Nucleic acid delivery vector comprising a circular single-stranded polynucleotide

Abstract

The present invention relates to a delivery vector for the delivery of single-stranded nucleic acids. The vector is a closed circular polynucleotide consisting of at least three sections, two of which are sufficiently complementary to form a double strand, and an intervening sequence containing the single-stranded nucleic acid to be delivered. The double strand contains a recognition sequence for a target nuclease so that the single-stranded nucleic acid is released under appropriate conditions.

Description

[Technical field]

[0001] The present invention relates to the intracellular delivery or release of single-stranded nucleic acids, specifically single-stranded donor oligonucleotides. Any type of nucleic acid is contemplated herein, although single-stranded deoxyribonucleic acid (DNA) may be preferred. [Background technology]

[0002] The most flexible regions of nucleic acids are often non-base paired and include single-stranded deoxyribonucleic acid (ssDNA) and single-stranded ribonucleic acid (ssRNA) regions that are involved in vital processes within the cell.

[0003] Single-stranded nucleic acid molecules are particularly interesting to those skilled in the art of delivering nucleic acids to cells, because the nucleic acid is immediately available in the transfected cell and does not require "unwinding" by appropriate enzymes, for example, to expose ssDNA segments. These sections are then available for transcription into ssRNA, such as messenger RNA (mRNA), or for interaction with other proteins that recognize ssDNA.

[0004] Single-stranded DNA (ssDNA) is an essential intermediate in many biological processes, including DNA replication, recombination, repair, transcription, and translocation. It is therefore also desirable to introduce ssDNA into cells, especially to have therapeutic effects that exploit these mechanisms. ssDNA also has many therapeutic applications. In eukaryotic cells, ssDNA is frequently exposed as a result of many cellular processes, such as replication, transcription, and recombination. Exposed ssDNA is vulnerable to chemical attack and nucleolytic degradation and therefore needs to be properly protected to avoid mutations. Single-stranded DNA-binding proteins (SSB) immediately bind to ssDNA and protect it from inappropriate reactions until the relevant process is completed. However, ssDNA that is not so protected is vulnerable to chemical attack and nucleolytic degradation.

[0005] Single-stranded nucleic acid molecules are particularly interesting for those skilled in the art of delivering nucleic acid to cells.Because nucleic acid is readily available in transfected cells and does not require "unwinding" by appropriate enzymes to expose relevant genetic information (e.g., for transcription and translation or insertion into genome).Single-stranded nucleic acid molecules are considered to be the best delivery vectors for several applications, especially gene transfer, gene editing, and biosensing.

[0006] Alternatively, the single stranded nucleic acid may have a function related to its conformation, ie, as an aptamer or a nucleic acid enzyme (including DNAzymes and RNAzymes). Additionally, antisense applications may require the provision of single-stranded nucleic acid within a cell. Antisense therapy involves the use of oligonucleotides with specific sequences complementary to a target sequence, such as messenger RNA (mRNA).

[0007] Still further, the provision of single-stranded nucleic acid in cells may be required for translation purposes, i.e., to provide mRNA for direct protein production in cells.Thus, the single-stranded nucleic acid may be RNA, particularly mRNA.Other types of RNA may also be delivered using vectors, including long non-coding RNA (lncRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), repeat-associated siRNA, enhancer RNA, antisense RNA, guide RNA, nucleolar RNA or small nuclear RNA.

[0008] Both ssDNA and dsDNA donor sequences can function as efficient gene editing templates.It has been found that ssDNA donor templates have their own advantages in terms of repair specificity when used in gene editing (Design and specificity of long ssDNA donors for CRISPR-based knock-in;Han Li, Kyle A. Beckman, Veronica Pessino, Bo Huang, Jonathan S. Weissman, Manuel D. Leonetti bioRxiv 178905), and therefore their use is desirable.

[0009] Although it is desirable to provide single-stranded nucleic acid to cells, this approach may have some drawbacks. The effectiveness of nucleic acid therapy may be limited by undesired degradation. Chemical modification is known to improve the stability of nucleic acids, but the type, position, and number of modifications all make a difference, and the use of modifications may affect the ability of nucleic acids to bind to proteins, so in some cases it may be desirable to minimize the number of modifications.

[0010] By their very nature, single-stranded nucleic acids are rapidly degraded in cells. This is because the free 3' and 5' ends are available for enzymatic degradation, such as by the action of nucleases that "chew" the ends and destroy the nucleic acid. For example, Trex1, the major 3' to 5' DNA exonuclease in mammalian cells, acts preferentially on and binds tightly to single-stranded DNA (ssDNA). Mutations in the human TREX1 gene can cause Aicardi-Goutières syndrome, which is characterized by immune disturbances. Modifications of the 3'-terminal nucleotides have been shown to aid resistance to such degradation.

[0011] It has been recognized for several years that cytosolic DNA is immunostimulatory, especially for the innate immune system. DNA is typically found in the nucleus of eukaryotic cells, and its presence in atypical locations, including the cytoplasm and endosomes, is understood to trigger immune activation. It is believed that the presence of DNA anywhere other than the nucleus triggers a DNA recognition system that detects both the DNA genomes of invading pathogens and misfunctioning cells.

[0012] It is known that unmethylated CpG DNA motifs, which are abundant in the genomes of many pathogens, can stimulate immune responses, and single-stranded DNA with a specific signature containing an AT-rich stem-loop region is also known to activate immune responses.

[0013] It is therefore desirable to deliver single-stranded nucleic acids in a "hidden" manner by delivering the linear single-stranded nucleic acid in a vector that is not easily recognized by the innate immune system and then releasing the linear single strand inside the cell.

[0014] The present inventors have devised a delivery vector that allows the release of single-stranded nucleic acid under appropriate conditions, such as the nucleus or other compartments of target cells.Single-stranded nucleic acid can be delivered for any conceivable purpose, and linear single-stranded nucleic acid is desirable, for example, as a donor for gene editing, for translation in cells, for modifying gene expression, for providing entities such as aptamers and nucleic acid enzymes, or for antisense applications. Summary of the Invention

[0015] The present invention relates to a delivery vector for delivering linear single-stranded nucleic acid to cells, preferably target cells.Delivery vector is effectively a carrier or delivery vehicle in which single-stranded nucleic acid is placed.Intracellular processes can utilize the structure of the delivery vehicle to release single-stranded nucleic acid.The construct can be engineered or designed so that release of single-stranded nucleic acid occurs only under specific conditions or cell types.

