Recombinant Corynebacterium glutamicum for efficient synthesis of high-purity hyaluronic acid and its oligosaccharides

Abstract

The present invention discloses a recombinant Corynebacterium glutamicum for efficient synthesis of high-purity hyaluronic acid and its oligosaccharides, which belongs to the field of bioengineering. The recombinant Corynebacterium glutamicum constructed in this invention can produce hyaluronic acid with a yield of up to 40 g / L and a crude purity of 95%. By adding exogenous hyaluronan hydrolase and optimizing fermentation conditions, hyaluronic acid oligosaccharides with specific molecular weights can be obtained, and the hyaluronic acid yield can be further improved to 72 g / L. This invention lays a solid foundation for the efficient synthesis of high-purity hyaluronic acid by microorganisms, and the constructed recombinant Corynebacterium glutamicum is suitable for industrial production and application.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to a recombinant Corynebacterium glutamicum for efficiently synthesizing high-purity hyaluronic acid and its oligosaccharides, which belongs to the technical field of bioengineering. [Background technology]

[0002] 2. Background of the Invention Hyaluronic acid is a linear acidic mucopolysaccharide formed by polymerization of disaccharide units composed of N-acetylglucosamine and glucuronic acid. Ultra-high molecular weight hyaluronic acid has good viscoelasticity, moisturizing and anti-inflammatory properties, and can be used as a viscoelastic agent in ophthalmic surgery, intra-articular injection therapy, etc. High molecular weight hyaluronic acid has excellent moisturizing and lubricating effects and can be used in the cosmetics field. High-purity hyaluronic acid and oligosaccharides have antitumor, wound healing promotion, bone formation and angiogenesis promotion, and immune regulation effects. In 2016, the global market for hyaluronic acid was US$7.2 billion, and is expected to reach US$10.8 billion worldwide in 2020.

[0003] At present, commercial hyaluronic acid is mainly obtained by fermentation of Streptococcus zooepidemicus, which naturally produces hyaluronic acid. However, since Streptococcus zooepidemicus is a pathogenic strain and can cause many diseases, the hyaluronic acid produced by Streptococcus zooepidemicus has difficulty meeting the requirements of medical, food and other fields. In addition, the hyaluronic acid produced by them has low purity, which reduces the quality of the product. To solve this problem, genetic engineering technology has been used to heterologously express hyaluronic acid synthase in some engineered strains, such as Bacillus subtilis and Corynebacterium glutamicum, to synthesize hyaluronic acid. However, Bacillus subtilis itself is prone to cell lysis, and DNA released by cell lysis will cause contamination of the hyaluronan product. In contrast, Corynebacterium glutamicum has a thicker cell wall, stronger resistance, and higher cell stability than Bacillus subtilis. However, Corynebacterium glutamicum will synthesize more exopolysaccharides outside the cell. These polysaccharides not only compete with substrates in the hyaluronan synthesis pathway, but also make downstream purification of hyaluronan difficult, thereby reducing the quality of the hyaluronan product. Summary of the Invention

[0004] SUMMARY OF THE PRESENT APPLICATION A first object of the invention is to provide a recombinant Corynebacterium glutamicum in which the exopolysaccharide genes cg0420 and / or cg0424 are silenced or knocked out and a hyaluronan synthase is expressed; the gene cg0420 comprises the nucleotide sequence set forth in SEQ ID NO:1; the cg0424 comprises the nucleotide sequence set forth in SEQ ID NO:2; and the hyaluronan synthase is as set forth in (a), (b) or (c). (a) an enzyme derived from Streptococcus pyogenes and its amino acid sequence having at least 90% homology with SEQ ID NO:3; (b) an enzyme having an amino acid sequence as shown in SEQ ID NO:3. (c) a protein having a substitution or deletion based on (a) or (b) and having hyaluronan synthase activity.

[0005] In one embodiment, the exopolysaccharide genes cg0420 (SEQ ID NO: 1) and cg0424 (SEQ ID NO: 2) of recombinant Corynebacterium glutamicum are silenced or knocked out and hyaluronic acid synthase is expressed in the recombinant Corynebacterium glutamicum.

