Method for isolating and amplifying nucleic acid

Abstract

To provide simple methods for separating nucleic acid from nucleic acid-containing samples and simple methods for amplifying nucleic acid in samples.SOLUTION: The invention provides a method for isolating a nucleic acid comprising the steps of: contacting nucleic acid to phosphate and / or carbonate salt of alkaline earth metal of which solubility to water is 1 g / 100 g H2O or less to form a complex; heating the formed complex of the nucleic acid and the phosphate and / or carbonate salt of alkaline earth metal salt at 45°C or higher. The invention also provides a method for amplifying nucleic acid comprising the steps of: contacting nucleic acid to phosphate and / or carbonate salt of alkaline earth metal of which solubility to water is 1 g / 100 g H2O or less to form a complex; heating the formed complex of the nucleic acid and the phosphate and / or carbonate salt of alkaline earth metal salt.SELECTED DRAWING: Figure 15

Description

[Technical field]

[0001] The present invention relates to a method and a kit for isolating nucleic acid from a biological sample, a method and an apparatus for isolating and amplifying nucleic acid from a biological sample, and an adsorbent for nucleic acid. [Background technology]

[0002] A method for isolating nucleic acids from cells has long been widely used, in which cells are lysed, proteins are removed by phenol-chloroform treatment, and nucleic acids are precipitated by adding ethanol. This method is multi-step and laborious. In addition, the recovery rate of nucleic acids in the sample is low, so it is difficult to apply to samples with low nucleic acid content. Other methods that have been used include adsorbing nucleic acids to silica carriers in the presence of chaotropic salts and then eluting the nucleic acids with an appropriate eluent (Boom method), eluting nucleic acids adsorbed to magnetic beads (SPRI method), and isolating nucleic acid components using charge interactions (Charge-Switch technology method).However, these methods require expensive equipment and are not suitable for processing a large number of samples.

[0003] In recent years, a method has been proposed in which, after lysing cells, the released nucleic acids are adsorbed onto particulate hydroxyapatite, and the complex of nucleic acid and hydroxyapatite is precipitated and separated from the sample liquid. Hydroxyapatite strongly adsorbs nucleic acids, so the nucleic acids are dissociated or desorbed from the hydroxyapatite using a high-concentration aqueous phosphate solution (phosphate buffer) (Patent Document 1). However, since hydroxyapatite adsorbs various organic substances such as proteins and sugars in addition to nucleic acids, a process of separating the nucleic acids from these organic substances is required. Furthermore, when the separated nucleic acids are subjected to a nucleic acid amplification method, a high concentration phosphate buffer inhibits the nucleic acid amplification enzyme used in the nucleic acid amplification method, so it is necessary to remove the phosphate by dialysis, gel filtration, ultrafiltration, etc. before the nucleic acid amplification. The method of Patent Document 1 is difficult to apply to samples with a low nucleic acid content because the nucleic acid recovery rate decreases in the phosphate removal step. In addition, the process of removing low molecular weight substances is not only time-consuming, but dialysis takes a long time, from 12 to 24 hours, and gel filtration and ultrafiltration require special equipment. Ultrafiltration in particular has the drawback of requiring expensive membranes for each sample.

[0004] Also, a method has been proposed in which particulate strontium apatite (hereinafter sometimes abbreviated as "SrHAP") is added to a cell lysate, nucleic acids in the lysate are adsorbed to SrHAP, and a complex of nucleic acids and SrHAP is precipitated and separated from the sample liquid. (Patent Document 2). Since SrHAP selectively adsorbs nucleic acids, a nucleic acid-SrHAP complex with high purity and high concentration can be obtained. Furthermore, nucleic acids can be dissociated or desorbed from the nucleic acid-SrHAP complex using a phosphate solution with a lower concentration than that of hydroxyapatite. However, in the method of Patent Document 2, nucleic acids adsorbed to SrHAP are desorbed from SrHAP using a low-concentration phosphate buffer, and the solution diluted with phosphate buffer is subjected to a nucleic acid amplification reaction. This has the drawbacks of lower detection sensitivity due to the low nucleic acid concentration, low nucleic acid recovery rate, laborious work, time-consuming work, and high cost. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Patent Publication No. 2000-23668 [Patent Document 2] Patent Publication No. 2017-35651 [Non-patent literature]

[0006] [Non-Patent Document 1] SCIENTIFIC REPORTS 6:38561(2016) [Non-Patent Document 2] Oral Diseases (2015) 21, 886-893 [Non-Patent Document 3] Osaka University Dental Journal, 62(1)P.15-17 [Non-Patent Document 4] SCIENTIFIC REPORTS 6:36886(2016) Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to provide a method and a kit for easily separating nucleic acid from a sample containing the nucleic acid. Another object of the present invention is to provide a method and an apparatus for easily amplifying the nucleic acid in the sample. A further object of the present invention is to provide a novel nucleic acid adsorbent. [Means for solving the problem]

[0008] The present inventors have conducted extensive research to solve the above problems and have obtained the following findings. (i) A compound which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g HO or less (hereinafter sometimes referred to as the "nucleic acid adsorbent of the present invention") preferentially or selectively adsorbs nucleic acids over proteins in an aqueous solution. (ii) By heating the complex between nucleic acid and the nucleic acid adsorbent of the present invention to 45°C or higher, the nucleic acid is dissociated or desorbed from the nucleic acid adsorbent of the present invention without the need for a treatment step with a dissociating agent such as an aqueous phosphate solution. (iii) Since nucleic acid dissociates from the nucleic acid adsorbent of the present invention at temperatures of 45°C or higher, nucleic acid dissociation and nucleic acid amplification can be performed simultaneously by simply adding a complex of nucleic acid and the nucleic acid adsorbent of the present invention to a nucleic acid amplification reaction solution.

[0009] The present invention has been completed based on the above findings, and provides the following [1] to [1 2 ] is provided. [1] A method for separating nucleic acid, comprising the steps of: contacting nucleic acid with an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g HO or less; and heating the complex of nucleic acid and an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g HO or less obtained by the contact to 45° C. or more. [2] The method according to [1], wherein the phosphate and / or carbonate of an alkaline earth metal having a solubility in water of 1 g / 100 g H2O or less is an apatite containing strontium. [3] The method according to [1] or [2], wherein the step of contacting an alkaline earth metal phosphate and / or carbonate having a solubility of 1 g / 100 g H2O or less is carried out at a temperature of 30°C or less. [4] A method for amplifying a nucleic acid, comprising the step of amplifying a nucleic acid separated by the method according to any one of [1] to [3]. [5] A method for amplifying nucleic acid, comprising the steps of: contacting nucleic acid with an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g HO or less; and causing a nucleic acid amplification reaction to occur by adding a complex of nucleic acid and an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g HO or less obtained by the contact to a nucleic acid amplification solution. [6] The method according to [5], wherein the phosphate and / or carbonate of an alkaline earth metal having a solubility in water of 1 g / 100 g H2O or less is an apatite containing strontium. [7] The method according to [5] or [6], wherein the step of contacting the nucleic acid with an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less is carried out at a temperature of 30°C or less. [8] A nucleic acid separation kit, comprising an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less contained in a liquid-passing portion of a liquid-passing container. [9] A nucleic acid amplification device having a nucleic acid adsorption container containing an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less, and a nucleic acid amplification container. machine and a means for transferring a complex of an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less and a nucleic acid from the nucleic acid adsorption container to a nucleic acid amplification container. acid increase Width device.

[10] A nucleic acid adsorption container containing an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less, and a nucleic acid amplification machine a means for discharging the sample solution from the nucleic acid adsorption container after the nucleic acid in the sample solution containing the nucleic acid has been adsorbed onto a phosphate and / or a carbonate of an alkaline earth metal having a solubility in water of 1 g / 100 g H2O or less; and a means for discharging the sample solution from the nucleic acid adsorption container after discharging the sample solution. machine and means for attaching the core to the core. acid increase Width device.

[11] A micropipette having a tip in which an alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less is contained, and a nucleic acid amplification machine Equipped with, nuclear acid increase Width device.

[12] Strontium apatite (Sr 10 (PO4)6(OH)2), halogenated strontium apatite, strontium carbonate, strontium carbonate apatite, strontium hydrogen phosphate, poorly crystalline hydroxyapatite (Ca 10 A nucleic acid adsorbent comprising at least one compound selected from the group consisting of (PO4)6(OH)2), barium apatite, halide barium apatite, barium phosphate, barium hydrogen phosphate, barium carbonate, magnesium-substituted strontium apatite, and zinc-substituted strontium apatite. Effect of the Invention

[0010] Nucleic acid isolation method The nucleic acid adsorbent of the present invention adsorbs nucleic acid simply by coming into contact with dissolved nucleic acid. In addition, biological samples such as cell lysates contain a large amount of protein in addition to nucleic acids, but the nucleic acid adsorbent of the present invention preferentially or selectively adsorbs nucleic acids because the adsorption force of nucleic acids is much stronger than that of proteins. Therefore, by using the nucleic acid adsorbent of the present invention, it is possible to separate high-purity nucleic acids without performing a process of separating nucleic acids and proteins in advance or a process of separating nucleic acids and proteins after nucleic acid desorption. Since nucleic acids are firmly fixed to the adsorbent of the present invention, it is possible to remove impurities other than nucleic acids by repeatedly washing the adsorbent with water, and to extract high-purity nucleic acids, and it has the effect of concentrating nucleic acids on the surface of the adsorbent, so that the detection sensitivity of nucleic acids can be dramatically improved.

[0011] In the nucleic acid separation method of the present invention, the nucleic acid is dissociated by heating the complex between the nucleic acid and the nucleic acid adsorbent of the present invention to 45° C. or higher. Therefore, there is no need to perform a step of treating with a dissociating agent such as an aqueous phosphate solution, and this is extremely simple.

[0012] Nucleic Acid Amplification Method In addition, when the nucleic acid separated by detachment from the adsorbent by treatment with an aqueous phosphate solution is subjected to a nucleic acid amplification reaction, it is desirable to remove the dissociating agent such as an aqueous phosphate solution prior to the nucleic acid amplification reaction, since the nucleic acid amplification enzyme used in the nucleic acid amplification method is inhibited in the presence of a high concentration of phosphate. In the nucleic acid amplification method of the present invention, the nucleic acid adsorbed to the nucleic acid adsorbent is purified by washing with water to remove excess phosphate and other impurities without being desorbed, thereby avoiding the problem of reduced sensitivity due to dilution caused by making a solution using a dissociating agent and then subjecting it to the nucleic acid amplification method.

[0013] In addition, dialysis usually takes a long time, such as 12 to 24 hours, and gel filtration and ultrafiltration require special equipment. In particular, ultrafiltration requires expensive membranes for each sample. In the method of Patent Document 2, the nucleic acid in the sample solution is taken out from the sample solution while adsorbed to SrHAP, and the nucleic acid is washed with water while adsorbed to the SrHAP surface, so that the concentration and purification of the nucleic acid are performed on the SrHAP surface, and the above-mentioned steps such as dialysis, gel filtration, and ultrafiltration can be omitted, which is efficient. However, a step of desorbing the nucleic acid from the SrHAP surface with a desorbing agent is required after that, and when the concentration of the phosphate buffer used is high, phosphate may be brought into the nucleic acid amplification solution and the nucleic acid amplification reaction may not proceed, and when the concentration of the phosphate buffer is low, the nucleic acid may not be desorbed from SrHAP and the amount of nucleic acid may be small, so the nucleic acid amplification reaction may not proceed. Since the appropriate phosphate buffer concentration also depends on the adsorption power of the nucleic acid, trial and error is required to find the optimal condition, and a period of investigation is required for that. Due to these circumstances, it is actually time-consuming and expensive. In this respect, the method of the present invention does not require a step of desorbing the nucleic acid from the nucleic acid adsorbent using a phosphate buffer, so it is not time-consuming and the nucleic acid in the sample can be amplified in a short time of about 1 to 2.5 hours from the collection of the sample.

[0014] A feature of the present invention is that nucleic acids dissociate from the nucleic acid adsorbent of the present invention at temperatures of 45° C. or higher, so that the nucleic acid adsorbent of the present invention with adsorbed nucleic acids can be added directly to a nucleic acid amplification reaction solution to initiate the nucleic acid amplification reaction, allowing dissociation of nucleic acids and nucleic acid amplification reaction to be carried out simultaneously. Therefore, this is a very simple method, and the entire process can be easily automated.

[0015] The present inventors have also discovered that nucleic acids can be eluted from cells by heating at a temperature of about 50°C or higher, preferably 60 to 98°C, and particularly 60 to 67°C. Since this temperature is similar to the nucleic acid amplification reaction temperature, the steps from nucleic acid extraction from a biological sample containing cells to nucleic acid amplification can be easily carried out in a single device.

