomal recessive spastic ataxia, laryngeal inflammatory diseases, and tuberculosis, chronic cholecystitis, bronchiectasis, silicosis, and other pneumoconiosis diseases.

[0144] In various embodiments, the compositions are used to treat, control, or prevent one or more autoimmune diseases or conditions, such as multiple sclerosis, diabetes, lupus, celiac disease, Crohn's disease, ulcerative colitis, Guillain-Barré syndrome, scleroderma, Goodpasture's syndrome, Wegener's granulomatosis, autoimmune epilepsy, Rasmussen's encephalitis, primary biliary sclerosis, sclerosing cholangitis, autoimmune hepatitis, Addison's disease, Hashimoto's thyroiditis, fibromyalgia, Meniere's syndrome, transplant rejection (e.g., prevention of allograft reactions), pernicious anemia, rheumatoid arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's syndrome, lupus erythematosus, multiple sclerosis, myasthenia gravis, Reiter's syndrome, Graves' disease, and other autoimmune diseases.

[0145] In various embodiments, the composition is a therapeutic agent for ADHD, AIDS-neurological complications, septum pellucidum defect, acquired epileptiform aphasia, acute disseminated encephalomyelitis, adrenoleukodystrophy, agenesis of the corpus callosum, agnosia, Aicardi syndrome, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis, anencephaly, aneurysm, Angelman syndrome, hemangiomatosis, anoxia, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, aspartame, Asperger's syndrome, ataxia-telangiectasia, ataxia, attention deficit hyperactivity disorder, autism, autonomic dysfunction, back pain, Barth syndrome, Batten disease, Behcet's disease, Bell's palsy, benign idiopathic blepharospasm, benign focal muscular atrophy, benign intracranial hypertension , Bernhard-Roth syndrome, Binswanger's disease, Blepharospasm, Bloch-Sulzberger syndrome, Brachial plexus birth trauma, Brachial plexus trauma, Bradburr-Eggleston syndrome, Cerebral aneurysm, Brain injury, Brain and spinal tumor, Brown-Séquard syndrome, Spinal-bulbar muscular atrophy, Canavan disease, Carpal tunnel syndrome, Burning pain, Cavernoma, Cavernous hemangioma, Cavernous malformation, Central cervical spinal cord syndrome, Central spinal cord syndrome, Central pain syndrome, Head injury, Cerebellar degeneration, Cerebellar hypoplasia, Cerebral aneurysm, Cerebral arteriosclerosis, Cerebral atrophy, Cerebral beriberi, Cerebral gigantism, Cerebral hypoxia, Cerebral palsy, COFS (brain, eye, face, skeleton) syndrome group, Charcot-Marie-Tooth disease, Chiari malformation, chorea, chorea acanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne syndrome type II, Coffin-Lowry syndrome, coma including delayed vegetative state, complex regional pain syndrome, congenital bilateral facial palsy, congenital myopathies, congenital myopathies, congenital vascular cavernous malformations, corticobasal degeneration, cranial arteritis, craniosynostosis, Crozfeldt-Jakob disease, cumulative trauma disease, Cushing's syndrome, cytomegalic inclusion body disease (CIBD), cytomegalovirus infection, dancing eyes-dance Foot syndrome, Dandy-Walker syndrome, Dawson's disease, De Morcier syndrome, Degelin-Krummpke palsy, Multi-infarct dementia, Subcortical dementia, Lewy body dementia, Dermatomyositis, Developmental behavioral disorder, Devic's syndrome, Diabetic neuropathy, Diffuse sclerosis, Dravet syndrome, Autonomic neuropathy, Dysgraphia, Dyslexia, Dysphagia, Behavioral disorder, Ataxia, Early infantile epileptic encephalopathy, Empty sella syndrome, Encephalitis lethargica, Encephalitis and meningitis, Brain herniation, Encephalopathy, Cerebral trigeminal region angiomatosis, Epilepsy, Erb's palsy, Erb's-Duchenne and Degelin-Krummpke palsy, Fab Leigh's disease, Fahr's syndrome, syncope, familial dysautonomia, familial hemangioma, familial idiopathic basal ganglia calcification, familial spastic paralysis, febrile seizures (e.g., GEFS and GEFS+), Fisher's syndrome, floppy infant syndrome, Friedreich's ataxia, Gaucher's disease, Gerstmann's syndrome, Gerstmann-Sträussler-Scheinker disease, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, Guillain-Barré syndrome, HTLV-1 associated myelopathy, Hallervorden-Spatz disease, head injury, headache, persistent unilateral headache, hemifacial spasm,Alternating hemiplegia, hereditary neuropathy, hereditary spastic paraplegia, hereditary polyneuropathic ataxia, herpes zoster oticus, herpes zoster, Hirayama syndrome, holoprosencephaly, Huntington's disease, internal hydrocephalus, normal pressure hydrocephalus, hydrocephalus, hydromyelia, hyperadrenocorticism, hypersomnia, hypertonia, hypotension, hypoxia, immune-mediated encephalomyelopathy, inclusion body myositis, incontinentia pigmenti, pediatric hypotonia, pediatric phytanic acid storage disease, pediatric Refsum's disease, infantile spasms, inflammatory myopathy, intestinal lipodystrophy, intracranial cyst, increased intracranial pressure, Isaac's syndrome, Joubert syndrome, Kearns-Sayre syndrome, Kennedy's disease, Kinsbone's disease syndrome, Kleine-Lewin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüver-Bucy syndrome, Korsakoff amnesic syndrome, Krabbe disease, Kugelberg-Welander disease, kuru, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral myelopathy syndrome, learning disability, Leigh syndrome, Lennox-Gastaut syndrome, Lesch-Nyhan syndrome, cerebral leukodystrophy, Levine-Critchley syndrome, Lewy body dementia, gyri, locked-in syndrome, Lou Gehrig's disease, lupus Neurological sequelae, Lyme disease - neurological complications, Machado-Joseph disease, myelopathy, megacephaly, Melkerson-Rosenthal syndrome, meningitis, Menkes disease, dysesthesias femoral neuralgia, metachromatic leukodystrophy, microcephaly, migraine, Miller-Fisher syndrome, minor stroke, mitochondrial myopathy, Moebius syndrome, monolimbic muscular atrophy, motor neuron disease, Moyamoya disease, mucolipidosis, mucopolysaccharidoses, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy with orthostatic hypotension, multiple system atrophy, muscular dystrophy, congenital myasthenia, myasthenia gravis, diffuse myelinating malformation Cancerous sclerosis, myoclonic encephalopathy in childhood, myoclonus, congenital myopathy, thyrotoxic myopathy, myopathy, congenital myotonia, myotonia, narcolepsy, neuroacanthocytosis, neurodegeneration due to accumulation of iron in the brain, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological manifestations of Pompe disease, neuromyelitis optica, neuromyotonia, neurological ceroid-lipofuscinosis, neuronal migration disorder, hereditary neuropathies, neurosarcoidosis, neurotoxicity, cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, occipital neuralgia, secondary to occult spinal malunion,Otawara disease, syndrome, olivopontocerebellar atrophy, opsoclonus-myoclonus, orthostatic hypotension, overuse syndrome, chronic pain, paraneoplastic syndrome, sensory disorder, Parkinson's disease, congenital myotonia, paroxysmal choreoathetosis, paroxysmal hemicrania, Parry-Romberg disease, Pelizaeus-Merzbacher disease, Pena-Shocker type II syndrome, perineural cyst, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorder, phytanic acid storage disease, Pick's disease, piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, porencephaly, post-polio syndrome, post-herpetic neuropathies Pain, Post-infectious encephalomyelitis, Orthostatic hypotension, Postural orthostatic tachycardia syndrome, Postural orthostatic tachycardia syndrome, Primary lateral sclerosis, Prion diseases, Progressive facial hemiatrophy, Progressive tabes dorsalis, Progressive multifocal leukoencephalopathy, Progressive sclerosing gray matter dystrophy, Progressive supranuclear palsy, Pseudotumor cerebri, Pyridoxine-dependent and pyridoxine-responsive seizure disorder, Ramsay Hunt syndrome type I, Ramsay Hunt syndrome type II, Rasmussen's encephalitis and other autoimmune epilepsies, Reflex sympathetic dystrophy syndromes, Refsum's disease in childhood, Refsum's disease, Repetitive movement disorder, Repetitive strain injury, Restless legs syndrome, Refsum's disease, Rovirus-associated myelopathy, Rett syndrome, Reye syndrome, Riley-Day syndrome, SUNCT headache, sacral radicular cyst, chorea, salivary gland disease, Sandhoff disease, Schilder's disease, schizencephaly, seizure disorder, septo-optic dysplasia, severe myoclonic epilepsy of childhood (SMEI), shaken baby syndrome, shingles, Shy-Drager syndrome, Sjogren's syndrome, sleep apnea, encephalitis lethargica, Sotos syndrome, spasticity, spina bifida, spinal cord infarction, spinal cord injury, spinal cord tumor, spinal muscular atrophy, spinocerebellar atrophy, Steele-Richardson-Olszewski syndrome, stiff-headed syndrome, striatal nigra Stroke, Sturge-Weber syndrome, Subacute sclerosing panencephalitis, Subcortical arteriosclerotic encephalopathy, Dysphagia, Sydenham chorea, Syncope, Syphilitic spinal sclerosis, Hydromyelia, Syringomyelia, Systemic lupus erythematosus, Tabes dorsalis, Tardive dyskinesia, Tarlov cyst, Tay-Sachs disease, Temporal arteritis, Tethered spinal cord syndrome, Thomsen's disease, Thoracic outlet syndrome, Thyrotoxic myopathy, Painful tics, Todd's palsy, Tourette's syndrome, Transient ischemic attacks, Transmissible spongiform encephalopathy, Transverse myelitis, Traumatic brain injury, Tremor, Trigeminal neuralgia, Tropical spastic paraparesis, Tuberous sclerosis, Vascular ectatic tumor,It is used to treat, control, or prevent one or more neurological disorders, including vasculitis, including temporal arteritis, von Echonomo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Werdnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, Whipple disease, Williams syndrome, Wilson disease, X-linked spinal and bulbar muscular atrophy, and Zellweger syndrome.

[0146] In various embodiments, the compositions are used to treat one or more respiratory diseases, such as asthma, chronic obstructive pulmonary disease (COPD), bronchiectasis, allergic rhinitis, sinusitis, pulmonary vasoconstriction, inflammation, allergies, respiratory disorders, respiratory distress syndrome, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, Hantavirus pulmonary syndrome (HPS), Loeffler's syndrome, Goodpasture's syndrome, pleurisy, pneumonia, pulmonary edema, pulmonary fibrosis, sarcoidosis, complications associated with respiratory syncytial virus infection, and other respiratory diseases.

[0147] In various embodiments, the compositions are used to treat, control, or prevent cardiovascular diseases, such as diseases or conditions affecting the heart and vascular system, including, but not limited to, coronary heart disease (CHD), cerebrovascular disease (CVD), aortic stenosis, peripheral vascular disease, atherosclerosis, arteriosclerosis, myocardial infarction (heart attack), cerebrovascular disease (stroke), transient ischemic attack (TIA), angina (stable and unstable), atrial fibrillation, arrhythmias, valvular disease, and / or congestive heart failure.

[0148] In various embodiments, the compositions are used to treat, control, or prevent one or more metabolic-related disorders. In various embodiments, the present invention is useful for treating, controlling, or preventing diabetes, including type 1 and type 2 diabetes, and diabetes associated with obesity. The compositions and methods of the present invention are useful for treating, controlling, or preventing diabetic nephropathy, hyperglycemia, impaired glucose tolerance, insulin resistance, obesity, lipid disorders, dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, hypo-HD, and other conditions. The compositions and methods of the present invention are useful for treating or preventing diabetes-related disorders, including, but not limited to, obesity and obesity-related disorders, including, but not limited to, obesity and obesity-related disorders, including, but not limited to, hypercalcaemia, hypertriglyceridemia, low HDL cholesterol, high blood pressure, and high fasting plasma glucose, and other disorders in which insulin resistance is a component, such as sleep apnea. The compositions and methods of the present invention are useful for treating, controlling, or preventing obesity and obesity-related disorders, including, but not limited to, genetic or environmental. The obesity-related disorders herein are associated with, caused by, or result from obesity. Examples of obesity-related disorders include obesity, diabetes, overeating, binge eating, and hyperphagia, hypertension, elevated plasma insulin concentration, and insulin resistance, dyslipidemia, hyperlipidemia, endometrial, breast, prostate, kidney, and colon cancer, osteoarthritis, obstructive sleep apnea, gallstones, heart disease, heart rhythm abnormalities, and arrhythmias, myocardial infarction, congestive heart failure, coronary heart disease, sudden death, stroke, polycystic ovarian disease, craniopharyngioma, Prader-Willi syndrome, Frohlich syndrome, GH-deficient subjects, normal variant dwarfism, Turner syndrome, and other pathological conditions that show reduced metabolic activity or reduced resting energy expenditure as a percentage of total lean body mass, for example, in children with acute lymphoblastic leukemia.Further examples of obesity-related disorders are metabolic syndrome, insulin resistance syndrome, reproductive hormone abnormalities, sexual and reproductive dysfunctions, such as reproductive disorders, infertility, male hypogonadism, and female hirsutism, fetal defects associated with maternal obesity, gastrointestinal motility disorders, such as obesity-associated gastroesophageal reflux, respiratory disorders, such as obesity hypoventilation syndrome (Pickwickian syndrome), shortness of breath, cardiovascular disorders, inflammation, such as systemic vasculitis, arteriosclerosis, hypercholesterolemia, lower back pain, gallbladder disease, hyperuricemia, gout, and kidney cancer, and increased risk of anesthesia. The compositions and methods of the present invention are also useful for treating Alzheimer's disease.

[0149] Nucleic acids, such as liposomal formulations containing nucleic acids, may accumulate in the liver and / or spleen when delivered in vivo. It has now been discovered that nucleic acids encoding proteins can regulate protein expression in the liver and spleen, and that nucleic acids used in this manner can constitute a powerful therapeutic agent for treating liver and spleen diseases. Accordingly, certain embodiments relate to methods for treating liver and / or spleen diseases by delivering a nucleic acid encoding a protein of interest to a patient. Other embodiments relate to therapeutic compositions comprising a nucleic acid encoding a protein of interest for treating liver and / or spleen diseases. Liver and / or spleen diseases and conditions that can be treated include, but are not limited to, hepatitis, alcohol-induced liver disease, drug-induced liver disease, Epstein-Barr virus infection, adenovirus infection, cytomegalovirus infection, toxoplasmosis, Rocky Mountain spotted fever, non-alcoholic fatty liver disease, hemochromatosis, Wilson's disease, Gilbert's disease, and liver and / or spleen cancer.

[0150] In some embodiments, the compositions and methods of the invention relate to the treatment of type 1 diabetes, cardiovascular disease including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophies, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV / AIDS.

[0151] Additionally, in some embodiments, the methods and compositions find use in targeting any of the proteins in Table 2B or treating any of the diseases or disorders in Table 2B. In various embodiments, the present invention provides full-length and / or fragments of any of the proteins disclosed in Table 2B. or truncated forms. In various embodiments, the present invention contemplates targeting of precursor and / or mature forms and / or isoforms of any of the proteins disclosed in Table 2B.

[0152] In various embodiments, the invention provides a method for the preparation of a protein sequence that is about 60% (e.g., about 60%, or about 61%, or about 62%, or about 63%, or about 64%, or about 65%, or about 66%, or about 67%, or about 68%, or about 69%, or about 70%, or about 71%, or about 72%, or about 73%, or about 74%, or about 75%, or about 76%, or about 77%, or about 78%, or about 79%, or about 80%, or about 81%, or about 82%, or about 83%, or about 84%, or about 85%, or about 86%, or about 87%, or about 88%, or about 89%, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 100%, or about 101%, or about 102%, or about 103%, or about 104%, or about 105%, or about 106%, or about 107%, or about 108%, or about 109%, or about 110%, or about 111%, or about 112%, or about 113%, or about 114%, or about 115%, or about 116%, or about 117%, or about 118%, or about 119%, or about 120%, or about 121%, or about 122%, or about 123%, or about 124%, or about 125%, or about 126%, or about 127%, or about 128%, or about 129%, or about 130%, or about 131%, or about 132, or about 133, or about 13 or about 78%, or about 79%, or about 80%, or about 81%, or about 82%, or about 83%, or about 84%, or about 85%, or about 86%, or about 87%, or about 88%, or about 89%, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% sequence identity to the polypeptide.

[0153] In various embodiments, the present invention contemplates targeting of proteins comprising an amino acid sequence having one or more amino acid mutations relative to any of the protein sequences disclosed herein (e.g., in Table 2B). For example, the present invention contemplates targeting of proteins comprising an amino acid sequence having 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12 amino acid mutations relative to any of the protein sequences disclosed herein (e.g., in Table 2B). In some embodiments, the one or more amino acid mutations may be independently selected from substitutions, insertions, deletions, and truncations.

[0154] In some embodiments, the amino acid mutations are amino acid substitutions, which may include conservative and / or non-conservative substitutions.

[0155] "Conservative substitutions" may be made, for example, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the amino acid residues involved. The 20 naturally occurring amino acids can be classified into six standard amino acid groups: (1) hydrophobic: Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that affect chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe.

[0156] As used herein, "conservative substitution" is defined as the replacement of an amino acid with another amino acid described in the same group of the six standard amino acid groups shown above. For example, replacing Asp with Glu retains one negative charge in the so modified polypeptide. In addition, glycine and proline may be substituted for each other based on their ability to disrupt α-helices.

[0157] As used herein, a "non-conservative substitution" is defined as the replacement of an amino acid with another amino acid that is listed in a different group of the six standard amino acid groups (1) to (6) shown above.

[0158] In various embodiments, substitutions are made with non-classical amino acids (e.g., generally, selenocysteine, pyrrolidine, N-formylmethionine, β-alanine, GABA, and δ-aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of the common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, , ornithine, norleucine, norvaline, hydroxyproline, sarcosme, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoroamino acids, designer amino acids such as β-methyl amino acids, C-α-methyl amino acids, N-α-methyl amino acids, and amino acid analogs.