[0006] In one embodiment, the hyaluronic acid synthase is from Streptococcus pyogenes (SEQ ID NO:3).

[0007] In one embodiment, the UDP-N-acetylglucosamine and / or UDP-glucuronic acid pathway is promoted in Corynebacterium glutamicum.

[0008] In one embodiment, the UDP-N-acetylglucosamine pathway includes the bifunctional enzymes glutamine-fructose-6-phosphate aminotransferase, phosphoglucomutase, and UDP-N-acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase.

[0009] In one embodiment, the UDP-glucuronic acid pathway includes phosphoglucomutase, glucose-6-phosphate urea amidotransferase, and UDP-glucose dehydrogenase.

[0010] In one embodiment, the phosphoglucomutase pgm (SEQ ID NO: 4), glucose-6-phosphate urea amidotransferase GalU (SEQ ID NO: 5), UDP-glucose dehydrogenase Ugd (SEQ ID NO: 6), glutamine fructose-6-phosphate aminotransferase GlmS (SEQ ID NO: 7), phosphoglucomutase GlmM (SEQ ID NO: 8), and the UDP-N-acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme GlmU (SEQ ID NO: 9) are derived from Pseudomonas putida KT2440.

[0011] In some embodiments, in any of the Corynebacterium glutamicum described above, expression of at least one gene selected from pgM, ugd, galU, glms, glmM, and glmU is promoted.

[0012] In one embodiment, the recombinant Corynebacterium glutamicum is derived from an industrially safe strain of Corynebacterium glutamicum and heterologously expresses the hyaluronan synthase gene hasA from Streptococcus pyogenes. The recombinant Corynebacterium glutamicum exopolysaccharide genes cg0420 and cg0424 were knocked out to remove heteropolysaccharides from the extracellular surface, and expression cassettes were constructed to enhance the expression of pathway genes pgM, ugd, galU, glms, glmM and glmU in Corynebacterium glutamicum to increase the production of UDP-N-acetylglucosamine and UDP-glucuronic acid, which are the synthetic substrates for hyaluronan.

[0013] In one embodiment, any one of the above-described Corynebacterium glutamicum also expresses Vitreoscilla hemoglobin VHb (SEQ ID NO: 10) to improve the growth and hyaluronic acid synthesis ability of the recombinant Corynebacterium glutamicum in a microaerobic environment. A second object of the present invention is to provide a method for constructing a recombinant Corynebacterium glutamicum, the method comprising: (1) knocking out the exopolysaccharide genes cg0420 and cg0424 by constructing knockout boxes stepwise or simultaneously; (2) ligating a gene encoding hyaluronic acid synthase and at least one gene selected from pgM, ugd, galU, glmS, glmM and glmU into a vector, and transforming the vector into a cell of a target strain.

[0014] In one embodiment, the vector may be pXMJ19, pECXK99E, pEC-XT99A, pEKEx1, pEKEx2, pVWEx1, pVWEx2, pZ8-1, pECTAC-K99 or pAPE12 (the above vectors are disclosed in Eggeling, L. and Bott, M., Handbook of corynebacterium glutamicum. 2005, Boca Raton: Taylor & Francis. 616 p.).

[0015] In one embodiment, the method involves ligating pgm, galU, ugd into the vector pXMJ19.

[0016] In one embodiment, the method involves ligating glmS, glmM, glmU into the vector pECXK99E.

[0017] A third object of the present invention is to provide a method for producing hyaluronic acid, the method comprising fermenting recombinant Corynebacterium glutamicum.

[0018] In one embodiment, the fermentation is carried out at 25-35° C. for 24-72 hours.

[0019] In one embodiment, the method also includes adding hyaluronan hydrolase or hyaluronate lyase at the beginning of the fermentation, wherein the hyaluronan hydrolase or hyaluronan lyase is added in an amount of 500-50,000 U / mL.

[0020] A fourth object of the present invention is to provide a use of recombinant Corynebacterium glutamicum in the preparation of hyaluronic acid and its derivative products.