[0016] As described above, the nucleic acid amplification method of the present invention is a simple and inexpensive method that can be performed in a short time, and therefore can be suitably used for processing a large number of biological samples. In particular, it is easy to incorporate into hospital tests and mass screenings that require rapid results for a large number of biological samples. For example, clinical tests for measles, tuberculosis, pneumonia, avian influenza infection, herpes virus infection, severe acute respiratory syndrome (SARS-CoV), etc., are actually performed using nucleic acid amplification methods such as PCR, and the method of the present invention can be used as a nucleic acid amplification method for these. It is also very useful as a nucleic acid amplification method that can quickly diagnose the presence or absence of infection during a sudden epidemic of an infectious disease such as the novel coronavirus disease (COVIT-19) caused by a new virus (2019-nCoV). By quickly identifying pathogenic microorganisms using the method of the present invention, a treatment strategy can be formulated in a timely manner. In addition, it is required that a detection test for food poisoning bacteria in food be performed as quickly as possible so as not to extend the period until the expiration date. Since the nucleic acid amplification method of the present invention can be performed in a short period of time, it can be suitably used for a detection test for food poisoning bacteria. It will also be possible to easily detect pathogenic microorganisms in environmental water (tap water, lake water, river water, etc.) and soil. Since nucleic acid amplification can now be easily performed in laboratories, the nucleic acid amplification method of the present invention is expected to be used in a wide range of applications.

[0017] A particularly suitable application of the nucleic acid amplification method of the present invention is the detection of Streptococcus mutans from oral samples such as saliva. Streptococcus mutans is not only a typical causative agent of dental caries, but is also known to be associated with systemic diseases. For example, the presence of Streptococcus mutans that has the surface cnm protein that binds to type I collagen (cnm-positive Streptococcus mutans) has been associated with cerebral microbleeds (SCIENTIFIC REPORTS 6:38561(2016), Oral Diseases(2015)21,886-893), cognitive decline (SCIENTIFIC REPORTS 6:38561(2016)), inflammatory bowel disease (Osaka University Dental Journal, 62(1)P.15-17), and non-alcoholic steatohepatitis (NASH: Non-alcoholic steatohepatitis) (Osaka University Dental Journal, 62(1)P.15-17, SCIENTIFIC REPORTS 6:36886(2016)). Therefore, by examining whether or not one has cnm-positive Streptococcus mutans, it is possible to predict the onset of these diseases and prevent them at an early stage.

[0018] A commonly used method for detecting Streptococcus mutans in the oral cavity is the method described in Oral Diseases (2015) 21, 886-893. In this method, saliva or dental plaque is applied to MSB (Mitis-Salivarius-Bacitracin) agar medium, and after culturing for two days, colonies are collected and inoculated into a liquid medium and cultured for one day. The grown bacteria are collected, and DNA is extracted by lysozyme lysis, RNase treatment, and ethanol precipitation. PCR is performed using primers specific to the Streptococcus mutans gene to determine the presence or absence of Streptococcus mutans. This method requires 3 to 4 days to obtain results after sampling from the oral cavity. In contrast, the nucleic acid amplification method of the present invention provides results in an extremely short time of 1 to 2.5 hours and is extremely simple.

[0019] If the nucleic acid amplification method of the present invention is used in hospital tests or mass health examinations, it will be possible to predict cerebral microbleeds and the resulting onset of stroke, dementia, inflammatory bowel disease, and NASH and the resulting onset of liver cirrhosis and liver cancer in a large number of subjects, and prevent these conditions at an early stage, thereby leading to a reduction in medical expenses. In addition, if Streptococcus mutans is detected, it can be bacteriostatically treated by oral irrigation with medicines or by taking Lactobacillus reuteri L8020 strain, which inhibits the proliferation of Streptococcus mutans. This can suppress dental caries, cerebral microbleeds and the resulting strokes, dementia, inflammatory bowel disease, NASH and the resulting liver cirrhosis and liver cancer. [Brief description of the drawings]

[0020] [Figure 1] FIG. 1 shows an X-ray diffraction spectrum of β-strontium hydrogen phosphate obtained in Synthesis Example 5. [Diagram 2] FIG. 1 is a diagram showing an X-ray diffraction spectrum of the barium hydroxyapatite obtained in Synthesis Example 6. [Diagram 3] FIG. 1 is a diagram showing an X-ray diffraction spectrum of the barium fluoride apatite obtained in Synthesis Example 7. [Figure 4] FIG. 1 is a diagram showing an X-ray diffraction spectrum of the low-crystalline strontium apatite obtained in Synthesis Example 8. [Diagram 5] FIG. 1 is a diagram showing an X-ray diffraction spectrum of the low-crystalline magnesium-substituted strontium apatite obtained in Synthesis Example 8. [Figure 6] FIG. 1 is a diagram showing an X-ray diffraction spectrum of the low-crystalline zinc-substituted strontium apatite obtained in Synthesis Example 9. [Figure 7] FIG. 2 is a scanning electron microscope (SEM) photograph of the SrHAP-supporting polystyrene beads obtained in Production Example 1. [Figure 8] FIG. 2 is a SEM photograph of the SrHAP-supported nonwoven fabric (large basis weight) obtained in Production Example 2. [Figure 9]FIG. 2 is a diagram showing an elemental analysis spectrum of the SrHAP-supported nonwoven fabric (large basis weight) obtained in Production Example 2. [Figure 10] FIG. 2 is a SEM photograph of the SrHAP-supported nonwoven fabric (small basis weight) obtained in Production Example 2. [Figure 11] FIG. 2 is a diagram showing an elemental analysis spectrum of the SrHAP-supported nonwoven fabric (small basis weight) obtained in Production Example 2. [Figure 12] FIG. 1 shows an amplification curve by PCR from a DNA solution using strontium / barium (2:8) apatite compound (SrBa:2 / 8) powder. [Figure 13] FIG. 1 shows an amplification curve by PCR from a DNA solution using a strontium apatite-supported nonwoven fabric. [Figure 14] FIG. 1 shows an amplification curve by PCR from a DNA solution using strontium apatite-supported polystyrene beads. [Figure 15] FIG. 1 shows the results of DNA amplification from saliva by the LAMP method. [Figure 16] FIG. 1 shows the results of investigating the DNA extraction temperature in the LAMP method from saliva. [Figure 17] FIG. 1 shows the results of investigating the DNA extraction temperature in the LAMP method from saliva. [Figure 18] FIG. 13 shows that DNA was amplified from saliva by the LAMP method using strontium apatite-supported nonwoven fabric. [Figure 19] FIG. 13 shows that DNA was amplified from saliva by the LAMP method using strontium apatite powder. [Figure 20] This figure shows that the target sequence was amplified even when saliva was mixed with a nucleic acid adsorbent and then DNA was extracted by heating. [Figure 21] FIG. 1 shows the results of investigating the elution temperature of DNA from a DNA-strontium apatite complex. [Figure 22] FIG. 1 shows the results of DNA amplification from saliva by the LAMP method using various alkaline earth metal phosphates and / or carbonates. [Figure 23]FIG. 1 shows the effect of phosphate on DNA amplification from saliva by the LAMP method using strontium apatite powder. [Figure 24] FIG. 1 shows an amplification curve by PCR from bacteria using strontium apatite powder. [Diagram 25] FIG. 1 is a graph showing the relationship between the ratio of the amount of strontium apatite used to DNA and the DNA adsorption ratio. [Figure 26] FIG. 1 shows the results of investigating the elution temperature of DNA from a DNA-strontium apatite complex. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] The present invention will be described in detail below. (1) Nucleic acid isolation method The nucleic acid separation method of the present invention comprises the steps of contacting nucleic acid with an alkaline earth metal phosphate and / or carbonate (nucleic acid adsorbent of the present invention) having a solubility in water of 1 g / 100 g H2O or less, and heating the complex of nucleic acid and nucleic acid adsorbent of the present invention obtained by the contact to 45°C or higher.

[0022] Sample containing nucleic acid Examples of samples containing nucleic acid include biological samples such as oral samples, such as saliva, dental plaque, oral mucosa, pharyngeal swabs, sputum, and tracheal aspirates; tissues suspected of cancer; blood, such as whole blood, serum, and plasma; lymph; and semen. Examples of biological samples include bacteria, viruses, fungi, algae, and protozoa. Examples also include samples containing nucleic acid extracted from cells. In the present invention, nucleic acids include DNA, RNA, oligonucleotides, and chemically modified versions of these.

[0023] Nucleic acid extraction process When a sample from which nucleic acid has not been extracted from cells is used, a step of extracting nucleic acid from cells may be performed before contacting the sample with the nucleic acid adsorbent of the present invention. In the present invention, nucleic acid extraction refers to a process of increasing the permeability of cells to release at least a part of nucleic acid outside the cells. Such a process is well known to those skilled in the art, and examples thereof include heating (heating at about 50 to 100°C), surfactant (nonionic surfactant such as TritonX-100, ionic surfactant such as SDS or guanidine salt, etc.), calcium chloride treatment, enzyme (cell wall lysing enzyme such as lysozyme, etc.) treatment, pulse voltage application, osmotic shock, and electron beam irradiation.

[0024] Nucleic acid adsorbent of the present invention The alkaline earth metals are group 2 elements. As the alkaline earth metal phosphate and / or carbonate having a solubility in water of 1 g / 100 g H2O or less, one or more alkaline earth metal phosphates and / or carbonates selected from magnesium (Mg), calcium (Ca), strontium (Sr), and barium (Ba) can be used. If the material is poorly soluble in water, that is, if its solubility in water is 1 g / 100 g H2O or less, it can adsorb nucleic acids in a sample containing water. In the present invention, "solubility in water" means solubility in water at a temperature of 25°C and a pH of 7. Theoretically, the pH of water is 7, but it varies slightly depending on the water source and the dissolution of atmospheric components. In this case, the water is adjusted to pH 7 using NaOH or HCl.

[0025] Examples of phosphates include magnesium phosphate, magnesium hydrogen phosphate, calcium phosphate, calcium hydrogen phosphate, hydroxyapatite, strontium phosphate, strontium hydrogen phosphate, strontium apatite, halogenated strontium apatite, barium phosphate, barium hydrogen phosphate, barium apatite, halogenated barium apatite, magnesium-substituted strontium apatite, zinc-substituted strontium apatite, magnesium-substituted hydroxyapatite, and strontium-substituted hydroxyapatite. As compounds with suitable compositions, magnesium phosphate (Mg3(PO4)2), magnesium hydrogen phosphate (MgHPO4), calcium phosphate (Ca3(PO4)2), calcium hydrogen phosphate (CaHPO4), hydroxyapatite (Ca 10 (PO4)6(OH)2), strontium phosphate (Sr3(PO4)2), strontium hydrogen phosphate (SrHPO4), strontium apatite (Sr 10 (PO4)6(OH)2), halogenated strontium apatite (Sr 10 (PO4)6X2) (X represents a halogen atom.), barium phosphate (Ba3(PO4)2), barium hydrogen phosphate (BaHPO4), barium apatite (Ba 10 (PO4)6(OH)2), halogenated barium apatite (Ba 10 (PO4)6X2) (X represents a halogen atom.), magnesium-substituted strontium apatite (Sr 10-x Mg x (PO4)6(OH)2: 0 < x < 5), zinc-substituted strontium apatite (Sr 10-x Zn x (PO4)6(OH)2: 0 < x < 5), magnesium-substituted hydroxyapatite (Ca 10-x Mg x (PO4)6(OH)2: 0 < x < 5), strontium-substituted hydroxyapatite (Ca 10-x Sr x (PO4)6(OH)2: 0 < x < 10), etc. can be mentioned. Examples of the halogen include fluorine, chlorine, bromine, and iodine. Hydroxyapatite is commercially available, and for example, "HAP-100" (Taihei Chemical Industry Co., Ltd.), "Natural Apatite" (Excel Co., Ltd.), etc. can be used. Commercially available products can be used for calcium hydrogen phosphate, calcium phosphate, and magnesium phosphate. Other compounds can be produced by the methods described in the examples or methods analogous thereto.

[0026] Examples of the carbonate include magnesium carbonate, calcium carbonate, strontium carbonate, strontium carbonate apatite, barium carbonate, and the like. As compounds with a preferred composition, magnesium carbonate (MgCO3), calcium carbonate (CaCO3), strontium carbonate (SrCO3), strontium carbonate apatite (Sr x (PO4) 6-y (CO3) y X2)(0 < y < 1), barium carbonate (BaCO3), and the like can be mentioned. Strontium carbonate apatite can be produced by the method described in the Examples section. Other carbonates can be commercially available products.