[0016] The provision of a delivery vector for linear single-stranded nucleic acids allows for covert delivery of entities that would otherwise be rapidly degraded. Delivery can be controlled or directed. According to one aspect, the present invention provides a method for producing a method for manufacturing a semiconductor device comprising: A nucleic acid delivery vector comprising a circular single-stranded polynucleotide, the vector comprising: (a) a duplex formed from a first section and a third section of the polynucleotide, the sections comprising complementary sequences; (b) a loop formed from the second section, the loop separating the first section and the third section; A nucleic acid delivery vector is provided, wherein the duplex contains a recognition sequence for a targeted nuclease.

[0017] The nucleic acid delivery vector is described as a single-stranded polynucleotide because under denaturing conditions, the delivery vector is a closed circular polynucleotide. The delivery vector preferably delivers a linear single-stranded nucleic acid. The single-stranded nucleic acid is present in the second section of the delivery vector, and therefore the sequence of the second section and the linear single-stranded nucleic acid are substantially the same. The linear single-stranded nucleic acid can be in any suitable conformation and in any suitable sequence. The linear single-stranded nucleic acid can be a nucleic acid enzyme, an aptamer, a donor template or an antisense nucleic acid, or any single-stranded nucleic acid discussed herein. When released from the delivery vector, the linear single-stranded nucleic acid has free 5' and 3' ends. Depending on the nature of the nuclease, the single-stranded nucleic acid can be released with fragments of the first section and the third section still present. This is the case for nucleases such as Cas9, and is shown in Figures 1A and 1B. These fragments can be small, preferably less than 15 bases in length.

[0018] The target nuclease can be any nuclease that is target specific. The double strand of the delivery vector contains the recognition site of the target nuclease. The nuclease may recognize this sequence independently or may require the assistance of a guide sequence. The action of the nuclease on the recognition site is the cleavage of the double strand, or at least one of its strands. The cleavage may be a blunt or protruding cleavage. The nuclease may be endogenous or exogenous, and in the latter case, it is also provided to the cell. The nuclease can be delivered separately to the cell, or by including the mRNA sequence or DNA gene sequence of the nuclease in the delivery vehicle. In the latter case, the delivery vector is provided, in effect, it provides its own nuclease to release single-stranded nucleic acid. The nuclease is preferably an endonuclease. The nuclease can be any entity that can appropriately cleave phosphodiester bonds in a sequence-specific manner.

[0019] Delivery vector can be used in cells. Delivery vector can be used to provide donor template for genome editing. Delivery vector can be used to deliver antisense nucleic acid to cells. Delivery vector can be used to deliver nucleic acid enzyme or aptamer to cells. Delivery vector can be used to deliver any single-stranded RNA or nucleic acid hybrid to cells.

[0020] As used herein, a cell may be a mammalian cell, preferably a human cell, preferably a human somatic cell. According to another aspect, the present invention provides a method of providing a linear single-stranded nucleic acid to a cell comprising the use of a delivery vector described herein.

[0021] According to another aspect, the present invention provides a method of providing a linear single-stranded donor oligonucleotide or template to a cell for genome editing comprising the use of a delivery vector described herein.

[0022] The delivery vector of the invention is introduced into a cell using any of the methods described herein. The delivery vector can be transfected by any suitable means, including chemical, physical, or viral. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The construct of the present invention is a closed circular polynucleotide consisting of a single strand. The sequence of the construct is designed to be distributed into at least three sections, but the boundaries of these sections can vary and be adaptive depending on the cleavage site of the nuclease. The construct is preferably a delivery vector intended for delivery of linear single-stranded nucleic acid. The first and third sections contain some complementarity such that under appropriate or physiological conditions, these sections can base pair and form a duplex or stem structure. This double strand is the result of a self-complementary sequence within the polynucleotide. The second section is interposed between the first and third sections and contains the sequence of the linear single-stranded nucleic acid for delivery. This second section is positioned between two complementary sequences, so it generally forms a "loop" of nucleic acid. This loop begins and ends with the double-stranded first and third sections. Since the delivery vector does not intentionally contain regions of complementarity with other sequences within the polynucleotide in order for it to function as intended, it will generally be represented as single stranded. However, single-stranded nucleic acids are well known to adopt several secondary structures, and therefore this second section can be any possible conformation, including one or more of a hairpin, loop, and pseudoknot, including a section of linear nucleic acid. A "loop" as used herein can also be considered to be a section of a polynucleotide that is not designed to form a double-stranded portion of a delivery vector, but this does not prevent it from self-annealing. If homology arms are present, these may be capable of self-annealing into an additional double strand. A loop is effectively a "single-stranded" sequence for delivery, trapped by a double-stranded section that can be processed to release the single strand. Although the term "loop" is used, it is clear that larger loops (e.g., 6 nucleotides or more) may have their own secondary structure.

[0024] For simplicity, the delivery vector is depicted in the figure as a closed circular polynucleotide that includes a double-stranded section and a looped-out single-stranded section. Those skilled in the art will understand that this structure is entirely simplified and that the looped-out section may include one or more secondary structures. Attached FIG. 1A shows a delivery vector in which the double strand is the stem and the remaining polynucleotide is looped out from one end of the stem. Thus, the "single strand" or second section of the delivery vector is captured or held in place by the double strand, which is formed by the first section and the third section. It will be understood that although there is a loop formed between the double strands due to the presence of the second section of the delivery vector, this loop may have its own secondary structure and therefore will not appear as a single-stranded loop upon inspection. The sequence of the loop (and therefore the second section) may preferably be designed to have little, if any, complementarity to the first and third sections of the polynucleotide. A polynucleotide is a polymer whose molecules are made up of many nucleotide units. The polynucleotide (delivery vector) can be of any suitable length, for example, from 50 or 100 residues / nucleotides / base to 10,000 residues / nucleotides / base. Thus, the polynucleotide can be from 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 residues / nucleotides / base. The polynucleotide can be up to 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, 4,000, 3,000, 2,000 or 1,000 residues / nucleotides / base. The polynucleotide can be any number of residues / nucleotides / base between these values.

[0025] The double-stranded section can be any suitable length to accommodate the recognition sequence of nuclease.The double-stranded section can be at least 4 base pairs long, but can be at least 5, 6, 7, 8, 9, or 10 base pairs long.The double-stranded section can actually be longer, and in some cases can be up to 100, 250, 500, 750, or 1000 base pairs long.A section of complementary sequence can surround the double-stranded nuclease recognition sequence to support double-stranded formation.

[0026] Polynucleotides may be composed of any nucleotides. These nucleotides may be natural, modified, or artificial. Nucleotides may be polymerized to form RNA, DNA, locked nucleic acids (LNA), peptide nucleic acids (PNA), morpholino nucleic acids, glycol nucleic acids (GNA), threos nucleic acids (TNA), hybrids and mixtures thereof, and any other artificial (heterologous) nucleic acids. Polynucleotides may preferably be DNA or modified versions thereof (i.e., having modifications in the backbone, sugar residues, or nucleobases). When modifications are used, these are such that binding or activity is not impaired as required. Those skilled in the art know how to determine whether modifications affect binding ability or activity using standard assays.