[0021] Beneficial Effects: In this invention, we construct the synthesis pathway of hyaluronan in Corynebacterium glutamicum, an industrially safe strain that heterologously expresses the hyaluronan synthase gene hasA from Streptococcus pyogenes. We knock out the exopolysaccharide genes cg0420 and cg0424 of Corynebacterium glutamicum, thereby improving the purity of hyaluronan by removing heteropolysaccharides from the extracytoplasmic surface. An expression cassette was constructed to increase the expression of pathway genes pgM, ugd, galU, glms, glmM, and glmU, which increase the synthesis of UDP-N-acetylglucosamine and UDP-glucuronic acid, which are synthetic substrates of hyaluronic acid, and to solve the problem of insufficient substrate supply during hyaluronic acid synthesis, thereby enhancing the hyaluronic acid synthesis ability of recombinant Corynebacterium glutamicum. In addition, to solve the problem of insufficient dissolved oxygen during the fermentation process, Vitreoscilla hemoglobin VHb was expressed in recombinant Corynebacterium glutamicum, improving the growth and hyaluronic acid synthesis ability of recombinant Corynebacterium glutamicum in a microaerobic environment. By knocking out cg0420, both the yield and purity of hyaluronic acid were improved to a certain extent. The crude yield increased by 27.8%, from 18g / L to 23g / L, and the purity increased from 75% to 86%. By knocking out both cg0420 and cg0424, the hyaluronic acid yield increased by 58.3%, reaching 28.5g / L, and the crude purity reached 95%. With the double knockout and VHb expression, the productivity of the recombinant Corynebacterium glutamicum reached 40g / L, a 40.3% improvement compared to the original strain.The production of hyaluronic acid oligosaccharides was achieved by adding 6000U / mL of exogenous hyaluronan hydrolase during the fermentation process. Finally, the productivity of hyaluronic acid reached 72g / L, which was 152.6% increased compared to the original strain and 2.5 times higher than the highest producing strain reported so far. [Brief description of the drawings]

[0022] Description of the drawings [Figure 1] Figure 1: Metabolic pathways and related enzymes for hyaluronan production by recombinant Corynebacterium glutamicum. [Diagram 2] Figure 2: Graph showing the yield and purity of hyaluronic acid produced by recombinant Corynebacterium glutamicum. [Diagram 3] Figure 3: Graph showing hyaluronic acid yield by recombinant Corynebacterium glutamicum in a 5 L fermentation tank. [Figure 4] Figure 4: Graph showing the yield of hyaluronan in a 5L fermentation tank using recombinant Corynebacterium glutamicum with exogenous hyaluronan hydrolase. [Diagram 5] Figure 5: Mass spectrum of the disaccharide unit hyaluronan produced by recombinant Corynebacterium glutamicum.

[0023] Detailed Description of the Invention Strain: Corynebacterium glutamicum ATCC13032, Plasmids: pXMJ19, pEC-XK99E, pK18mobSacB LB medium: yeast powder 5g / L, peptone 10g / L, and sodium chloride 10g / L BHI: Brain Heart Extract 17g / L, Sorbitol 21g / L Fermentation medium: glucose: 40g / L, corn steep powder: 20g / L, KH2PO4: 15g / L, K2HPO4: 5g / L, MgSO4: 1g / L

[0024] Measurement of hyaluronic acid yield: Fermentation broth was appropriately taken and diluted 10 times, centrifuged at 10,000 rpm for 10 minutes, the supernatant was taken and added with 4x volume of pre-chilled ethanol, ethanol precipitated at -20 for 6 hours, centrifuged at 10,000 rpm for 10 minutes, the supernatant was discarded, resuspended with water to the original volume, centrifuged at 10,000 rpm for 5 minutes, the precipitate was discarded, the supernatant was taken and mixed with 4x volume of pre-chilled ethanol, ethanol precipitated at -20 for 6 hours, centrifuged at 10,000 rpm for 10 minutes, the supernatant was discarded, resuspended with water to the original volume, centrifuged at 10,000 rpm for 5 minutes, the supernatant was taken and the precipitate was discarded. The supernatant was taken and diluted 50 times, and finally diluted 500 times. The measurement of the sample was performed by diluting the sample within the linear effective range, and then measuring by the carbazole sulfuric acid method.