[0027] Examples of the phosphoric acid and carbonate include strontium-substituted carbonated hydroxyapatite, for example, (Ca 10-x Sr x (PO4) 6-y (CO3) y X2)(0 < x < 10, 0 < y < 1) and strontium-substituted carbonated hydroxyapatite having such a composition. Strontium-substituted carbonated hydroxyapatite can be produced by introducing strontium into the apatite crystal of commercially available carbonated hydroxyapatite by an ion exchange reaction according to the method of Synthesis Example 8 in the Examples.

[0028] Strontium apatite (SrHAP) can be produced by the method described in the Examples, but it can also be produced, for example, by the method described in JP-A-2015-86084. Specifically, in water, a strontium salt (for example, strontium chloride), a phosphate (for example, disodium hydrogen phosphate), and a carbonate (for example, sodium hydrogen carbonate) are mixed, and by adjusting the molar ratio of each component, SrHAP can be obtained in one step.

[0029] Among them, SrHAP is preferable in that it has an extremely high selective adsorption power for nucleic acids.

[0030] Here, the chemical formulas of various apatites are not uniquely expressed by the ratio of each of the constituent elements shown above, but are merely listed as representative compositions. In reality, it is known that the ratio of the constituent elements varies depending on the synthesis method and synthesis conditions of various apatites (for example, calcium-deficient hydroxyapatite). Furthermore, sodium and other alkali metals may be included in the crystal lattice of various apatites as constituent elements. Furthermore, since it is difficult to accurately analyze and determine the ratio of hydroxyl groups in the structural formulas of various apatites, the above composition ratio ((OH)2) is listed as a representative composition ratio, but it is not necessarily limited to this, and for example, if hydration water on the surface of various apatite crystals is included, the composition ratio of hydroxyl groups may be higher than this.

[0031] The shape of the nucleic acid adsorbent of the present invention is not particularly limited, and it may be in the form of powder, granules, or the like. When the volume average particle diameter is about 10 μm or more, the complex with the nucleic acid can be easily recovered from the sample solution without centrifugation, filtration, etc., and after the nucleic acid is desorbed, the nucleic acid solution and the nucleic acid adsorbent of the present invention can be easily separated. The upper limit of the volume average particle diameter can be about 1 mm. On the other hand, when the volume average particle diameter is less than about 10 μm, it is easy to support or coat the carrier. Among them, 5 μm or less is preferable, and 1 μm or less is more preferable. In this range, the particle surface area is large, so the amount of nucleic acid adsorbed per particle weight is large. In addition, the volume average particle diameter is preferably 40 nm or more, and more preferably 50 nm or more. In this range, the complex with nucleic acid can be recovered by centrifugation or the like. The volume average particle size of the nucleic acid adsorbent of the present invention after production is usually about 10 μm or more, but this can be reduced by wet dispersion treatment using, for example, a media mill. In the present invention, the volume average particle size is a value measured by a laser diffraction scattering method in a state where the particle is dispersed in water.

[0032] Furthermore, a powder or granular material may be molded into a porous body (such as a block, columnar, or film) having liquid permeability and may also be used.

[0033] When the powdered nucleic acid adsorbent of the present invention is supported on a carrier, it can be fixed to the carrier using a resin binder or by heat fusion. The shape of the support is not particularly limited, and examples thereof include beads, fibers, and porous molded bodies.

[0034] As the bead material, various polymers can be used. The size of the beads can be about 1 μm to several mm in diameter, and within this range, the complex with the nucleic acid can be easily recovered from the sample liquid by centrifugation, filtration, decantation, etc., and the complex with the nucleic acid can be placed directly in a container for performing the nucleic acid amplification reaction.

[0035] Examples of fiber materials that can be used include polymers such as polyester and nylon; natural materials such as cotton; and inorganic materials such as glass, metals, and ceramics. The fibers can be in the form of threads or short threads, and can also be formed into cloth such as nonwoven fabrics, woven fabrics, and knitted fabrics, or into strings. The fiber diameter can be about 1 to 50 μm, and in the case of cloth, the basis weight is 1 to 200 g / m. 2 It can be about that. When the nucleic acid adsorbent of the present invention is supported on a cloth, the amount supported is 0.1 to 50 g / m 2 The thickness can be set to about 0.5 to 40 g / m 2 Within this range, the amount of nucleic acid adsorbed is large and the liquid can easily pass through.

[0036] As the material of the porous body, various plastics and inorganic materials such as glass, metal, ceramics, etc. can be used. The porous body is formed into a columnar or membrane shape, and preferably has liquid permeability. If it has liquid permeability, it can pass a sample containing nucleic acid.

[0037] When a nucleic acid adsorbent is immobilized on the surface of a fibrous or porous material, the adsorbent can be simply immersed in a sample solution, removed with tweezers or the like, washed with water, and then directly subjected to a nucleic acid amplification reaction. Therefore, fibrous or porous materials can be extremely preferably used as carriers.

[0038] Contact process Contact between nucleic acid and the nucleic acid adsorbent of the present invention may be generally carried out in an aqueous solution such as water or a buffer solution (e.g., phosphate buffer solution). For example, an aqueous solution of nucleic acid may be contacted with the nucleic acid adsorbent of the present invention. The pH of the liquid used for contact is preferably neutral or nearly neutral, for example, preferably pH 5 to 9, more preferably pH 5.5 to 8.5, and even more preferably pH 6 to 8. If the pH is within this range, dissolution of the nucleic acid adsorbent of the present invention in the liquid used for contact is suppressed, and nucleic acids are less likely to be denatured. The temperature during mixing can be less than 45°C, preferably 40°C or less, 30°C or less, 25°C or less, and 10°C or less, which allows nucleic acid to be easily adsorbed to the nucleic acid adsorbent of the present invention. In particular, if the temperature is 10°C or less, protein adsorption is effectively suppressed. The temperature during mixing may be 0°C or more so that the nucleic acid solution does not freeze. It is convenient to carry out the mixing at room temperature.

[0039] The ratio of the nucleic acid to be contacted to the nucleic acid adsorbent of the present invention may be 10 to 10,000 parts by mass, preferably 20 to 1,000 parts by mass, of the nucleic acid adsorbent of the present invention per part by mass of nucleic acid. Within this range, the nucleic acid in the sample solution can be sufficiently adsorbed, and even when the nucleic acid adsorbent of the present invention having adsorbed nucleic acid is directly subjected to a nucleic acid amplification reaction, a sufficient amount of nucleic acid can be added to the nucleic acid amplification solution.

[0040] When the nucleic acid adsorbent of the present invention (including those supported on a carrier; the same applies below) is of a size that can fit into a container such as a microtube or the well of a multi-well plate, the nucleic acid solution and the nucleic acid adsorbent of the present invention can be mixed in the container. In addition, when the nucleic acid adsorbent of the present invention is packed in a column, or when the nucleic acid adsorbent of the present invention is formed into a liquid-permeable molded body such as a columnar or membrane, the nucleic acid solution can be passed through the column. In addition, when the nucleic acid adsorbent of the present invention is packed or attached to the liquid-permeable part of a container, the nucleic acid solution can be sucked up or discharged. Examples of the liquid-permeable part of a container with liquid permeability include the liquid-suction part of a pipette and the attached tip of a micropipette. By mixing or passing the solution, the nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention, and a complex of the nucleic acid and the nucleic acid adsorbent of the present invention is obtained.

[0041] The contact time is preferably 1 second or more, more preferably 5 seconds or more, and even more preferably 10 seconds or more. The contact time can be 24 hours or less, and even more preferably 10 minutes or less, in order to prevent denaturation of nucleic acid. When passing a nucleic acid solution through the nucleic acid adsorbent of the present invention, the flow rate can be adjusted so that the total contact time is at least 1 second. The same sample may be passed through multiple times.

[0042] The nucleic acid and the nucleic acid adsorbent of the present invention may be washed with water or the like as necessary, and then the next heating step may be carried out.

[0043] heating process Next, the complex of the nucleic acid and the nucleic acid adsorbent of the present invention is heated to 45° C. or higher, whereby the nucleic acid is dissociated or desorbed from the nucleic acid adsorbent of the present invention. The heating temperature is preferably 55° C. or higher, more preferably 65° C. or higher, and even more preferably 75° C. or higher. The heating temperature can be, for example, 100° C. or lower in order to prevent denaturation of the nucleic acid. Heating may also be generally carried out in an aqueous solution such as water or a buffer solution, and is preferably carried out in a neutral or near-neutral solution having a pH of about 5 to 9, particularly 6 to 8. The heating time can be about 1 second to several minutes (for example, 2, 3, 4, or 5 minutes), which is sufficient to desorb nucleic acids.

[0044] When nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention in a liquid in a container, after removing the liquid, a dissociation liquid can be added to the same container and heated, or the nucleic acid adsorbent of the present invention with adsorbed nucleic acid can be transferred to a separate container, and a dissociation liquid can be added and heated. When nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention by passing an aqueous solution of nucleic acid through a column or molded article, the liquid at 45° C. or higher may be passed through the column or molded article after adsorption. When nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention in a liquid-permeable portion of a container, such as the liquid-suction portion of a pipette or a tip attached to a micropipette, the nucleic acid can be dissociated by aspirating or discharging a liquid at 45° C. or higher. For example, the liquid can be aspirated or discharged in a container kept at 45° C. or higher.

[0045] Phosphate can be added to the liquid in which heating is carried out, which aids in dissociation of the nucleic acids. Examples of phosphates include sodium phosphate, potassium phosphate, ammonium phosphate, sodium hydrogen phosphate, potassium hydrogen phosphate, ammonium hydrogen phosphate, etc. Among these, phosphate buffer solutions such as Tris phosphate buffer containing sodium phosphate are preferred. One or more types of phosphates can be used. The amount of phosphate added can be set to a final concentration of 1 mM or more, 10 mM or more, 20 mM or more, 40 mM or more, or 50 mM or more. Within this range, dissociation of nucleic acid can be promoted. Furthermore, the amount of phosphate added can be set to a final concentration of 300 mM or less, 200 mM or less, 100 mM or less, 80 mM or less, 50 mM or less, 40 mM or less, 30 mM or less, 20 mM or less, or 10 mM or less. Within this range, even if the solution containing dissociated nucleic acid (containing phosphate) is directly subjected to a nucleic acid amplification reaction, there is little inhibition of the nucleic acid amplification enzyme, and the nucleic acid amplification reaction proceeds to a detectable extent. It is also possible to omit the addition of a nucleic acid dissociating agent such as phosphate.

[0046] The nucleic acid dissociated by heating may be recovered separately from the nucleic acid adsorbent of the present invention. When nucleic acids are separated from a nucleic acid solution extracted from cells, the nucleic acids dissolved in the sample solution are selectively adsorbed and recovered, so that the nucleic acids can be concentrated or purified, and therefore the nucleic acid separation method of the present invention can also be considered as a nucleic acid concentration method or a nucleic acid purification method. After the nucleic acids in the sample solution are adsorbed, the nucleic acids can be desorbed in a liquid with a volume smaller than that of the sample solution, and then the nucleic acids can be concentrated in the solution. When the adsorbed and recovered nucleic acid is subjected to a nucleic acid amplification reaction for amplification, the temperature of the reaction system is then lowered, so that the nucleic acid can be re-adsorbed onto the nucleic acid adsorbent of the present invention and removed. The amplified nucleic acid can be purified by washing with water while still adsorbed on the surface of the nucleic acid adsorbent of the present invention, and the nucleic acid can be separated and recovered by heating in water at a temperature of 45°C or higher. This allows a large amount of nucleic acid to be separated and recovered.

[0047] It is preferable that the method of the present invention does not include a step of dissociating or desorbing nucleic acid from the nucleic acid adsorbent of the present invention using a dissociating agent such as phosphate (dissociating agent treatment step) between the contact step and the heating step, or after the heating step.

[0048] (2) Nucleic acid amplification method The nucleic acid amplification method of the present invention includes the steps of contacting nucleic acid with the nucleic acid adsorbent of the present invention described above, and performing a nucleic acid amplification reaction using the nucleic acid and the nucleic acid adsorbent complex of the present invention obtained by the contact. Carrying out a nucleic acid amplification reaction using a nucleic acid and a complex of the present invention means using a nucleic acid and a complex of the present invention instead of a nucleic acid or a nucleic acid solution, and this complex may be included in a nucleic acid amplification solution. That is, the nucleic acid adsorbent may be immersed in the nucleic acid amplification solution, or the nucleic acid may be amplified in a state where the nucleic acid adsorbent is in contact with the nucleic acid amplification solution. This complex is ultimately added to the nucleic acid amplification solution, but the order of addition is not limited.