[0159] In Table 2B, all representative identifiers (eg, gene SEQ ID NOs and references are incorporated herein by reference in their entirety). [Table 2B-1] [Table 2B-2] [Table 2B-3] [Table 2B-4] [Table 2B-5] [Table 2B-6] [Table 2B-7]

Table 2B-8

Table 2B-9

Table 2B-10

Table 2B-11

Table 2B-12

Table 2B-13

Table 2B-14

Table 2B-15

Table 2B-16

Table 2B-17

Table 2B-18

Table 2B-19

Table 2B-20

Table 2B-21

Table 2B-22

Table 2B-23

Table 2B-24

Table 2B-25

Table 2B-26

Table 2B-27

Table 2B-28

Table 2B-29

Table 2B-30

Table 2B-31

Table 2B-32

Table 2B-33

Table 2B-34

Table 2B-35

Table 2B-36

Table 2B-37

Table 2B-38

Table 2B-39

Table 2B-40

Table 2B-41

Table 2B-42

Table 2B-43

Table 2B-44

Table 2B-45

Table 2B-46

Table 2B-47

Table 2B-48

Table 2B-49

Table 2B-50

Table 2B-51

Table 2B-52

Table 2B-53

Table 2B-54

Table 2B-55

Table 2B-56

Table 2B-57

Table 2B-58

Table 2B-59

Table 2B-60

Table 2B-61

Table 2B-62

Table 2B-63

Table 2B-64

Table 2B-65

Table 2B-66

Table 2B-67

Table 2B-68

Table 2B-69

Table 2B-70

Table 2B-71

Table 2B-72

Table 2B-73

Table 2B-74

Table 2B-75

Table 2B-76

Table 2B-77

Table 2B-78

Table 2B-79

Table 2B-80

Table 2B-81

Table 2B-82

Table 2B-83

Table 2B-84

Table 2B-85

Table 2B-86

Table 2B-87

Table 2B-88

Table 2B-89

Table 2B-90

Table 2B-91

Table 2B-92

Table 2B-93

Table 2B-94

Table 2B-95

Table 2B-96

Table 2B-97

Table 2B-98

Table 2B-99

Table 2B-100

Table 2B-101

Table 2B-102

Table 2B-103

Table 2B-104

Table 2B-105

Table 2B-106

Table 2B-107

Table 2B-108

Table 2B-109

Table 2B-110

Table 2B-111

Table 2B-112

Table 2B-113

Table 2B-114

Table 2B-115

Table 2B-116

Table 2B-117

Table 2B-118

Table 2B-119

Table 2B-120

Table 2B-121

Table 2B-122

Table 2B-123

Table 2B-124

Table 2B-125

Table 2B-126

Table 2B-127

Table 2B-128

Table 2B-129

Table 2B-130

Table 2B-131

Table 2B-132

Table 2B-133

Table 2B-134

Table 2B-135

Table 2B-136

Table 2B-137

Table 2B-138

Table 2B-139

[0160] In various embodiments, the nucleic acid drug, e.g., synthetic RNA, is administered in a manner that has an effect on one or more of the keratinocytes and fibroblasts (e.g., causing these cells to express one or more therapeutic proteins). For example, the method allows for a method of using a patient's cells to produce a therapeutic protein, and the levels of such protein are modulated by administration of the synthetic RNA.

[0161] In certain embodiments, the synthetic RNA targets soluble proteins. In some embodiments, the synthetic RNA targets one or more of the following families of proteins: transforming growth factor (TGF) beta, bone morphogenetic proteins (BMPs), fibroblast growth factors (FGFs), vascular endothelial growth factors (VEGFs), and interleukins. The terms "family," "superfamily," and "subfamily" can be used interchangeably.

[0162] In certain embodiments, the synthetic RNA targets a member of the TGF-β family. The TGF-β superfamily proteins include cytokines characterized by six conserved cysteine ​​residues (Lander et al., (2001) Nature, 409:860-921). The human genome contains at least about 42 open reading frames encoding TGF-β superfamily proteins. The TGF-β superfamily proteins are classified at least into the BMP subfamily and the TGF-β subfamily based on sequence similarity and the specific signaling pathways that they activate. In various embodiments, the synthetic RNA targets one or more of TGF (e.g., TGF-β1, TGF-β2, and TGF-β3), activin (e.g., activin A), and inhibin, macrophage inhibitory cytokine-1 (MIC-1), Müllerian inhibiting substance, anti-Müllerian hormone, and glial cell line-derived neurotrophic factor (GDNF).

[0163] The TGF-β superfamily comprises a subset of the cysteine ​​knot cytokine superfamily. Additional members of the cysteine ​​knot cytokine superfamily include, but are not limited to, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), placenta growth factor (P1GF), noggin, neurotrophins (BDNF, NT3, NT4, and βNGF), gonadotropins, follitropin, lutropin, interleukin-17, and coagulogens. Proteins of this family are also among the targets encompassed by the present invention.

[0164] In various embodiments, the present invention relates to targeting TGFβ family members to treat or prevent various immunological disorders, cancer, bronchial asthma, pulmonary fibrosis, heart disease, diabetes, hereditary hemorrhagic telangiectasia, Marfan syndrome, vascular Ehlers-Danlos syndrome, Loeys-Dietz syndrome, Parkinson's disease, chronic kidney disease, multiple sclerosis, and AIDS.

[0165] In certain embodiments, the synthetic RNA targets a member of the BMP family, including but not limited to BMP-2, BMP-3 (osteogenin), BMP-3b (GDF-10), BMP-4 (BMP-2b), BMP-5, BMP-6, BMP-7 (bone morphogenetic protein-1 or OP-1), BMP-8 (OP-2), BMP-8B (OP-3), BMP-9 (GDF-2), BMP-10, BMP-11 (GDF-11), BMP-12 (GDF-7), BMP-13 (GDF-6, CDMP-2), BMP-15 (GDF-9), BMP-16, GDF-1, GDF-3, GDF-5 (CDMP-1), and GDF-8 (myostatin). In various embodiments, the synthetic RNA targets one or more of BMP-2, BMP-3 (osteogenin), BMP-3b (GDF-10), BMP-4 (BMP-2b), BMP-5, BMP-6, BMP-7 (bone morphogenetic protein-1 or OP-1), BMP-8 (OP-2), BMP-8B (OP-3), BMP-9 (GDF-2), BMP-10, BMP-11 (GDF-11), BMP-12 (GDF-7), BMP-13 (GDF-6, CDMP-2), BMP-15 (GDF-9), BMP-16, GDF-1, GDF-3, GDF-5 (CDMP-1), and GDF-8 (myostatin). BMPs are also sometimes referred to as bone morphogenetic proteins (OPs), growth differentiation factors (GDFs), or cartilage-derived morphogenetic proteins (CDMPs). In certain embodiments, the synthetic RNA targets one or more BMP fusions (e.g., as described in U.S. Patent Publication No. 2009 / 0202638, the entire contents of which are incorporated herein by reference) and / or one or more BMP mutants (e.g., as described in U.S. Patent Publication No. 2011 / 0039773, the entire contents of which are incorporated herein by reference).

[0166] In various embodiments, the present invention relates to targeting BMP family members for regenerative medicine or metabolic applications, including but not limited to orthopedic applications such as spinal fusion, non-union, and oral surgery, metabolic disease, pre-diabetes, diabetes, thermogenesis, insulin sensitivity, insulin resistance, and adipogenesis, including brown fat adipogenesis. Various other metabolic applications are described elsewhere herein. In various embodiments, the present invention relates to targeting BMP family members, such as BMP-7, to treat chronic kidney disease (CKD) and / or reverse glomerular loss due to sclerosis.

[0167] In various embodiments, the present invention relates to targeting BMP family members to induce bone and cartilage growth in various locations of the body. For example, repair of joints such as knees, elbows, ankles, and knuckles is also contemplated by the present invention. For example, targeting BMP family members can result in cartilage regeneration in patients suffering from arthritis or other cartilage degenerative diseases. Furthermore, the present invention relates to treating cartilage tears due to injury. In addition, the present invention is useful for inducing bone growth in patients, for example, but not limited to, for use in treating patients suffering from fractures or bone fractures, osteoporosis, or patients in need of spinal fusion or repair of spine, vertebrae, etc.

[0168] In various embodiments, the present invention relates to targeting BMP family members to induce the developmental cascade of bone morphogenesis and tissue morphogenesis in various tissues in mammals distinct from bone or osteochondral. This morphogenic activity includes the ability to induce proliferation and differentiation of precursor cells, and to support and maintain the differentiated phenotype through the progression of events that result in the formation of bone, cartilage, non-mineralized skeletal or connective tissue, and other adult tissues.

[0169] For example, the present invention may be used in the treatment of preventing bone loss and / or increase in metabolic bone disease. A general method of treatment of preventing bone loss and / or increasing bone mass in metabolic bone disease using bone morphogenetic proteins is disclosed in U.S. Pat. No. 5,674,844, the entire contents of which are incorporated herein by reference. In addition, the compositions and methods of the present invention may be used in the replacement or repair of bone or cartilage at damaged sites such as bone fractures, bone fractures, and cartilage tears, periodontal tissue regeneration (e.g., a general method of periodontal tissue regeneration using bone morphogenetic proteins is disclosed in U.S. Pat. No. 5,733,878, the entire contents of which are incorporated herein by reference), liver regeneration, for example, after partial hepatectomy (see, e.g., U.S. Pat. No. 5,849,686, the entire contents of which are incorporated herein by reference), treatment of chronic renal failure (see, e.g., U.S. Pat. No. 6,861,404, the entire contents of which are incorporated herein by reference), central nervous system (CNS) regeneration, and the like. They find use in enhancing functional recovery after system ischemia or trauma (see, for example, U.S. Patent No. 6,407,060, the entire contents of which are incorporated herein by reference), inducing dendritic growth (see, for example, U.S. Patent No. 6,949,505, the entire contents of which are incorporated herein by reference), inducing neural cell adhesion (see, for example, U.S. Patent No. 6,800,603, the entire contents of which are incorporated herein by reference), and in treating and preventing Parkinson's disease (see, for example, U.S. Patent No. 6,506,729, the entire contents of which are incorporated herein by reference).As another example, the compositions and methods of the present invention can be used to induce dentin formation, for example, when targeting one or more BMPs.To date, the unpredictable response of dental pulp tissue to injury is a fundamental clinical problem in dentistry. Using standard dental surgical procedures, a small area (e.g., 2 mm) of the pulp can be surgically exposed by removing (by drilling) the enamel and dentin immediately above the pulp of the sample tooth, a partial cut of the coronal pulp tissue is performed, hemostasis is induced, pulp therapy is applied, and the cavity is sealed and filled by standard procedures.

[0170] In various embodiments, the present invention relates to targeting BMP family members for the treatment of one or more metabolic-related disorders as described herein.

[0171] In certain embodiments, the synthetic RNA targets a member of the FGF family. FGFs are a family of growth factors with members involved in angiogenesis, wound healing, embryonic development, and various endocrine signaling pathways. In various embodiments, the following FGFs are targeted: FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14 (FGF11, FGF12, FGF13, and FGF14 are FGF homologous factors 1-4 (FHF1-FHF4)), FGF16, FGF17, FGF18, FGF19 (also known as FHF15 / 19), Any one of FGF20, FGF21, FGF22, and FGF22 is a target of the present invention. In some embodiments, the synthetic RNA targets the cognate receptor of any of the above FGFs. In various embodiments, the invention relates to targeting FGF family members to treat or prevent diseases or disorders associated with abnormal function and / or expression of FGFs, metabolic diseases or disorders (e.g., diabetes, obesity, dyslipidemia, hyperglycemia, hyperinsulinemia, hypertension, fatty liver such as non-alcoholic steatohepatitis (NASH), etc.), cancer, diseases or disorders associated with impaired lipid metabolism, diseases or disorders associated with impaired renal function, diseases or disorders associated with impaired liver function, abnormal cell proliferation, vascular diseases or disorders (e.g., coronary artery disease, peripheral artery disease, atherosclerosis, abdominal aortic aneurysm, blood clots, deep vein thrombosis, venous stasis disease, phlebitis, varicose veins, etc.), angiogenesis, atherosclerosis, cardiovascular diseases or disorders, diseases or disorders associated with impaired angiogenesis, diseases or disorders associated with impaired cell signaling, diseases or disorders associated with impaired kinase activity, and diseases or disorders associated with impaired glucose uptake into adipocytes.

[0172] In certain embodiments, the synthetic RNA targets a member of the VEGF family. In some embodiments, the target is one or more of VEGF-A (including all isoforms, e.g., VEGF121, VEGF165, and VEGF189), placental growth factor (PGF, including all isoforms, e.g., PGF-1, PGF-2, and PGF-3), VEGF-B, VEGF-C, and VEGF-D, and any variants thereof (see, e.g., U.S. Pat. No. 9,078,860, the entire contents of which are incorporated herein by reference). In some embodiments, the synthetic RNA targets the cognate receptor of any of the above VEGFs. The present invention also encompasses as targets VEGF-related proteins, including the orf virus-encoded VEGF-like protein, designated VEGF-E, and a series of snake venoms, designated VEGF-F. VEGF and VEGF-related proteins are members of the platelet-derived growth factor (PDGF) supergene family of cystine-knot growth factors. All members of the PDGF supergene family share a high degree of structural homology with PDGF.

[0173] In various embodiments, the invention relates to targeting VEGF family members to treat diseases and conditions associated with angiogenesis, including, but not limited to, solid tumor cancer, hemangiomas, rheumatoid arthritis, osteoarthritis, septic arthritis, asthma, atherosclerosis, idiopathic pulmonary fibrosis, vascular restenosis, arteriovenous malformations, meningiomas, neovascular glaucoma, psoriasis, Kaposi's syndrome, angiofibromas, hemophilic joints, hypertrophic scars, Osler-Weber syndrome, pyogenic granulomas, retrolental fibroplasia, scleroderma, trachoma, von Hippel-Lindau disease, vascular adhesion pathology, synovitis, dermatitis, neurological degenerative diseases, pre-eclampsia, unexplained female infertility, endometriosis, unexplained male infertility, pterygium, wounds, pain, skin ulcers, gastric ulcers, and duodenal ulcers. In various embodiments, the present invention relates to targeting VEGF family members to treat angiogenesis-related ocular diseases, including, but not limited to, retinopathy of prematurity, diabetic retinopathy, retinal vein occlusion, and age-related macular degeneration, as well as any ocular disease associated with abnormal intraocular neovascularization, including, but not limited to, diabetic macular edema, and retinal vein occlusion. In embodiments, the compositions and methods of the present invention relate to the treatment of wet age-related macular degeneration.

[0174] In certain embodiments, the synthetic RNA targets a member of the interleukin family. Interleukins represent a large group of cytokines with diverse functions that were first characterized by their expression in leukocytes and have since been shown to be expressed in a wide range of cells, including macrophages, TH-1 and TH-2 cells, T-lymphocytes, monocytes, and bone marrow stroma. In a broad sense, the function of the immune system is largely dependent on the expression and function of interleukins. In some embodiments, the target is interleukin 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 3, 35, and 36, and within each type of interleukin, one or more of the various isotypes and / or interleukin receptors (e.g., IL-1R, IL-2R, IL-3R, IL-4R, IL-5R, IL-6R, IL-7R, IL-8R, IL-9R, IL-10R, IL-11R, IL-12R, IL-13R, IL-14R, IL-15R, IL-16R, IL-17R, IL-18R, IL-19R, IL-20R, IL-21R, IL-22R, IL-23R, IL-24R, IL-25R, IL-26, IL-27R, IL-28R, IL-29R, IL-30R, IL-31R, IL-32R, IL-33R, IL-34R, IL-35R, and IL-36R). In certain embodiments, both IL-15 and IL-15R (e.g., IL-15RA) are targeted. Without wishing to be bound by theory, it is believed that targeting both an interleukin (e.g., IL-15) and its cognate interleukin receptor (e.g., IL-15RA) results in beneficial synergistic effects. In various embodiments, the invention relates to targeting members of the interleukin family to treat cancer, inflammatory, respiratory, autoimmune, cardiovascular, neurological, metabolic, and / or proliferative diseases, disorders, and / or conditions as described herein in a subject or organism. In certain embodiments, the invention relates to targeting members of the interleukin family to treat cancer. In certain embodiments, the invention relates to targeting members of the interleukin family to treat rheumatoid arthritis.

[0175] In certain embodiments, the synthetic RNA targets the EPO gene or a derivative thereof (e.g., SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, and SEQ ID NO: 167). Some embodiments relate to the NOVEPOETIN protein (SEQ ID NO: 167). Other embodiments relate to NOVECRIT (SEQ ID NO: 168).

[0176] Erythropoietin can stimulate erythropoiesis in anemic patients with chronic renal failure who have impaired endogenous production of erythropoietin. Without wishing to be bound by theory, due to the length of time often required for erythropoiesis (several days for erythrocyte precursors to mature and be released into the bloodstream), clinically significant increases in hemoglobin are not usually observed in less than two weeks, and up to 10 weeks may be required in some patients. The methods and compositions, in some embodiments, provide a more rapid therapeutic effect. The methods and compositions, in some embodiments, provide a more rapid therapeutic effect, for example, when compared to wild-type EPO, and / or EPO without non-standard nucleotides, and / or EPO delivered as a protein biologic. The methods and compositions, in some embodiments, provide a sustained therapeutic effect. The methods and compositions, in some embodiments, provide a sustained therapeutic effect, for example, when compared to wild-type EPO, and / or EPO without non-standard nucleotides, and / or EPO delivered as a protein biologic.

[0177] For example, with EPO, the methods and compositions provide a clinically significant increase in hematocrit in less than about 6 weeks, or less than about 5 weeks, or less than about 4 weeks, or less than about 3 weeks, or less than about 2 weeks, or less than about 1 week. In some embodiments, the methods and compositions provide a clinically significant increase in hematocrit in about 2 weeks, or about 10 days, or about 1 week, or about 3 days, or about 1 day. In various embodiments, the methods and compositions accelerate the process by which red blood cell precursors mature and are released into the bloodstream.

[0178] In some embodiments, the EPO-related compositions of the invention find use in reducing the dose and / or frequency of administration when compared to wild-type EPO, and / or EPO without non-standard nucleotides, and / or EPO delivered as a protein biologic. For example, the EPO-related compositions of the invention may find use in treatment regimens for diseases disclosed herein (such as, but not limited to, one or more anemias) involving administration on a monthly, biweekly, or weekly basis. In some embodiments, the EPO-related compositions of the invention thus find use in reducing the dose and / or frequency of administration when compared to wild-type EPO, and / or EPO without non-standard nucleotides, and / or EPO delivered as a protein biologic. For example, the EPO-related compositions of the invention may find use in treatment regimens for diseases disclosed herein (such as, but not limited to, one or more anemias) involving administration on a monthly, biweekly, or weekly basis. The EPO-related compositions reduce the need for daily or, in some embodiments, weekly administration. In some embodiments, the EPO-related compositions of the present invention require a lower maintenance dose compared to wild-type EPO, and / or EPO without non-standard nucleotides, and / or EPO delivered as a protein biologic. Certain embodiments are particularly useful for treating chemotherapy-induced anemia. Other embodiments are particularly useful for treating anemia associated with inflammation, including, but not limited to, rheumatoid arthritis.