[0025] Measurement by carbazole sulfate method: 1 mL of sample was added to a glass tube containing 5 mL of borax sulfate (4.77 g of borax dissolved in 500 mL of concentrated H2SO4), mixed thoroughly, boiled in a boiling water bath for 15 min, and then cooled on ice. 250 μL of carbazole reagent (0.125 g of carbazole dissolved in 100 mL of complete ethanol) was added, mixed thoroughly, and boiled in a boiling water bath for 15 min. Blank controls were prepared under the same conditions except that the sample was replaced with an equal amount of distilled water, and the absorbance value at a wavelength of 530 nm was measured. Standard samples were prepared using different concentrations (10, 20, 30, 40, 50 μg mL -1 A standard curve was plotted using D-glucuronic acid, and the absorbance values ​​were fitted to the standard curve to calculate the hyaluronic acid content. Standard curve equation: y = 126.88x - 9.2639, R 2 = 0.9991(x, A530 absorbance; y, glucuronic acid content in the sample (μg mL -1)) The formula for calculating the yield of chondroitin is: hyaluronic acid content (g / L) = (concentration determined from the standard curve * dilution factor * 2.067) / 1000. When measuring the samples, the samples were diluted to fit within the linear range.

[0026] Measurement of molecular weight of hyaluronic acid: Impurities were removed from the fermentation supernatant by repeated alcohol precipitation to obtain highly pure hyaluronic acid, whose molecular weight was measured by HPLC.

[0027] Determination of hyaluronan structure by LC-MS: After removing impurities from the fermentation supernatant by repeated alcohol precipitation to obtain highly purified hyaluronan, the sample was treated with hyaluronidase overnight at 37°C to cleave the hyaluronan into disaccharide units. Nine volumes of anhydrous methanol were then added to the sample. Impurities and unhydrolyzed hyaluronan were removed by centrifugation, and insoluble impurities were filtered through an organic membrane before analyzing the structure of the disaccharide units by LC-MS. EXAMPLES

[0028] Example 1: Construction of recombinant Corynebacterium glutamicum (1) Knockout of genes cg0420 and cg0424 Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and 0420-up-F and 0420-up-R as primers, a fragment approximately 500 bp upstream of cg0420, 0420-up, was obtained by PCR, and the PCR product was purified.

[0029] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and 0420-down-F and 0420-down-R as primers, a fragment approximately 500 bp downstream of cg0420, 0420-down, was obtained by PCR, and the PCR product was purified.

[0030] Corynebacterium glutamicum solusite plasmid pK18mobsacB was double-digested with EcoRI / BamhI, and the 0420-up and 0420-down fragments were ligated into the digested pK18mobsacB in one step using the Gibson Assembly kit. The resulting recombinant plasmid was named pK18-0420.

[0031] Corynebacterium glutamicum ATCC13032 was transfected with plasmid pK18-0420 by electroporation, and the electric shock conditions were 1.5 KV, 5 ms (the width of the electroporation tube was 1 mm), and the electric shock was performed twice. The first screening of the recombinant bacteria was performed on BHI plates containing 25 mg / L kanamycin. The positive recombinant bacteria were picked up and further cultured in liquid LB medium overnight, and then the second screening was performed on BHI plates containing 100 g / L sucrose. PCR was performed on the colonies using primers 0420-up-F and 0420-down-R, which could amplify a 1 Kb fragment from the 0420 gene knockout recombinant strain, and this recombinant strain was named C. glutamicum Δ0420. The cg0424 gene was also knocked out by the above method, and the cg0424 single knockout strain, cg0420 and cg0424 double knockout strains were obtained, named C. glutamicum Δ0420, C. glutamicum Δ0420 and Δ0424, respectively.