[0049] The sample containing nucleic acid, the nucleic acid extraction step, the nucleic acid adsorbent of the present invention, and the contact step are as described in the nucleic acid separation method of the present invention. It is also preferable not to perform a dissociation agent treatment step between the contact step and the nucleic acid amplification step, as in the nucleic acid separation method of the present invention. Heating can be performed in conjunction with the nucleic acid amplification reaction without performing a heating step. The complex of nucleic acid and the nucleic acid adsorbent of the present invention may be washed with water or the like as necessary, and then the next nucleic acid amplification step may be carried out. Conventionally, nucleic acids were desorbed from adsorbents and used as a solution, which caused a problem of reduced sensitivity due to dilution. In the nucleic acid amplification method of the present invention, the nucleic acids adsorbed to the nucleic acid adsorbent can be directly subjected to a nucleic acid amplification reaction, so that nucleic acids can be detected and amplified with high sensitivity without diluting the reaction system.

[0050] After the nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention, the resulting complex can be transferred to a container for nucleic acid amplification. When the nucleic acid adsorbent of the present invention is supported on a metal carrier, it can be picked up and transferred using a magnet. When the nucleic acid is adsorbed using a micropipette equipped with a tip containing the nucleic acid adsorbent of the present invention, the tip can be placed in an amplification container of a nucleic acid amplifier to carry out an amplification reaction.

[0051] Regarding the size of the nucleic acid adsorbent of the present invention (including that supported on a carrier), in the nucleic acid amplification method of the present invention, the complex of nucleic acid and the nucleic acid adsorbent of the present invention is placed directly into the nucleic acid amplification liquid, so the nucleic acid adsorbent of the present invention need only be of a size that can fit into a reaction vessel.

[0052] Nucleic Acid Amplification Reaction The nucleic acid amplification method is not particularly limited as long as it includes a step of performing the amplification at 45° C. or higher. Methods for amplifying DNA include methods involving a heat denaturation step of double-stranded DNA, such as PCR (polymerase chain reaction) (Science 239, 487-491 (1988)) and LCR (ligase chain reaction) (Proc. Natl. Acad. Sci. USA, 88: 189-193 (1991)); LAMP (loop-mediated isothermal amplification) (International Publication No. 00 / 28082), SDA (strand displacement amplification) (U.S. Pat. No. 5,455,166), ICAN (isothermal and chimeric primer-initiated amplification of nucleic acids) (International Publication No. 00 / 56877), SMAP (Smart amplification process) (Seibutsu butsuri kagaku, 52 (4): 183-187, 2008), 3SR (self-stranded sequence and isothermal amplification methods that do not involve a heat denaturation step of double-stranded DNA, such as the isothermal amplification method (Am. Biotechnol. Lab. 8, 14-25 (1990)).

[0053] When amplifying RNA, since the RNA is single-stranded from the beginning, there is no need to heat-denaturate it, and isothermal amplification can be performed. Examples of nucleic acid amplification methods for amplifying RNA include TMA (Transcription Mediated Amplification) (In Ferre, F. (ed), Gene quantification, Boston, Birkhauser p189-201 (1998)), NASBA (Nucleic Acid Sequence-Based Amplification) (In Ferre, F. (ed), Gene quantification, Boston, Birkhauser p169-188 (1998)), and TRC (Transcription-reverse transcription concerted reaction) (J. Clin. Microbiol,.42 (9): 4284-4292, 2004).

[0054] Among these, the isothermal amplification method is preferred because it is simple and does not require temperature changes, and the equipment is inexpensive. Among these, the LAMP method is particularly simple because it can amplify DNA in one step using one type of synthetic enzyme. In addition, the LAMP method has high amplification efficiency, so it can detectably amplify even small amounts of target DNA, and has extremely high specificity, which reduces erroneous detection of related bacterial species. In isothermal amplification, the temperature during amplification varies depending on the type of DNA amplification enzyme, but can be about 50 to 70°C.

[0055] In addition, since the method of the present invention has a high recovery rate of nucleic acid, the target sequence can be sufficiently detected even by using a general-purpose nucleic acid amplification method such as PCR. The temperature during PCR amplification can be about 45 to 98°C, including denaturation, annealing, and extension.

[0056] The target sequence portion to be amplified by the nucleic acid amplification method may be appropriately determined depending on the test. For example, when detecting Streptococcus mutans (a caries-causing bacterium) from an oral sample such as saliva, a sequence portion including all or a part of the glycosyltransferase gene (GenBank accession number: M1736) can be targeted. Since the base sequence of the glycosyltransferase gene varies relatively widely between species of the genus Streptococcus, Streptococcus mutans can be detected with high accuracy by targeting the glycosyltransferase gene. In addition, cnm-positive Streptococcus mutans can be detected by targeting a sequence portion including all or a part of the gene (GenBank accession number: AB465300.1) encoding the cnm protein. Furthermore, when detecting Porphyromonas gingivalis (a type of bacteria that causes periodontal disease) from oral samples such as dental plaque, a sequence portion containing all or part of the 16S RNA gene of Porphyromonas gingivalis can be targeted.

[0057] Phosphate can be added to the nucleic acid amplification solution, which promotes dissociation of nucleic acids. Examples of phosphate include sodium phosphate, potassium phosphate, ammonium phosphate, sodium hydrogen phosphate, potassium hydrogen phosphate, and ammonium hydrogen phosphate. One or more types of phosphate can be used. The amount of phosphate added can be 1 mM or more, 10 mM or more, 20 mM or more, 40 mM or more, or 50 mM or more at a final concentration. In this range, dissociation of nucleic acid can be promoted. In addition, the amount of phosphate added can be 300 mM or less, 200 mM or less, 100 mM or less, 80 mM or less, 50 mM or less, 40 mM or less, 30 mM or less, 20 mM or less, or 10 mM or less at a final concentration. In this range, the inhibition of the nucleic acid amplification enzyme is small, and the nucleic acid amplification reaction proceeds to a detectable extent. When PCR is used as the nucleic acid amplification method, the amount of phosphate added should be lower than in other nucleic acid amplification methods, and a final concentration of 50 mM or less, 40 mM or less, 30 mM or less, 20 mM or less, or 10 mM or less is preferred. It is also possible not to add a nucleic acid dissociating agent such as phosphate to the nucleic acid amplification solution.

[0058] Amplification of the target sequence of nucleic acid can be confirmed by a conventional method. For example, the amplification reaction can be performed in the presence of an intercalator that binds to double-stranded nucleic acid, such as ethidium bromide (EtBr) or SYBR GREEN, and the fluorescence can be confirmed under an ultraviolet lamp. In addition, a chelating agent such as calcein binds to manganese ions and is quenched before amplification, but as the nucleic acid amplification reaction progresses, the manganese ions are taken by the pyrophosphate ions produced and the fluorescence is enhanced by binding to magnesium ions in the reaction solution, so the presence or absence of amplification can be confirmed by checking the fluorescence under an ultraviolet lamp. Furthermore, pyrophosphate is generated as a by-product in the extension reaction by DNA amplification enzymes, which reacts with magnesium ions in the reaction solution to produce magnesium pyrophosphate. In methods that generate a large amount of amplified product, such as the LAMP method, magnesium pyrophosphate precipitates in the reaction solution, causing it to become cloudy, so the amplification of the target sequence can be confirmed by visually checking the cloudiness.

[0059] The present invention also provides a nucleic acid amplification method including a step of amplifying the nucleic acid separated by the above-described nucleic acid separation method of the present invention (the second nucleic acid amplification method of the present invention). The nucleic acid amplification reaction in the second nucleic acid amplification method is not particularly limited. The nucleic acid amplification reaction in the second nucleic acid amplification method does not have to be performed at a temperature of 45° C. or higher. Examples of the types and methods of nucleic acid amplification reaction that can be used include those exemplified for the above-described nucleic acid amplification method. In the second nucleic acid amplification method, it is also preferable not to perform a dissociation agent treatment step prior to the nucleic acid amplification step.

[0060] (3) Nucleic acid isolation kit The nucleic acid separation kit of the present invention is a kit in which the nucleic acid adsorbent of the present invention is contained in the liquid passage part of a liquid-passing container. Examples of the liquid-passing container include a pipette and a micropipette tip. The form of the nucleic acid adsorbent of the present invention is not limited, but it is preferable that the powder or particles are molded or supported on a carrier, which makes it easy to fix the adsorbent to the liquid passage part of a pipette, a micropipette tip, etc. The nucleic acid isolation kit of the present invention may further comprise a nucleic acid adsorption container and / or a nucleic acid dissociation container. The nucleic acid dissociation container is a container that is heated to 45° C. or higher.

[0061] (4) Direct nucleic acid amplification device The first core of the present invention acid increase The apparatus includes a nucleic acid adsorption container containing the nucleic acid adsorbent of the present invention described above and a nucleic acid amplification container having a nucleic acid amplification chamber. machine and a means for transferring the complex of the nucleic acid adsorbent of the present invention and nucleic acid from the nucleic acid adsorption container to a nucleic acid amplification container. The nucleic acid adsorption container is not limited, but may be a microtube, a well of a multi-well plate, etc. The form of the nucleic acid adsorbent of the present invention is not limited, but it is preferable that the powder or particles are formed into a mass or are supported on a carrier, which makes it easy to transfer the nucleic acid adsorbent of the present invention after adsorbing the nucleic acid to the nucleic acid amplification container. The means for transferring the complex of the nucleic acid adsorbent of the present invention and the nucleic acid to the nucleic acid amplification container may be lifted up and transferred, but when the carrier is metal, it may be lifted up and transferred using a magnet.

[0062] The second core of the present invention acid increase The amplification device includes a nucleic acid adsorption container containing the nucleic acid adsorbent of the present invention described above and a nucleic acid amplification machine a means for discharging the sample liquid from the nucleic acid adsorption container after the nucleic acid in the sample liquid containing nucleic acid has been adsorbed to the nucleic acid adsorbent of the present invention; and a means for discharging the sample liquid from the nucleic acid adsorption container after discharging the sample liquid, the nucleic acid adsorption container being subjected to a nucleic acid amplification reaction. machine and means for mounting the device to the A sample liquid containing nucleic acids is placed in a nucleic acid adsorption container, and the nucleic acids are adsorbed to the nucleic acid adsorbent of the present invention. The sample liquid is then removed or discharged, and a nucleic acid amplification reaction liquid is placed in the container to carry out nucleic acid amplification. machine and start the nucleic acid amplification reaction. Examples of the nucleic acid adsorption container include a microtube and a well of a multi-well plate. The form of the nucleic acid adsorbent of the present invention is not limited, but it is preferable that the powder or particles are formed into a mass or are supported on a carrier, which makes it easy to remove the liquid after the nucleic acid is adsorbed to the nucleic acid adsorbent of the present invention.

[0063] The third core of the present invention acid increase The apparatus includes a micropipette having a tip in which the nucleic acid adsorbent of the present invention described above is contained, and a nucleic acid amplification machine The form of the nucleic acid adsorbent of the present invention is not limited, but it is preferable that the adsorbent is in the form of a powder or particles, or is supported on a carrier, which makes it easy to fix the adsorbent in the tube of the tip of a micropipette. The third core of the present invention acid increase The apparatus may further include a nucleic acid adsorption container and / or a nucleic acid amplification container. A solution containing nucleic acid is placed in a nucleic acid adsorption container, and the sample is aspirated with a micropipette to adsorb the nucleic acid to the nucleic acid adsorbent of the present invention. The tip of the micropipette is placed in the nucleic acid amplification container as is, or the nucleic acid adsorbent is removed from the tip. machine and perform the amplification reaction.