[0179] In some embodiments, the methods and compositions provide a rapid and robust response that eliminates the need for RBC transfusions, for example, in some embodiments, the methods and compositions can treat patients who will not consent to transfusions.

[0180] In some embodiments, the methods and compositions enhance the rate of increase in hematocrit, hi some embodiments, the methods and compositions maintain the increase in hematocrit (e.g., 25%, or 30%, or 35%, or 40% or more) for a sustained period of time (e.g., about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months, or about 9 months).

[0181] In some embodiments, the methods and compositions stimulate red blood cell production, hi some embodiments, the methods and compositions stimulate the division and differentiation of committed red blood cell precursors in the bone marrow.

[0182] In some embodiments, including but not limited to, when targeting EPO, the invention relates to the treatment of one or more of anemias, such as anemia resulting from chronic kidney disease (e.g., from dialysis), and / or chemotherapy, and / or HIV treatment (e.g., zidovudine (INN) or azidothymidine (AZT)), inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), anemia associated with inflammatory conditions (e.g., arthritis, lupus, IBD), myelodysplasia from diabetes, schizophrenia, cerebral malaria (as aplastic anemia), and cancer treatment (e.g., chemotherapy, and / or radiation), and anemia associated with various myelodysplastic syndrome diseases (e.g., sickle cell anemia, hemoglobin SC disease, hemoglobin C disease, α- and β-thalassemia, neonatal anemia after premature birth, and corresponding conditions).

[0183] In some embodiments, including but not limited to, when targeting EPO, the present invention provides a method for treating cancer, heart failure, autoimmune diseases, sickle cell disease, thalassemia, blood loss, transfusion reactions, diabetes, vitamin B12 deficiency, collagen vascular disease, Shwachman's syndrome, thrombocytopenic purpura, celiac disease, endocrine deficiency states such as hypothyroidism or Addison's disease, autoimmune diseases such as Crohn's disease, systemic lupus erythematosus, rheumatoid arthritis or juvenile rheumatoid arthritis, ulcerative colitis, immunodeficiencies such as eosinophilic fasciitis, hypoimmunoglobulinemia, or thymoma / thymic carcinoma, graft versus host disease, pre-leukemia, non-hematological syndromes (Down's syndrome, Dubowitz syndrome, Seckel syndrome), Felty's syndrome, hemolytic uremic syndrome, bone marrow In one embodiment, the present invention relates to the treatment of one or more of the following diseases: dysplastic syndromes, nocturnal paroxysmal hemoglobinuria, osteomyelofibrosis, pancytopenia, pure red cell aplasia, Schonlein-Henoch purpura, malaria, protein starvation, menorrhagia, systemic sclerosis, liver cirrhosis, hypometabolic states, congestive heart failure, chronic infections such as HIV / AIDS, tuberculosis, osteomyelitis, hepatitis B, hepatitis C, Epstein-Barr virus or parvovirus, T-cell leukemia virus, bacterial overproliferation syndrome, fungal or parasitic infections, and / or red blood cell membrane disorders such as hereditary spherocytosis, hereditary elliptocytosis, hereditary thermotolerant dystrophic erythrocytosis, hereditary stomatocytosis, red blood cell enzymopathies, hypersplenism, immune hemolysis, or paroxysmal nocturnal hemoglobinuria, or patients with one or more of said diseases.

[0184] In some embodiments, but not limited to, when targeting EPO, the present invention provides anemia, i.e., an abnormality in the number of red blood cells and / or the amount of hemoglobin found in red blood cells. The present invention relates to the treatment of conditions in which the blood glucose level is below 100 mg / kg / day or patients with the disease. In various embodiments, anemia can be acute or chronic. For example, anemia includes, but is not limited to, iron deficiency anemia, renal anemia, anemia of chronic disease / inflammation, pernicious anemia, such as polycytic asecretory anemia, juvenile pernicious anemia and congenital pernicious anemia, cancer-related anemia, chemotherapy-related anemia, radiotherapy-related anemia, pure red cell aplasia, refractory anemia with excess blasts, aplastic anemia, X-linked sideroblastic anemia, hemolytic anemia, sickle cell anemia, anemia caused by insufficient production of ESA, myelodysplastic syndrome, hypochromic anemia, microcytic anemia, sideroblastic anemia, autoimmune hemolytic anemia, Cooley anemia, thalassemia, Diamond Blackfan anemia, Fanconi anemia, and drug-induced immune hemolytic anemia. Anemia can cause serious symptoms including hypoxia, chronic fatigue, lack of concentration, pallor, low blood pressure, dizziness, and heart failure.

[0185] In some embodiments, the anemia is induced by chemotherapy, which is one of the causes of anemia. For example, the chemotherapy may be any myelosuppressive chemotherapy. In some embodiments, the chemotherapy is one or more platinum-based drugs, including cisplatin (e.g., PLATINOL) and carboplatin (e.g., PARAPLATIN). In some embodiments, the chemotherapy is any one of the agents described herein. In some embodiments, the chemotherapy is any agent described in Groopman et al. J Natl Cancer Inst (1999) 91(19):1616-1634, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the compositions and methods are used to treat chemotherapy-associated anemia in patients with late-stage cancer (e.g., stage IV, or stage III, or stage II cancer). In some embodiments, the compositions and methods are used to treat chemotherapy-associated anemia in cancer patients receiving dose-dense chemotherapy or other aggressive chemotherapy regimens.

[0186] In some embodiments, the present invention relates to the treatment of anemia in patients with one or more blood cancers, such as leukemia, lymphoma, and multiple myeloma. Such cancers may directly affect the bone marrow. Additionally, the present invention relates to metastatic cancers that have spread to the bone or bone marrow. In some embodiments, the present invention relates to the treatment of anemia in patients undergoing radiation therapy. Such radiation therapy may damage the bone marrow and reduce its ability to make red blood cells. In further embodiments, the present invention relates to the treatment of anemia in patients with reduced or deficient levels of one or more of iron, vitamin B12, and folic acid. In further embodiments, the present invention relates to the treatment of anemia in patients with excessive bleeding, including but not limited to after surgery or from a tumor causing internal bleeding. In further embodiments, the present invention relates to the treatment of anemia in patients with anemia of chronic disease.

[0187] In some embodiments, the present invention relates to the treatment of anemia resulting from chronic renal failure. In some embodiments, the present invention relates to the treatment of anemia resulting from the use of one or more renal replacement therapies, including dialysis, hemodialysis, peritoneal dialysis, hemofiltration, hemodiafiltration, and kidney transplantation.

[0188] In some embodiments, the present invention relates to the treatment of anemia in patients with chronic kidney disease not undergoing dialysis. For example, the present invention relates to patients with stage 1 CKD (chronic kidney disease), or stage 2 CKD, or stage 3 CKD, or stage 4 CKD, or stage 5 CKD. In some embodiments, the patient has stage 4 CKD or stage 5 CKD. In some embodiments, the patient has undergone a kidney transplant. In some embodiments, the present invention relates to the treatment of anemia in patients with acute kidney injury (AKI).

[0189] In various embodiments, the compositions and methods are used to reduce or eliminate fatigue, dizziness, and shortness of breath in a patient.

[0190] In various embodiments, the compositions and methods are used to treat patients exhibiting hyporesponsiveness or resistance to erythropoiesis stimulating agent therapy. In some embodiments, hyporesponsiveness to erythropoietin or ESA-resistant anemia refers to the presence of at least one of the following conditions: i) a significant decrease in hemoglobin levels with a constant dose of ESA therapy, ii) a significant increase in the ESA dose required to achieve or maintain a certain hemoglobin level, iii) a failure to raise hemoglobin levels to the target range despite erythropoietin-equivalent ESA doses greater than 150 IU / kg / week of darbepoetin-α or 0.75 mg / kg / week, or a continued need for such high doses of ESA to maintain the target hemoglobin level. For example, approximately 5-10% of patients with CDK exhibit hyporesponsiveness to ESAs, defined as the ongoing need for more than 300 IU / kg / week of erythropoietin or more than 1.5 ng / kg / week of darbepoietin administered by the subcutaneous route.

[0191] In various embodiments, the compositions and methods reduce the need for dose escalation of erythropoiesis stimulating agent therapy, if necessary, thereby avoiding side effects (e.g., joint pain, flu-like symptoms such as weakness, dizziness, and fatigue, skin irritation, and increased risk of adverse cardiovascular complications).

[0192] In various embodiments, the compositions and methods are used to maintain hemoglobin levels at about 12.5-13 g / dL. In various embodiments, the compositions and methods are used in patients with hemoglobin levels below about 12 g / dL, or about 11 g / dL, or about 10 g / dL, or about 9 g / dL, or about 8 g / dL, or about 7 g / dL, or about 6 g / dL, or about 5 g / dL. In various embodiments, the compositions and methods are used in patients with iron blood test scores indicative of blood pathology, e.g., a ferritin score below about 200 ng / L and / or a transferrin saturation score below about 30%.

[0193] In various embodiments, the compositions and methods are used to increase or maintain hemoglobin levels at a target level in the range of 9-10 g / dL, a target level in the range of 9 g / dL-11 g / dL, a target level in the range of 9 g / dL-12 g / dL, a target level in the range of 9 g / dL-14 g / dL, a target level in the range of 10 g / dL-14 g / dL, or a target level in the range of 12 g / dL-14 g / dL.

[0194] In various embodiments, the compositions and methods are used to restore a patient's hemoglobin levels to normal. In various embodiments, the normal hemoglobin range for humans is about 14-18 g / dl for men and 12-16 g / dl for women, with the average hemoglobin value for men being about 16 g / dL and for women being about 14 g / dL.

[0195] In some embodiments, for example, when targeting EPO, the invention relates to treating anemia with one or more of the following toxicity criteria (e.g., NCI Common Toxicity Criteria): Grade 1 (mild), 10.0 g hemoglobin / dL to within normal range; Grade 2 (moderate), 8.0-10.0 g hemoglobin / dL; Grade 3 (severe or critical), 6.5-7.9 g hemoglobin / dL; and Grade 4 (life-threatening), less than 6.5 g hemoglobin / dL. In various embodiments, the invention results in an increase in a toxicity metric of about 1 point, or about 2 points, or about 3 points, or about 4 points. In various embodiments, the invention results in patients with levels of 0 or 1. In various embodiments, the compositions and methods improve anemia as assessed by one or more scales described in Groopman et al. J Natl Cancer Inst (1999) 91(19):1616-1634, the entire contents of which are incorporated herein by reference.

[0196] In some embodiments, when targeting EPO, the present invention provides a method for the synthesis of one or more EPOs. Concerning combination therapy. For example, the composition of the present invention can provide a sustained effect that can complement the immediate effect of another EPO. In some embodiments, the composition is used as an adjuvant for other EPO. In some embodiments, the composition is used as a maintenance therapy for other EPO.Other EPOs include: epoetin alfa, such as, but not limited to, DARBEPOETIN (ARANESP), EPOCEPT (LUPIN PHARMA), NANOKINE (NANOGEN PHARMACEUTICAL), EPOFIT (INTAS PHARMA), EPOGEN (AMGEN), EPOGIN, EPREX (JANSSEN-CILAG), BINOCRIT (SANDOZ), PROCRIT; epoetin beta, such as, but not limited to, NEORECORMON (HOFFMANN-LA ROCHE), RECORMONE, methoxypolyethylene glycol-epoetin beta (MIRCERA, ROCHE); and epoetin delta, such as, but not limited to, DYNEPO (erythropoiesis stimulating protein, SHIRE PLC), epoetin Ω, such as, but not limited to, EPOMAX, and epoetin ζ, such as, but not limited to, SILAPO (STADA), and RETACRIT (HOSPIRA), and other EPOs, such as, but not limited to, EPOCEPT (LUPIN PHARMACEUTICALS), EPOTRUST (PANACEA BIOTEC LTD), ERYPRO SAFE (BIOCON LTD.), REPOITIN (SERUM INSTITUTE OF INDIA LIMITED), VINTOR (EMCURE PHARMACEUTICALS), EPOFIT (INTAS PHARMA), ERYKINE (INTAS BIOPHARMACEUTICA), WEPOX (WOCKHARDT BIOTECH), ESPOGEN (LG LIFE SCIENCES), RELIPOIETIN (RELIANCE LIFE SCIENCES), SHANPOIETIN (SHANTHA BIOTECHNICS) LTD), ZYROP (CADILA HEALTHCARE LTD.), EPIAO (RHUEPO) (SHENYANG SUNSHINE PHARMACEUTICAL CO.LTD), and CINNAPOIETIN (CINNAGEN).

[0197] In some embodiments, when EPO is targeted, the present invention relates to combination therapy with blood transfusion.For example, the composition of the present invention can supplement blood transfusion.In some embodiments, when EPO is targeted, the present invention relates to combination therapy with iron supplement.

[0198] In some embodiments, the invention also relates to the use of the following protein targets, for example, in the treatment of disease: growth hormone (GH), e.g., human and bovine growth hormone, growth hormone releasing hormone, and interferons, including α-, β-, or γ-interferon, interleukin I, interleukin II, and erythropoietin, including α- and β-erythropoietin (EPO), granulocyte colony stimulating factor (GCSF), granulocyte macrophage colony stimulating factor (GM-CSF), anti-angiogenic proteins (e.g., angiostatin, endostatin), PACAP polypeptide (pituitary adenylate cyclase activating polypeptide), vasoactive intestinal peptide (VIP), thyrotropin releasing hormone (TRH), corticotropin releasing hormone (CRH), vasopressin, arginine vasopressin (AVP), angiotensin II, and cytochrome P450 (C-V4) proteins, such as arginine vasopressin (AVP), and angiotensin II. The present invention relates to an immunosuppressant for the treatment of various conditions, including but not limited to insulin, calcitonin, atrial natriuretic factor, somatostatin, adrenocorticotropic hormone, gonadotropin releasing hormone, oxytocin, insulin, somatotropin, plasminogen tissue activator, clotting factors including clotting factors VIII and IX, glucosylceramidase, sargramostim, lenograstin, filgrastin, dornase-α, molgramostim, PEG-L-asparaginase, PEG-adenosine deaminase, hirudin, eptacog-α (human blood clotting factor VIIa), nerve growth factor, transforming growth factor, epidermal growth factor, basic fibroblast growth factor, VEGF, heparin including low molecular weight heparin, calcitonin, antigens, monoclonal antibodies, vancomycin, desferrioxamine (DFO), parathyroid hormone, immunogens or antigens, and antibodies such as monoclonal antibodies.

[0199] In some embodiments, the method can effect the activity of an additional therapeutic agent (e.g., those described herein) and / or target it to a cell and / or tissue of interest. For example, the synthetic RNA can result in increased expression of one or more target molecules that direct the additional therapeutic agent to the treatment site. For example, the additional therapeutic agent can have a binding partner encoded by the synthetic RNA. For example, the synthetic RNA can induce expression of an antigen that directs the therapeutic activity of an antibody that may be used in combination (e.g., Herceptin, Rituxan, Campath, Gemtuzumab, Herceptin, Panorex, Rituximab, Beksar, Edrecolomab, Alemtuzumab, Milotrag, IMC-C225, Sumartin 195, and Mitomomab). In some embodiments, the synthetic RNA can be directly injected into one or more of the tumors described herein to direct the therapeutic antibody to the tumor.

[0200] In some embodiments, the method can generate an effective additional therapeutic agent, especially when the additional therapeutic agent is, for example, a prodrug that generates an active form of the drug. In some embodiments, the synthetic RNA can be directly injected into one or more of the tumors described herein to direct the prodrug to the tumor. For example, the synthetic RNA can encode an enzyme that catalyzes the localized conversion of a non-toxic systemically delivered drug to a potent chemotherapeutic agent. By way of illustration (note that any of the prodrugs or drugs described herein are additional agents as used herein): [Table A-1] [Table A-2] [Table A-3]

[0201] In certain embodiments, the synthetic RNA may encode enzymes that catalyze the conversion of various prodrugs to 5-FU and / or doxorubicin, as shown in the following examples: [Table B]

[0202] In some embodiments, the nucleic acid drug at the doses and regimens described herein may be used in combination with one or more additional agents (also known as adjunctive therapy or combination agent). In some embodiments, the nucleic acid drug at the doses and regimens described herein may be used in human patients undergoing treatment with one or more additional agents. In some embodiments, the nucleic acid drug is used as an adjuvant or neoadjuvant to any of the additional agents described herein. In some embodiments, the present invention relates to co-administration and / or co-formulation. Any of the compositions described herein may be co-formulated and / or co-administered. In some embodiments, any nucleic acid drug described herein acts synergistically when co-administered with another agent and may be administered at a dose that is less than the dose that would typically be employed if such agent were used as a monotherapy.

[0203] In some embodiments, any nucleic acid drug described herein may include derivatives that are modified, i.e., modified by covalently attaching any type of molecule to the composition, such that the covalent attachment does not prevent the activity of the composition. For example, but not limited to, derivatives include compositions that are modified by, among others, glycosylation, lipidation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linking to cellular ligands or other proteins, etc. A number of optional chemical modifications can be made by known techniques, including, but not limited to, specific chemical cleavage of tunicamycin, acetylation, formylation, metabolic synthesis, etc. In addition, derivatives may contain one or more non-classical amino acids. In various embodiments, one or more additional agents (aka adjunct therapy or combination agent) may be conjugated to any nucleic acid drug described herein.

[0204] Contacting cells with steroids can suppress the innate immune response to foreign nucleic acids and increase the efficiency of nucleic acid delivery and translation. Thus, certain embodiments relate to contacting cells with steroids. Other embodiments relate to administering steroids to a patient. Exemplary steroids include corticosteroids. In some embodiments, the steroid is one or more of cortisone, hydrocortisone, prednisone, prednisolone, dexamethasone, triamcinolone, and betamethasone. In one embodiment, the steroid is hydrocortisone. In another embodiment, the steroid is dexamethasone.

[0205] Other embodiments relate to administering to the patient members of the classes of antibiotics, antifungals, and RNAse inhibitors.

