Biocatalysis Technology

Abstract

The present invention relates to a cytochrome P450 enzyme comprising the amino acid sequence set forth in SEQ ID NO: 3, or a variant thereof having an amino acid sequence having at least 95% identity to SEQ ID NO: 3 and having CYP450 activity. The cytochrome P450 enzyme provided herein was isolated from Streptomyces eurythermus NRRL2539, has a broad substrate range and high activity, and can be used to oxidize organic compounds.

Description

[Technical field]

[0001] Technical Field The present invention relates to a cytochrome P450 enzyme from Streptomyces eurythermus NRRL2539, to nucleic acids encoding the enzyme, to kits containing the enzyme, and to the use of the enzyme to catalyze the oxidation of organic substrates.

[0002] Background technology Cytochrome P450 (CYP) is a superfamily of heme-thiolate proteins, named after the carbon monoxide-bound species that have an absorbance spectrum peak at 450 nm. Cytochrome P450 exists in all kingdoms of life, including animals, plants, fungi, protists, bacteria, and archaea. In addition, a putative P450 has been reported from the giant virus Acanthamoeba polyphaga (Lamb, DC; Lei, L; Warrilow, AG; Lepesheva, GI; Mullins, JG; Waterman, MR; Kelly, SL (2009). "The first virally encoded cytochrome P450". Journal of Virology. 83 (16): pp8266-9). No cytochrome P450 enzymes have been identified in E. coli (Roland Sigel; Sigel, Astrid; Sigel, Helmut (2007). The Ubiquitous Roles of Cytochrome P450 Proteins: Metal Ions in Life Sciences. New York: Wiley. ISBN 0-470-01672-8; Danielson PB (December 2002). "The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism in humans". Curr. Drug Metab. 3 (6): pp561-97).

[0003] Cytochromes P450 exhibit remarkable diversity in their reaction chemistry and support the oxidative, peroxidative and reductive metabolism of a wide variety of endogenous and xenobiotic substrates. In humans, cytochrome P450 is best known for its central role in phase I drug metabolism, where it is of critical importance in two of the most significant problems in clinical pharmacology: drug interactions and interindividual variability in drug metabolism. The most common reactions catalyzed by cytochrome P450 are monooxygenase reactions. Cytochrome P450 monooxygenases utilize a heme group to oxidize molecules, often making them more water soluble by adding or exposing a polar group. In general, the reactions catalyzed by these enzymes can be summarized as follows: [ka] In the example in the first row, RH is the substrate and R-OH is the substrate with an oxygen added. The oxygen is bound to the heme group at the center of the CYP enzyme and converts it into a hydrogen ion (H + ) is usually indirectly supplied by the reduced cofactors NADH or NADPH through specific amino acids of the CYP enzyme by redox partner proteins, either independent or fused to CYP. CYP enzymes can accept electrons from a series of redox partner proteins, such as cytochrome b5, ferredoxin reductase and ferredoxin, and adrenodoxin reductase and adrenodoxin.

[0004] The classification and nomenclature of cytochrome P450 is rather complicated, but can be classified by their redox partner transport protein system, as proposed by I. Hanukoglu (1996). "Electron Transfer Proteins of Cytochrome P450 Systems". Advances in Molecular and Cell Biology. Advances in Molecular and Cell Biology. 14: 29-56. In summary, cytochrome P450 enzymes can be divided into the following groups: the microsomal P450 system, which utilizes cytochrome P450 reductase or cytochrome b5 to transfer electrons from cofactors to cytochrome P450; the mitochondrial P450 system, which utilizes adrenodoxin reductase and adrenodoxin to transfer electrons from reduced cofactors to cytochrome P450; Bacterial P450 systems that utilize ferredoxin reductase and ferredoxin proteins to transfer electrons from reduced cofactors to cytochrome P450; the CYB5R-cytb5-P450 system, which utilizes cytochrome b5 for electron transfer from cofactor to cytochrome P450; FMN-Fd-P450 systems in which the electron partner reductase is a condensed FMN domain; P450-only systems that do not require a redox partner protein, e.g., P450 BM-3 .