[0027] A polynucleotide is circular or contiguous, thus it does not have any free 3' or 5' ends. The polynucleotide comprises a single-stranded linear nucleic acid sequence that one desires to deliver to a cell.

[0028] Polynucleotide is effectively a delivery vehicle or vector for linear single-stranded nucleic acid with free 3' and 5' ends.This linear single-stranded nucleic acid can be of any suitable length and any sequence.Although single-stranded nucleic acid is depicted as a long chain of nucleotides, because single-stranded nucleic acid tends to form secondary structures, self-complementary regions tend to anneal and form secondary structures such as hairpins, stems, loops, pseudoknots, cruciforms, etc.

[0029] The linear single-stranded nucleic acid for delivery can be for any intended purpose. Thus, a linear single-stranded nucleic acid can be an antisense molecule, which is designed with a sequence that base pairs with a complementary RNA strand to prevent that RNA strand from functioning in the normal manner, for example if the RNA is messenger RNA (mRNA), to be translated into protein.

[0030] The linear single-stranded nucleic acid may be any RNA that functions in the cell, such as mRNA, long non-coding RNA (lncRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), repeat-associated siRNA, enhancer RNA, antisense RNA, guide RNA, nucleolar RNA or small nuclear RNA.

[0031] Linear single-stranded nucleic acids may contain sequences that form secondary structures that have functions such as nucleic acid enzymes or aptamers. The linear single-stranded nucleic acid can be a donor template for genome editing, as described in more detail below.

[0032] The linear single-stranded nucleic acid is part of a polynucleotide that is referred to herein as the "second section." It is effectively contained within the delivery vector until conditions exist such that the nucleic acid is released.

[0033] The sequence of polynucleotide can be designed to include the first, second and third sections described herein. The sequence, or the order of nucleotides, can be designed so that there are self-complementary sequences that allow double strands to form. These self-complementary sequences are obviously on the same strand of polynucleotide, and thus base pairing is only possible when the section aligns with one section in the 5' to 3' direction and the other section in the 3' to 5' direction. Those skilled in the art will understand that this naturally occurs in single-stranded polynucleotide molecules.

[0034] Complementarity is achieved by defined interactions between nucleic acid bases: adenine (A), thymine (T) (uracil (U) in RNA), guanine (G) and cytosine (C). When referring to complementary sequences or the like, this refers to the nucleotide base pairing interactions between one nucleic acid sequence and another, resulting in the formation of a duplex, triplex, or other higher order structure. Primary interactions are usually nucleotide base specific, e.g., A:T, A:U, and G:C, through Watson-Crick and Hoogsteen type hydrogen bonds. In certain embodiments, base stacking and hydrophobic interactions may also contribute to the stability of the duplex. Conditions under which sections anneal to complementary or substantially complementary sections are well known in the art, for example, as described in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, DC (1985) and Wetmur and Davidson, Mol. Biol. 31:349, 1968. In general, whether such annealing or binding occurs is influenced by, among other things, the length of the sections and their complementary sections, pH, temperature, the presence of monovalent and divalent cations, the ratio of G and C nucleotides in the sequence, the viscosity of the medium, and the presence of denaturing agents. Such variables affect the time required for base pairing or annealing. Thus, preferred conditions depend on the particular application. However, such conditions can be routinely determined by those skilled in the art without undue experimentation. Typically, conditions are selected that allow complementary or substantially complementary sections to selectively bind or anneal to their corresponding sections, but do not hybridize to a significant extent to other sequences within the polynucleotide. Therefore, appropriate conditions are selected to allow the self-complementary sequences present in sections 1 and 3 to anneal and form duplexes. Ideally, the polynucleotide does not contain other sequences that can anneal to either of these sections to avoid undesired duplex formation.

[0035] The sequences of the first and third sections of the polynucleotide are designed or created such that they form a duplex under appropriate conditions as discussed above. For use in human or animal therapy, the duplex forms under physiological conditions. One skilled in the art will be able to determine what the physiological conditions are. These are generally the conditions of the external or internal environment that may occur in the natural world of that organism or cellular system, as opposed to artificial laboratory conditions. Temperature ranges of 20-40 degrees Celsius, atmospheric pressure of 1, pH of 6-8, glucose concentration of 1-20 mM, oxygen concentration in the atmosphere, gravity, and electromagnetism of the Earth are examples of physiological conditions for most terrestrial organisms.

[0036] The stability of this duplex is determined by its length, the number of mismatches or bulges it contains (a small number may be tolerated, especially in long duplexes), and the base composition of the two regions. The pairing of guanine with cytosine has three hydrogen bonds, making it more stable compared to the pairing of adenine-thymine / uracil, which has only two. Base-stacking interactions, which align the pi bonds of the aromatic rings of the bases in a preferred orientation, also promote duplex formation.

[0037] The duplex is the key processing site of the delivery vector. The duplex provides a section of "double-stranded" nucleic acid, but the secondary structure of the remaining part of the polynucleotide that forms the delivery vector is more variable. This duplex, shown in the figure as a stem, can be any secondary structure, including a hairpin (so the first and third sections are adjacent), a stem loop (a fourth section is interposed between the first and third sections), or a more complex structural part such as a pseudoknot or a cruciform. It is only the presence of the duplex that is directly relevant to the present invention.

[0038] The sequence of the double strand is designed or made so that the double strand comprises the recognition sequence of the target nuclease, preferably the endonuclease.Alternatively, the double strand provides a site that can be targeted for cleavage by a suitable entity.Thus, the double strand not only provides a means for capturing or binding the linear single-stranded nucleic acid for delivery, but also provides a means for releasing or delivering the linear single-stranded nucleic acid, if appropriate.Thus, the double strand comprises a target sequence (sometimes designated as recognition sequence) and a cleavage site designed to allow the release of the linear single-stranded nucleic acid.

[0039] The cleavage site may allow for blunt double-stranded cleavage, or double-stranded overhanging cleavage with an overhanging strand. The cleavage site may allow only one of the strands to be cleaved. Preferably, both strands are cleaved. The cleavage of the double strands depends on the type of nuclease used. Those skilled in the art will understand that, depending on the nature of the cleavage site, double-stranded fragments may remain present at the 3' and 5' ends of the single-stranded nucleic acid molecule. Indeed, such fragments are shown in Figures 1A and 1B (see 7a and 7b). Such fragments may be advantageous in that they provide an immediate "buffer" portion that can be degraded by nucleases in the cell.