[0064] (5) Nucleic acid adsorbent As described above, magnesium phosphate, magnesium hydrogen phosphate, calcium phosphate, calcium hydrogen phosphate, hydroxyapatite, strontium phosphate, strontium hydrogen phosphate, strontium apatite, halogenated strontium apatite, barium phosphate, barium hydrogen phosphate, barium apatite, halogenated barium apatite, magnesium-substituted strontium apatite, zinc-substituted strontium apatite, magnesium-substituted hydroxyapatite, strontium-substituted hydroxyapatite, magnesium carbonate, calcium carbonate, strontium carbonate, strontium carbonate apatite, barium carbonate, strontium-substituted carbonated hydroxyapatite can be used for adsorbing nucleic acids. That is, they can be used as nucleic acid adsorbents. As compounds with a suitable composition, magnesium phosphate (Mg3(PO4)2), magnesium hydrogen phosphate (MgHPO4), calcium phosphate (Ca3(PO4)2), calcium hydrogen phosphate (CaHPO4), hydroxyapatite (Ca 10 (PO4)6(OH)2), strontium phosphate (Sr3(PO4)2), strontium hydrogen phosphate (SrHPO4), strontium apatite (Sr 10 (PO4)6(OH)2), barium phosphate (Ba3(PO4)2), barium hydrogen phosphate (BaHPO4), barium apatite (Ba 10 (PO4)6(OH)2), halogenated strontium apatite (Sr 10 (PO4)6X2) (X represents a halogen atom.), halogenated barium apatite (Ba 10 (PO4)6X2) (X represents a halogen atom.), magnesium-substituted strontium apatite (Sr 10-x Mg x (PO4)6(OH)2: 0 < x < 5), zinc-substituted strontium apatite (Sr 10-x Zn x (PO4)6(OH)2: 0 < x < 5), magnesium-substituted hydroxyapatite (Ca 10-x Mg x (PO4)6(OH)2: 0 < x < 5), strontium-substituted hydroxyapatite (Ca 10-xSr x Phosphates such as (PO4)6(OH)2 (0 < x < 10); magnesium carbonate (MgCO3), calcium carbonate (CaCO3), strontium carbonate (SrCO3), strontium carbonate apatite (Sr x (PO4) 6-y (CO3) y X2) (0 < y < 1), carbonates such as barium carbonate (BaCO3); strontium-substituted carbonated hydroxyapatite (Ca 10-x Sr x (PO4) 6-y (CO3) y X2) (0 < x < 10, 0 < y < 1), etc. may be mentioned.

Example

[0065] Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto. (1) Synthesis of nucleic acid adsorbent Synthesis Example 1 (SrHAP: Strontium Apatite Synthesis No. 1) SrHAP was synthesized by the method described in JP-A-2014-180491. That is, 267 g (1 mol) of strontium chloride hexahydrate was weighed into a 1 L Erlenmeyer flask, and 350 g of distilled water was added and dissolved. Separately, 132 g (1 mol) of diammonium hydrogen phosphate was weighed into a 500 mL glass beaker, and 300 g of distilled water was added and dissolved. The Erlenmeyer flask containing the strontium chloride aqueous solution prepared above was transferred onto a water bath adjusted to 50 °C, and while stirring, an aqueous solution in which diammonium hydrogen phosphate was dissolved was gradually added dropwise over 1 hour using a dropping funnel. The pH of the reaction system during the reaction was 6.5. The Erlenmeyer flask was removed from the water bath and cooled to room temperature, and then suction filtration was performed using a glass filter. The white precipitate on the filter was further washed repeatedly with distilled water, and then dried in a dryer adjusted to 60 °C for one day and night to obtain a white powder. The entire amount of strontium hydrogen phosphate obtained above was transferred to a 1L Erlenmeyer flask, and 600g of pure water was added and 35g of sodium hydroxide was added while stirring. The pH of the reaction system was 13. The temperature of the reaction system was raised to 70°C while stirring on a hot plate, and the mixture was heated and stirred at this temperature for 3 hours. The mixture was then cooled to room temperature, and the product was collected on a glass filter by suction filtration. After thorough washing with pure water, the product was heated and dried overnight in a dryer adjusted to 80°C to obtain a white powder. The product showed a diffraction pattern characteristic of strontium apatite by powder X-ray diffraction.

[0066] Synthesis Example 2 (SrHAP: Strontium Apatite Synthesis No. 2) SrHAP was synthesized by the method described in JP 2015-086084 A. That is, 134 g (0.5 mol) of strontium chloride hexahydrate (reagent manufactured by Wako Pure Chemical Industries, Ltd.) was weighed into a 1 L Erlenmeyer flask, and 350 g of ion-exchanged water was added to dissolve it. Separately, 40 g (0.3 mol) of diammonium hydrogen phosphate (reagent manufactured by Wako Pure Chemical Industries, Ltd.) and 16 g (0.15 mol) of sodium carbonate (reagent manufactured by Wako Pure Chemical Industries, Ltd.) were weighed into a 500 mL glass beaker, and 300 g of ion-exchanged water was added to dissolve it. The Erlenmeyer flask containing the above-prepared strontium chloride aqueous solution was transferred to a water bath adjusted to 50°C, and an aqueous solution in which diammonium hydrogen phosphate and sodium carbonate were dissolved was gradually dropped over 1 hour using a dropping funnel while stirring. The pH of the reaction system during the reaction was 7. After the dropwise addition, the mixture was heated and stirred for another 1 hour. The Erlenmeyer flask was then removed from the water bath and cooled to room temperature, after which the resulting white precipitate was suction filtered using a glass filter. The white precipitate on the filter was washed repeatedly with ion-exchanged water, and then dried overnight in a dryer adjusted to 60°C to obtain a white powder. The product showed a diffraction pattern characteristic of strontium apatite using powder X-ray diffraction.

[0067] Synthesis Example 3 (SrCAP: Synthesis of strontium carbonate apatite) SrCAP was synthesized by the method described in JP 2015-086081 A. That is, 134 g (0.5 mol) of strontium chloride hexahydrate was weighed into a 1 L Erlenmeyer flask, and 350 g of ion-exchanged water was added to dissolve it. Separately, 66 g (0.5 mol) of diammonium hydrogen phosphate was weighed into a 500 mL glass beaker, and 300 g of ion-exchanged water was added to dissolve it. The Erlenmeyer flask containing the above-prepared strontium chloride aqueous solution was transferred to a water bath adjusted to 50°C, and an aqueous solution of diammonium hydrogen phosphate was gradually dropped into the mixture over one hour using a dropping funnel while stirring. The pH of the reaction system during the reaction was 6.5. The Erlenmeyer flask was removed from the water bath and cooled to room temperature, and then suction filtration was performed using a glass filter. The white precipitate on the filter was further repeatedly washed with ion-exchanged water, and then dried for one day and night in a dryer adjusted to 60°C to obtain a white powder. The entire amount (0.5 moles) of strontium hydrogen phosphate obtained above was transferred to a 1 L Erlenmeyer flask, and 600 g of ion-exchanged water was added and 27 g (0.25 moles) of sodium carbonate was added while stirring. The pH of the reaction system was 9.5. The temperature of the reaction system was raised to 80°C while stirring on a hot plate, and the mixture was heated and stirred at this temperature for 3 hours. The mixture was then cooled to room temperature, and the product was collected on a glass filter by suction filtration. After thorough washing with ion-exchanged water, the product was heated and dried overnight in a dryer adjusted to 80°C to obtain a white powder. The product showed a characteristic diffraction pattern of strontium apatite by powder X-ray diffraction, and also showed a peak at 1460 cm in FT-IR spectrum measurement. -1 ,1405cm -1 , and 870 cm -1 Absorption characteristic of carbonate ions contained in B-type carbonate apatite was observed nearby.

[0068] Synthesis Example 4 (SrFAP: Synthesis of strontium fluoride apatite) SrFAP was synthesized by the method described in JP 2015-093825 A. That is, 134 g (0.5 mol) of strontium chloride hexahydrate (reagent manufactured by Wako Pure Chemical Industries, Ltd.) was weighed into a 1 L Erlenmeyer flask, and 350 g of ion-exchanged water was added to dissolve it. Separately, 40 g (0.3 mol) of diammonium hydrogen phosphate (reagent manufactured by Wako Pure Chemical Industries, Ltd.), 11 g (0.1 mol) of sodium carbonate (reagent manufactured by Wako Pure Chemical Industries, Ltd.), and 4.2 g (0.1 mol) of sodium fluoride (reagent manufactured by Wako Pure Chemical Industries, Ltd.) were weighed into a 500 mL glass beaker, and 300 g of ion-exchanged water was added to dissolve them. The Erlenmeyer flask containing the aqueous strontium chloride solution prepared above was transferred to a water bath adjusted to 50°C, and an aqueous solution containing diammonium hydrogen phosphate, sodium carbonate, and sodium fluoride was gradually added dropwise over one hour using a dropping funnel while stirring. The pH of the reaction system was 4. After the dropwise addition, the mixture was heated and stirred for another hour. The Erlenmeyer flask was then removed from the water bath and cooled to room temperature, after which the white precipitate formed was suction filtered using a glass filter. The white precipitate on the filter was washed repeatedly with ion-exchanged water, and then dried overnight in a dryer adjusted to 60°C to obtain a white powder. The product showed a characteristic diffraction pattern of strontium apatite by powder X-ray diffraction. Furthermore, elemental analysis of the powder by SEM / EDS detected strontium, phosphorus, and oxygen as well as fluorine, and the elemental ratios of each were in good agreement with the calculated values ​​for strontium fluoride apatite.

[0069] Synthesis example 5 (β-SrHPO 4 :Synthesis of β-strontium hydrogen phosphate) 133g (0.5 moles) of strontium chloride hexahydrate was weighed into a 1L Erlenmeyer flask, 500mL of distilled water was added, and the mixture was stirred and dissolved in a cooling water bath adjusted to 10℃. A solution of 66g (0.5 moles) of diammonium hydrogen phosphate dissolved in 150mL of distilled water was gradually added dropwise to the aqueous strontium chloride solution over a period of 1 hour using a dropping funnel. After the end of the dropwise addition, the mixture was stirred for 1 hour with the internal temperature at 10℃, filtered on a glass filter, and repeatedly washed with distilled water to recover a white solid. After drying overnight in a dryer adjusted to 70℃, the product was measured by powder X-ray diffraction. The results are shown in Figure 1. The peak profile closely matched that of JCPDS 12-0368 in the database, confirming that the desired β-SrHPO4 had been produced.

[0070] Synthesis Example 6 (BaHAP: Synthesis of Barium Apatite) 61.1g (0.25 mol) of barium chloride dihydrate was dissolved in 200mL of distilled water and stirred in a water bath adjusted to 50℃. A solution of 23g (0.174 mol) of diammonium hydrogen phosphate and 8g (0.075 mol) of sodium carbonate dissolved in 200mL of distilled water was gradually added dropwise over 30 minutes using a dropping funnel. After the end of the dropping, the mixture was stirred in a water bath at 50℃ for 1 hour, and then filtered using a glass filter. The product on the filter was repeatedly washed with distilled water, dried overnight in a dryer adjusted to 70℃, and the product was measured by powder X-ray diffraction. The results are shown in Figure 2. It was confirmed that the target BaHAP was produced because the peak profile matched well with that of PDF01-0811 (Ba5(OH)(PO4)3: Barium Hydroxide Phosphate) from the database. In addition, the X-ray diffraction spectrum of the product showed several peaks other than those assigned to barium apatite, indicating that the product contained a small amount of barium hydrogen phosphate. The same results were obtained even when the product was further purified to remove barium hydrogen phosphate.

[0071] Synthesis Example 7 (BaFAP: Synthesis of barium fluoride apatite) 61.1g (0.25 mol) of barium chloride dihydrate was dissolved in 350mL of distilled water and stirred on a water bath adjusted to 50℃. A solution of 20g (0.151 mol) of diammonium hydrogen phosphate, 2.1g (0.05M) of sodium fluoride, and 10.6g (0.10 mol) of sodium carbonate dissolved in 300mL of distilled water was gradually added dropwise over 30 minutes using a dropping funnel. One hour after the end of the dropping, the mixture was stirred on a 50℃ water bath and then filtered using a glass filter. The product on the filter was repeatedly washed with distilled water, dried overnight in a dryer adjusted to 70℃, and then the product was measured by powder X-ray diffraction. The results are shown in Figure 3. It was confirmed that the target BaFAP was produced because the peak profile matched well with that of PDF70-2318 (Ba5(PO4)3Cl:Alforsite) from the database. In addition, the X-ray diffraction spectrum of the product showed several peaks other than those attributable to barium fluoride apatite, indicating that the product contained a small amount of barium hydrogen phosphate. The same results were obtained even when the product was further purified to remove the barium hydrogen phosphate.

[0072] Synthesis Example 8 (L-SrMgP: Synthesis of low-crystalline magnesium-substituted strontium apatite) The β-SrHPO4 obtained in Synthesis Example 5 (synthesis of β-SrHPO4) was suspended in water containing an equimolar amount of sodium hydroxide, stirred for 5 hours at 20°C, and filtered onto a glass filter. After repeated washing with distilled water and drying overnight in a dryer adjusted to 70°C, measurement was performed by X-ray diffraction, and low-crystalline strontium apatite (L-SrHAP) was obtained, which exhibited the diffraction profile shown in Figure 4.