[0206] Botulinum toxin type A is approved by the US Food and Drug Administration (FDA) for the treatment of idiopathic blepharospasm, strabismus and hemifacial spasm in patients over 12 years of age, cervical dystonia, glabellar lines, (facial) wrinkles, and for the treatment of hyperhidrosis, and botulinum toxin type B is approved for the treatment of cervical dystonia. The present composition may be combined with these toxins in the treatment of these and related diseases. Some embodiments relate to nucleic acid drugs that target neurotoxins. In various embodiments, the neurotoxin is a botulinum toxin or a biologically active fragment, variant, analog, or family member thereof.

[0207] Additionally, any one combination of the aforementioned toxins may be used in combination with the present compositions for various cosmetic treatments, including, but not limited to, facial wrinkles, hyperkinetic skin lines, frown lines, crow's feet, nasolabial folds, skin disorders, nasolabial folds, blepharospasm, strabismus, hemifacial spasm, and sweating disorders. Alternatively, the present compositions may be used in these cosmetic treatments as a monotherapy.

[0208] Certain embodiments relate to combination therapy comprising one or more of the pharmaceutical or cosmetic compositions of the present invention and one or more supplementary or cosmetic treatments. In certain embodiments, one or more of the therapeutic or cosmetic compositions of the present invention are administered to a subject undergoing treatment with one or more supplementary or cosmetic treatments. Examples of supplementary and cosmetic treatments are listed in Tables 3 and 5 of U.S. Provisional Patent Application No. 61 / 721,302, the contents of which are incorporated herein by reference, and are provided for illustrative purposes, not for limitation.

[0209] [Table 3-1] [Table 3-2]

[0210] In some embodiments, the additional agent is a cytotoxic agent, and exemplary embodiments include toxins, chemotherapeutic agents, radioisotopes, and agents that induce apoptosis or cell death.

[0211] Representative cytotoxic agents include methotrexate, aminopterin, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine, mechlorethamine, thioepamine, melphalan, carmustine (BSNU), mitomycin C, lomustine (CCNU), 1-methylnitrosourea, cyclophosphamide, mechlorethamine, busulfan, dibromomannitol, streptozotocin, mitomycin C, cis-dichlorodiamineplatinum(II) (DDP), cisplatin, and carboplatin (paraplatin). These include, but are not limited to, alkylating agents such as daunorubicin (formerly daunomycin), doxorubicin (adriamycin), anthracyclines including daunorubicin (formerly daunomycin), doxorubicin (adriamycin), detorubicin, carminomycin, idarubicin, epirubicin, mitoxantrone, and bisantrene, antibiotics including dactinomycin (actinomycin D), bleomycin, calicheamicin, mithramycin, and anthramycin (AMC), and antimitotic agents such as the vinca alkaloids, vincristine, and vinblastine. Other cytotoxic agents include paclitaxel (taxol), ricin, Pseudomonas aeruginosa exotoxin, gemcitabine, cytochalasin B, gramicidin D, ethidium bromide, emetine, etoposide, tenoposide, colchicine, dihydroxyanthracinedione, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, procarbazine, hydroxyurea, asparaginase, corticosteroids, mitotane (O,P'-(DDD)), interferons, as well as mixtures of these cytotoxic agents.

[0212] Additional cytotoxic agents include carboplatin, cisplatin, paclitaxel, gemcitabine, calicheamicin, doxorubicin, 5-fluorouracil, mitomycin C, actinomycin D, cyclophosphamide, vincristine, bleomycin, VEGF antagonists, EGFR antagonists, platinum, taxol, irinotecan, 5-fluorouracil, gemcitabine, leucovorin, steroids, cyclophosphamide, melphalan, vinca alkaloids (e.g., vinblastine, vincristine, vindesine, and vinorelbine), mustine, tyrosine kinase inhibitors, radiation therapy, sex hormone antagonists, selective androgen receptor modulators, selective estrogen receptor modulators, PDGF antagonists, TNF antagonists, IL-1 antagonists, interleukins (e.g., IL-12 or IL-2), IL-12R antagonists, toxin-conjugated monoclonal antibodies, tumor antigen-specific monoclonal antibodies, Erbitux, Avastin, Pertuzumab, anti-CD20 antibodies, Rituxan, Octopus T cell activators, cyclosporine ... These include, but are not limited to, chemotherapeutic agents such as relizumab, ofatumumab, DXL625, HERCEPTIN, or any combination thereof. Toxic enzymes from plants and bacteria, such as ricin, diphtheria toxin, and pseudomonas toxin, can be conjugated to therapeutic agents (e.g., antibodies) to produce cell type specific killing reagents (Youle, et al., J. Med. Soc. 1999, 143:1311-1323, 1999). al., Proc. Nat'l Acad. Sci. USA77:5483(1980), Gilliland, et al., Proc. Nat'l Acad. Sci. USA77:4539(1980), Krolick, et al., Proc. Nat'l Acad. Sci. USA77:5419(1980)).

[0213] Other cytotoxic agents include cytotoxic ribonucleases as described by Goldenberg in U.S. Patent No. 6,653,104. Embodiments of the present invention also relate to radioimmunoconjugates in which an alpha or beta particle-emitting radionuclide is stably bound to an antibody or binding fragment thereof, with or without the use of a complexing agent. Such radionuclides include beta emitters such as phosphorus-32, scandium-47, copper-67, gallium-67, yttrium-88, yttrium-90, iodine-125, iodine-131, samarium-153, lutetium-177, rhenium-186, or rhenium-188, and alpha emitters such as astatine-211, lead-212, bismuth-212, bismuth-213, or actinium-225.

[0214] Representative detectable moieties further include, but are not limited to, horseradish peroxidase, acetylcholinesterase, alkaline phosphatase, β-galactosidase, and luciferase. Further exemplary fluorescent materials include, but are not limited to, rhodamine, fluorescein, fluorescein isothiocyanate, umbelliferone, dichlorotriazinylamine, phycoerythrin, and dansyl chloride. Further exemplary chemiluminescent moieties include, but are not limited to, luminol. Further exemplary bioluminescent materials include, but are not limited to, luciferin, and aequorin. Further exemplary radioactive materials include, but are not limited to, iodine-125, carbon-14, sulfur-35, tritium, and phosphorus-32.

[0215] The dosage amount, as well as the administration schedule, of any additional agent described herein may depend on a variety of parameters, including, but not limited to, the general health of the human patient, and the discretion of the administering physician and / or human patient. Co-administration may be simultaneous or sequential. Any additional agent described herein may be administered prior to administration of the nucleic acid drug to a human patient in need thereof (e.g., about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 12 hours, about 24 hours, about 48 hours, about 72 hours, about 96 hours, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, 8 weeks, or more). or about 12 weeks prior), concomitantly with, or subsequent to administration (e.g., about 5 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 12 hours, about 24 hours, about 48 hours, about 72 hours, about 96 hours, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, or about 12 weeks later). In various embodiments, any agent described herein is administered at about 1 minute intervals, about 10 minutes intervals, about 30 minutes intervals, less than about 1 hour intervals, about 1 hour intervals, about 1 to about 2 hours intervals, about 2 to about 3 hours intervals, about 3 to about 4 hours intervals, about 4 to about 5 hours intervals, about 5 to about 6 hours intervals, about 6 to about 7 hours intervals, about 7 to about 8 hours intervals, about 8 to about 9 hours intervals, about 9 to about 10 hours intervals, about 10 to about 11 hours intervals, about 11 to about 12 hours intervals, or about 24 hours or less, or about 48 hours or less.

[0216] In certain embodiments, the combination regimen involves administration and formulation of the nucleic acid drugs of the invention over a short period of time (e.g. For example, the present invention is designed to take advantage of the finding that a compound capable of exerting a potent effect within about 6 hours, or about 12 hours, or about 24 hours, or about 30 hours, or about 36 hours, or about 48 hours, and that the effect can persist for about 7 days or longer.

[0217] Dosages of nucleic acid drugs are disclosed herein. In general, dosages of any additional agents useful are known to those skilled in the art. For example, dosages may be determined in the reference Physicians' Desk Reference, 66th Edition, PDR Network; 2012 Edition (December 27, 2011), the contents of which are incorporated by reference in their entirety. In some embodiments, the present invention allows a patient to receive a dosage that exceeds that determined in the reference Physicians' Desk Reference. The dosage of any additional agent described herein may depend on several factors, including the severity of the condition, whether the condition is being treated or prevented, and the age, weight, and health of the patient being treated. In addition, the pharmacogenomics (effect of genotype on the pharmacokinetic, pharmacodynamic, or efficacy profile of a therapeutic agent) information of a particular human patient may affect the dosage used. Furthermore, the exact individual dosage may be adjusted somewhat depending on a variety of factors, including the particular combination of agents administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disease being treated, the severity of the disorder, and the anatomical location of the disorder. Some variation in dosage is to be expected.

[0218] For example, living organisms, including but not limited to cells, tissues, organs, and humans, including the stratum corneum, which can function as a barrier against foreign organisms and nucleic acids, have several characteristics that can inhibit or prevent the delivery of nucleic acids. These characteristics can therefore inhibit the effectiveness of therapeutic and cosmetic products, including nucleic acids. It has now been discovered that many of these characteristics can be avoided or overcome with a patch comprising a flexible membrane and multiple needles, and that such a patch can function as an effective and safe article for the delivery of nucleic acids. Accordingly, certain embodiments relate to a nucleic acid delivery patch. In one embodiment, the nucleic acid delivery patch comprises a flexible membrane. In another embodiment, the nucleic acid delivery patch comprises multiple needles. In yet another embodiment, the multiple needles are attached to the flexible membrane. In some embodiments, the patch comprises a nucleic acid. In one embodiment, the nucleic acid is in a solution. In one embodiment, the multiple needles comprise one or more needles having a lumen. In another embodiment, the patch further comprises a second flexible membrane. In yet another embodiment, the flexible membrane and the second flexible membrane are arranged to form a cavity. In a further embodiment, the cavity contains the nucleic acid. In yet another embodiment, the membrane comprises one or more holes through which the nucleic acid can pass. In yet another embodiment, the one or more needles having one or more holes and lumens are arranged to allow passage of a solution containing nucleic acid through at least one of the one or more holes and through at least one of the one or more needles having a lumen. In some embodiments, the patch is configured to deliver a solution to the skin. In one embodiment, the solution includes nucleic acid. In another embodiment, the solution includes a vehicle. In yet another embodiment, the vehicle is a lipid or lipid-like substance. In yet another embodiment, the vehicle is a lipid-based transfection reagent.

[0219] Cell membranes can function as a barrier to foreign nucleic acids. It has now been discovered that the efficiency of nucleic acid delivery can be increased by combining an electric field with the patch of the present invention. Thus, certain embodiments relate to a nucleic acid delivery patch comprising multiple needles, at least two of which form part of a high-voltage circuit. Certain embodiments relate to implantable "tattoos" for microneedle delivery (see, for example, Nature Materials 12, pp367-376 (2013), the entire contents of which are incorporated herein by reference). In one embodiment, the high-voltage circuit generates a voltage greater than about 10V. In another embodiment, the high-voltage circuit generates a voltage greater than about 20V. In yet another embodiment, the electric field is generated between two needles. Further embodiments In one embodiment, the magnitude of the electric field is at least about 100 V / cm. In yet another embodiment, the magnitude of the electric field is at least about 200 V / cm. In some embodiments, the patch is configured to deliver nucleic acid to the epidermis. In other embodiments, the patch is configured to deliver nucleic acid to the dermis. In yet other embodiments, the patch is configured to deliver nucleic acid to the subcutaneous tissue. In yet other embodiments, the patch is configured to deliver nucleic acid to the muscle. Certain embodiments relate to nucleic acid delivery patches comprising multiple electrodes. In one embodiment, the multiple electrodes are attached to a flexible membrane. Other embodiments relate to nucleic acid delivery patches comprising a rigid structure. In one embodiment, the multiple electrodes are attached to a rigid structure.

[0220] In some embodiments, the compositions described herein are administered using a needle array covering the affected area of ​​the subject. In some embodiments, the treatment area is mechanically massaged after administration. In some embodiments, the treatment area is exposed to an electrical pulse after administration. In some embodiments, the electrical pulse is from about 10V to about 200V for about 50 microseconds to about 1 second. In some embodiments, the electrical pulse is generated around the treatment area by a multi-electrode array.

[0221] In some embodiments, the present invention provides a non-viral RNA transfection composition that is encapsulated in a membrane, and 2 Less than or equal to 50cm 2 Less than or equal to 10cm 2 Less than or equal to 5cm 2 Less than or equal to 1 cm 2 Less than or equal to 0.5 cm 2 Less than or equal to 0.2 cm 2 A patch delivery system is provided that includes an array of delivery needles that deliver from 10 ng to about 2000 ng of RNA per treatment area of: In some embodiments, the non-viral transfection composition contains from about 10 ng to about 2000 ng per injection volume of about 20 μL to about 1 ml; In some embodiments, each needle delivers an injection volume of 1 μL to 500 μL.

[0222] In some embodiments, the delivery patch includes an acrylic container that holds the nucleic acid drug. In some embodiments, a silicone adhesive is added to create a semi-solid suspension of finely concentrated drug cells. Additionally, some embodiments boast a patch that is associated with one or more enhancers, including, but not limited to, iontophoresis, ultrasound, chemicals including gels, microneedles, sonophoresis, lasers, and electroporation.

[0223] In some embodiments, delivery is via a gel, optionally a hydroalcoholic gel containing a combination of enhancers (eg, COMBIGEL (ANTARES PHARMA)).

[0224] In various embodiments, RNA is delivered using a needle array. Exemplary needle arrays include, but are not limited to, AdminPen 600 and those described in U.S. Patent Nos. 7,658,728, 7,785,301, and 8,414,548, the disclosures of which are incorporated herein by reference in their entirety. Other examples of needles include, for example, 3M™ hollow microtransdermal system and 3M™ solid microtransdermal system (sMTS). See, for example, U.S. Patent Nos. 3,034,507 and 3,675,766, the contents of which are incorporated herein by reference in their entirety, and Microneedles for Transdermal Drug Delivery.Advanced Drug Delivery Reviews.56:581-587(2004);Pharm Res.2011 Jan;28(1):31-40.

[0225] In some embodiments, microneedles and / or microneedle arrays are used. In various embodiments, the microneedles and / or microneedle arrays may be, but are not limited to, solid, RNA-coated, dissolvable, biodegradable, and / or hollow. In some embodiments, delivery is effected via a microneedle system, optionally combined with an electronically controlled micropump that delivers the drug at a specific time or on demand. For example, the MACROFLUX (Alza) system may be used.

[0226] Other embodiments relate to a method for delivering a nucleic acid to a cell in vivo, comprising applying the nucleic acid to a tissue containing the cell in vivo. In one embodiment, the method further comprises applying a transient electric field in the vicinity of the cell. In another embodiment, the method results in a cell in vivo that internalizes the nucleic acid. In yet another embodiment, the nucleic acid comprises synthetic RNA. In a further embodiment, the method further results in a cell that internalizes a therapeutically or cosmetically effective amount of the nucleic acid. In one embodiment, the cell is a skin cell. In another embodiment, the cell is a muscle cell. In yet another embodiment, the cell is a skin fibroblast. In a further embodiment, the cell is a keratinocyte. In yet another embodiment, the cell is a myoblast. In some embodiments, the nucleic acid comprises a protein of interest. In one embodiment, the protein of interest is a fluorescent protein. In another embodiment, the protein of interest is an extracellular matrix protein. In yet another embodiment, the protein of interest is a member of the group of elastin, collagen, laminin, fibronectin, vitronectin, lysyl oxidase, elastin-binding protein, growth factor, fibroblast growth factor, transforming growth factor beta, granulocyte colony-stimulating factor, matrix metalloproteinase, actin, fibrillin, microfibril-binding glycoprotein, lysyl oxidase-like protein, platelet-derived growth factor, lipase, uncoupling protein, thermogenin, filaggrin, fibroblast growth factor, antibody, and protein involved in pigment production. In some embodiments, the method further comprises delivering the nucleic acid to the epidermis. In other embodiments, the method further comprises delivering the nucleic acid to the dermis. In yet other embodiments, the method further comprises delivering the nucleic acid below the dermis. In one embodiment, the delivery is by injection. In another embodiment, the delivery is by injection with a microneedle array. In yet another embodiment, the delivery is by topical administration. In a further embodiment, the delivery comprises the destruction or removal of a portion of the tissue. In yet another embodiment, the delivery comprises the destruction or removal of the stratum corneum. In some embodiments, the nucleic acid is in solution, hi one embodiment, the solution comprises a growth factor.In another embodiment, the growth factor is a member of the group of fibroblast growth factor and transforming growth factor. In yet another embodiment, the growth factor is a member of the group of basic fibroblast growth factor and transforming growth factor beta. In another embodiment, the solution comprises cholesterol.

[0227] In another embodiment, the method further comprises contacting the cell with one or more nucleic acid molecules. In yet another embodiment, at least one of the one or more nucleic acid molecules encodes a protein of interest. In a further embodiment, the method results in the cell expressing the protein of interest. In yet another embodiment, the method results in the cell expressing a therapeutically or cosmetically effective amount of the protein of interest.

[0228] In another embodiment, the cell is contacted with the nucleic acid molecule. In yet another embodiment, the method results in the cell internalizing the nucleic acid molecule. In a further embodiment, the method results in the cell internalizing a therapeutically or cosmetically effective amount of the nucleic acid molecule. In one embodiment, the nucleic acid encodes a protein of interest. In one embodiment, the nucleic acid molecule comprises a member of the group of a dsDNA molecule, a ssDNA molecule, an RNA molecule, a dsRNA molecule, a ssRNA molecule, a plasmid, an oligonucleotide, a synthetic RNA molecule, a miRNA molecule, an mRNA molecule, and a siRNA molecule. In various embodiments, the RNA comprises one or more non-standard nucleotides.

[0229] In some embodiments, the present invention relates to one or more administration techniques described in U.S. Pat. Nos. 5,711,964, 5,891,468, 6,316,260, 6,413,544, 6,770,291, and 7,390,780, the entire contents of which are incorporated herein by reference.