[0032] Among them, the primer sequences used are as follows: 0420-UP-F: GCAGGTCGACTCTAGAGGATCCAAGTTTCGAACCATGCTTGAAC (SEQ ID NO: 11) 0420-UP-R: GATCTGATTCTTCGCACCAATAGGCGACATACCGTTTCTAACTGCTCAG (SEQ ID NO: 12) 0420-down-F: CTGAGCAGTTAGAAACGGTATGTCGCCTATTGGTGCGAAGAATCAGATC (SEQ ID NO: 13) 0420-down-R: CTATGACCATGATTACGAATTCTGGACCCTAAACTGAGCAGTGA (SEQ ID NO: 14)

[0033] (2) Integration of genes HasA and VHb A 500 bp U-up fragment was amplified by PCR using genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and U-up-F and U-up-R as primers, and the PCR product was purified.

[0034] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and U-down-F and U-down-R as primers, an approximately 500 bp D-down fragment was amplified by PCR, and the PCR product was purified.

[0035] Using the genomic DNA of Vitreoscilla (Vitreoscilla stercoraria DSM 513) as a template and HasA-F and HasA-R as primers, the fragment shown in SEQ ID NO: 10 was amplified by PCR, and the PCR product was purified.

[0036] The Corynebacterium glutamicum suicide plasmid pK18mobsacB was double-digested with EcoRI / BamhI, and the fragments U-up, D-down, and VHb were ligated into the digested pK18mobsacB in one step using the Gibson Assembly kit, and the resulting recombinant plasmid was named pK18-VHB.

[0037] Plasmid pK18-VHB was introduced into C. glutamicum Δ0420, C. glutamicum Δ0424, C. glutamicum Δ0420 Δ0424, and wild-type strains by electroporation. The electric shock conditions were: voltage 1.5KV, 5ms, (the width of the electroporation tube was 1mm), and electric shock was performed twice. The first screening of recombinant bacteria was performed on BHI plates containing 25mg / L kanamycin. The positive recombinants were picked up and further cultured in liquid LB medium overnight, and then the second screening was performed on BHI plates containing 100g / L sucrose. PCR was performed on the colonies using primers U-up-F and D-down-R, and a 1.3Kb fragment could be amplified from the recombinants that had incorporated the HasA gene, and the resulting recombinant strain was named C. glutamicum-HasA. The above method was also used for integration of the VHb gene, and the final strains obtained were C. glutamicum Δ0420-HasA-VHB, Δ0424-HasA-VHB, Δ0420&Δ0424-HasA-VHB, and WT-HasA-VHB, respectively. U-up-F: GCAGGTCGACTCTAGAGGATCCTTAGAAGAACTGCTTCTGAAT (SEQ ID NO: 15) U-up-R:AATAGGCATGATATACGCTCCTTCGAACACGGCGACACTGAAC (SEQ ID NO: 16) D-down-F: GTTACCGACGGTTTCTTTCATATTCCAAGCCGGAGAATTTCC (SEQ ID NO: 17) D-down-R: CTATGACCATGATTACGAA ATGAAAGAAACCGTCGGTAAC (SEQ ID NO: 18) HasA-F: AAGGAGCGTATATCATGCCTATTTTCAAGAAGACT (SEQ ID NO: 19) HasA-R:AATAGGCATGATATACGCTCCTTTTATTTAAAAATAGTAACTTTTTTTCTAG (SEQ ID NO: 20)

[0038] (3) Construction of recombinant plasmids pXMJ19-pgm-galU-ugd and pECXK99E-glmS-glmM-glmU Pseudomonas putida KT2440 was inoculated into 3 ml of LB liquid medium and cultured at 30°C and 220 rpm for 24 hours. The bacteria were harvested and genomic DNA was extracted using a cell genome extraction kit. Primers pgm-F / pgm-R, galU-F / galU-R, ugd-F / ugd-R, glmS-F / glmS-R, glmM-F / glmM-R, and glmU-F / glmU-R were designed, and the genes pgm, ugd, galU, glmU, glmS, and glmM were amplified and obtained using the PCR amplification system and procedure with the extracted Pseudomonas putida genomic DNA as a template. Plasmids pXMJ19 and pECXK99E were enzymatically digested at selected restriction sites to obtain linear plasmids pXMJ19 and pECXK99E, and Gibson assembly reactions were performed for the amplified fragments pgm, ugd, galU and linear plasmid pXMJ19, and glmU, glmS, glmM and linear plasmid pECXK99E. JM109 competent cells were transformed with the Gibson assembly reaction system. The transformants were selected for plasmid sequencing reactions and sequence alignment, and recombinant plasmids pXMJ19-pgm-ugd-galU and pECX99E-glmU-glmM-glmS were successfully constructed. The recombinant plasmids were electrotransformed into Corynebacterium glutamicum ATCC13032, C. glutamicum Δ0420-HasA-VHB, Δ0424-HasA-VHB, Δ0420&Δ0424-HasA-VHB and WT-HasA-VHB strains, and the resulting recombinant strains were named WT, Δ0420, Δ0424 and Δ0420&Δ0424, respectively.