[0040] The recognition sequence for the target nuclease can be any desired sequence, depending on the target nuclease. A targeting nuclease is a nuclease, such as an endonuclease (an enzyme that breaks phosphodiester bonds in a polynucleotide chain), that recognizes a specific sequence. This recognition can be specific (i.e., it recognizes a specific target or recognition sequence by itself), or this recognition can be guided by another entity (e.g., a guide nucleic acid). Either the recognition sequence of a specific nuclease or a guided nuclease can be used in the delivery vector of the present invention.

[0041] Nucleases may have the inherent ability to recognize specific sequences. The specific sequences are referred to herein as recognition sequences. In some embodiments, the recognition sequences are palindromic sequences of about 4-6 nucleotides in length. Most nucleases cleave double strands heterogeneously, leaving complementary single stranded ends. Hundreds of nucleases are known, each using a different recognition sequence. Endonucleases are classified into three categories, type I, type II, and type III, depending on their mechanism of action. One skilled in the art will be able to identify suitable nucleases and appropriate recognition sequences that need to be included in the double strand to allow specific cleavage to occur.

[0042] Targeted nucleases, or programmable site-specific nucleases, include zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and meganucleases (MN). Targeting these nucleases to specific sequences requires protein engineering, but those skilled in the art will know the requirements of protein engineering to generate nucleases that recognize and cleave specific sequences. Such nucleases are used in gene editing.

[0043] Nucleases can also be guided by recognition sequences. The "guide" in this case can be any suitable nucleic acid molecule or its derivatives, such as DNA or RNA or their hybrids. Thus, nucleases can be RNA-guided nucleases or DNA-guided nucleases. As technology evolves, nucleases that can also be guided by artificial nucleic acid molecules may be discovered. Thus, in this embodiment, the recognition sequence is complementary or substantially complementary to the guide nucleic acid, i.e., the guide nucleic acid that recruits nucleases to the correct site of action.

[0044] Alternatively, the delivery vector itself may provide one or more self-cleaving nucleases or other entities capable of cleaving within a double strand in a sequence-specific manner. Currently, the best-known guided nuclease is Cas9 (CRISPR-associated protein 9). Cas9 is an RNA-guided DNA nuclease enzyme associated with the CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune system of Streptococcus pyogenes. As used in nature, Cas9 surveys and cleaves foreign DNA, such as from invading bacteriophages or bacterial plasmids. Cas9 performs this survey by checking for sites complementary to the 20 base pair spacer region of the guide RNA. If the DNA substrate is complementary to the guide RNA, Cas9 cleaves the invading DNA. Cas9 has attracted great interest in recent years because it can cleave almost any sequence complementary to the guide RNA. Because the target specificity of Cas9 comes from guide RNA:DNA complementarity, engineering Cas9 to target new DNA is straightforward, simply by designing the appropriate guide. The programmable sequence specificity of Cas9 has been exploited for genome editing and gene expression control in many organisms. Native Cas9 requires a guide RNA to which two different RNAs bind: CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA). However, Cas9 targeting has been simplified by the engineering of chimeric single guide RNAs (sgRNAs) or hybrid DNA / RNA guides. The Cas9 protein remains inactive in the absence of guide RNA. In engineered CRISPR systems, the guide sequence consists of a single strand of RNA or RNA / DNA that may form a T-shape composed of one tetraloop and two or three stem loops. Guide sequences are engineered to have a 5' end complementary to the target DNA sequence, which is generally about 20 bases in length. For Cas9, guide sequences have been shown to function in the range of 17-24 bases in length.

[0045] The guide RNA or RNA / DNA binds to complementary target DNA. Immediately adjacent to the target DNA sequence is a protospacer adjacent motif (PAM), which is a 2-6 base pair DNA sequence that immediately follows the DNA sequence targeted by the Cas9 nuclease. It is generally believed that Cas9 will not successfully bind or cleave a target DNA sequence if it is not followed by a PAM sequence. The canonical PAM is the sequence 5'-NGG-3', where "N" is any nucleobase followed by two guanine ("G") nucleobases, which is associated with the Cas9 nuclease of Streptococcus pyogenes (SpCas9), although different PAMs are associated with Cas9 orthologs from other bacteria. 5'-NGA-3' is a non-canonical PAM that is highly efficient for human cells. Attempts have been made to engineer Cas9 to recognize different PAMs, simply by matching the engineered Cas9 to the relevant PAM.

[0046] Therefore, when designing a duplex for targeting by Cas9 or similar nucleases, the inclusion of the target sequence and a PAM sequence (if the target is DNA) must be considered to provide a viable recognition and cleavage site.

[0047] Cas9 has been subject to modification and mutagenesis, and engineered Cas9 variants are available; variant definitions are included below. Work is underway to identify other guided nucleases, particularly those that can be used in the CRISPR system.

[0048] Several have already been identified. These include: Cas12a: Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 or CRISPR / Cpf1 (also known as Cas12a): Cpf1 is an RNA-guided nuclease in the class II CRISPR / Cas system. The Cpf1 gene is associated with the CRISPR locus and encodes a nuclease that uses guide RNA to find and cleave viral DNA. Cpf1 is a smaller and simpler nuclease than Cas9, overcoming some of the limitations of the CRISPR / Cas9 system. The enzyme recognizes T-rich PAMs and may generate protruding double-stranded DNA cleaved at the 5' overhang.

[0049] Cas13a (from the bacterium Leptotrichia shahii), an RNA-guided enzyme system that targets RNA rather than DNA, does not appear to require a PAM; instead, it is the protospacer adjacent site (PFS) that may be involved.

[0050] Thus, the duplex formed by the polynucleotide contains the recognition sequence of the target nuclease. This recognition sequence can be designed to match the recognition sequence of a nuclease that can recognize the sequence intrinsically (i.e., by itself), or to match the guide sequence of a guided nuclease. In the latter case, the guide sequence can also be designed by a skilled user, so this gives the greatest flexibility to select the sequence to ensure that it is not common or is not found in the cell of interest, such as the genome of the cell being edited. When using a guided nuclease, the recognition sequence of the target nuclease may also need to include a PAM or PFS, as necessary.

[0051] The delivery vectors of the present invention may have utility in methods of genome editing or gene editing in cells, particularly eukaryotic cells, especially mammalian cells, including human cells. The delivery vectors of the invention can be used to deliver single stranded nucleic acids to cells, particularly eukaryotic cells, especially mammalian cells, including human cells.

[0052] When it is desired to perform genome or gene editing of a cell, those skilled in the art understand that there are several elements that must be provided to the cell. The first is a sequence-specific nuclease to introduce a double-strand break (DSB) at a predetermined position in the DNA. Then, genome or gene editing utilizes the cell's machinery in repairing the break, mainly by providing the cell with an exogenous donor nucleic acid to repair the DSB. Thus, the mechanism for introducing the break is introduced together with the donor sequence required to repair it.