[0073] 36 g of the L-SrHAP obtained above was weighed out and suspended in 200 mL of distilled water, to which 30.5 g (0.15 mol) of magnesium chloride hexahydrate and 36 g of 28% ammonia water were added, and the mixture was heated and stirred for 6 hours in a water bath set at 90°C. After cooling to room temperature, the reaction system was filtered through a glass filter and repeatedly washed with ammonia water, and then repeatedly washed with distilled water. The product was dried overnight in a dryer adjusted to 70°C, and then measured by X-ray diffraction, resulting in a low-crystalline magnesium-substituted strontium (hydroxy)apatite with the diffraction profile shown in Figure 5. From the analysis of the X-ray diffraction profile in FIG. 5, it was found that the product was a mixture of strontium and magnesium-containing phosphate compounds (Sr9Mg(PO3OH)(PO4)6) that exhibited a Whitlockite structure together with magnesium-substituted strontium apatite. The presence of other magnesium compounds (magnesium hydroxide) was not confirmed. In the present invention, the compound obtained in this synthesis example was conveniently called L-SrMgP (low-crystalline magnesium-substituted strontium apatite). In addition, the product was dissolved in an aqueous nitric acid solution and subjected to elemental analysis by ICP-AES (inductively coupled plasma atomic emission spectrometry), and it was found that the elemental composition of the product contained each element in the ratio of Sr(6.8)Mg(2.58)(PO44)6.

[0074] Synthesis Example 9 (Synthesis of L-SrZnP low-crystalline zinc-substituted strontium apatite) The same procedure was followed as in Synthesis Example 8 (synthesis of L-SrMgP low-crystalline magnesium-substituted strontium apatite), except that 20.4 g (0.15 mol) of zinc chloride was used instead of magnesium chloride hexahydrate, to obtain a product. The X-ray diffraction pattern is shown in FIG. 6. From this X-ray diffraction pattern, it was confirmed that low-crystalline zinc-substituted strontium apatite was produced. In addition, the product was dissolved in an aqueous nitric acid solution and subjected to elemental analysis by ICP-AES (inductively coupled plasma atomic emission spectrometry), and it was found that the elemental composition of the product contained each element in the ratio of Sr(7)Zn(2.45)(PO4)6.

[0075] Synthesis Example 10 (Synthesis of strontium / barium (2:8) apatite compound (SrBa:2 / 8)) 13.4g (0.05 mol) of strontium chloride hexahydrate and 48.9g (0.20 mol) of barium chloride dihydrate were dissolved in 200mL of distilled water and stirred in a water bath adjusted to 50℃. A solution of 23g (0.174 mol) of diammonium hydrogen phosphate and 8g (0.075 mol) of sodium carbonate dissolved in 200mL of distilled water was gradually added dropwise using a dropping funnel over 30 minutes. After the end of the dropping, the mixture was stirred in a water bath at 50℃ for 1 hour, and then filtered using a glass filter. The product on the filter was repeatedly washed with distilled water, dried overnight in a dryer adjusted to 70℃, and the product was measured by powder X-ray diffraction. It was confirmed from the database that the peak profile almost matched that of PDF01-0811 (Ba5(OH)(PO4)3: Barium Hydroxide Hydroxide Phosphate). In addition, the product was dissolved in an aqueous nitric acid solution and subjected to elemental analysis by ICP-AES. It was found that the elemental composition of the product contained each element in a ratio of Sr / Br = 2 / 8, confirming that the desired strontium / barium (2:8) apatite compound had been produced.

[0076] (2) Production of nucleic acid adsorbent supported on a carrier Production Example 1 (Production of polystyrene beads carrying SrHAP) Monodisperse polystyrene beads with a particle size of the micron order were synthesized by dispersing styrene in ethanol using polyvinylpyrrolidone as a dispersion stabilizer. That is, 20 g of PVP K-30 was placed in a 1 L round-bottom flask equipped with a stirrer, thermometer, reflux condenser, and nitrogen inlet tube, and 100 g of styrene monomer and 200 g of ethanol were added and placed on a water bath adjusted to 75°C. Polymerization was started by adding 1 g of AIBN as a polymerization initiator, and the mixture was heated and stirred at 75°C for 6 hours. After the reaction, the polymerization product solution was taken out and divided into 1 / 10 portions, and each of the polymerization reaction solutions was used in the following mixed treatment test with SrHAP. 1 g, 2 g, and 3 g of the SrHAP powder obtained in Synthesis Example 1 were added to 30 g of the polymerization reaction solution, and the mixture was placed in a 100 mL polypropylene container. 160 g of zirconia beads with a particle size of 0.3 mm were added and the container was sealed, and a wet dispersion treatment was performed for 6 hours using a shaker at a cycle of 205 times / minute. Then, the zirconia beads were separated from the dispersion using a filter cloth. The dispersion was filtered using #200 filter paper, repeatedly washed with ethanol, and then dried at room temperature. Scanning electron microscope (SEM) photographs of each bead are shown in FIG.

[0077] Production Example 2 (Production of nonwoven fabric carrying SrHAP) As nonwoven fabrics, two samples of 100% PET (polyethylene terephthalate) with different basis weights (basis weights are 15 g / m2 each) were purchased from Japan Vilene Co., Ltd. 2 and 30g / m 2 ) were obtained and each of them was loaded with SrHAP as described below. 5 g of SrHAP obtained in Synthesis Example 1 was used and placed in a 100 ml polypropylene container. 0.3 g of citric acid monohydrate was added as a dispersion stabilizer, and 30 g of ethanol was further added. 100 g of zirconia beads with a particle size of 0.3 mm were further added and sealed, and a wet dispersion treatment was performed for 12 hours at a cycle of 220 times / min using a shaker (MK201D manufactured by Yamato Scientific Co., Ltd., with a two-stage spring shaker table). The dispersion was a milky white homogeneous solution with no generation of aggregates, and was left at room temperature for one week, but no generation of aggregates or precipitation occurred, and the dispersion stability was extremely excellent. This dispersion was diluted with ethanol to 10% by mass, and the above two types of nonwoven fabrics were immersed in the dispersion, pulled out from the liquid, excess dispersion was removed, and the mixture was dried at room temperature.

[0078] Next, SrHAP dispersed particles were thermally welded to the nonwoven fabric using the method described in JP 2017-051416 A. That is, a carbon dioxide gas laser (Keyence Corporation, Laser Marker ML-Z9510, wavelength 10.6 μm, maximum output 80 W) was used to irradiate the coated surface of the film with laser light from above 38 cm away from the nonwoven fabric surface under the following drawing conditions. In order to measure the surface temperature of the laser light irradiated area, a digital radiation thermometer (LumaSense Technologies Inc., IGA6 / 23) was used to measure the change in surface temperature in an area with a diameter of 0.6 mm as the measurement diameter at the center point of the laser light irradiated area. As drawing conditions, the scanning speed of the laser light irradiation was 3000 mm / sec, the laser power (duty ratio) was 100%, and the spot diameter was 140 μm, and drawing was performed on the surface of the nonwoven fabric containing SrHAP while drawing concentric circles from the center point with a line interval of 140 μm. The laser oscillation frequency was 25 kHz, and the pulse width of the laser light was 24 μsec. At this time, the surface temperature of the laser irradiated area was measured using the radiation thermometer described above immediately after the start of drawing with the laser light, and the surface temperature was adjusted to be around 150°C, which is close to the melting temperature of PET fiber, 155°C. After the laser irradiation, the nonwoven fabric was repeatedly washed with ethanol to remove excess SrHAP that was not heat-welded, and then dried to obtain the target nonwoven fabric carrier carrying SrHAP.

[0079] This was analyzed using a scanning electron microscope (SEM) equipped with an energy dispersive X-ray analyzer (EDAX), and the surface of the SrHAP immobilized on the nonwoven fabric was observed. Basis weight 15g / m 2 An SEM photograph of the nonwoven fabric using the above is shown in Figure 8. An elemental analysis was performed on the area enclosed in a box in Figure 8, and the results shown in Figure 9 were obtained. Figures 8 and 9 make it clear that SrHAP is supported on the fiber surface. Basis weight 30g / m 2 An SEM photograph of the case where a nonwoven fabric having the above structure was used is shown in Figure 10. An elemental analysis was performed on the area enclosed in a box in Figure 10, and the results shown in Figure 11 were obtained. It was found that when a nonwoven fabric with a large basis weight was used (FIGS. 10 and 11), a significantly larger amount of SrHAP was supported on the surface of the nonwoven fabric than when a nonwoven fabric with a small basis weight was used (FIGS. 8 and 9).

[0080] (3) Amplification of DNA from a DNA solution (3-1) DNA amplification using strontium / barium (2:8) apatite compound (SrBa:2 / 8) powder Preparation of DNA samples Mycobacterium bovis BCG strain DNA (5ng / μL) was used as the test sample. 10μL of DNA was added to 1mg of powder of strontium / barium (2:8) apatite compound (SrBa:2 / 8) synthesized in Synthesis Example 10, and the DNA was adsorbed to the apatite compound at 4℃ for 10 minutes. The apatite compound with adsorbed DNA was rinsed by adding 500μL of sterile distilled water and centrifuging at 13,000 rpm for 3 minutes, and then used as a PCR sample. PCR reaction DNA sample: Mycobacterium bovis BCG strain DNA adsorbed SrBa: 2 / 8 (1 mg) Positive control: 5ng / μL BCG strain DNA Negative control: SrBa: 2 / 8 (1 mg) PCR reaction mixture Probe (FAM labeled): FAM-GTGGGGCGTAGGCCGTGAGGGGTTC (SEQ ID NO: 1) Primer TB-sp1F70 (Tm: 70.3°C): GGATCACCTCCTTTCTAAGGAGCACC (SEQ ID NO: 2) Primer TB-sp2R (Tm: 67.2°C): GATGCTCGCAACCACTATCCA (SEQ ID NO: 3) The target is a partial sequence of the Mycobacterium ITS sequence (Internal Transcribed Spacer region of the Mycobacterium genome). Reaction solution composition d H2O 17.4μL 10x Fast Buffer 1 2.5μL d-NTP Mixture(2.5mM each) 2.0μL SpeedSTAR HS DNA Polymerase (5 U / μl) 0.1 μL 25 μM Primer Mix (TB-sp1F70 / TB-sp2R) 1.0 μL 5 μM Probe 1.0 μL DNA 1.0 μL Total volume 25.0 μL Amplification conditions The StepOne Real-time PCR System (Life Technologies) was used as the amplification device, and DNA polymerase was activated and DNA was denatured by heating at 98°C for 30 seconds, followed by 40 amplification cycles of 98°C for 5 seconds and 72°C for 10 seconds. result The amplification curve is shown in Figure 12. Although the value was lower than that of the 5 ng / μL BCG strain DNA used as the positive control, amplification of the target DNA was confirmed in the SrBa:2 / 8 sample to which DNA was adsorbed.

[0081] (3-2) DNA amplification using SrHAP-loaded nonwoven fabric Preparation of DNA samples The DNA (5 ng / μL) of Mycobacterium bovis BCG strain was used as the test sample. 2 ) (3 mm × 3 mm), 10 μL of DNA was added, and the DNA was adsorbed onto SrHAP at 4°C for 10 minutes. The SrHAP-supported nonwoven fabric with adsorbed DNA was rinsed with 500 μL of sterile distilled water and used as a PCR sample. PCR reaction DNA sample: Mycobacterium bovis BCG strain DNA-adsorbed SrHAP-supported nonwoven fabric (3mm x 3mm) Positive control: 5ng / μL BCG strain DNA Negative control: SrHAP-supported nonwoven fabric (3 mm x 3 mm) The PCR reaction solution, reaction solution composition, and amplification conditions were the same as those in "(3-1) DNA amplification using strontium / barium (2:8) apatite compound (SrBa:2 / 8) powder." result The amplification curve is shown in Figure 13. Although the value was lower than that of 5 ng / μL of BCG strain DNA used as a positive control, amplification of the target DNA was confirmed in the SrHAP-supported nonwoven fabric (3 mm × 3 mm) to which DNA was adsorbed.