[0039] [Table 1]

[0040] [Table 2]

[0041] Example 2: Production of hyaluronic acid by recombinant Corynebacterium glutamicum The constructed recombinant Corynebacterium glutamicum strains WT, Δ0420, Δ0424 and Δ0420&Δ0424 single clones were inoculated into 5ml BHI medium at 200 rpm, 30℃ overnight. After 10 hours, 1% of the inoculum was transferred to a 250ml Erlenmeyer flask (containing 25ml fermentation medium). After 3 hours of incubation at 200 rpm, 28℃, IPTG was added at a final concentration of 0.25Mm to induce gene expression. The fermentation period was 48 hours. After the end of fermentation, the supernatant was taken and alcohol precipitation was performed by adding 4 times the amount of ethanol to remove impurities. After repeating the alcohol precipitation twice, the content of hyaluronic acid was measured by carbazole sulfate method. From Figure 2, it can be seen that the yield and purity of hyaluronic acid were improved to a certain extent by knocking out cg0420 and cg0420. In the double knockout strain, the shake bottle yield and purity of hyaluronan were improved to 6.9 g / L and 95%, respectively.

[0042] Example 3: Fermentation of recombinant Corynebacterium glutamicum in a 5L fermentation tank The constructed recombinant Corynebacterium glutamicum Corynebacterium glutamicum HasA-VGB / pXMJ19-pgm-ugd-galU and pECX99E-glmU-glmM-glmS (cg0420 and cg0424 knockout) single clones were inoculated into 5 ml of BHI medium at 200 rpm, 30 °C, overnight. After 10 h, 1% of the inoculum was transferred to a 250 ml Erlenmeyer flask (containing 25 ml of fermentation medium). After 10 h of cultivation at 200 rpm, 28 °C, 10% of the inoculum was inoculated into the fermentation tank. During fermentation, the glucose content in the tank was maintained at approximately 10 g / L by feeding glucose, and the pH was controlled at neutral by feeding NaOH. After 20 hours of fermentation, hyaluronic acid hydrolase was added externally at a final concentration of 6000U / mL. The fermentation time was 72 hours. From Figure 3, it can be seen that without the addition of hyaluronic acid hydrolase, the OD reached the highest level at 48 hours. Hyaluronic acid accumulated rapidly from 24 to 48 hours, and the yield rose to 40g / L at 60 hours. From Figure 4, it can be seen that the growth phase was logarithmic from 4 to 36 hours, and the bacteria grew rapidly and entered the stationary phase at 36 hours. Furthermore, hyaluronic acid accumulated rapidly from 24 to 60 hours. Compared with Figure 3, the fermentation period was extended by 12 hours, and the yield of hyaluronic acid was also significantly increased. At 72 hours, the yield of hyaluronic acid reached 72g / L, which was 32g / L higher than that without the addition of hydrolase, and the OD also increased to a certain extent.