[0053] Homology directed repair (HDR) is a process of homologous recombination in which a template is used to provide the homology required for the accurate repair of double-strand breaks (DSBs). It is one of the natural mechanisms utilized for genome or gene editing.

[0054] Currently, exogenous repair (or donor) template can be delivered to cells in the form of synthetic single-stranded DNA donor oligo or DNA donor plasmid.However, as previously discussed, there is a problem with delivering single-stranded nucleic acid to cells.There is also a problem that single-stranded nucleic acid may be delivered off-target to other cells that do not require genome or gene editing.

[0055] The delivery vector of the present invention has an important advantage over the use of single-stranded linear donor template.Delivery vector can be designed to target both genome and delivery vector using the same nuclease, thus providing a two-step system that ensures that single-stranded template is only released into cells that contain the correct mechanism for genome or gene editing.Therefore, when delivery vector is to be used to deliver single-stranded nucleic acid donor template, the same technology can be utilized to release the usable donor template and introduce DSB into genome that is required for editing, thus piggybacking on the system already delivered to target cell.

[0056] Genome editing can be of any part of the genome. The term "genome" generally refers to the entire sequence of an organism's DNA. Genomes contain genes. Genes are sequences of nucleotides of DNA or RNA that code for molecules that have a function. Genomes also contain regions of DNA that promote or inhibit gene activity, as well as regions that do not appear to affect protein production and function. Any one or more of these can be edited as needed. Gene editing may be a primary application, as direct editing of genes could have therapeutic impact on many diseases and conditions.

[0057] When the delivery vector is used for genome editing, the second section of the polynucleotide is a sequence suitable for use as a nucleic acid donor template. It can be an RNA or DNA template, but DNA is currently more preferred. Thus, the polynucleotide is preferably DNA. When a single-stranded donor template requires the use of HDR to perform gene editing, it usually includes homology arms within the donor template. HDR relies on the presence of a donor template that has sufficient homology with the region adjacent to the cut site, and these are the homology arms.

[0058] Important parameters to consider for successful genome editing include the length of the homology arms and the symmetry of the homology arms. Using current technology, it is generally accepted that homology arm lengths of 30, 40, and 50 nucleotides have optimal efficiency, with longer lengths such as 50 or 60 nucleotides having lower efficiency. Whether the homology arms are symmetric (i.e., the same length) depends on the nature of the donor template. In the case of unmodified single-stranded donor templates, asymmetric homology arms are more efficient, but once phosphorothioate modifications are made, symmetric homology arms appear to be more effective. Those skilled in the art of genome editing know the optimization of these parameters for the particular situation in which they are operating.

[0059] Thus, the second section of the polynucleotide may include sequences designated as homology arms flanking the insertion sequence. The insertion sequence may be a single nucleotide for single nucleotide substitution. The insertion sequence may be an entire gene or a non-coding region of the genome and may be hundreds of nucleotides long. Because the donor template is delivered via a delivery vector, it may be possible to include more nucleotides in the insertion sequence than previously achieved with single stranded donor templates. Thus, the insertion sequence may be 0 nucleotides long to 1000 nucleotides long. If the insertion sequence is 0, it can be used to knock out a single nucleotide or a larger sequence in the target genome.

[0060] The use of single-stranded donor templates for HDR has been shown to be more efficient than the use of other types of donor templates. Such templates can be delivered to cells to insert or modify short sequences of DNA (such as SNPs, amino acid substitutions, epitope tags, etc.) in endogenous genomic target regions. The advantage of using synthetic donor templates is that no replication is required to generate the donor template, and modifications can be added during synthesis for different applications, such as improved resistance to nucleases. The donor template may not actually contain nucleotides for insertion. In this embodiment, the gene or nucleotide is instead removed from the genome. The insertion sequence can be any desired sequence ranging from a single nucleotide to correct a SNP to the entire sequence of a gene or genomic region. Since the insertion sequence is completely synthetic, the sequence can be modified to change function, if necessary. Thus, the insertion sequence can be any desired sequence required to perform genome editing. Those skilled in the art of genome editing will understand that target nucleases are not endogenous to potential target cells, and therefore they must be provided to the cells in any appropriate manner (genetic or direct) along with the associated guide sequences. The delivery vectors of the present invention can be provided to the cells simultaneously or separately. Any suitable transfection technique can be used. The cells for transfection can be isolated for reimplantation into an organism, or can be ex vivo, or the cells for transfection can be in vivo. The nuclease and any guide sequence can be provided on the same vector or on different vectors. The vector can be any suitable nucleic acid, including a plasmid. Possible transfection routes include lipofection, electroporation, nucleofection, microinjection, or the use of viruses. The route adopted depends on the cells selected for transfection, the nature of the vector used for expression of the nuclease, and the guide sequence.

[0061] The delivery vectors of the present invention can be useful for providing antisense single-stranded nucleic acids to cells. The delivery vectors of the present invention may be useful for providing nucleic acid enzymes or aptamers to cells.

[0062] If the delivery vector is not being used for genome editing, the double-stranded sequence may be designed with a recognition sequence for an endogenous nuclease, so that all that needs to be provided to the cell is the delivery vector of the present invention. In other embodiments, a nuclease is provided to the cell, as discussed above with respect to genome editing.

[0063] The delivery vector of the present invention can be provided to any cell, including cell lines, primary cells, stem cells, etc. Somatic cells are preferred. The cells can be derived from any organism. The delivery vector can be transfected by any suitable means, including electroporation, lipofection, nucleofection or microinjection. Viral gene delivery methods can also be considered. The cells can be transfected ex vivo, in vitro, or in vivo.

[0064] Delivery vector, and thus polynucleotide, is preferably a synthetic molecule, and is produced in a cell-free manner.Many techniques are known for synthesizing long single strands of nucleic acid of specific sequence, including enzymatic amplification of template nucleic acid, ab-initio synthesis, use of overlapping templates, rolling circle amplification, etc.Strand stripping of double-stranded polynucleotide may be necessary for techniques such as PCR that produce double strands.

[0065] Once a long single strand of polynucleotide is obtained as desired, the ends can be sealed using a single strand ligase. This results in a single strand circular polynucleotide. Examples of suitable ligase enzymes include CircLigase™ from Epicentre, US. Chemical cyclization reactions can also be used. In the latter technique, a circular oligonucleotide containing a single triazole, amide, or phosphoramidate analog of the nucleic acid backbone is used. Thus, the linear precursor can contain, for example, a 5' azide and a 3'-alkyne, and a chemically included 1,4 triazole bond, resulting in a circular polynucleotide.