[0005] Isolated bacterial cytochrome P450 enzymes are known, including the P450 from Pseudomonas putida. cam (J Biol Chem (1974) 249, 94); both are P450s derived from Bacillus megaterium ATCC14581 BM-1 and P450 BM-3(Biochim Biophys Acta (1985) 838, 302, and J Biol Chem (1986) 261, 1986, 7160); P450a, P450b, and P450c from Rhizobium japonicum (Biochim Biophys Acta (1967) 147, 399); and P450npd from Nocardia NHI (Microbios (1974) 9, 119). In comparison, however, there have been no reports of purified cytochrome P450 enzymes from actinomycete microorganisms. In Biochem and Biophys Res Comm (1986) 141, 405, it was reported that soybean flour induces cytochrome P450 in Streptomyces griseus (P450 soy Other reported examples include two forms of P450 from Saccharopolyspora erythraea (originally classified as Streptomyces erythraeus) that exert an effect on pesticide inactivation (P450 SU1 and P450 SU2) as well as the isolation and characterization of two forms of 6-deoxyerythronolide B hydroxylase. US Patent No. 6,884,608 describes the enzymatic hydroxylation of epothilone B to epothilone F, accomplished by a hydroxylating enzyme produced by a strain of Amycolatopsis orientalis (originally classified as Streptomyces orientalis). A more recent example is CYP107L from Streptomyces platensis DSM40041, which was reported in Biotechnology and Bioengineering (2018) 115; 2156-2166 to exhibit activity similar to some human drug-metabolizing P450 enzymes.

[0006] In the field of medicinal chemistry, modification of chemicals is used to change their properties. For example, in the synthesis of drug-like molecules, medicinal chemists often use tertiary butyl groups to introduce hydrophobicity. However, further modifications may improve the potency, selectivity and solubility profiles of such compounds, for example, hydroxylation. Hydroxylation is also the main pathway for metabolic degradation, another important aspect of pharmacology and medicinal chemistry. These hydroxylated metabolites are often difficult to synthesize by purely chemical means, and thus there is a demand for their production using biotransformation in animal tissues.

[0007] Summary of the Invention Surprisingly, it has been found that certain cytochrome P450 enzymes present in Streptomyces urithermus NRRL2539 can be used to provide different types of oxidation reactions for various organic substrates, where the term oxidation and its derivatives refer to reaction types including, but not limited to, hydroxylation, epoxidation, carboxylation, and dealkylation of substrates.

[0008] In particular, the cytochrome P450 enzyme having the amino acid sequence shown as SEQ ID NO: 3 can be used for the oxidation of organic compounds for the purpose of activating or modifying the physicochemical and pharmacological properties of the compounds. In a particularly preferred embodiment, the cytochrome P450 enzyme having the amino acid sequence shown as SEQ ID NO: 3 is useful for the oxidation of various aliphatic or aromatic moieties, or chemicals containing such moieties, for the purpose of CH activation or CH modification of the physicochemical and pharmacological properties of the compounds. The cytochrome P450 enzyme of SEQ ID NO: 3 has not been previously identified and is a particularly useful cytochrome P450 for industrial applications due to its broad reactivity and excellent activity towards many substrates.

[0009] In a first aspect, the present invention provides a cytochrome P450 enzyme comprising the amino acid sequence shown in SEQ ID NO:3, or a variant thereof having an amino acid sequence which has at least 95% identity to SEQ ID NO:3 and which has CYP450 activity.

[0010] In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding an enzyme of the invention.

[0011] In a third aspect, the present invention provides a recombinant construct comprising a nucleic acid molecule of the present invention operably linked to a heterologous expression control sequence.

[0012] In a fourth aspect, the present invention provides a vector comprising a nucleic acid molecule or recombinant construct of the present invention.

[0013] In a fifth aspect, the present invention provides a microorganism comprising a nucleic acid molecule, recombinant construct or vector of the present invention, wherein the nucleotide sequence encoding an enzyme of the present invention is heterologous to the microorganism, and preferably the microorganism is not Streptomyces urothermus.

[0014] In a sixth aspect, the present invention provides the use of a cytochrome P450 enzyme comprising SEQ ID NO:3, or a variant thereof having at least 95% identity to SEQ ID NO:3 and having CYP450 activity, for oxidizing an organic compound.

[0015] In a seventh aspect, the present invention provides a method for producing an oxidized organic compound comprising reacting an organic compound with a cytochrome P450 enzyme comprising SEQ ID NO:3, or a variant thereof having at least 95% identity to SEQ ID NO:3 and having CYP450 activity.