[0230] The present invention also provides kits that simplify administration of the nucleic acid drug described herein and / or any additional agent described herein. An exemplary kit of the present invention includes the nucleic acid drug described herein and / or any additional agent in unit dosage form. In one embodiment, the unit dosage form is a container, such as a pre-filled syringe, which may be sterile, containing any agent described herein and a pharma- ceutically acceptable carrier, diluent, excipient, or vehicle. The kit may further include a label or printed instructions directing the use of any agent described herein. The kit or one or more components of the kit may be stored at room temperature, about 4°C, about -20°C, about -80°C, or about -196°C. The kit may also include an eyelid speculum, a local anesthetic, and an irrigant for the administration site. The kit may further include one or more additional agents described herein. In one embodiment, the kit includes a container containing an effective amount of the nucleic acid drug disclosed herein and an effective amount of another composition, such as an additional agent as described herein. In some embodiments, the unit dosage form is a preloaded (aka pre-dosed or pre-filled) syringe or pen needle injector (injector pen). Such a unit dosage form may contain an effective dose of the nucleic acid drug described herein, for example, about 10 ng to about 2000 ng, for example, about 10 ng, or about 20 ng, or about 50 ng, or about 100 ng, or about 200 ng, or about 300 ng, or about 400 ng, or about 500 ng, or about 600 ng, or about 700 ng, or about 800 ng, or about 900 ng, or about 1000 ng, or about 1100 ng, or about 1200 ng, or about 1300 ng, or about 1400 ng, or about 1500 ng, or about 1600 ng, or about 1700 ng, or about 1800 ng, or about 1900 ng, or about 2000 ng.

[0231] Some embodiments relate to synthetic RNA molecules with low toxicity and high translation efficiency. Other embodiments relate to cell culture media for high efficiency in vivo transfection, reprogramming, and gene editing of cells. Other embodiments relate to methods for generating synthetic RNA molecules that encode reprogramming proteins. Yet other embodiments relate to methods for generating synthetic RNA molecules that encode gene editing proteins.

[0232] Some embodiments relate to methods of gene editing and / or gene correction. Some embodiments include synthetic RNA-based gene editing and / or gene correction, for example, by RNAs that contain non-standard nucleotides, such as RNAs that code for nucleases, transcription activator-like effector nucleases (TALENs), zinc finger nucleases, meganucleases, nickases, clustered regularly interspaced short palindromic repeats (CRISPR)-associated proteins or one or more of their natural or engineered variants, family members, orthologues, fragments, or fusion constructs. In some embodiments, the efficiency of gene editing and / or gene correction is high, for example, higher than DNA-based gene editing and / or gene correction. In some embodiments, the method of gene editing and / or gene correction is efficient enough for in vivo application. In some embodiments, the method of gene editing and / or gene correction is efficient enough so as not to require cell selection (e.g., selection of cells that have been edited). In various embodiments, the efficiency of gene editing of the method is about 1%, or about 2%, or about 3%, or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 9%, or about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 100%. In various embodiments, the efficiency of gene correction of the method is about 1%, or about 2%, or about 3%. , or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 9%, or about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 100%.

[0233] Some embodiments relate to highly efficient gene editing proteins that include an engineered nuclease cleavage domain. Other embodiments relate to highly fidelity gene editing proteins that include an engineered nuclease cleavage domain. Various embodiments relate to highly efficient gene editing proteins that include an engineered DNA binding domain. Other embodiments relate to highly fidelity gene editing proteins that include an engineered DNA binding domain. Still other embodiments relate to gene editing proteins that include engineered repeat sequences. Some embodiments relate to gene editing proteins that include one or more CRISPR-associated family members. Some embodiments relate to methods for modifying the DNA sequence of a cell by transfecting the cell with or inducing the cell to express a gene editing protein. Other embodiments relate to methods for modifying the DNA sequence of a cell present in an in vitro culture. Yet another embodiment relates to methods for modifying the DNA sequence of a cell present in vivo.

[0234] Some embodiments relate to a method for regulating the secretion or intracellular localization of a polypeptide. In such an embodiment, the present invention provides an RNA encoding a protein comprising a signal peptide operably linked to a polypeptide having biological functionality. In an embodiment, the signal peptide regulates the secretion of the polypeptide. In another embodiment, the signal peptide regulates the intracellular localization of the polypeptide. For example, BMP7 comprising at least one FGF21 signal peptide can result in increased secretion of BMP7. In another example, BMP7 comprising at least one FGF21 signal peptide instead of endogenous BMP7 signal peptide can result in increased secretion of BMP7. In various embodiments, any of the proteins listed in Table 2A or Table 2B comprising at least one signal peptide listed in the following table can result in increased secretion of the protein. [Table C]

[0235] Some embodiments relate to methods for modulating the serum half-life, secretion, bioavailability, and / or activity of a protein comprising administering RNA encoding the protein and RNA encoding a receptor for the protein. For example, IL15 may be administered together with its receptor, e.g., IL15RA, to enhance one or more of the serum half-life, secretion, bioavailability, and activity of IL15.

[0236] Many proteins and peptides can show reduced activity when translated from in vitro transcribed RNA, due to incomplete or insufficient post-translational processing. It has now been discovered that the amount of active protein, polypeptide, or peptide produced after RNA transfection can be increased by contacting the cell with a second protein capable of processing the polypeptide into a protein, peptide, or polypeptide, and / or inducing the cell to express a second protein capable of processing the polypeptide into a protein, peptide, or polypeptide. Thus, certain embodiments relate to a method for inducing a cell to express an active protein, polypeptide, or peptide, comprising contacting the cell with a synthetic RNA molecule encoding a first polypeptide, and contacting the cell with a second protein capable of processing the first polypeptide into an active protein, polypeptide, or peptide.

[0237] In certain embodiments, a second protein is administered to the patient. In one embodiment, the second protein is a recombinant protein. In another embodiment, the cell is contacted with a synthetic RNA molecule that encodes the second protein. In a further embodiment, the second protein is The cell is contacted with an inhibitor of the inhibitory molecule and / or induced to express an inhibitor of the molecule that inhibits the second protein, hi one embodiment, the inhibitor is a short interfering RNA molecule.

[0238] In certain embodiments, the second protein is a member of the PCSK family. In other embodiments, the second protein is a proprotein convertase. In yet other embodiments, the second protein is a prohormone convertase. In yet other embodiments, the second protein is a carboxypeptidase. In one embodiment, the second protein is PCSK3 (furin / PACE). In another embodiment, the second protein is primarily secreted. In yet another embodiment, the second protein is primarily intracellular. In further embodiments, the first polypeptide, protein, polypeptide or peptide is selected from the group consisting of a product of proopiomelanocortin, renin, a product of enkephalin, a product of prodynorphin, somatostatin, insulin, agouti-related peptide, glucagon, parathyroid hormone, a member of the transforming growth factor beta superfamily, albumin, beta-secretase 1, nerve growth factor, caldesmon, alpha-integrin, factor IX, alpha-melanocyte stimulating hormone, adrenocorticotropic hormone, beta-endorphin, and metenkephalin.

[0239] Glycosylation is the process by which one or more sugar molecules are attached to a protein. It has now been discovered that by altering the number or location of glycosylation and glycosylation sites, the stability of a protein can be increased or decreased. Thus, certain embodiments relate to proteins with one or more glycosylation or glycosylation sites. In one embodiment, the protein is engineered to have more glycosylation or glycosylation sites than a naturally occurring variant of the protein. In another embodiment, the protein is engineered to have fewer glycosylation or glycosylation sites than a naturally occurring variant of the protein. In yet another embodiment, the protein has increased stability. In yet another embodiment, the protein has decreased stability. In some embodiments, the protein is a circulating protein. In one embodiment, the protein is erythropoietin or a biologically active fragment, variant, analog, or family member thereof. In another embodiment, the protein is darbepoetin alfa or a biologically active fragment, variant, analog, or family member thereof. In another embodiment, the protein is NOVEPOETIN or a biologically active fragment, variant, analog, or family member thereof.

[0240] It has further been discovered that in certain circumstances, including one or more steroids and / or one or more antioxidants in the transfection medium can increase in vivo transfection efficiency, in vivo reprogramming efficiency, and in vivo gene editing efficiency. Accordingly, certain embodiments relate to contacting cells or patients with glucocorticoids, such as hydrocortisone, prednisone, prednisolone, methylprednisolone, dexamethasone, or betamethasone. Other embodiments relate to methods for inducing cells to express a protein of interest by contacting the cells with a medium containing a steroid and by contacting the cells with one or more nucleic acid molecules. In one embodiment, the nucleic acid molecule comprises synthetic RNA. In another embodiment, the steroid is hydrocortisone. In yet another embodiment, the hydrocortisone is present in the medium at a concentration of about 0.1 μM to about 10 μM, or about 1 μM. Other embodiments relate to methods for inducing cells to express a protein of interest by contacting the cells in vivo with a medium containing an antioxidant and by contacting the cells with one or more nucleic acid molecules. In one embodiment, the antioxidant is ascorbic acid or ascorbic acid-2-phosphate. In another embodiment, the ascorbic acid or ascorbic acid-2-phosphate is present in the medium at a concentration of about 0.5 mg / L to about 500 mg / L, including about 50 mg / L. Yet other embodiments relate to methods for reprogramming and / or gene editing cells in vivo by contacting the cells with a medium containing a steroid and / or an antioxidant and by contacting the cells with one or more nucleic acid molecules, the one or more nucleic acid molecules encoding one or more reprogramming and / or gene editing proteins. In certain embodiments, the cells are present in a living organism and the steroid and / or antioxidant are delivered to the living organism.

[0241] It has been reported that the addition of transferrin to the complex formation medium increases the efficiency of plasmid transfection in certain circumstances. It has now been discovered that the addition of transferrin to the complex formation medium can similarly increase the efficiency of in vivo transfection with synthetic RNA molecules. Accordingly, certain embodiments relate to a method for inducing cells in vivo to express a protein of interest by adding one or more synthetic RNA molecules and a transfection reagent to a solution containing transferrin. In one embodiment, the transferrin is present in the solution at a concentration of about 1 mg / L to about 100 mg / L, such as about 5 mg / L. In another embodiment, the transferrin is recombinant.

[0242] In certain situations, for example with respect to cultivation, it may be desirable to exchange animal-derived components for non-animal and / or recombinant components, in part because the non-animal and / or recombinant components can be produced with a higher degree of consistency than the animal-derived components, and in part because the non-animal and / or recombinant components carry a lower risk of contamination with toxic and / or pathogenic substances than the animal-derived components. Thus, certain embodiments relate to proteins that are non-animal and / or recombinant. Other embodiments relate to media in which some or all of the components of the media are non-animal and / or recombinant.

[0243] Other embodiments relate to methods for transfecting cells in vivo. In one embodiment, cells in vivo are transfected with one or more nucleic acids, and the transfection is carried out using a transfection reagent, such as a lipid-based transfection reagent. In one embodiment, the one or more nucleic acids include at least one RNA molecule. In another embodiment, cells are transfected with one or more nucleic acids, and the one or more nucleic acids encode at least one of p53, TERT, an antibody, an extracellular matrix protein, a cytokine, a secreted protein, a membrane-associated protein, an enzyme, a gene editing protein, a chromatin-modifying protein, a DNA-binding protein, a transcription factor, a histone deacetylase, a pathogen-associated molecular pattern, and a tumor-associated antigen or a biologically active fragment, analog, variant, or family member thereof. In another embodiment, cells are transfected repeatedly, for example, at least about twice in about 10 consecutive days, or at least about three times in about 7 consecutive days, or at least about four times in about 6 consecutive days. Some embodiments relate to a method of increasing expression of telomerase in one of fibroblasts, hematopoietic stem cells, mesenchymal stem cells, cardiac stem cells, hair follicle stem cells, neural stem cells, intestinal stem cells, endothelial stem cells, olfactory stem cells, neural crest stem cells, testicular cells, and keratinocytes. Some embodiments relate to a method of increasing telomere length in one of fibroblasts, hematopoietic stem cells, mesenchymal stem cells, cardiac stem cells, hair follicle stem cells, neural stem cells, intestinal stem cells, endothelial stem cells, olfactory stem cells, neural crest stem cells, testicular cells, and keratinocytes. Other embodiments relate to a method of isolating cells from a patient, contacting the cells with a nucleic acid drug encoding a component of telomerase (e.g., TERT), and reintroducing the cells into the patient. Various embodiments relate to a method of increasing the replicative capacity of a cell.

[0244] Reprogramming can be achieved by transfecting cells with one or more nucleic acids encoding one or more reprogramming factors, such as Oct4 protein, Sox2 protein, Klf4 protein, c-Myc protein, and the like. The microRNAs include, but are not limited to, c protein, I-Myc protein, TERT protein, Nanog protein, Lin28 protein, Utf1 protein, Aicda protein, miR200 microRNA, miR302 microRNA, miR367 microRNA, miR369 microRNA, and biologically active fragments, analogs, variants, and family members thereof. Accordingly, certain embodiments relate to a method for reprogramming a cell in vivo. In one embodiment, the cell in vivo is reprogrammed by transfecting the cell with one or more nucleic acids encoding one or more reprogramming factors. In one embodiment, the one or more nucleic acids include an RNA molecule encoding an Oct4 protein. In another embodiment, the one or more nucleic acids further include one or more RNA molecules encoding a Sox2 protein, a Klf4 protein, and a c-Myc protein. In yet another embodiment, the one or more nucleic acids further include an RNA molecule encoding a Lin28 protein. In one embodiment, the cell is a human skin cell, and the human skin cell is reprogrammed into a pluripotent stem cell. In another embodiment, the cell is a human skin cell, and the human skin cell is reprogrammed into a glucose-responsive insulin-producing cell. Examples of other cells that can be reprogrammed and that the cell can reprogram include, but are not limited to, skin cells, pluripotent stem cells, mesenchymal stem cells, beta cells, retinal pigment epithelial cells, hematopoietic cells, cardiac cells, airway epithelial cells, neural stem cells, neuronal cells, glial cells, bone cells, blood cells, and dental pulp stem cells. In one embodiment, the cell is contacted with a medium that supports the reprogrammed cell. In one embodiment, the medium further supports the cell.

[0245] Importantly, it has been reported that infection of skin cells with viruses encoding Oct4, Sox2, Klf4, and c-Myc, combined with culturing the cells in a medium that supports the growth of cardiomyocytes, results in the reprogramming of skin cells into cardiomyocytes without first reprogramming the skin cells into pluripotent stem cells (see Efs et al Nat Cell Biol. 2011;13:215-22, the contents of which are incorporated herein by reference). In certain circumstances, direct reprogramming (also known as "transdifferentiation," reprogramming one somatic cell into another somatic cell without first reprogramming the somatic cell into a pluripotent stem cell) may be desirable, in part because culturing pluripotent stem cells can be time-consuming and expensive, the additional processing involved in establishing and characterizing stable pluripotent stem cells can carry increased risks of contamination, and the additional time of culture associated with first producing pluripotent stem cells can carry increased risks of genomic instability and acquisition of mutations, including point mutations, copy number alterations, and karyotypic abnormalities. Thus, certain embodiments relate to methods for reprogramming somatic cells in vivo, where the cells are reprogrammed into somatic cells and no characterized pluripotent stem cell lines are produced.

[0246] It has further been discovered that in certain circumstances, less total transfections may be required to reprogram cells according to the methods of the present invention than according to other methods. Accordingly, certain embodiments relate to a method for reprogramming cells in vivo, in which about 1 to about 12 transfections are performed in about 20 consecutive days, or about 4 to about 10 transfections are performed in about 15 consecutive days, or about 4 to about 8 transfections are performed in about 10 consecutive days. It is recognized that when a cell is contacted with a medium containing a nucleic acid molecule, the cell may possibly come into contact with and / or internalize more than one nucleic acid molecule, either simultaneously or at different times. Thus, even if the cell is contacted only once with a medium containing a nucleic acid, the cell may be contacted with the nucleic acid more than once, e.g., repeatedly.

[0247] Of note, the nucleic acid may contain one or more non-standard or "modified" nucleic acids as described herein. The reprogramming method may contain "modified" residues. For example, any of the non-standard nucleotides described herein may be used in the reprogramming method. In one embodiment, pseudouridine-5'-triphosphate may be substituted for uridine-5'-triphosphate in an in vitro transcription reaction to obtain a synthetic RNA, and up to 100% of the uridine residues of the synthetic RNA may be replaced with pseudouridine residues. In vitro transcription can obtain RNA with residual immunogenicity even when pseudouridine and 5-methylcytidine are completely replaced by uridine and cytidine, respectively (see, e.g., Angel. Reprogramming Human Somatic Cells to Pluripotency Using RNA [Doctoral Thesis]. Cambridge, MA: MIT; 2011, the contents of which are incorporated herein by reference). For this reason, it is common to add immunosuppressants to the transfection medium when transfecting cells with RNA. In certain circumstances, adding immunosuppressants to the transfection medium may be undesirable, in part because the most commonly used recombinant immunosuppressant for this purpose, B18R, may be expensive and difficult to manufacture. It has now been discovered that in vivo cells can be transfected and / or reprogrammed according to the methods of the invention without using B18R or any other immunosuppressant. It has further been discovered that reprogramming in vivo cells according to the methods of the invention without using immunosuppressants may be rapid, efficient and reliable. Thus, certain embodiments relate to methods for transfecting in vivo cells, in which the transfection medium does not contain immunosuppressants. Other embodiments relate to methods for reprogramming in vivo cells, in which the transfection medium does not contain immunosuppressants. In certain circumstances, for example when using high cell densities, it may be beneficial to add immunosuppressants to the transfection medium.Thus, certain embodiments relate to a method for transfecting cells in vivo, in which the transfection medium contains an immunosuppressant. Other embodiments relate to a method for reprogramming cells in vivo, in which the transfection medium contains an immunosuppressant. In one embodiment, the immunosuppressant is B18R or a biologically active fragment, analog, variant, or family member thereof, or dexamethasone or a derivative thereof. In one embodiment, the transfection medium does not contain an immunosuppressant, and the nucleic acid dose is selected to prevent excessive toxicity. In another embodiment, the nucleic acid dose is 1 cm of tissue. 2 or less than about 1 mg per 100,000 cells, or less than about 10 mg per kg.