[0066] It may be necessary to use a solid support during the preparation of the delivery vector, either to isolate single-stranded polynucleotides or to aid in the annealing of free ends during circularization. Binding affinity pairs such as biotin-streptavidin can be utilized on commercially available supports such as beads. For example, polynucleotides can be biotinylated and streptavidin is present on the beads.

[0067] Those skilled in the art will appreciate that there are a number of synthetic techniques which can be used to synthesize polynucleotides with desired sequences.

[0068] Mutant Polypeptides: A variant polypeptide comprises (or consists of) a sequence having at least 40% identity to the native protein. A variant sequence may be at least 55%, 65%, 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 97%, or 99% homologous to a particular region of the native protein over at least 20, preferably at least 30, such as at least 40, 60, 100, 200, 300, 400 or more consecutive amino acids, or even over the entire sequence of the variant. Alternatively, a variant sequence may be at least 55%, 65%, 70%, 75%, 80%, 85%, 90%, more preferably at least 95%, 97% or 99% homologous to the full-length native protein. Typically, a variant sequence differs from the relevant region of the native protein by at least 2, 5, 10, 20, 40, 50, or 60 mutations, each of which may be a substitution, insertion, or deletion. The variant sequences used in the process of the invention include sequences having at least 80% identity to the native protein.

[0069] Variants of native proteins also include truncations. Any truncation can be used as long as the variant can cleave the target sequence as described above. Truncation is usually performed to remove sequences that are not essential for catalytic activity and / or do not affect the conformation of the folded protein, especially the folding of the active site. Truncation can also be selected to improve the solubility of the nuclease polypeptide. Suitable truncations can be routinely identified by systematically truncating sequences of various lengths from the N-terminus or C-terminus.

[0070] Variants of native proteins further include variants having one or more, e.g., 2, 3, 4, 5 to 10, 10-20, 20-40 or more, insertions, substitutions or deletions of amino acids with respect to a particular region of the native protein. Deletions and insertions are preferably made outside the catalytic domain. Insertions are usually made at the N- or C-terminus of the sequence derived from the native protein, e.g., for purposes of recombinant expression. Substitutions are also typically made in regions that are not essential for catalytic activity and / or do not affect the conformation of the folded protein. Such substitutions can be made to improve the solubility or other properties of the enzyme. Although generally not preferred, substitutions can also be made in the active site or a second region, i.e., in residues that affect or contact the position or orientation of one or more amino acids in the active site. These substitutions can be made to improve catalytic properties.

[0071] Substitution preferably introduces one or more conservative changes, which replace an amino acid with another amino acid of similar chemical structure, similar chemical properties, or similar side chain volume. The introduced amino acids may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality, or charge as the amino acids they replace. Alternatively, a conservative change may introduce another amino acid that is aromatic or aliphatic in place of an existing aromatic or aliphatic amino acid.

[0072] It is particularly preferred that the variants are capable of cleaving nucleic acids as described above with comparable or the same efficiency as the native protein, or actually are improved with respect to speed, efficiency, precision or delivery. [Brief description of the drawings]

[0073] [Figure 1A]1 is a depiction of an exemplary delivery vector of the present invention. Shown are the first and third sections (1 and 3) that form a double strand, and a recognition sequence for a nuclease is shown (4). The second section (2), which represents the donor template for gene editing herein, can include homology arms (5a and 5b) and a target sequence (6). [Figure 1B] This shows the same delivery vector as in Figure 1A, but the nuclease has cleaved at the target site, releasing the single-stranded nucleic acid (10). Here, fragments of the first and third sections (7a and 7b) can be seen remaining in the single-stranded nucleic acid. These may or may not be present depending on the nature of the nuclease and the design scheme of the duplex. [Diagram 2] Depicts recruitment of a nuclease such as Cas9 (12) to a duplex (4) using a guide sequence (in this case gRNA-11). Shown are two cleavage sites (13a and 13b), one on each strand of the duplex. [Diagram 3] FIG. 1A is a simplified representation of gene editing using single-stranded nucleic acid released from a delivery vector of the invention. Gene editing in this case is performed via HDR. The homology arms (5a and 5b) play a key role in aligning the insert (6) for inclusion in a genome where a DSB has already been introduced (20). The genome with the inserted sequence is also shown (21). [Figure 4]Shows a photograph of a gel prepared according to Example 1. It is divided into three sections. Gel electrophoresis is a standard laboratory procedure to separate nucleic acids by size (e.g., base pair length) for visualization and purification. Electrophoresis uses an electric field to move negatively charged nucleic acids through an agarose gel matrix toward a positive electrode. Short DNA fragments move faster in the gel than longer DNA fragments. Therefore, the approximate length of a DNA fragment can be determined by running it on an agarose gel along with a DNA ladder (a collection of DNA fragments of known length). However, circular nucleic acids behave anomalously in the gel. In section 1, a preparation of a delivery vector of the invention is applied to the gel. The delivery vector is highlighted with an arrow. Other nucleic acids present in the preparation are raw materials or by-products. Section 2 includes a marker ladder (M) and shows the application of the preparation applied in section 1 when treated with exonuclease. Since there are no free ends, the delivery vector is unaffected, but other fragments are degraded. The delivery vector here was designed to contain a double strand where the guide RNA recruits Cas9. Section 3 contains a marker ladder (M). The lane marked 3 is for the preparation after the guide RNA and Cas9 have been introduced. The arrow here indicates that the action of Cas9 releases the single stranded nucleic acid, opening up the circular structure. [Diagram 5] 1 is a delivery vector map showing the oligonucleotides of the vectors made and used in Example 2. The sequences of the GFP gRNA and PAM, the single stranded oligonucleotides from GFP to BFP and various restriction sites are shown. The oligonucleotides are 254 base pairs in length. It can be seen that the gRNA and PAM sequences are present in sense and antisense sequences to allow for loopback and annealing. The hairpin sequence is also shown. [Figure 6]Data generated from Example 2. HEK293T-EGFP cells expressing Cas9 have lost EGFP. Histograms showing GFP signal as a percentage of maximum counted events measured by flow cytometry for cells transfected with either high (450 ng) or low (45 ng) BFP delivery vector ("mbDNA") at the indicated time points post-transfection. The dotted line indicates the threshold for GFP positive signal. The percentage of GFP negative events for each sample is quoted. These are plots of GFP expression versus percentage of maximum count. Three sets of data are displayed. The first column is data for the high BFP delivery vector (mbDNA), the middle column is data for the low BFP delivery vector (mbDNA), and the last column is data without Cas9. Results are shown for 2, 3, 5, 6, and 10 days post-transfection. [Figure 7] Data generated from Example 2. The delivery vector (mbDNA) triggers Cas9-mediated EGFP to BFP conversion in HEK293T-EGFP cells. The mean blue fluorescence of lysed cells was measured at the indicated time points post-transfection and plotted relative to raw intensity (non-normalized) or a control without mbDNA (normalized). Data from two biological replicates are shown. Results are shown for 2, 3, 5, and 6 days post-transfection.