[0043] Comparative Example Using a strategy similar to that of Example 1, the genes encoding the other pathway-competing precursors Cgl1118 (NC_003450.3) and Cgl0452 (NC_003450.3) were knocked out. The recombinant plasmids constructed according to steps (2) and (3) of Example 1 were transformed into knockout cells of Cgl1118 (NC_003450.3) and Cgl0452 (NC_003450.3). Fermentation was carried out according to the method of Example 2 or 3. As a result, the yield of hyaluronic acid was significantly reduced in these gene knockout strains. The yield in a shake bottle was only 3.1 g / L. The main reason for this is that knocking out these genes affects the growth of the bacteria, resulting in slower growth of the strain. In addition, the OD value of 48 hours of fermentation was 34, which was only about half that of the wild-type strain cultured under the same conditions.

[0044] Although the present invention has been disclosed with the above preferred embodiments, it is not intended to limit the present invention. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the following claims.

Claims

1. Corynebacterium glutamicum, characterized in that the exopolysaccharide genes cg0420 and / or cg0424 are silenced or knocked out, and a hyaluronan synthase is expressed, the hyaluronan synthase being selected from the following (a) or (b): (a) an enzyme derived from Streptococcus pyogenes and having the amino acid sequence shown in SEQ ID NO:3; (b) an enzyme having an amino acid sequence having at least 90% identity to SEQ ID NO:3 and having hyaluronic acid synthesis activity; Corynebacterium glutamicum, as shown in FIG.

2. The Corynebacterium glutamicum according to claim 1, in which the UDP-N-acetylglucosamine and / or UDP-glucuronic acid pathway is promoted.

3. 3. The Corynebacterium glutamicum of claim 2, wherein the UDP-N-acetylglucosamine pathway comprises glutamine-fructose-6-phosphate aminotransferase, phosphoglucomutase, and the bifunctional enzymes UDP-N-acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase; and the UDP-glucuronic acid pathway comprises phosphoglucomutase, glucose-6-phosphate urea amidotransferase, and UDP-glucose dehydrogenase.

4. Corynebacterium glutamicum according to any one of claims 1 to 3, characterized in that it also expresses hemoglobin VHb derived from Vitreoscilla.

5. 4. The Corynebacterium glutamicum according to claim 2 or 3, wherein the gene encoding the UDP-N-acetylglucosamine and / or UDP-glucuronic acid pathway is ligated to a vector so as to be expressed in Corynebacterium glutamicum, the vector comprising any one of pXMJ19, pECXK99E, pEC-XT99A, pEKEx1, pEKEx2, pVWEx1, pVWEx2, pZ8-1, pECTAC-K99 and pAPE12, and wherein the gene encoding the UDP-N-acetylglucosamine and / or UDP-glucuronic acid pathway is at least one gene selected from pgM, ugd, galU, glmS, glmM and glmU.

6. The Corynebacterium glutamicum according to claim 4, characterized in that the gene encoding the hemoglobin VHb is ligated into a vector so as to be expressed in Corynebacterium glutamicum, and the vector includes any one of pXMJ19, pECXK99E, pEC-XT99A, pEKEx1, pEKEx2, pVWEx1, pVWEx2, pZ8-1, pECTAC-K99 and pAPE12.

7. The following steps: (1) knocking out the exopolysaccharide synthesis genes cg0420 and cg0424 stepwise or simultaneously; and (2) ligating a gene encoding hyaluronic acid synthase, a gene encoding hemoglobin VHb, and at least one gene selected from pgM, ugd, galU, glmS, glmM, and glmU into a vector and transforming the vector into a cell of Corynebacterium glutamicum. A method for constructing Corynebacterium glutamicum according to any one of claims 1 to 6, comprising:

8. A method for producing hyaluronic acid, comprising carrying out fermentation using the Corynebacterium glutamicum according to any one of claims 1 to 7, in a culture environment containing a carbon source, a nitrogen source, inorganic salts, metal ions and oxygen at 25 to 35°C for 24 to 72 hours.

9. The method according to claim 8, wherein the hyaluronan hydrolase or hyaluronan lyase is added at an early stage of fermentation, and the amount of the hyaluronan hydrolase or hyaluronan lyase added is 500 to 50,000 U / mL.

10. 10. The method according to claim 8 or 9, characterized in that glucose is replenished during the fermentation process.

11. Use of Corynebacterium glutamicum according to any one of claims 1 to 7 in the preparation of hyaluronic acid and its derivative products.

Images