[0016] In an eighth aspect, the present invention provides a method for producing a composition comprising the steps of: i) a cytochrome P450 enzyme comprising SEQ ID NO:3, or a variant thereof having at least 95% identity to SEQ ID NO:3 and having CYP450 activity; ii) a microorganism expressing a cytochrome P450 enzyme comprising SEQ ID NO: 3 or a variant thereof having at least 95% identity to SEQ ID NO: 3 and having CYP450 activity, and / or iii) a nucleic acid molecule, recombinant construct, or vector of the invention, Optionally, a kit is provided that further includes instructions and other cofactor reagents used to oxidize the organic compound.

[0017] In a ninth aspect, the present invention provides a method for producing a cytochrome P450 enzyme of the invention, the method comprising introducing a nucleic acid molecule, a recombinant construct or a vector of the invention into a microorganism, expressing the cytochrome P450 enzyme in said microorganism and optionally isolating and / or purifying said cytochrome P450 enzyme. [Brief description of the drawings]

[0018] The present invention will now be described with reference to the accompanying drawings in which: [Figure 1-1]Figure 1 shows schematic examples of biotransformations exerted by the use of cytochrome P450 enzymes comprising SEQ ID NO:3 of the present invention: Figure 1(a) shows the epoxidation of carbamazepine, Figure 1(b) shows the hydroxylation of bosentan (with demethylation as a minor side reaction), and Figure 1(c) shows the hydroxylation of diclofenac; [Figure 1-2] Figure 1(d) shows the hydroxylation of the methyl groups of meloxicam, some of which are further oxidized to generate carboxyl groups, and Figure 1(e) shows the hydroxylation of tivantinib. [Figure 1-3] FIG. 1(f) shows the hydroxylation of ambroxide. [Diagram 2] FIG. 2 shows the expression plasmid pHD05-SeuC10-SeuF08. [Diagram 3] Figure 3 shows the carbon monoxide difference spectrum of the crude enzyme extract containing the P450SeuC10 protein. The sample was prepared from an IPTG-induced culture of E. coli Tuner (DE3) cells containing the pHD05-SeuC10-SeuF08 plasmid. [Figure 4a] Figure 4a-f show the ultra-performance high-resolution liquid chromatography-mass spectrometry (UPLC-MS) chromatograms of various reactions carried out at a screening scale of 100 μL: Figure 4a shows the chromatogram of the extract after the reaction with lyophilized material of recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A, described in Example 4A, dosed with 100 mg / L carbamazepine. From top to bottom, UV 225 nm, EIC 237 m / z (carbamazepine, 1.33 min), and EIC 253 m / z (carbamazepine-10,11-epoxide, 1.16 min (estimated yield 49%)). [Figure 4b]Figure 4b shows chromatograms of the extract after reaction with E. coli expressing recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A as described in Example 4B, dosed with 100 mg / L bosentan: from top to bottom: UV268 nm, EIC552 m / z (bosentan, 1.76 min), EIC538 m / z (O-desmethylbosentan, 1.67 min (estimated yield 3.4%)), and EIC568 ​​m / z (hydroxy-bosentan, 1.44 min (estimated yield 81%)). [Figure 4c] Figure 4c shows chromatograms of the extract after reaction with E. coli expressing recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A as described in Example 4B, dosed with 100 mg / L diclofenac: from top to bottom, UV 275 nm, EIC 294 m / z (diclofenac, 1.83 min), EIC 310 m / z (5-hydroxydiclofenac and 4'-hydroxydiclofenac, 1.59 min (estimated yield 19.4%) and 1.64 min (estimated yield 73.4%), respectively). [Figure 4d] Figure 4d shows chromatograms of the extracts after reaction with lyophilized material of recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A, as described in Example 4A, dosed with 100 mg / L meloxicam: from top to bottom: UV 354 nm, EIC 352 m / z (meloxicam, 1.61 min), EIC 368 m / z (5'-hydroxymethyl meloxicam, 1.32 min (estimated yield 28.4%), and EIC 382 m / z (5'-carboxyl meloxicam, 1.54 min (estimated yield 5.3%)). [Figure 4e]Figure 4e shows chromatograms of the post-reaction extracts with lyophilized material of recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A, as described in Example 4A, dosed with 100 mg / L tivantinib: from top to bottom, UV 280 nm, EIC 370 m / z (tivantinib, 1.55 min), and EIC 386 m / z (epimers of benzyl hydroxylated products of tivantinib, 1.16 min and 1.14 min (total estimated yield 98.3%)). [Figure 4f] Figure 4f shows chromatograms of post-reaction extracts of recombinant P450SeuC10, ferredoxin seuF08, and ferredoxin reductase SCF15A lyophilized material dosed with 100 mg / L ambroxide, as described in Example 4A. From top to bottom, EIC237 m / z (ambroxide, 2.19 min) and EIC253 m / z (hydroxy-ambroxide derivative, 1.46 min (estimated yield 74%)).