[0074] The invention will now be illustrated by the following examples, which are not intended to limit the scope of the invention. EXAMPLES

[0075] Example 1: Demonstration of Cas9 processivity An example of a delivery vector of the present invention was designed to contain a double strand in which the guide RNA recruits Cas9. The vector was generated in-house as ssDNA and ligated to seal into the conformation shown in Figure 1A. A sample (sample 1) was taken. The vector was then incubated with 10 units of T5 exonuclease (NEB) at 37°C for 3 hours. Another sample (sample 2) was taken.

[0076] The guide RNA was designed to target the double-stranded region of the vector with purified Cas9 protein from GenScript. The sgRNA was annealed in 19.5 μl of H 2 HO, 3 μl 10x Cas9 reaction buffer, 7.5 μl 100 μM sgRNA were combined and heated to 75 °C and allowed to cool to room temperature. Ribonucleoproteins were then prepared according to the GenScript instructions. 0.3 μl annealed sgRNA, 0.5 μl Cas9 protein, 4 μl 10x Cas9 reaction buffer, 27.2 μl HO, 3 μl 10x Cas9 reaction buffer, 7.5 μl 100 μM sgRNA were combined and heated to 75 °C and allowed to cool to room temperature. Ribonucleoproteins were then prepared according to the GenScript instructions. 2 O were combined and incubated at 37°C for 10 minutes.

[0077] Next, 900 ng of vector DNA was added and incubated for 1 h. 2 The volume was brought to 40 μl with O and the reaction was incubated for 3 hours at 37° C. A final sample was taken (sample 3). Samples 1, 2, and 3 were loaded onto a 0.8% agarose TBE gel stained with SafeView (Figure 4: Section 1: Sample 1, Section 2: Sample 2, and Section 3: Sample 3). A marker, GeneRuler 1kb+DNA Ladder (ThermoFisher), was also loaded and the gel was run to separate the bands.

[0078] Sample 1 showed bands consistent with the closed vector (indicated by an arrow in Figure 4, section 1), and by-products (unclosed vector, smaller products of the assembly reaction). Sample 2 showed a strong band for the closed vector, indicating resistance to exonucleases, while the open vector and by-product bands were reduced to a smear at the bottom of the gel. Sample 3 shows that the vector band has been successfully cut by Cas9. The open linear portion is able to migrate faster and farther on the gel compared to when it was constrained to an uncut circular form (indicated by an arrow in Figure 4, section 3).

[0079] array: In the delivery vector, the nuclease target site and the double-stranded PAM sequence are as follows: GTCACCAATCCTGTCCCTAGTGG (SEQ ID NO: 1) The sgRNA guide sequence is as follows: gucaccaauccugucccuagGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 2)

[0080] Example 2: Preparation of nucleic acid vectors array: In the delivery vector, the nuclease target site and the double-stranded PAM sequence are as follows: GCTGAAGCACTGCACGCCGTAGG (SEQ ID NO: 3) In the delivery vector, the sequence of the HDR template (with edited bases in lowercase and underlined) is as follows:

[0081] [ka]

[0082] The genomic sequence of EGFP (edited in lowercase with underlined bases) is as follows:

[0083] [ka]

[0084] The sgRNA guide sequence is as follows: gcugaagcacugcacgccguGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 6) SEQ ID NO:7 is the sequence of the Cas9 / sgRNA plasmid (not shown here).

[0085] The delivery vector shown in FIG. 5 with a stem designed to target EGFP (EGFP is a green fluorescent protein from Aequorea victoria) and edit it into BFP (blue fluorescent protein) ("BFP mbDNA"), and a control vector oligonucleotide lacking the targeting sequence, were ordered from Biolegio (Nijmegen, the Netherlands). The oligonucleotides were looped back and annealed to form a "lasso"-like structure in the following reaction: 8μl Oligo (100μM) (7.5μg / μl) 9 μl ddH 2 O After incubation at 98°C for 10 min, the mixture was cooled to 16°C at a rate of 0.06°C per second.

[0086] The annealed oligonucleotides were ligated to seal the nicks in the vector backbone: 17 μl of annealing vector 2μl N buffer (10x) -300mM Tris pH 8.9 -300mM (NH 4 ) 2 SO4 -5mM MgSO 4 ·2μl ATP (10mM) (NEB, Ipswich, US) 1 μl T4 DNA ligase (400,000 U / ml) (NEB, Ipswich, US) Incubated at 16°C for 7 hours.

[0087] To remove unligated single-stranded DNA, the reaction was subjected to digestion with T5 exonuclease: 20μl ligation vector 2 μl N Buffer (10x - as above) 2 μl T5 exonuclease (10,000 U / ml) (NEB, Ipswich, US) 16μl ddH 2 O Incubated at 37°C for 12 hours. The annealed, ligated, T5-digested vector was column purified using a PCR purification kit (Macherey-Nagel, Dueren, Germany).

[0088] Demonstration of Cas9 gene editing capabilities We obtained a HEK293T cell line (HEK293T-EGFP) stably expressing a single copy of EGFP (a kind gift from Astrid Glaser). Conversion of EGFP to a blue fluorescent variant (BFP) by Cas9-mediated gene editing has been previously demonstrated in this cell line using single-stranded oligonucleotide DNA (ssODN) as a template (Glaser et al, Molecular Therapy, Nucleic Acids, 5(7), e334, incorporated herein by reference).

[0089] DNA was delivered to HEK293T or HEK293T-EGFP cells seeded in 6-well plates and grown according to the manufacturer's instructions in 1.5 ml complete medium (DMEM + 10% FBS + 2 mM glutamine) by chemical transfection using PEIpro (Polyplus-transfection®). 1.13 μg total DNA and 3.39 μl PEIpro were used per transfection in a total volume of 200 μl serum-free DMEM (4.5 g / l glucose). Transfection efficiency was monitored using 100 ng TIVA-pUCEF1α-Scarlet-I plasmid DNA per reaction. For Cas9 reactions, 250 ng Cas9+sgRNA plasmid was added. Either 450 ng (high) or 45 ng (low) BFP or control mbDNA was used (as indicated in the figure). Empty plasmid was used to bring the reactions to 1.13 μg DNA. All transfections were performed in duplicate.