[0248] The reprogrammed cells generated according to certain embodiments of the invention are suitable for therapeutic and / or cosmetic applications because they do not contain undesirable foreign DNA sequences and are not exposed to animal- or human-derived products that may be unclear and may contain toxic and / or pathogenic contaminants. Furthermore, the high speed, efficiency, and reliability of certain embodiments of the invention may reduce the risk of acquiring and accumulating mutations and other chromosomal abnormalities. Thus, certain embodiments of the invention can be used to generate cells with a suitable safety profile for use in therapeutic and / or cosmetic applications. For example, by reprogramming cells with the RNA of the invention and a medium that does not contain animal- or human-derived components, cells that have not been exposed to allogeneic materials can be obtained. Thus, certain embodiments relate to reprogrammed cells with a desirable safety profile. In one embodiment, the reprogrammed cells have a normal karyotype. In another embodiment, the reprogrammed cells have a copy number variation (CNV) of less than about 5 relative to the patient genome, for example, a copy number variation of less than about 3 relative to the patient genome, or no copy number variation relative to the patient genome. In yet another embodiment, the reprogrammed cells have a normal karyotype and fewer than about 100 single nucleotide variants in the coding regions relative to the patient genome, or There are less than about 50 single nucleotide variants in the coding regions relative to the genome, or less than about 10 single nucleotide variants in the coding regions relative to the patient's genome.

[0249] Endotoxins and nucleases can be co-purified and / or associated with other proteins such as serum albumin. In particular, recombinant proteins often have high levels of associated endotoxins and nucleases, due in part to cell lysis that may occur during production. Endotoxins and nucleases can be reduced, removed, replaced, or otherwise inactivated according to a number of methods of the invention, including, for example, by acetylation, by addition of stabilizers such as sodium octanoate followed by heat treatment, by adding nuclease inhibitors to the albumin solution and / or medium, by crystallization, by contact with one or more ion exchange resins, by contact with activated charcoal, by preparative electrophoresis, or by affinity chromatography. It has now been discovered that by partially or completely reducing, removing, replacing, or otherwise inactivating endotoxins and / or nucleases from the medium and / or from one or more components of the medium, the efficiency with which cells can be transfected and reprogrammed can be increased. Thus, certain embodiments relate to methods for transfecting cells in vivo with one or more nucleic acids, in which the transfection medium is treated to partially or completely reduce, remove, replace, or otherwise inactivate one or more endotoxins and / or nucleases. Other embodiments relate to media that cause minimal degradation of nucleic acids. In one embodiment, the medium contains less than about 1 EU / mL, or less than about 0.1 EU / mL, or less than about 0.01 EU / mL.

[0250] In certain circumstances, protein-based lipid carriers such as serum albumin can be replaced with non-protein-based lipid carriers such as methyl-β-cyclodextrin. The medium of the present invention can also be used without lipid carriers, for example, when transfection is performed using a method that may not require or benefit from the presence of lipid carriers, for example, using one or more transfection reagents, polymer-based transfection reagents, or peptide-based transfection reagents, or using electroporation. Many protein-related molecules, such as metals, can be highly toxic to cells in vivo. This toxicity can cause reduced survival rate and the acquisition of mutations. Therefore, certain embodiments have the additional benefit of producing cells that are free of toxic molecules.

[0251] The associated molecular components of a protein can be measured by suspending the protein in a solution and measuring the conductivity of the solution. Thus, certain embodiments relate to a medium containing a protein, in which about 10% of the protein in water has a conductivity of less than about 500 μmho / cm. In one embodiment, the solution has a conductivity of less than about 50 μmho / cm. In another embodiment, less than about 0.65% of the dry weight of the protein comprises lipids and / or less than about 0.35% of the dry weight of the protein comprises free fatty acids.

[0252] The amount of nucleic acid delivered to in vivo cells can be increased to increase the desired effect of the nucleic acid. However, increasing the amount of nucleic acid delivered to in vivo cells beyond a certain point can cause a decrease in cell viability, in part due to the toxicity of the transfection reagent. It has now been discovered that when nucleic acid is delivered to a population of in vivo cells (e.g., cells in a region of a tissue) of a certain amount, the amount of nucleic acid delivered to each cell can depend on the total amount of nucleic acid delivered to the population of cells and on the density of the cells, with higher cell density resulting in less nucleic acid delivered to each cell. In certain embodiments, in vivo cells are transfected more than once with one or more nucleic acids. Under certain conditions, for example when cells grow, cell density may change from one transfection to the next. Thus, certain embodiments relate to a method for transfecting cells in vivo with nucleic acid, where the cells are transfected two or more times, and the amount of nucleic acid delivered to the cells is different in the two transfections. In one embodiment, the cells grow between the two transfections, and the amount of nucleic acid delivered to the cells is greater for the second of the two transfections than for the first of the two transfections. In another embodiment, the cells are transfected three or more times, and the amount of nucleic acid delivered to the cells is greater for the second of the three transfections than for the first of the same three transfections, and the amount of nucleic acid delivered to the cells is greater for the third of the same three transfections than for the second of the same three transfections. In yet another embodiment, the cells are transfected two or more times, and the maximum amount of nucleic acid delivered to the cells during each transfection is sufficiently low to obtain a viability of at least about 80% for at least two successive transfections.

[0253] It has now been discovered that modulating the amount of nucleic acid delivered to a population of proliferating in vivo cells in a series of transfections can result in increased efficacy of the nucleic acid and increased survival of the cells. In certain circumstances, it has been further discovered that when in vivo cells are contacted with one or more nucleic acids encoding one or more reprogramming factors in a series of transfections, the efficiency of reprogramming can be increased if, for at least some of the series of transfections, the amount of nucleic acid delivered in a later transfection is greater than the amount of nucleic acid delivered in a previous transfection. Accordingly, certain embodiments relate to a method for reprogramming in vivo cells, in which one or more nucleic acids are repeatedly delivered to cells in a series of transfections, and the amount of nucleic acid delivered to the cells is greater for at least one later transfection than for at least one previous transfection. In one embodiment, the cells are transfected about 2 to about 10 times, or about 3 to about 8 times, or about 4 to about 6 times. In another embodiment, the one or more nucleic acids include at least one RNA molecule, and the cell is transfected about 2 to about 10 times, and the amount of nucleic acid delivered to the cell in each transfection is the same as or greater than the amount of nucleic acid delivered to the cell in the immediately preceding transfection. In yet another embodiment, the amount of nucleic acid delivered to the cell in the first transfection is about 20 ng / cm 2 ~about 250ng / cm 2 , or 100ng / cm 2 ~600ng / cm 2 In yet another embodiment, the cells are transfected about five times at intervals of about 12 to about 48 hours, and the amount of nucleic acid delivered to the cells is about 25 ng / cm for the first transfection. 2 , and approximately 50 ng / cm for the second transfection. 2 , and approximately 100 ng / cm for the third transfection. 2 , and approximately 200 ng / cm for the fourth transfection. 2 , and approximately 400 ng / cm for the fifth transfection. 2In yet another embodiment, the cells are further transfected at least once after the fifth transfection, and the amount of nucleic acid delivered to the cells is about 400 ng / cm 2 It is.

[0254] Certain embodiments relate to a method for transfecting in vivo cells with nucleic acid, the amount of nucleic acid is determined by measuring cell density, and the amount of nucleic acid to be transfected is selected based on the measured cell density. In one embodiment, the cell density is measured by optical means. In another embodiment, the cells are repeatedly transfected, the cell density is increased between the two transfections, and the amount of nucleic acid transfected is greater for the second of the two transfections than for the first of the two transfections.

[0255] In certain circumstances, the amount of circulating protein produced in a patient may be increased by multiple administration sites. It has now been discovered that the amount of circulating protein can be increased by administering a nucleic acid to a patient. In certain embodiments, the amount of circulating protein is increased compared to the amount of circulating protein produced in a patient by administering a nucleic acid to a patient at a single injection site. In one embodiment, the administering is by injection. In another embodiment, the injection is an intradermal injection. In yet another embodiment, the injection is a subcutaneous or intramuscular injection. In some embodiments, the multiple administration sites include an administration site in the skin. In other embodiments, the multiple administration sites are at least about 1, or at least about 2, or at least about 5, or at least about 10, or at least about 20, or at least about 50, or at least about 100 administration sites. In one embodiment, the administering is performed within at least about 5 minutes, or at least about 10 minutes, or at least about 30 minutes, or at least about 1 hour, or at least about 2 hours, or at least about 5 hours, or at least about 12 hours, or at least about 1 day. In certain embodiments, the amount of circulating protein is increased by at least about 10%, or at least about 20%, or at least about 50%, or at least about 100%, or at least about 3-fold, or at least about 5-fold, or at least about 10-fold, or at least about 20-fold, or at least about 50-fold, or at least about 100-fold, or at least about 500-fold, or at least about 1000-fold, or more than 1000-fold.

[0256] It has now been discovered that in certain circumstances, the in vivo transfection efficiency and viability of cells contacted with the medium of the present invention can be improved by conditioning the medium. Thus, certain embodiments relate to a method for conditioning the medium. Other embodiments relate to the medium being conditioned. In one embodiment, the feeder is a fibroblast, and the medium is conditioned for about 24 hours. Other embodiments relate to a method for transfecting cells in vivo, in which the transfection medium is conditioned. Other embodiments relate to a method for reprogramming and / or gene editing cells in vivo, in which the medium is conditioned. In one embodiment, the feeder is mitotically inactivated, for example, by exposure to a chemical such as mitomycin-C or by exposure to gamma radiation. In certain embodiments, to some extent, for example, without wishing to be bound by theory, it may be beneficial to use only autologous material to avoid the risk of disease transmission from the feeder to the cell or the patient. Thus, certain embodiments relate to methods for transfecting cells in vivo, where the transfection medium is conditioned and the feeders are derived from the same individual as the cells to be transfected, while other embodiments relate to methods for reprogramming and / or gene editing cells in vivo, where the medium is conditioned and the feeders are derived from the same individual as the cells to be reprogrammed and / or gene edited.

[0257] Some molecules can be added to the medium by conditioning. Thus, certain embodiments relate to a medium supplemented with one or more molecules present in the conditioned medium. In one embodiment, the medium is supplemented with Wnt1, Wnt2, Wnt3, Wnt3a, or a biologically active fragment, analog, variant, agonist, or family member thereof. In another embodiment, the medium is supplemented with TGF-β, or a biologically active fragment, analog, variant, agonist, or family member thereof. In yet another embodiment, cells in vivo are reprogrammed according to the method of the invention, in which the medium is not supplemented with TGF-β for about 1 to about 5 days, and then supplemented with TGF-β for at least about 2 days. In yet another embodiment, the medium is supplemented with IL-6, IL-6R, or a biologically active fragment, analog, variant, agonist, or family member thereof. In yet another embodiment, the medium is supplemented with sphingolipids or fatty acids. In yet another embodiment, the sphingolipid is lysophosphatidic acid, lysosphingomyelin, sphingosine-1-phosphate, or a biologically active analog, variant, or derivative thereof.

[0258] In addition to mitotically inactivating cells, irradiation can, under certain conditions, change the gene expression of cells, causing them to produce less of certain proteins and more of other specific proteins, such as members of the Wnt family of proteins, than non-irradiated cells. In addition, certain members of the Wnt family of proteins can promote cell growth and transformation. It has now been discovered that, in certain circumstances, the efficiency of reprogramming can be significantly increased by contacting cells in vivo with medium conditioned using irradiated feeders instead of mitomycin-C treated feeders. It has further been discovered that the increased reprogramming efficiency observed when using irradiated feeders is caused, in part, by Wnt proteins secreted by the feeders. Accordingly, certain embodiments relate to methods for reprogramming cells in vivo, contacting the cells with Wnt1, Wnt2, Wnt3, Wnt3a, or a biologically active fragment, analog, variant, family member, or agonist thereof, e.g., an agonist of a downstream target of a Wnt protein, and / or an agent that mimics one or more of the biological effects of a Wnt protein, e.g., 2-amino-4-[3,4-(methylenedioxy)benzylamino]-6-(3-methoxyphenyl)pyrimidine.

[0259] The low efficiency of many DNA-based reprogramming methods can make these methods difficult or impossible to use with cells derived from a patient sample, which may contain only a small number of cells. In contrast, the high efficiency of certain embodiments of the present invention can enable reliable reprogramming of small numbers of cells, including single cells. Certain embodiments relate to methods for reprogramming small numbers of cells. Other embodiments relate to methods for reprogramming single cells. In one embodiment, the cells are contacted with one or more enzymes. In another embodiment, the enzyme is collagenase. In yet another embodiment, the collagenase is free of animal components. In one embodiment, the collagenase is present at a concentration of about 0.1 mg / mL to about 10 mg / mL, or about 0.5 mg / mL to about 5 mg / mL. In another embodiment, the cells are blood cells. In yet another embodiment, the cells are contacted with a medium containing one or more proteins derived from the patient's blood. In yet another embodiment, the cells are contacted with medium comprising DMEM / F12 + 2 mM L-alanyl-L-glutamine + about 5% to about 25% patient-derived serum, or about 10% to about 20% patient-derived serum, or about 20% patient-derived serum.

[0260] It has now been discovered that in certain circumstances, the proliferation rate of cells can be increased by transfecting cells in vivo with a mixture of RNAs encoding Oct4, Sox2, Klf4, and c-Myc using the medium of the present invention. If the amount of RNA delivered to the cells is too small to ensure that all of the cells are transfected, only a portion of the cells may exhibit an increased proliferation rate. In certain circumstances, such as when creating a personalized therapeutic, increasing the proliferation rate of cells may be desirable, in part because it can reduce the time required to create the therapeutic, thereby reducing the cost of the therapeutic. Thus, certain embodiments relate to a method for transfecting cells in vivo with a mixture of RNAs encoding Oct4, Sox2, Klf4, and c-Myc. In one embodiment, the cells exhibit an increased proliferation rate. In another embodiment, the cells are reprogrammed.

[0261] Many diseases are associated with one or more mutations. Mutations can be altered by contacting cells with nucleic acids that code for proteins that correct the mutations, either alone or in combination with other molecules (an example of gene editing). Examples of such proteins include nucleases, transcription activator-like effector nucleases (TALENs), and ribosomal enzymes. ), zinc finger nuclease, meganuclease, nickase, clustered regularly interspaced short palindromic repeats (CRISPR) related protein or their natural or engineered variants, family members, orthologues, fragments or fusion constructs.Therefore, certain embodiments relate to a method for transfecting cells in vivo with nucleic acid that encodes a protein that forms single-stranded or double-stranded breaks in DNA molecules, either alone or in combination with other molecules.In one embodiment, the protein is zinc finger nuclease or TALEN.In another embodiment, the nucleic acid is an RNA molecule. In yet another embodiment, the single-stranded or double-stranded break is within about 5,000,000 bases of the transcription start site of a gene selected from the group of CCR5, CXCR4, GAD1, GAD2, CFTR, HBA1, HBA2, HBB, HBD, FANCA, XPA, XPB, XPC, ERCC2, POLH, HTT, DMD, SOD1, APOE, PRNP, BRCA1, and BRCA2 or their analogs, variants, or family members. In one embodiment, the present invention relates to gene editing of MYC protein (e.g., correcting one or more mutations that may be associated with cancer), optionally by TALEN. In yet another embodiment, the cell is transfected with a nucleic acid that acts as a repair template by either causing insertion of a DNA sequence in the region of the single-stranded or double-stranded break or otherwise altering the DNA sequence in the region of the single-stranded or double-stranded break. In yet another embodiment, the cell is reprogrammed, and then the cell is gene edited. In yet another embodiment, the cells are genetically edited and then the cells are reprogrammed. In yet another embodiment, the genetic editing and reprogramming are performed within about 7 days of each other. In yet another embodiment, the genetic editing and reprogramming occur simultaneously or on the same day.In yet another embodiment, the cells are skin cells, the skin cells are genetically edited to inhibit the CCR5 gene, and the skin cells are reprogrammed into hematopoietic stem cells, thereby producing a therapeutic agent against HIV / AIDS, and the therapeutic agent is used to treat a patient with HIV / AIDS. In yet another embodiment, the skin cells are derived from the same patient that the therapeutic agent is used to treat.

[0262] Genes that can be edited in accordance with the methods of the invention to produce the therapeutic agents of the invention include genes that can be edited to restore normal function and genes that can be edited to reduce or eliminate function. Such genes include beta-globin (HBB), mutations of which may cause sickle cell disease (SCD) and beta-thalassemia; breast cancer 1, early-onset (BRCA1) and breast cancer 2, early-onset (BRCA2), mutations of which may increase susceptibility to breast cancer; CC chemokine receptor type 5 (CCR5) and CXC chemokine receptor type 4 (CXCR4), mutations of which may confer resistance to HIV infection; cystic fibrosis transmembrane conductance regulator (CFTR), mutations of which may cause cystic fibrosis; dystrophin (DMD), mutations of which may cause muscular dystrophies, including Duchenne muscular dystrophy and Becker muscular dystrophy; glutamic acid decarboxylase 1 and glutamic acid decarboxylase 2 (GAD1, GAD2), mutations of which may prevent autoimmune destruction of beta cells; and thyroid cancer 2, thyroid cancer 1, early-onset (THC2), mutations of which may increase susceptibility to breast cancer. Hemoglobin alpha 1, hemoglobin alpha 2, and hemoglobin delta (HBA1, HBA2, and HBD), which may cause anemia; desmoplakin, keratin 5, keratin 14, plectin, integrin alpha-6, integrin beta-4, laminin subunit alpha-3, laminin subunit beta-3, laminin subunit gamma-2, collagen type VII alpha 1, collagen type XVII alpha 1, and matrix metalloproteinase-1 (DSP, KRT5, KRT14, PLEC1, ITGA6, ITGB4, LAMA3, LAMB3, LAMC2, COL7A1, COL17A1, and MMP1), which may cause epidermolysis bullosa; Huntington (HTT), which may cause Huntington's disease; superoxide dismutase 1 (SOD1), which may cause amyotrophic lateral sclerosis (ALS); and pigment These include, but are not limited to, XPA, XPB, XPC, XPD (ERCC6), and polymerase (DNA-dependent), eta (POLH), which can cause xeroderma perstans; leucine-rich repeat kinase 2 (LRRK2), in which mutations can cause Parkinson's disease; and Fanconi anemia, complementation groups A, B, C, D1, D2, E, F, G, I, J, L, M, N, P (FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, FANCN, FANCP), and RAD51 homolog C (S. cerevisiae) (RAD51C), in which mutations can cause Fanconi anemia.