[0019] Description of the Preferred Embodiments A first aspect of the present invention provides a cytochrome P450 enzyme comprising the amino acid sequence shown in SEQ ID NO: 3, or a variant thereof having an amino acid sequence with at least 95% identity to SEQ ID NO: 3 and having CYP450 activity. Alternatively, this aspect of the present invention can be considered to provide a polypeptide having cytochrome P450 activity and comprising the amino acid sequence shown in SEQ ID NO: 3 or a sequence with at least 95% identity to SEQ ID NO: 3. In a preferred embodiment, the enzyme comprises an amino acid sequence with at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 3. Most preferably, the enzyme comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the enzyme may consist of the amino acid sequence of SEQ ID NO: 3 or may consist of an amino acid sequence with at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 3. The origin of the enzyme and the method of obtaining the enzyme are described below. Similarly, variants of the enzyme included in the present invention are described below, including preferred substitutions by which variants can be obtained.

[0020] The enzyme of the present invention is isolated from its native or natural form. Thus, the enzyme is separated from other components with which it is normally associated. For example, the enzyme may be normally present in a microorganism, but in this aspect of the present invention, it is separated from at least some components of the microorganism. The isolated enzyme may be in the form of a concentrated extract or a simple untreated extract in which the concentration of the enzyme is increased from its concentration in the microorganism. In a preferred embodiment, the isolated enzyme is the major component (i.e., the predominant component) of any solution in which it is provided. In particular, if the enzyme is initially produced in a mixture or mixed solution, the enzyme may be separated or purified from the mixture or mixed solution. Thus, for example, if the enzyme is produced using a protein expression system (such as a cellular expression system using prokaryotic (e.g., bacterial) cells, a cell-free in vitro expression system, etc.), the enzyme may be isolated so that it is the most abundant polypeptide in the solution or composition in which it is present, preferably constituting the majority of the polypeptides in the solution or composition, and is enriched relative to other polypeptides and biomolecules present in the natural production medium. As described below, in general the enzymes of the invention are produced using cellular expression systems, in particular by expression in bacterial cells.

[0021] In preferred aspects, the enzyme is present in a solution or composition, e.g., at a purity of at least 60% w / w, at least 70% w / w, at least 80% w / w, at least 90% w / w, at least 95% w / w, or at least 99% w / w (dry weight), e.g. when assessed relative to the presence of other components, particularly other polypeptide components, in the solution or composition.

[0022] To determine the degree of purification of the enzyme of the present invention, for example, to evaluate whether the enzyme is a major component, the solution of the enzyme may be analyzed by quantitative proteomics.For example, 2D gel electrophoresis and / or mass spectrometry may be used.Such isolated molecules may be present in a preparation or composition, as described below.Alternatively, the degree of purification may be more simply evaluated, for example, by performing SDS-PAGE followed by Coomassie staining to check for contaminants / impurities. The enzymes of the invention can be isolated or purified using any technique known in the art. For example, the enzymes can be produced with affinity tags, such as polyhistidine tags (His tags), Strep tags, FLAG tags, or HA tags, allowing the molecules to be isolated or purified by affinity chromatography using appropriate binding partners, for example, polyhistidine tagged molecules can ... 2+ Alternatively, the enzyme may be isolated or purified by, for example, size exclusion or ion exchange chromatography.

[0023] Instead of producing the enzyme of the present invention in a protein expression system, it may be chemically synthesized in a non-biological system, for example, liquid phase synthesis or solid phase synthesis may be employed. Enzymes produced by chemical synthesis (i.e., by non-biological methods) are, in contrast, more likely to be produced in isolated form. Thus, when the enzyme of the present invention is synthesized in a manner that produces an isolated molecule, it is not necessary to carry out a specific purification or isolation step for the enzyme to be considered isolated.

[0024] The enzymes may be provided in a solution or composition, for example with a solution suitable for maintaining activity, the enzymes may be provided in lyophilized form, immobilized or tethered to other polymers or support materials such as alginate beads, iron affinity beads, nickel columns, and electrochemical electrodes.