[0082] (3-3) DNA amplification using SrHAP-loaded microbeads (PCR method) Preparation of DNA samples Mycobacterium bovis BCG strain was cultured in Ogawa medium for 3 weeks, then collected, placed in a sterile test tube containing glass beads, and disrupted with a vortex mixer. DNA samples were then prepared using the High Pure PCR Template Preparation Kit (Roche). 50 μL of DNA was added and suspended in 5 mg of SrHAP-loaded polystyrene beads obtained by loading 30% SrHAP microparticles in Production Example 1. The beads were heated at 37° C. for 10 minutes, washed five times with 1.0 mL of sterile distilled water, and then suspended in 100 mL of sterile distilled water to prepare a PCR sample. PCR reaction DNA sample: Mycobacterium bovis BCG strain DNA-adsorbed polystyrene beads (5 mg) Positive control: 250ng / μL BCG strain DNA Negative control: polystyrene beads (5 mg) PCR reaction mixture Probe (FAM label) (SEQ ID NO: 1) Primer TB-sp1F70 (Tm: 70.3°C) (SEQ ID NO: 2) Primer TB-sp2R (Tm: 67.2°C) (SEQ ID NO: 3) The target is a partial sequence of the Mycobacterium ITS sequence (Internal Transcribed Spacer region of the Mycobacterium genome). Reaction solution composition d H2O 16.4μL 10x Fast Buffer 1 2.5μL d-NTP Mixture(2.5mM each) 2.0μL SpeedSTAR HS DNA Polymerase (5 U / μl) 0.1 μL 25 μM Primer Mix (TB-sp1F70 / TB-sp2R) 1.0 μL 5 μM Probe 1.0 μL DNA 2.0 μL Total volume 25.0 μL Amplification conditions The amplification device used was the StepOne Real-Time PCR System (Life Technologies), and the amplification cycle consisted of 40 cycles of heating at 98°C for 30 seconds to activate DNA polymerase, heating at 98°C for 5 seconds to denature DNA, and annealing and elongation at 72°C for 10 seconds. result The amplification curve is shown in Figure 14. Amplification of the target DNA was confirmed in the DNA-adsorbed polystyrene beads.

[0083] (4) Amplification of DNA in biological samples (4-1) DNA Amplification from Saliva DNA extraction A sample of 1 mL of saliva mixed with 0.1 mL of 10% sodium dodecyl sulfate (SDS) solution and a sample of 1 mL of saliva alone were each heated at 98°C for 10 minutes. 5 μL of SrHAP suspension (0.1 g / mL) obtained in Synthesis Example 1 suspended in water was added to each sample and mixed by inversion for 10 minutes. After centrifugation (5000 g, 5 min), the precipitate (DNA-SrHAP complex) was collected and suspended in 10 μL of water. LAMP reaction DNA was amplified using 5 μL of the DNA-SrHAP suspension as a template and a LAMP reagent (Loopamp DNA Amplification Reagent, Eiken Chemical Co., Ltd.). 4 The molecule was used as a positive control, and the SrHAP suspension was used as a negative control, and they were reacted with the LAMP reagent in the same manner. The amounts of each component contained in 25 μL of the LAMP reaction solution were as follows: Primers: 1600nM FIP, 1600nM BIP, 800nM LF, 800nM LB, 400nM F3, 400nM R3 Target DNA solution: 5μL Loopamp fluorescent and visual detection reagent (Eiken Chemical Co., Ltd.) 1μL 0.8M Betaine After preparing the LAMP reaction solution, the mixture was transferred to a reaction tube, mixed by inversion, and reacted at 64°C for 90 minutes. The primer sets used are as follows: Primer set for amplifying the cnm protein gene (hereinafter referred to as "cnm primers") F3: CCAGTAATACTGTCATTGAAAGT (SEQ ID NO: 5) R3: CGCTTTGAGTTTGATGAGC (SEQ ID NO: 6) FIP: AACCATTAAGCTGGAGGTTCAGGAACTGCTTTGTCTTGCGT (SEQ ID NO: 7) BIP: CGTATAACCTGTTCCTCTGACTGTAATATTAAAGCAGGCGACAC (SEQ ID NO: 8) LF: GCAAGTATGTTGGTGATTTG (SEQ ID NO: 9) LB: CCTGAATTCTGCCAGTTAAC (SEQ ID NO: 10) The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. Although SDS has the effect of destroying cell membranes, DNA could be extracted without SDS by heat treatment at 98°C alone (Figure 15, "2. Saliva + SDS" and "3. Saliva only"). The DNA-SrHAP complex was added to the LAMP reaction without any treatment, but it is thought that the DNA dissociated from SrHAP at around 64°C during the LAMP reaction, becoming a template for LAMP and being amplified. This shows that template DNA can be easily obtained from the DNA-SrHAP complex without using an acidic solution such as phosphate as a dissociating agent. With the method of the present invention, results could be obtained within 2 hours after saliva collection.

[0084] (4-2) Extraction system study No. 1 In "(4-1) DNA amplification using saliva," DNA was eluted from cells by heat-treating saliva at 98°C. Here, we investigated whether heat treatment would be unnecessary by using SDS as a surfactant capable of destroying cell membranes. A sample was prepared by mixing 1 mL of saliva and 0.1 mL of 10% SDS solution and heating it at 98°C for 10 minutes, and another sample was prepared without heating. 5 μL of SrHAP suspension (0.1 g / mL) obtained in Synthesis Example 1 suspended in water was added to each sample, and the mixture was mixed by inversion for 10 minutes. After centrifugation (5000 g, 5 min), the precipitate (DNA-SrHAP complex) was collected and suspended in 10 μL of water. Next, the LAMP reaction was carried out in the same manner as in "(4-1) DNA amplification using saliva." The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. Heat treatment at 98°C caused amplification, but no amplification was observed when left at room temperature, indicating that a final concentration of 0.1% SDS had no effect.

[0085] (4-3) Extraction system study No. 2 In "(4-1) DNA amplification using saliva," a high-temperature heat treatment of 98°C was performed to elute DNA from cells. We investigated whether this temperature could be lowered to the reaction temperature of LAMP. 1 mL of each of cnm-positive and cnm-negative saliva was heated at 98°C for 10 minutes or 65°C for 10 minutes. 5 μL of SrHAP suspension (0.1 g / mL) obtained in Synthesis Example 1 suspended in water was added and mixed by inversion for 10 minutes. After centrifugation (5000 g, 5 min), the precipitate (DNA-SrHAP complex) was collected and suspended in 10 μL of water. Next, the LAMP reaction was carried out in the same manner as in "(4-1) DNA amplification using saliva." The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. Amplification by the LAMP method was possible even with saliva samples that had been heat-treated at 65°C. In other words, it was confirmed that DNA can be eluted from cells even at 65°C. Since 65°C is the optimal temperature for the LAMP reaction, if DNA can be extracted at 65°C, there is the advantage that DNA extraction and DNA amplification can be performed using the same device.

[0086] (4-4) Study of SrHAP-loaded nonwoven fabric Since the SrHAP used in (4-1) to (4-3) is a powder, the suspension had to be centrifuged to separate the DNA-SrHAP complex before adding the DNA-adsorbed SrHAP to the LAMP reaction. To avoid this step, we used SrHAP bound to a nonwoven fabric. DNA extraction 0.5 mL of each of the cnm-positive and negative saliva samples was heated at 98°C for 10 minutes. 2The SrHAP-supported nonwoven fabric (4 mm x 4 mm) was added and mixed by inversion for 10 minutes. After mixing, the nonwoven fabric was lifted up and added to the LAMP reaction solution. Next, the LAMP reaction was carried out in the same manner as in "(4-1) DNA amplification using saliva." The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. Even when SrHAP bound to nonwoven fabric was used, DNA could be amplified by the LAMP method without eluting DNA from the DNA-SrHAP (nonwoven fabric).

[0087] (4-5) Detection of periodontal disease bacteria (Proshyromonas gingivalis) from dental plaque DNA extraction Plaque samples were collected from the gingival sulcus and suspended in 1 mL of distilled water. After heating at 98°C for 10 minutes, 5 μL of the suspension was used as a template for LAMP. In addition, 5 μL of the SrHAP suspension (0.1 g / mL) obtained in Synthesis Example 1 suspended in water was added to 500 μL of the heat-treated dental plaque suspension, and the mixture was mixed by inversion for 10 minutes. After centrifugation (5000 g, 5 min), the precipitate (DNA-SrHAP complex) was collected and suspended in 5 μL of water, which was also used as a template for LAMP. LAMP reaction The amounts of each component contained in 25 μL of the LAMP reaction solution were as follows: Primers: 1600nM FIP, 1600nM BIP, 400nM F3, 400nM R3 Target DNA solution: 5μL Loopamp fluorescent and visual detection reagent (Eiken Chemical Co., Ltd.) 1μL After preparing the LAMP reaction solution, the mixture was transferred to a reaction tube, mixed by inversion, and reacted at 62° C. for 90 minutes. The primer sets used are as follows: Primer set for amplifying the 16S RNA gene of periodontal disease bacterium (Proshyromonas gingivalis) F3: GCAGCTTGCCATACTGCG (SEQ ID NO: 11) R3: ACATGTTCCTCCGCTTGTG (SEQ ID NO: 12) FIP: TGCGTGGACTACCAGGGTATCTACTGACACTGAAGCACGAAG (SEQ ID NO: 13) BIP: TACCGTCAAGCTTCCACAGCGACTTTGAGTTTCACCGTTGCC (SEQ ID NO: 14) The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. In a sample of oral plaque that had been heat-treated to extract DNA, the periodontal disease bacteria (P. gingivalis) could not be detected using the LAMP method, but the periodontal disease bacteria could be detected by adsorbing it to SrHAP. Periodontal disease bacteria cannot grow substantially in the presence of oxygen, so they require anaerobic culture conditions. They also grow slowly and require a special medium composition. For this reason, it has been difficult and time-consuming to detect periodontal disease bacteria in dental plaque using conventional methods. The method of the present invention is also very useful in that it can confirm the presence of periodontal disease bacteria without culturing them.

[0088] (4-6) DNA extraction method DNA extraction To each 200 μL of cnm-positive saliva (cnm+) and negative saliva (cnm-), 2 μL of each suspension (0.1 g / mL) of strontium carbonate apatite (SrCAP) (Synthesis Example 3), barium fluoride apatite (BaFAP) (Synthesis Example 7), and low-crystalline magnesium-substituted strontium apatite (L-SrMgP) (Synthesis Example 8) that had been previously suspended in water was added and heated at 80°C for 10 minutes. Then, the mixture was mixed by inversion for 10 minutes. After centrifugation (5000g, 5 min), the precipitate was collected and suspended in 5 μL of water. LAMP reaction The LAMP reaction was the same as that described in “(4-1) Amplification of DNA from saliva.” The results of observing each reaction tube under an ultraviolet lamp are shown in FIG. When extracting DNA by heat treatment, even if the nucleic acid adsorbent powder was added before the sample was heat treated, the partial sequence of the cnm gene was amplified in the same way as when the nucleic acid adsorbent powder and the sample were mixed and then heat treated. By using these powders, the opening and closing of the lid during the extraction procedure can be reduced, the operation becomes easier, and the risk of contamination can be reduced. When detecting the new coronavirus or influenza virus, a cotton swab taken from the throat is used in the detection reaction. The cotton swab is then placed in a powder suspension, heat-treated, and the DNA-nucleic acid adsorbent complex powder isolated by centrifugation or other methods is then placed in the LAMP reaction, making it possible to detect the target sequence.

[0089] (5) Examination of dissociation temperature of DNA from DNA-SrHAP 100 μL (10 ng / μL) of lambda DNA and 15 g / m2 of the paper obtained in Example 2 2 The SrHAP-supported nonwoven fabric (4 mm x 4 mm) was mixed at room temperature for 10 minutes, washed with distilled water, and then 50 μL of distilled water was added and heated at each temperature (25°C, 45°C, 55°C, 65°C, 75°C) for 15 minutes. After that, the nonwoven fabric was removed and the absorbance A 260 The results are shown in Figure 21. We investigated whether DNA dissociates from the DNA-SrHAP complex by heating, and found that the DNA concentration increased almost temperature-dependently. It was confirmed that DNA dissociates from the DNA-SrHAP complex by heating. It was also found that DNA dissociates at temperatures above 45°C. Nucleic acid amplification reactions are usually performed at temperatures above 45°C. For example, the LAMP reaction is performed at around 65°C. This suggests that DNA dissociates from the DNA-SrHAP complex during nucleic acid amplification reactions and is able to bind to the primers.