[0263] Certain embodiments relate to therapeutic agents comprising a nucleic acid. In one embodiment, the nucleic acid encodes one or more gene editing proteins. Other embodiments relate to therapeutic agents comprising one or more cells transfected, reprogrammed, and / or gene edited in vivo according to the methods of the invention. In one embodiment, the cells are transfected, reprogrammed, and / or gene edited, and the transfected, reprogrammed, and / or gene edited cells are introduced into a patient. In another embodiment, the cells are taken from the same patient into which the transfected, reprogrammed, and / or gene edited cells are introduced. Examples of diseases that can be treated with the therapeutic agents of the invention include, but are not limited to, Alzheimer's disease, spinal cord injury, amyotrophic lateral sclerosis, cystic fibrosis, heart disease including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, Huntington's disease, diabetes, sickle cell anemia, thalassemia, Fanconi anemia, xeroderma pigmentosum, muscular dystrophy, severe combined immunodeficiency, hereditary sensory neuropathy, cancer, and HIV / AIDS. In certain embodiments, the therapeutic agent comprises a cosmetic product. In one embodiment, cells are harvested from a patient, the cells are reprogrammed and expanded into a multiplicity of adipocytes to produce the cosmetic product, and the cosmetic product is introduced into the patient. In yet another embodiment, the cosmetic product is used for tissue regeneration.

[0264] Although detailed examples are provided herein regarding the production of particular types of cells and the generation of therapeutics comprising particular types of cells, it will be appreciated that the methods of the invention can be used to produce many other types of cells and to generate therapeutics comprising one or more of many other types of cells, e.g., by reprogramming cells according to the methods of the invention and culturing the cells under conditions that mimic one or more aspects of development by providing conditions similar to those present in the microenvironment of the developing cell.

[0265] Certain embodiments relate to libraries of cells with different human leukocyte antigen (HLA) types ("HLA-matched libraries"). HLA-matched libraries can be beneficial, in part, because they can provide for rapid production and / or distribution of therapeutics without the patient having to wait for the therapeutic to be produced from the patient's cells. Such libraries can be particularly beneficial for the production of cosmetics, as well as for the treatment of cardiac diseases and diseases of the blood and / or immune system, where patients may benefit from having ready access to therapeutics or cosmetics.

[0266] The DNA sequence of a cell can be altered by contacting the cell with a gene editing protein or inducing the cell to express a gene editing protein. However, previously disclosed gene editing proteins have the drawbacks of low binding efficiency and excessive off-target activity, which may introduce undesirable mutations into the DNA of cells, for example in therapeutic and cosmetic applications, greatly limiting their use in vivo. In these applications, the introduction of undesirable mutations into the patient's cells may lead to the development of cancer. A gene editing protein containing a StsI endonuclease cleavage domain (SEQ ID NO: 1) has been shown to induce high levels of on-target expression in vivo. It has now been discovered that the nuclease domains of StsI-HA (SEQ ID NO:2), StsI-HA2 (SEQ ID NO:3), StsI-UHA (SEQ ID NO:4), StsI-UHA2 (SEQ ID NO:5), StsI-HF (SEQ ID NO:6), and StsI-UHF (SEQ ID NO:7) can exhibit substantially lower in vivo on-target activity than previously disclosed gene editing proteins while maintaining on-target activity. Other novel engineered proteins have also been discovered that can exhibit high on-target activity in vivo, low off-target activity in vivo, small size, solubility, and other desirable properties when used as the nuclease domains of the gene editing proteins: StsI-HA (SEQ ID NO:2), StsI-HA2 (SEQ ID NO:3), StsI-UHA (SEQ ID NO:4), StsI-UHA2 (SEQ ID NO:5), StsI-HF (SEQ ID NO:6), and StsI-UHF (SEQ ID NO:7). StsI-HA, StsI-HA2 (high activity), StsI-UHA, and StsI-UHA2 (ultra-high activity) can exhibit higher in vivo on-target activity than both wild-type StsI and wild-type FokI, due in part to specific amino acid substitutions in the N-terminal region at positions 34 and 61, while StsI-HF (high fidelity) and StsI-UHF (ultra-high fidelity) can exhibit lower in vivo off-target activity than both wild-type StsI and wild-type FokI, due in part to specific amino acid substitutions in the C-terminal region at positions 141 and 152.

[0267] Thus, certain embodiments relate to proteins. In some embodiments, the proteins are present in vivo. In other embodiments, the proteins comprise a nuclease domain. In one embodiment, the nuclease domain comprises one or more of the cleavage domains of FokI endonuclease (SEQ ID NO:53), StsI endonuclease (SEQ ID NO:1), StsI-HA (SEQ ID NO:2), StsI-HA2 (SEQ ID NO:3), StsI-UHA (SEQ ID NO:4), StsI-UHA2 (SEQ ID NO:5), StsI-HF (SEQ ID NO:6), and StsI-UHF (SEQ ID NO:7), or biologically active fragments or variants thereof.

[0268] It has also been discovered that engineered gene editing proteins that include a DNA-binding domain that includes certain novel repeat sequences can exhibit lower in vivo off-target activity than previously disclosed gene editing proteins while maintaining a high level of in vivo on-target activity. Some of these engineered gene editing proteins can offer several advantages over previously disclosed gene editing proteins, including, for example, improved flexibility of the linker region that connects the repeat sequences, which can result in increased binding efficiency. Thus, certain embodiments relate to proteins that include multiple repeat sequences. In one embodiment, at least one of the repeat sequences contains the amino acid sequence: GabG, where "a" and "b" each represent any amino acid. In one embodiment, the protein is a gene editing protein. In another embodiment, one or more of the repeat sequences are present in the DNA-binding domain. In a further embodiment, "a" and "b" are each independently selected from group H and group G. In yet another embodiment, "a" and "b" are H and G, respectively. In one embodiment, the amino acid sequence is present within about 5 amino acids of the C-terminus of the repeat sequence. In another embodiment, the amino acid sequence is present at the C-terminus of the repeat sequence. In some embodiments, one or more Gs of the amino acid sequence GabG are replaced with one or more amino acids other than G, e.g., A, H, or GG. In one embodiment, the repeat sequence has a length of about 32 to about 40 amino acids, or about 33 to about 39 amino acids, or about 34 to 38 amino acids, or about 35 to about 37 amino acids, or about 36 amino acids, or more than about 32 amino acids, or more than about 33 amino acids, or more than about 34 amino acids, or more than about 35 amino acids. Other embodiments relate to proteins that include one or more transcription activator-like effector domains. In one embodiment, at least one of the transcription activator-like effector domains includes a repeat sequence. Other embodiments relate to proteins that include multiple repeat sequences generated by inserting one or more amino acids between at least two of the repeat sequences of the transcription activator-like effector domains.In one embodiment, the one or more amino acids are inserted about 1 or about 2 or about 3 or about 4 or about 5 amino acids from the C-terminus of at least one repeat sequence. The present invention relates to a protein comprising a plurality of repeat sequences, in which about every other repeat sequence has a different length than the repeat sequence immediately preceding or following the repeat sequence. In one embodiment, every other repeat sequence is about 36 amino acids long. In another embodiment, every other repeat sequence is 36 amino acids long. Still other embodiments relate to a protein comprising a plurality of repeat sequences, in which the plurality of repeat sequences comprises at least two repeat sequences, each of which is at least 36 amino acids long, and at least two of the repeat sequences that are at least 36 amino acids long are separated by at least one repeat sequence that is less than 36 amino acids long. Some embodiments relate to a protein comprising one or more sequences selected from, for example, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, and SEQ ID NO:60.

[0269] Other embodiments relate to proteins comprising a DNA binding domain. In some embodiments, the DNA binding domain comprises multiple repeat sequences. In one embodiment, the multiple repeat sequences allow for highly specific recognition of a binding site on a target DNA molecule. In another embodiment, at least two of the repeat sequences have at least about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homology to each other. In a further embodiment, at least one of the repeat sequences comprises one or more regions capable of binding to a binding site on a target DNA molecule. In yet another embodiment, the binding site comprises a distinct sequence about 1 to about 5 bases in length. In one embodiment, the DNA binding domain comprises a zinc finger. In another embodiment, the DNA binding domain comprises a transcription activator-like effector (TALE). In further embodiments, the multiple repeat sequences include at least one repeat sequence having at least about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homology to the TALE. In yet another embodiment, the gene editing protein includes a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein. In one embodiment, the gene editing protein includes a nuclear localization sequence. In another embodiment, the nuclear localization sequence includes the amino acid sequence PKKKRKV (SEQ ID NO: 471). In one embodiment, the gene editing protein includes a mitochondrial localization sequence. In another embodiment, the mitochondrial localization sequence includes the amino acid sequence: LGRVIPRKIASRASLM (SEQ ID NO: 472). In one embodiment, the gene editing protein includes a linker. In another embodiment, the linker connects the DNA binding domain to the nuclease domain. In a further embodiment, the linker is about 1 to about 10 amino acids in length. In some embodiments, the linker is about 1, about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10 amino acids in length. In one embodiment, the gene editing protein is capable of generating a nick or a double-stranded break in the target DNA molecule.

[0270] Certain embodiments relate to a method for modifying the genome of a cell in vivo, the method comprising introducing into the cell in vivo a nucleic acid molecule encoding a non-naturally occurring fusion protein comprising an artificial transcription activator-like (TAL) effector repeat domain comprising one or more repeat units of 36 amino acids in length and an endonuclease domain, wherein the repeat domain is engineered for recognition of a predetermined nucleotide sequence, and the fusion protein recognizes the predetermined nucleotide sequence. In one embodiment, the cell is a eukaryotic cell. In another embodiment, the cell is an animal cell. In a further embodiment, the cell is a mammalian cell. In yet another embodiment, the cell is a human cell. In one embodiment, the cell is a plant cell. In another embodiment, the cell is a prokaryotic cell. In some embodiments, the fusion protein introduces an endonuclease cleavage into the nucleic acid of the cell, such that the genome of the cell is modified.

[0271] Certain embodiments relate to compositions for modifying the DNA sequence of a cell in vivo, wherein the nucleic acid comprises a nucleic acid encoding a gene editing protein. Other embodiments relate to compositions for modifying the DNA sequence of a cell in vivo, wherein the nucleic acid mixture comprises a first nucleic acid encoding a first gene editing protein and a second nucleic acid encoding a second gene editing protein. The present invention relates to a composition for modifying a DNA sequence in a cell in vivo, comprising a nucleic acid mixture comprising a second nucleic acid encoding a first gene editing protein. In one embodiment, the binding site of the first gene editing protein and the binding site of the second gene editing protein are present on the same target DNA molecule. In another embodiment, the binding site of the first gene editing protein and the binding site of the second gene editing protein are separated by less than about 50 bases, or less than about 40 bases, or less than about 30 bases, or less than about 20 bases, or less than about 10 bases, or about 10 to about 25 bases, or about 15 bases. In one embodiment, the nuclease domain of the first gene editing protein and the nuclease domain of the second gene editing protein are capable of forming a dimer. In another embodiment, the dimer is capable of generating a nick or a double-stranded break in the target DNA molecule.

[0272] Certain embodiments relate to therapeutic compositions. Other embodiments relate to cosmetic compositions. In some embodiments, the composition comprises a repair template. In further embodiments, the repair template is a single-stranded DNA molecule or a double-stranded DNA molecule.

[0273] Other embodiments relate to articles of manufacture for synthesizing proteins or nucleic acids encoding proteins. In one embodiment, the article is a nucleic acid. In another embodiment, the protein comprises a DNA binding domain. In a further embodiment, the nucleic acid comprises a nucleotide sequence encoding the DNA binding domain. In one embodiment, the protein comprises a nuclease domain. In another embodiment, the nucleic acid comprises a nucleotide sequence encoding the nuclease domain. In one embodiment, the protein comprises a plurality of repeat sequences. In another embodiment, the nucleic acid encodes a plurality of repeat sequences. In a further embodiment, the nuclease domain is selected from FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, and StsI-UHF, or naturally occurring or engineered variants or biologically active fragments thereof. In one embodiment, the nucleic acid comprises an RNA polymerase promoter. In another embodiment, the RNA polymerase promoter is a T7 promoter or an SP6 promoter. In a further embodiment, the nucleic acid comprises a viral promoter. In one embodiment, the nucleic acid comprises an untranslated region. In another embodiment, the nucleic acid is an in vitro transcription template.

[0274] Certain embodiments relate to methods for inducing cells to express a protein in vivo. Other embodiments relate to methods for modifying the DNA sequence of a cell in vivo, including transfecting the cell in vivo with a gene editing protein or inducing the cell to express a gene editing protein in vivo. Still other embodiments relate to methods for reducing expression of a protein of interest in a cell in vivo. In one embodiment, the cell is induced to express a gene editing protein, where the gene editing protein is capable of creating a nick or double-strand break in a target DNA molecule. In another embodiment, the nick or double-strand break results in inactivation of the gene. Still other embodiments relate to methods for generating inactive, reduced activity, or dominant negative versions of a protein in vivo. In one embodiment, the protein is survivin. Still other embodiments relate to methods for repairing one or more mutations in a cell in vivo. In one embodiment, the cell is contacted with a repair template. In another embodiment, the repair template is a DNA molecule. In a further embodiment, the repair template does not contain a binding site for the gene editing protein. In yet another embodiment, the repair template encodes an amino acid sequence that is encoded by a DNA sequence that comprises a binding site for a gene-editing protein.

[0275] In various embodiments, the repair template is about 20 nucleotides, or about 30 nucleotides, or about 40 nucleotides, or about 50 nucleotides, or about 60 nucleotides, or about 70 nucleotides, or about 80 nucleotides, or about 90 nucleotides, or about 100 nucleotides, or about 150 nucleotides, or about 200 nucleotides, or about 300 nucleotides, or about 400 nucleotides, or about 500 nucleotides, or about 750 nucleotides, or about 1000 nucleotides. In various embodiments, the repair template is about 20-1000 nucleotides, or about 20-500 nucleotides, or about 20-400 nucleotides, or about 20-200 nucleotides, or about 20-100 nucleotides, or about 80-100 nucleotides, or about 50-100 nucleotides.

[0276] In various embodiments, the mass ratio of RNA (e.g., a synthetic RNA encoding a gene-editing protein) to repair template is about 1:10, or about 1:9, or about 1:8, or about 1:7, or about 1:6, or about 1:5, or about 1:4, or about 1:3, or about 1:2, or about 1:1, or about 2:1, or about 3:1, or about 4:1, or about 5:1, or about 6:1, or about 7:1, or about 8:1, or about 9:1, or about 10:1.

[0277] In various embodiments, the molar ratio of RNA (e.g., a synthetic RNA encoding a gene-editing protein) to repair template is about 1:10, or about 1:9, or about 1:8, or about 1:7, or about 1:6, or about 1:5, or about 1:4, or about 1:3, or about 1:2, or about 1:1, or about 2:1, or about 3:1, or about 4:1, or about 5:1, or about 6:1, or about 7:1, or about 8:1, or about 9:1, or about 10:1.

[0278] In various embodiments, the repair template has the dual function of both inducing repair at the gene editing target sequence and preventing further binding of the gene editing protein, thereby reducing or eliminating further gene editing (e.g., via the repair template inducing repair that renders what was a gene editing protein binding site unsuitable for gene editing protein binding). Thus, in some embodiments, the subject methods of gene editing are tunable to ensure a single gene edit per target site.

[0279] Other embodiments relate to methods for treating a patient, comprising administering to the patient a therapeutically or cosmetically effective amount of a protein or a nucleic acid encoding the protein. In one embodiment, the treatment results in one or more of the patient's symptoms being improved. Certain embodiments relate to methods for treating a patient, comprising: a. inducing a cell to express a protein of interest by transfecting the cell in vivo with a nucleic acid encoding the protein of interest, and / or b. reprogramming the cell in vivo. In one embodiment, the cell is reprogrammed to a less differentiated state. In another embodiment, the cell is reprogrammed by transfecting the cell with one or more synthetic RNA molecules encoding one or more reprogramming proteins. In a further embodiment, the cell is differentiated. In yet another embodiment, the cell is differentiated into one of a skin cell, a glucose-responsive insulin-producing cell, a hematopoietic cell, a cardiac cell, a retinal cell, a kidney cell, a neuronal cell, a stromal cell, an adipocyte, a bone cell, a muscle cell, an oocyte, and a sperm cell. Other embodiments relate to methods for treating a patient comprising: a. inducing cells in vivo to express a gene-editing protein by transfecting the cells with a nucleic acid encoding the gene-editing protein, and / or b. reprogramming cells in vivo.

[0280] Other embodiments relate to a complex formation medium. In one embodiment, the complex formation medium has an NA greater than about 7, or greater than about 7.2, or greater than about 7.4, or greater than about 7.6, or greater than about 7.8, or greater than about 8.0, or greater than about 8.2, or The complexation medium has a pH of greater than about 8.4, or greater than about 8.6, or greater than about 8.8, or greater than about 9.0. In another embodiment, the complexation medium comprises transferrin. In a further embodiment, the complexation medium comprises DMEM. In yet another embodiment, the complexation medium comprises DMEM / F12. Yet another embodiment relates to a method for forming a nucleic acid-transfection reagent complex. In one embodiment, the transfection reagent is incubated in the complexation medium. In another embodiment, the incubation occurs before the mixing step. In a further embodiment, the incubation step is from about 5 seconds to about 5 minutes, or from about 10 seconds to about 2 minutes, or from about 15 seconds to about 1 minute, or from about 30 seconds to about 45 seconds. In one embodiment, the transfection reagent is selected from Table 1. In another embodiment, the transfection reagent is a lipid or lipid-like substance. In a further embodiment, the transfection reagent comprises a cation. In yet another embodiment, the cation is a multivalent cation. In yet another embodiment, the transfection reagent is N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (also known as MVL5) or a derivative thereof.

[0281] Certain embodiments relate to methods for inducing cells to express a protein by contacting the cells with a nucleic acid in vivo. In one embodiment, the cell is a mammalian cell. In another embodiment, the cell is a human cell or a rodent cell. Other embodiments relate to cells generated using one or more of the methods of the invention. In one embodiment, the cell is present in a patient. In another embodiment, the cell is isolated from a patient. Other embodiments relate to screening libraries comprising cells generated using one or more of the methods of the invention. In one embodiment, the screening libraries are used for at least one of toxicity screening, including cardiotoxicity screening, neurotoxicity screening, and hepatotoxicity screening, efficacy screening, high throughput screening, high content screening, and other screening.