[0025] A second aspect of the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a cytochrome P450 enzyme of the invention. Thus, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a cytochrome P450 enzyme comprising the amino acid sequence shown in SEQ ID NO:3, or a variant thereof having an amino acid sequence having at least 95% identity to SEQ ID NO:3 and having CYP450 activity.

[0026] Those skilled in the art will understand that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that can code for any given amino acid sequence.Degenerate nucleotide sequence means two (or more) nucleotide sequences that code for the same protein (or protein sequence), specifically two (or more) nucleotide sequences that code for the same protein (or protein sequence) in the open reading frame of the reference nucleotide sequence starting from position 1 (i.e., codon 1 of the coding sequence corresponds to positions 1-3 of the reference nucleotide sequence).

[0027] The native nucleotide sequence of the cytochrome P450 enzyme of SEQ ID NO:3 is shown in SEQ ID NO:9. Thus, in certain embodiments, the nucleic acid molecule of the invention comprises the nucleotide sequence of SEQ ID NO:9. In another embodiment, the nucleic acid molecule of the invention comprises a nucleotide sequence that is degenerate to SEQ ID NO:9, for example, a codon-optimized version of SEQ ID NO:9. In another embodiment, the nucleic acid molecule of the invention comprises a nucleotide sequence that is a variant of SEQ ID NO:9, having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:9. The nucleic acid molecule may comprise or consist of the above sequence.

[0028] The nucleic acid molecule of the present invention may be an isolated nucleic acid molecule, and may further comprise DNA or RNA, or chemical derivatives of DNA or RNA.The term "nucleic acid molecule" specifically includes DNA and RNA in single-stranded and double-stranded forms.The method of isolating or synthesizing nucleic acid molecules is well known in the art.

[0029] The present invention further provides a construct comprising the nucleic acid molecule of the present invention. Advantageously, said construct is a recombinant construct comprising the nucleic acid molecule of the present invention. In said construct, the nucleic acid molecule of the present invention may be flanked by restriction sites (i.e. nucleotide sequences recognised by one or more restriction enzymes) to allow easy cloning of the nucleic acid molecule of the present invention. In the construct of the present invention, the nucleotide sequence encoding the enzyme of the present invention may advantageously be operably linked within the construct to an expression control sequence which may be heterologous to the nucleic acid molecule, i.e. may be non-natural. Here, non-natural means that the expression control sequence and the nucleic acid molecule do not occur together in any natural molecule. Such an expression control sequence is typically a promoter, but the nucleotide sequence encoding the enzyme may be operably linked to other expression control sequences such as terminator sequences, operator sequences or enhancer sequences instead of or in addition to a promoter. Thus, said construct may comprise a promoter which is natural or non-natural (with respect to said nucleic acid molecule), preferably a non-natural promoter. The promoter may be a constitutive promoter or an inducible promoter.

[0030] The term "operably linked" refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence if it can affect the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in a sense or antisense orientation.

[0031] The term "expression control sequence" refers to a nucleotide sequence located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence and affecting transcription, RNA processing or RNA stability, or translation of the associated coding sequence. Expression control sequences may include promoters, operators, enhancers, translation leader sequences, TATA boxes, and B recognition elements, etc. As used herein, the term "promoter" refers to a nucleotide sequence capable of controlling the expression of a coding sequence or RNA. Suitable examples are given below. Generally, a coding sequence is located 3' to the promoter sequence. A promoter may be derived entirely from a native gene, may be composed of different elements derived from different promoters found in nature, or may even include synthetic nucleotide segments. Since in most cases the exact boundaries of a control sequence have not been completely defined, it is further recognized that nucleic acid fragments of different lengths may have the same regulatory activity.

[0032] Methods for preparing constructs of the invention are well known in the art, for example, conventional polymerase chain reaction (PCR) cloning techniques can be used to construct nucleic acid molecules of the invention which can be inserted using known methods into a suitable construct (e.g., containing an expression control sequence).

[0033] The present invention further provides a vector comprising the nucleic acid molecule or construct of the present invention.As used herein, the term "vector" refers to a vehicle into which the nucleic acid molecule or construct of the present invention can be introduced (e.g., covalently inserted), from which the enzyme or the mRNA encoding the enzyme can be expressed, and / or the nucleic acid molecule / construct of the present invention can be cloned.Therefore, the vector can be a cloning vector or an expression vector.