[0090] (6) Study of phosphates or carbonates of various alkaline earth metals (Mg, Ca, Sr, Ba) DNA extraction 0.2 mL of saliva was heated at 98°C for 10 minutes, and 2 μL of an aqueous suspension (0.1 g / mL) of alkaline earth metal (Ca, Sr, Ba) phosphate or carbonate compounds was added to the sample and mixed by inversion for 10 minutes. After centrifugation (10,000 g, 1 min), the precipitate (DNA-alkaline earth metal (Ca, Sr, Ba) phosphate or carbonate compound complex) was suspended in 5 μL of water. Hydroxyapatite (HAP) was HAP-200 manufactured by Taihei Chemical Industry Co., Ltd., strontium apatite (SrHAP) was used in Synthesis Example 1, strontium fluoride apatite (SrFA) was used in Synthesis Example 4, strontium carbonate (SrCO3) was used in Synthesis Example 3, β-strontium hydrogen phosphate (β-SrHPO44) was used in Synthesis Example 5, barium hydroxyapatite (BaHAP) was used in Synthesis Example 6, barium fluoride apatite (BaFAP) was used in Synthesis Example 7, and low-crystalline magnesium-substituted strontium apatite (L-SrMgP) was used in Synthesis Example 8. LAMP reaction A LAMP reaction was carried out using 5 μL of the DNA-alkaline earth metal (Ca, Sr, Ba) phosphate or carbonate compound complex suspension as a template and the cnm primer described in "(4-1) DNA amplification using saliva." In addition, as a negative control, a LAMP reaction was carried out in the same manner using 5 μL of saliva. The LAMP reaction conditions were the same as those in “(4-1) DNA amplification using saliva.” The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in FIG. Phosphates or carbonates of various alkaline earth metals (Ca, Sr, Ba) functioned as nucleic acid adsorbents, and were able to detect the cnm gene from saliva, similar to SrHAP.

[0091] (7) Study on the effects of phosphates (7-1) DNA Amplification from Saliva (LAMP Method) Phosphate has the effect of promoting dissociation of nucleic acid from a complex of nucleic acid and an alkaline earth metal phosphate or carbonate, so it is desirable to use it to promote dissociation of nucleic acid. On the other hand, phosphate inhibits nucleic acid amplification enzymes, so it is desirable not to use it for nucleic acid amplification reactions. Therefore, in the nucleic acid amplification method of the present invention, it was investigated whether or not a concentration of phosphate can be added when subjecting a complex of nucleic acid and the nucleic acid adsorbent of the present invention to a nucleic acid amplification reaction. In other words, it was examined whether the nucleic acid amplification reaction would proceed even if phosphate was added to the LAMP reaction solution. 1 mL of cnm-positive saliva was heated at 98°C for 10 minutes. 10 μL of SrHAP suspension (0.1 g / mL) obtained in Synthesis Example 1 suspended in water was added and mixed by inversion for 10 minutes. After centrifugation (5000 g, 5 min), the precipitate (DNA-SrHAP complex) was collected and suspended in 25 μL of water. LAMP reaction Using 5 μL of the DNA-SrHAP suspension as a template, the LAMP reaction was carried out using the cnm primer described in "(4-1) DNA amplification using saliva." At this time, KH2PO4 was added to each reaction tube to set the KH2PO4 concentrations to 0 mM, 5 mM, 10 mM, 20 mM, and 100 mM. The LAMP reaction conditions were the same as in "(4-1) DNA amplification using saliva." The results of observing each reaction tube after the reaction under an ultraviolet lamp are shown in Figure 23. It was found that nucleic acid amplification occurred even in the presence of 100 mM phosphate in the LAMP reaction solution.

[0092] (7-2) Amplification of DNA from bacteria (PCR method) Preparation of DNA samples Mycobacterium bovis BCG strain was cultured in Ogawa medium for 3 weeks, then collected, placed in a sterile test tube containing glass beads, and disrupted with a vortex mixer. DNA samples were then prepared using the High Pure PCR Template Preparation Kit (Roche). 100 μL of 250 ng / μL BCG strain DNA was added to and adsorbed onto the SrHAP powder (5 mg) obtained in Synthesis Example 1, and centrifuged at 3000 g for 1 minute. The precipitate from which the supernatant was removed was washed five times with 1.0 mL of sterile distilled water, and then suspended in 100 μL of sterile distilled water to prepare a PCR sample. PCR reaction DNA sample: Mycobacterium bovis BCG strain DNA-adsorbed SrHAP (0.1 mg) Positive control: 250ng / μL BCG strain DNA Negative control: SrHAP (0.1 mg) PCR reaction mixture Probe (FAM label) (SEQ ID NO: 1) Primer TB-sp1F70 (Tm: 70.3°C) (SEQ ID NO: 2) Primer TB-sp2R (Tm: 67.2°C) (SEQ ID NO: 3) The target is a partial sequence of the Mycobacterium ITS sequence (Internal Transcribed Spacer region of the Mycobacterium genome). Reaction solution composition d H2O 17.4μL 10x Fast Buffer 1 2.5μL d-NTP Mixture(2.5mM each) 2.0μL SpeedSTAR HS DNA Polymerase (5 U / μl) 0.1 μL 25 μM Primer Mix (TB-sp1F70 / TB-sp2R) 1.0 μL 5 μM Probe 1.0 μL DNA 1.0 μL Total volume 25.0 μL Amplification conditions The StepOne Real-time PCR System (Life Technologies) was used as the amplification device, and DNA polymerase was activated and DNA was denatured by heating at 98°C for 5 seconds, followed by 40 amplification cycles of 60°C for 10 seconds and 72°C for 10 seconds. result The amplification curve is shown in Figure 24. Amplification was observed in PCR reaction solutions containing 20 to 50 mM phosphate buffer. Under the above conditions, in which the denatured single-stranded DNA was annealed at 60°C for 10 seconds, amplification did not occur unless phosphate buffer was added at a concentration of 20 mM or more. This is thought to be because the single-stranded DNA was re-adsorbed onto the surface of the SrHAP particles during the annealing process, preventing primer binding and subsequent amplification reactions. However, if the PCR conditions are adjusted, the amplification reaction will proceed without the addition of a phosphate buffer, and will also proceed in the presence of a higher concentration of phosphate buffer.

[0093] (8) Nucleic acid adsorption capacity The following experiment was carried out to investigate the saturation adsorption amount of DNA onto SrHAP powder. An aqueous solution of Escherichia coli (E. Coli) DNA (0.4 mg / mL concentration) was introduced into a 5 mL test tube, to which 1 to 50 mg of the SrHAP particles obtained in Synthesis Example 1 was added, and after shaking and mixing, the mixture was centrifuged to collect the supernatant. The DNA concentration in the supernatant was measured by measuring the absorbance at a wavelength of 260 nm using a UV-visible spectrophotometer. The results are shown in Figure 25. The absorbance decreased with the addition of SrHAP particles, and the proportion of DNA adsorbed to the SrHAP particles was calculated from the ratio of absorbance after adsorption to the original absorbance without the addition of SrHAP particles (DNA adsorption ratio). It was found that DNA was adsorbed to SrHAP in proportion to the amount of SrHAP particles added, and when 50 mg of SrHAP particles were added to 2 mg of DNA, the DNA was completely adsorbed to the SrHAP particles. Therefore, the amount of DNA adsorbed to 1 mg of SrHAP particles was 0.04 mg.

[0094] Next, the SrHAP particles with saturated DNA adsorption were suspended in 5 mL of pure water, shaken and stirred for 10 minutes at temperatures ranging from 5 to 70°C, then centrifuged to collect the supernatant. The concentration of DNA present in the supernatant was measured in the same manner using a UV-Vis spectrophotometer. The results are shown in Figure 26. No DNA was observed to detach from the SrHAP particles at temperatures below 30°C, but it was found that about 25% of the DNA detached from the SrHAP particles at temperatures of 50°C, and about 45% of the DNA detached from the SrHAP particles at 70°C. This suggests that when SrHAP particles are used in gene amplification reactions, simply heating SrHAP particles carrying DNA adsorbed at temperatures below 30°C to a temperature of 50°C or higher will cause the DNA to detach and bind to primers, resulting in an amplification reaction.

[0095] (9) Study of nucleic acid separation and purification chip with nonwoven fabric carrying nucleic acid adsorbent immobilized inside The SrHAP-supported nonwoven fabric obtained in Production Example 2 (basis weight 30 g / m 2 ) (5mm x 5mm) was filled and immobilized inside a 200μL pipette tip (Eppendorf epTIPS) to prepare a chip. In 1mL of Tris-HCl buffer solution (temperature adjusted to 20℃) containing Escherichia coli (E.Coli) DNA (0.4mg / mL concentration) and bovine serum albumin (1.2mg / mL concentration), the above-mentioned tip was used to repeatedly draw and discharge the solution five times using a pipette equipped with the tip. After that, the concentration of DNA remaining in the sample solution was measured from the absorbance at 260nm of the sample solution using a UV-Vis spectrophotometer. Furthermore, the albumin concentration in the sample solution was also measured from the absorbance at 280nm of the sample solution at the same time. As a result, no DNA was present in the sample solution after the drawing and discharging operation using the pipette, and no change was observed in the albumin concentration before and after the drawing and discharging operation. This clearly shows that the DNA in the sample solution is quantitatively (total amount) captured by the adsorbent, and at the same time, since albumin is not adsorbed, it is possible to selectively and quantitatively adsorb and separate DNA.

[0096] Next, the tip attached to the pipette that had been subjected to the above-mentioned suction and discharge operation was washed by repeatedly suctioning and discharging using 5 mL of pure water adjusted to 20 ° C. Then, suction and discharge were performed five times using the pipette equipped with the tip in 5 mL of pure water adjusted to 70 ° C. The solution was cooled to room temperature, and the concentration of DNA present in the sample solution was measured from the absorbance at 260 nm using an ultraviolet-visible spectrophotometer, which revealed that DNA was recovered almost quantitatively (almost the entire amount). From this result, it was demonstrated that the tip on which the nonwoven fabric carrying SrHAP prepared in this embodiment was immobilized can selectively adsorb and separate nucleic acid from a nucleic acid solution that also contains protein by using it alone, and after purifying the nucleic acid by washing, it is possible to quantitatively recover the nucleic acid by hot water or warm water treatment.

[0097] This series of operations can be automated by programming, and when the specimen solution is introduced into the automated device, a pipette is loaded with a tip for nucleic acid separation and purification, the sample solution is sucked up at room temperature to perform an adsorption operation, then a water washing operation is performed, and the nucleic acid is transferred to a nucleic acid amplification step by hot water or warm water extraction. Alternatively, after the water washing operation, the adsorbent can be removed from the tip and introduced into a nucleic acid amplification reaction solution to proceed with the nucleic acid amplification reaction step. Furthermore, it was clarified that following the nucleic acid amplification process, the reaction solution can be cooled to room temperature, the adsorbent recovered from the reaction solution, and then treated with hot or warm water, thereby recovering the amplified nucleic acid in solution. [Industrial Applicability]

[0098] The nucleic acid separation and amplification method of the present invention is a very useful method that can be performed very simply and inexpensively. In addition to being usable in laboratories, it can also be suitably used in hospitals, food, and environmental water testing, and there is a great demand for it.

Claims

1. A method for amplifying nucleic acid, comprising the steps of: contacting nucleic acid with a nucleic acid adsorbent selected from the group consisting of phosphates and / or carbonates of one or more alkaline earth metals selected from strontium, magnesium, and barium, and hydroxyapatite; and incorporating the complex of nucleic acid and the nucleic acid adsorbent obtained by the contact into a nucleic acid amplification solution and carrying out a nucleic acid amplification reaction at 45°C or higher.

2. The method according to claim 1, wherein the step of contacting the nucleic acid with the nucleic acid adsorbent is carried out at a temperature of 30°C or lower.

3. The method according to claim 1 or 2, wherein the nucleic acid adsorbent is in powder or granular form.

4. The method according to any one of claims 1 to 3, wherein the nucleic acid adsorbent is supported on a carrier.

5. A nucleic acid amplification device comprising: a nucleic acid adsorption container containing a nucleic acid adsorbent selected from the group consisting of phosphates and / or carbonates of one or more alkaline earth metals selected from strontium, magnesium, and barium, and hydroxyapatite; a nucleic acid amplifier having a nucleic acid amplification container; and a means for transferring a complex of the nucleic acid adsorbent and nucleic acid from the nucleic acid adsorption container to the nucleic acid amplification container.

6. A nucleic acid amplification device comprising: a nucleic acid adsorption container containing a nucleic acid adsorbent selected from the group consisting of phosphates and / or carbonates of one or more alkaline earth metals selected from strontium, magnesium, and barium, and hydroxyapatite; a nucleic acid amplifier; a means for discharging the sample liquid from the nucleic acid adsorption container after the nucleic acids in the sample liquid containing nucleic acids have been adsorbed onto the nucleic acid adsorbent; and a means for attaching the nucleic acid adsorption container to the nucleic acid amplifier after discharging the sample liquid.

Images