[0282] Other embodiments relate to kits containing nucleic acids. In one embodiment, the kit contains a delivery reagent (aka "transfection reagent"). In another embodiment, the kit is a reprogramming kit. In a further embodiment, the kit is a gene editing kit. Other embodiments relate to kits for generating nucleic acids. In one embodiment, the kit contains at least two of pseudouridine-triphosphate, 5-methyluridine triphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine triphosphate, N4-methylcytidine triphosphate, N4-acetylcytidine triphosphate, and 7-deazaguanosine triphosphate, or one or more derivatives thereof. Other embodiments relate to therapeutic or cosmetic products comprising nucleic acids. In one embodiment, the therapeutic or cosmetic product is a pharmaceutical composition. In another embodiment, the pharmaceutical composition is formulated. In a further embodiment, the formulation comprises an aqueous suspension of liposomes. Examples of liposome components are described in Table 1 and are given by way of illustration and not by way of limitation. In one embodiment, the liposome comprises one or more polyethylene glycol (PEG) chains. In another embodiment, the PEG is PEG2000. In a further embodiment, the liposome comprises 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) or a derivative thereof. In one embodiment, the therapeutic agent comprises one or more ligands. In another embodiment, the therapeutic agent comprises at least one of androgen, CD30 (TNFRSF8), cell penetrating peptide, CXCR, estrogen, epidermal growth factor, EGFR, HER2, folate, insulin, insulin-like growth factor I, interleukin 13, integrin, progesterone, stromal derived factor 1, thrombin, vitamin D, and transferrin, or biologically active fragments or variants thereof. Still other embodiments relate to therapeutic or cosmetic products comprising cells produced using one or more of the methods of the present invention. In one embodiment, the therapeutic agent is a therapeutic agent for diseases including, but not limited to, type 1 diabetes, heart disease including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, and the like. The compositions may be administered to a patient to treat any of the diseases or disorders described herein, including fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases, including hepatitis and HIV / AIDS.

[0283] Other embodiments relate to methods for reprogramming cells in vivo. In one embodiment, the cells are reprogrammed by contacting the cells with one or more nucleic acids. In one embodiment, the cells are contacted with multiple nucleic acids encoding at least one of Oct4 protein, Sox2 protein, Klf4 protein, c-Myc protein, Lin28 protein, or biologically active fragments, variants, or derivatives thereof. In another embodiment, the cells are contacted with multiple nucleic acids encoding multiple proteins including Oct4 protein, Sox2 protein, Klf4 protein, and c-Myc protein, or one or more biologically active fragments, variants, or derivatives thereof. Yet other embodiments relate to methods for gene editing cells in vivo. In one embodiment, the cells are gene edited by contacting the cells with one or more nucleic acids.

[0284] Certain embodiments relate to a method for inducing an in vivo cell to express a protein of interest comprising contacting the in vivo cell with a solution comprising albumin treated with an ion exchange resin or activated charcoal and one or more nucleic acid molecules, at least one of which encodes the protein of interest. In one embodiment, the method results in a cell expressing the protein of interest. In another embodiment, the one or more nucleic acid molecules comprise a synthetic RNA molecule. In one embodiment, the cell is a skin cell. In another embodiment, the cell is a muscle cell. In yet another embodiment, the cell is a skin fibroblast. In yet another embodiment, the cell is a myoblast. In one embodiment, the protein of interest is an extracellular matrix protein. In another embodiment, the protein of interest is selected from elastin, collagen, laminin, fibronectin, vitronectin, lysyl oxidase, elastin-binding protein, growth factor, fibroblast growth factor, transforming growth factor be...

Claims

1. 1. A composition for use in a method for genetically editing cells in the skin of a human subject, comprising: The method includes transdermally administering the composition to the human subject to generate single-strand or double-strand breaks in DNA of the cells; the composition comprises an effective dose of about 300 ng of RNA encoding a protein of interest, causing the cell to express the protein of interest, the RNA comprising one or more of 5-hydroxymethyluridine, 5-carboxyuridine, 5-methoxyuridine, and pseudouridine; The protein of interest is a gene editing protein; composition.

2. The composition of claim 1, wherein the RNA comprises a 5' cap structure, a 5'-UTR comprising a Kozak consensus sequence, a 5'-UTR comprising a sequence that increases RNA stability in vivo, a 3'-UTR comprising a sequence that increases RNA stability in vivo, and / or a 3' poly(A) tail.

3. the RNA is from about 200 nucleotides to about 5000 nucleotides in length, from about 500 nucleotides to about 2000 nucleotides in length, from about 500 nucleotides to about 1500 nucleotides in length, or from about 500 nucleotides to about 1000 nucleotides in length; The RNA is prepared by in vitro transcription. The composition according to claim 1 or 2.

4. 4. The composition of claim 1, further comprising one or more lipids that enhance uptake of RNA by cells.

5. The one or more lipids may be 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol; 1,2-dioleoyl-3-trimethylammonium-propane; N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-aminium; 1,2-dimyristoyl-3-trimethylammonium-propane; 1,2-dipalmitoyl-3-trimethylammonium-propane; 1,2-stearoyl-3-trimethylammonium-propane; 1,2-dioleoyl-3-dimethylammonium-propane; 1,2-Dimyristoyl-3-dimethylammonium-propane; 1,2-Dipalmitoyl-3-dimethylammonium-propane; 1,2-Distearoyl-3-dimethylammonium-propane; Dimethyldioctadecylammonium; 1,2-Dilauroyl-sn-glycero-3-ethylphosphocholine; 1,2-Dimyristoyl-sn-glycero-3-ethylphosphocholine; 1,2-Dimyristoleyl-sn-glycero-3-ethylphosphocholine; 1,2-Dipalmitoyl-sn-glycero-3-ethylphosphocholine; 1,2-Dipalmitoyl-sn-glycero-3-ethylphosphocholine 1,2-distearoyl-sn-glycero-3-ethylphosphocholine; 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine; 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine; 1,2-di-O-octadecenyl-3-trimethylammonium propane; N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide; 2,3-dioleoyl 5. The composition of claim 4, wherein the compound is selected from: 1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylamide; N-[1-(2,3-dimyristyloxy)propyl]-N,N-dimethyl-N-(2-hydroxyethyl)ammonium bromide; transfection reagents; dioctadecylamidoglyceryl spermine; dioleoylphosphatidylethanolamine; and combinations thereof.

6. Approximately 300 ng of RNA is approximately 10 cm 2 Less than or equal to 5 cm 2 Less than or equal to 1 cm 2 Less than or equal to about 0.5 cm 2 Less than or equal to about 0.2 cm 2 Administered per therapeutic area as follows: A composition according to any one of claims 1 to 5.

7. Administered approximately once a week for at least 2 weeks; Administered approximately once every other week for at least one month, or Administered monthly, or Administered approximately once every other month The composition according to any one of claims 1 to 6.

8. 8. The composition of claim 7, which is administered for at least 2 months, or at least 4 months, or at least 6 months, or at least 9 months, or at least 1 year.

9. 12. The method of claim 11, wherein the human subject Acne, acne vulgaris, summer acne, acne conglomerata, cosmetic acne, acne fulminans, keloid acne nuchalensis, mechanical acne, drug-induced acne, miliary necrotizing acne, gangrenous acne, erythematous acne, actinic keratosis, urticaria, acute urticaria, allergic contact dermatitis, allergic dermatitis, alopecia areata, angioedema, tinea pedis, atopic dermatitis, autosensitization dermatitis, infantile acne, hair loss, basal cell carcinoma, blastomycosis, blackheads, birthmarks, skin pigmentation disorders, pimples, bruises, insect bites, insect stings, burns, cellulitis, scrub mites, chloracne, cholinergic urticaria or stress urticaria, chronic urticaria, Cold urticaria, Confluent reticular papillomatosis, Corn, Cyst, Pityriasis capitis, Dermatitis herpetiformis, Dermatographia, Sweaty eczema, Diaper rash, Dry skin, Dyshidrosis, Ectodermal dysplasia, Hypohidrotic ectodermal dysplasia, X-linked hypohidrotic ectodermal dysplasia, Eczema, Epidermodysplasia verruciformis, Erythema nodosum, Exfoliative acne, Exercise-induced anaphylactic folliculitis, Sebum excess, Folliculitis, Epheliditis, Chilblains, Tinea unguium, Hair density, Hair growth, Hair growth rate, Halogen acne, Alopecia, Miliaria rubra, Hematoma, Herpes simplex infection, Hidradenitis suppurativa, Urticaria, Hyperhidrosis, Hyperpigmentation, Hypohidrotic ectodermal dysplasia Lamiella dysplasia, hypopigmentation, impetigo, ingrowth of hair, thermal urticaria, ingrown nails, childhood or neonatal acne, pruritus, irritant contact dermatitis, jock itch, Kaposi's sarcoma, keloid, keratosis, keratosis pilaris, lichen planus, lichen sclerosus, lupus miliaris disseminatus facialis, melanoma, melasma, lentigines, molluscum contagiosum, nail growth rate, nail health, neurodermatitis, nummular eczema, occupational acne, oily acne, oily skin, onychomycosis, physical urticaria, pilonidal cyst, pityriasis rosea, tinea versicolor, poison ivy rash, acne pomade, pseudofolliculitis hair folliculitis or nuchal acne keloid, psoriasis, psoriatic arthritis, pressure urticaria or delayed urticaria, cuts, abrasions, rashes, rare urticaria or water urticaria, rhinoplasty, ringworm, rosacea, Rothmund-Thompson syndrome, loose skin, scabies, scars, seborrhea, seborrheic dermatitis, shingles, skin cancer, skin tags, solar urticaria, spider bites, squamous cell carcinoma, stretch marks, sunburn, tar acne, tropical acne, thinning skin, verruca versicolor, transient acantholytic dermatosis, miliaria acne necrotica, dull skin, varicose veins, venous eczema, angioedema, vitiligo, warts, Weber-Christian disease, wounds, wrinkles, X-linked hypohidrotic ectodermal dysplasia, dry eczema, yeast infections, and general signs of aging having a disease, disorder, or condition of the integumentary system selected from one or more of:

9. The composition according to any one of claims 1 to 8.

10. The composition of claim 9, which alters, modifies and / or changes the appearance of the integumentary system.

11. The composition is administered using a patch delivery system; The patch delivery system comprises: the composition encapsulated within a membrane; Approximately 100cm 2 Less than or equal to 50 cm 2 Less than or equal to 20 cm 2 Less than or equal to 10 cm 2 Less than or equal to 5 cm 2 Less than or equal to 1 cm 2 Less than or equal to about 0.5 cm 2 Less than or equal to about 0.2 cm 2 an array of delivery needles delivering approximately 300 ng of RNA per treatment area of Equipped with 11. The composition according to any one of claims 1 to 10.

12. 12. The composition of any one of claims 1 to 11, wherein the gene editing protein is selected from a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease, a meganuclease, and a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein.

13. 13. The composition of any one of claims 1 to 12, wherein an effective dose of about 300 ng of RNA encoding the protein of interest provides greater expression of the protein of interest than a dose of about 1200 ng of RNA encoding the protein of interest between days 2 and 5 after administration of the RNA.

14. 1. A composition for use in a method for genetically editing cells in the skin of a human subject, comprising: The method includes transdermally administering to a human subject in need of gene editing of skin cells a unit dosage form of the composition; the unit dosage form comprises RNA encoding a gene-editing protein, the RNA comprising one or more of 5-hydroxymethyluridine, 5-carboxyuridine, 5-methoxyuridine, and pseudouridine; the unit dosage form comprises about 300 ng of the RNA; administering the unit dosage form creates a single strand break or a double strand break in the DNA of the cell, thereby gene editing the cell. composition.

15. The composition of claim 14, wherein the RNA comprises a 5' cap structure, a 5'-UTR comprising a Kozak consensus sequence, a 5'-UTR comprising a sequence that increases RNA stability in vivo, a 3'-UTR comprising a sequence that increases RNA stability in vivo, and / or a 3' poly(A) tail.

16. the RNA is from about 200 nucleotides to about 5000 nucleotides in length, from about 500 nucleotides to about 2000 nucleotides in length, from about 500 nucleotides to about 1500 nucleotides in length, or from about 500 nucleotides to about 1000 nucleotides in length; The RNA is prepared by in vitro transcription.

16. The composition according to any one of claims 14 to 15.

17. 17. The composition of any one of claims 14 to 16, comprising one or more lipids that enhance uptake of RNA by cells.

18. The one or more lipids may be 3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol; 1,2-dioleoyl-3-trimethylammonium-propane; N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-aminium; 1,2-dimyristoyl-3-trimethylammonium-propane; 1,2-dipalmitoyl-3-trimethylammonium-propane; 1,2-stearoyl-3-trimethylammonium-propane; 1,2-dioleoyl-3-dimethylammonium-propane; 1,2-Dimyristoyl-3-dimethylammonium-propane; 1,2-Dipalmitoyl-3-dimethylammonium-propane; 1,2-Distearoyl-3-dimethylammonium-propane; Dimethyldioctadecylammonium; 1,2-Dilauroyl-sn-glycero-3-ethylphosphocholine; 1,2-Dimyristoyl-sn-glycero-3-ethylphosphocholine; 1,2-Dimyristoleyl-sn-glycero-3-ethylphosphocholine; 1,2-Dipalmitoyl-sn-glycero-3-ethylphosphocholine; 1,2-Dipalmitoyl-sn-glycero-3-ethyl 1,2-distearoyl-sn-glycero-3-ethylphosphocholine; 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine; 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine; 1,2-di-O-octadecenyl-3-trimethylammonium propane; N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide; 2,3-dioleyloxy 18. The composition of claim 17, selected from: ci-N-[2-sperminecarboxamido]ethyl-N,N-dimethyl-1-propanamnium trifluoroacetate; 1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylamide; N-[1-(2,3-dimyristyloxy)propyl]-N,N-dimethyl-N-(2-hydroxyethyl)ammonium bromide; transfection reagents; dioctadecylamidoglyceryl spermine; dioleoylphosphatidylethanolamine; and combinations thereof.

19. Approximately 300 ng of RNA is approximately 10 cm 2 Less than or equal to 5 cm 2 Less than or equal to 1 cm 2 Less than or equal to about 0.5 cm 2 Less than or equal to about 0.2 cm 2 19. The composition of any one of claims 14 to 18, administered per treatment area:

20. Administered approximately once a week for at least 2 weeks; Administered approximately once every other week for at least one month, or Administered monthly, or Administered approximately once every other month 20. The composition of any one of claims 14 to 19.

21. 21. The composition of claim 20, which is administered for at least 2 months, or at least 4 months, or at least 6 months, or at least 9 months, or at least 1 year.

22. 12. The method of claim 11, wherein the human subject Acne, acne vulgaris, summer acne, acne conglomerata, cosmetic acne, acne fulminans, keloid acne nuchalensis, mechanical acne, drug-induced acne, miliary necrotizing acne, gangrenous acne, erythematous acne, actinic keratosis, urticaria, acute urticaria, allergic contact dermatitis, allergic dermatitis, alopecia areata, angioedema, tinea pedis, atopic dermatitis, autosensitization dermatitis, infantile acne, hair loss, basal cell carcinoma, blastomycosis, blackheads, birthmarks, skin pigmentation disorders, pimples, bruises, insect bites, insect stings, burns, cellulitis, scrub mites, chloracne, cholinergic urticaria or stress urticaria, chronic urticaria, Cold urticaria, Confluent reticular papillomatosis, Corn, Cyst, Pityriasis capitis, Dermatitis herpetiformis, Dermatographia, Sweaty eczema, Diaper rash, Dry skin, Dyshidrosis, Ectodermal dysplasia, Hypohidrotic ectodermal dysplasia, X-linked hypohidrotic ectodermal dysplasia, Eczema, Epidermodysplasia verruciformis, Erythema nodosum, Exfoliative acne, Exercise-induced anaphylactic folliculitis, Sebum excess, Folliculitis, Epheliditis, Chilblains, Tinea unguium, Hair density, Hair growth, Hair growth rate, Halogen acne, Alopecia, Miliaria rubra, Hematoma, Herpes simplex infection, Hidradenitis suppurativa, Urticaria, Hyperhidrosis, Hyperpigmentation, Hypohidrotic ectodermal dysplasia Lamiella dysplasia, hypopigmentation, impetigo, ingrowth of hair, thermal urticaria, ingrown nails, childhood or neonatal acne, pruritus, irritant contact dermatitis, jock itch, Kaposi's sarcoma, keloid, keratosis, keratosis pilaris, lichen planus, lichen sclerosus, lupus miliaris disseminatus facialis, melanoma, melasma, lentigines, molluscum contagiosum, nail growth rate, nail health, neurodermatitis, nummular eczema, occupational acne, oily acne, oily skin, onychomycosis, physical urticaria, pilonidal cyst, pityriasis rosea, tinea versicolor, poison ivy rash, acne pomade, pseudofolliculitis hair folliculitis or nuchal acne keloid, psoriasis, psoriatic arthritis, pressure urticaria or delayed urticaria, cuts, abrasions, rashes, rare urticaria or water urticaria, rhinoplasty, ringworm, rosacea, Rothmund-Thompson syndrome, loose skin, scabies, scars, seborrhea, seborrheic dermatitis, shingles, skin cancer, skin tags, solar urticaria, spider bites, squamous cell carcinoma, stretch marks, sunburn, tar acne, tropical acne, thinning skin, verruca versicolor, transient acantholytic dermatosis, miliaria acne necrotica, dull skin, varicose veins, venous eczema, angioedema, vitiligo, warts, Weber-Christian disease, wounds, wrinkles, X-linked hypohidrotic ectodermal dysplasia, dry eczema, yeast infections, and general signs of aging having a disease, disorder, or condition of the integumentary system selected from one or more of:

22. The composition according to any one of claims 14 to 21.

23. 23. The composition of claim 22, which alters, modifies, and / or changes the appearance of the integumentary system.

24. The composition is administered using a patch delivery system; The patch delivery system comprises: the composition encapsulated within a membrane; Approximately 100cm 2 Less than or equal to 50 cm 2 Less than or equal to 20 cm 2 Less than or equal to 10 cm 2 Less than or equal to 5 cm 2 Less than or equal to 1 cm 2 Less than or equal to about 0.5 cm 2 Less than or equal to about 0.2 cm 2 an array of delivery needles delivering approximately 300 ng of RNA per treatment area of Equipped with 24. The composition according to any one of claims 14 to 23.

25. 25. The composition of any one of claims 14 to 24, wherein the gene editing protein is selected from a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease, a meganuclease, and a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein.

26. 26. The composition of any one of claims 14-25, wherein the unit dosage form of about 300 ng of the RNA encoding the gene-editing protein provides greater expression of the gene-editing protein than a dose of about 1200 ng of RNA encoding the gene-editing protein between days 2 and 5 after administration of the RNA.

Images