[0090] Cells were grown for the indicated periods before being harvested by trypsinization. Transfection efficiency (red fluorescence %) and loss of GFP intensity over time were monitored on a CytoFLEX flow cytometer (Beckman Coulter, High Wycombe, UK). Cells were lysed with RIPA buffer to release protein content. Relative blue fluorescence intensity of lysed cells (protein) throughout the sample was measured using a Spark® microplate reader (Tecan, Mannedorf, Switzerland) with excitation at 360 nm and emission at 465 nm.

[0091] result: HEK293T-EGFP cells transfected with Cas9+sgRNA plasmid and BFP mbDNA (delivery vector) showed a gradual decrease in EGFP over 6 days post-transfection. At day 6, 35%-50% of cells stopped expressing EGFP (Figure 6), indicating the gene targeting ability of Cas9 in our system. Cells transfected with a large amount (450 ng) of BFP delivery vector lost EGFP at a slower rate compared to cells with a small amount (45 ng) of BFP delivery vector. This decrease in gene editing rate could be explained by a slightly decreased efficiency of high mbDNA transfection (~70% of cells with high BFP / control vector showed Scarlet-I expression 48 hours post-transfection compared to ~80% with low / no vector). As shown by data from day 10 post-transfection, no further loss of EGFP was observed after day 6 (HEK293T-EGFP cells expressing Cas9 have lost EGFP). Histograms showing GFP signal as a percentage of maximum counted events measured by flow cytometry in cells transfected with either high (450 ng) or low (45 ng) BFP delivery vectors at the indicated time points post-transfection. The dotted line indicates the threshold for GFP positive signal. The percentage of GFP negative events for each sample is quoted (Figure 6), suggesting that no Cas9 activity is detectable after day 6. In contrast, cells not expressing Cas9 show no drop in EGFP, confirming that the loss of EGFP is Cas9-mediated.

[0092] As used, "mbDNA" refers to the vector, which may include delivery of the BFP or is a control (no BFP). Successful homologous directed recombination (HDR) gene editing events were identified by measuring blue fluorescent protein (BFP) intensity in lysates from cells 2–6 days after introduction of the BFP delivery vector and control vector. As soon as 2 days after transfection, cells containing BFP but not the control vector showed a 1.3-fold increase in BFP signal compared to the no-vector control (Figure 7). At day 5, BFP intensity from cells with high BFP vector was 2-fold higher compared to the control, and by day 6, the same relative levels of BFP were detected in both low and high BFP vector cells (Figure 7). Importantly, the increase in BFP signal cannot be explained by interference from EGFP signal, as cells without Cas9 (and thus expressing more functional EGFP) have lower BFP signal compared to cells transfected with Cas9 (Figure 7).

[0093] In summary, our data demonstrate that the BFP delivery vector according to the invention can be cleaved by Cas9 in vivo to release a viable transgene that can be used as an HDR template in Cas9-mediated gene editing. This application includes the following inventions. [Item 1] A nucleic acid delivery vector comprising a circular single-stranded polynucleotide, the vector comprising: (a) a duplex formed from a first section and a third section of said polynucleotide, said sections comprising complementary sequences; (b) a loop formed from a second section, said section separating the first section and the third section; A nucleic acid delivery vector, wherein the double strand comprises a recognition sequence for a targeted nuclease. [Item 2] The nucleic acid delivery vector described in Item 1, wherein the vector delivers a linear single-stranded nucleic acid, and the single-stranded nucleic acid is present within the second section. [Item 3] The nucleic acid delivery vector described in Item 2, wherein the linear single-stranded nucleic acid can be any one or more of a nucleic acid enzyme, an aptamer, a donor template, an mRNA, a functional RNA, or an antisense nucleic acid. [Item 4] The nucleic acid delivery vector described in Item 2 or 3, wherein the linear single-stranded nucleic acid has free 5' and 3' ends when released from the delivery vector. [Item 5] The nucleic acid delivery vector described in Item 1, wherein the vector is a closed circular polynucleotide, optionally a closed DNA or closed RNA. [Item 6] A nucleic acid delivery vector described in any one of the preceding items, wherein the nuclease is a guided nuclease, optionally a nuclease associated with gene editing, preferably Cas9. [Item 7] The nucleic acid delivery vector according to any one of Items 1 to 5, wherein the nuclease binds to the recognition sequence without a guide. [Item 8] A nucleic acid delivery vector described in any one of the preceding items, wherein the vector is for use in a cell. [Item 9] A method for providing a linear single-stranded nucleic acid to a cell, the method comprising the use of the delivery vector described in any one of Items 1 to 8. [Item 10] A method for providing a linear single-stranded donor template to a cell for genome editing, comprising the use of a delivery vector described in any one of Items 1 to 8, preferably wherein the linear single-stranded nucleic acid is the donor template. [Item 11] The method of Item 10, wherein the nuclease is a guided nuclease, optionally Cas9 or a variant thereof.

Claims

1. A nucleic acid delivery vector comprising a circular single-stranded polynucleotide, the vector comprising: (a) a duplex formed from a first section and a third section of said polynucleotide, said sections comprising complementary sequences; (b) a loop formed from a second section, the second section separating the first section and the third section; A nucleic acid delivery vector, wherein the double strand comprises a recognition sequence for a targeted nuclease.

2. The nucleic acid delivery vector of claim 1 , wherein the vector delivers a linear single-stranded nucleic acid, the single-stranded nucleic acid being present within the second section.

3. The nucleic acid delivery vector of claim 2 , wherein the linear single-stranded nucleic acid is any one or more of a nucleic acid enzyme, an aptamer, a donor template, an mRNA, a functional RNA, or an antisense nucleic acid.

4. The nucleic acid delivery vector of claim 2 or 3, wherein the linear single-stranded nucleic acid has free 5' and 3' ends upon release from the delivery vector.

5. The nucleic acid delivery vector of claim 1 , wherein the vector is a closed circular polynucleotide.

6. The nucleic acid delivery vector according to any one of claims 1 to 5, wherein the nuclease is a guided nuclease.

7. The nucleic acid delivery vector described in claim 6, wherein the guided nuclease is associated with gene editing.

8. The nucleic acid delivery vector described in claim 7, wherein the guided nuclease is Cas9 or a variant thereof.

9. The nucleic acid delivery vector of any one of claims 1 to 5, wherein the nuclease binds to the recognition sequence without a guide.

10. A nucleic acid delivery vector according to any one of claims 1 to 9, wherein the vector is for use in a cell.

11. A composition for providing a linear single-stranded nucleic acid to a cell, comprising a delivery vector according to any one of claims 1 to 10.

12. A composition for providing a linear single-stranded donor template to a cell for genome editing, the composition comprising a delivery vector according to any one of claims 1 to 10.

Images