[0034] The nucleic acid molecules or constructs of the invention can be inserted into a vector using any suitable method known in the art, including but not limited to, digestion of the vector and nucleic acid molecule with appropriate restriction enzymes followed by ligation of the nucleic acid molecule with compatible cohesive ends, or, if necessary, blunt end cloning can be used to ligate the digested nucleic acid molecule into the digested vector.

[0035] Said vector is generally a prokaryotic vector, specifically a bacterial vector. The nucleic acid molecule or construct of the present invention may be produced or introduced into a general-purpose cloning vector, particularly a bacterial cloning vector, such as an E. coli cloning vector. Examples of such vectors include pUC19, pBR322, pBluescript vector (Stratagene Inc.), and pCR TOPO® from Invitrogen Inc., such as pCR2.1-TOPO.

[0036] The nucleic acid molecules or constructs of the present invention may be subcloned into an expression vector to express the enzymes of the present invention. Expression vectors may contain a variety of expression control sequences. In addition to control sequences governing transcription and translation, vectors may contain additional nucleic acid sequences that serve other functions, including, for example, vector replication and selection markers. Plasmids are preferred vectors according to the present invention.

[0037] The vector of the present invention may further comprise a nucleotide sequence encoding a ferredoxin to be used with the enzyme of the present invention when required for the cytochrome P450 activity of the enzyme of the present invention. In a particular embodiment, the vector may comprise a nucleotide sequence encoding the ferredoxin of SEQ ID NO: 4 (SeuF08). The native SeuF08 coding sequence is shown in SEQ ID NO: 10. In a particular embodiment, the vector comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is degenerate to SEQ ID NO: 10.

[0038] When a vector of the invention contains both a nucleic acid molecule of the invention and a nucleotide sequence encoding a ferredoxin, the two genes may be polycistronic, i.e., encoded within an operon such that expression of both genes is controlled by the same promoter, or the two genes may be encoded by separate promoters. Alternatively, or in addition, the vector of the invention may comprise a ferredoxin reductase for use with the enzyme of the invention (e.g., ferredoxin-NADP + The vector may further comprise a nucleotide sequence encoding an enzyme of the invention, a ferredoxin and a ferredoxin reductase. Preferably, the vector comprises nucleotide sequences (i.e. genes) encoding the enzyme of the invention, a ferredoxin and a ferredoxin reductase. The ferredoxin reductase may be encoded as part of an operon together with the enzyme of the invention. In certain embodiments, the enzyme of the invention, the ferredoxin and the ferredoxin reductase are encoded in an operon. The genes may be encoded in any order within such an operon.

[0039] In certain embodiments, the vector encodes the ferredoxin reductase Scf15A. Scf15A has the amino acid sequence set forth in SEQ ID NO:11. In certain embodiments, the vector may comprise a nucleotide sequence encoding the ferredoxin reductase of SEQ ID NO:11. The native Scf15A coding sequence is set forth in SEQ ID NO:12. In certain embodiments, the vector comprises the SEQ ID NO:12 nucleotide sequence or a nucleotide sequence that is degenerate to SEQ ID NO:12.

[0040] The present invention further provides a microorganism comprising a nucleic acid molecule of the present invention, a recombinant construct of the present invention, or a vector of the present invention, wherein the nucleotide sequence encoding the enzyme of the present invention is heterologous to the microorganism, or a lysate of such a microorganism. That is, the microorganism of the present invention does not naturally comprise the nucleotide sequence of the nucleic acid of the present invention, or more broadly, the microorganism of the present invention does not naturally encode or express the cytochrome P450 enzyme of SEQ ID NO: 3. Thus, the microorganism is not Streptomyces urothermus NRRL2539. Preferably, the microorganism is not Streptomyces urothermus, i.e., is not any strain of Streptomyces urothermus. As used herein, the term "lysate" is interchangeable with "extract".

[0041] The microorganism is generally a prokaryote, in particular a bacterium. The bacterium may be a gram-positive or gram-negative species or strain, and is generally a non-pathogenic bacterium. In a preferred embodiment, the bacterium is Escherichia coli.

[0042] The microorganism may be a cloning host or an expression host. Suitable bacterial expression strains are known, for example E. coli expression strains such as E. coli (DE3) strains.

[0043] The lysate (or extract) of the present invention (i.e., lysate or extract of a microorganism of the present invention) comprises the enzyme of the present invention. The lysate is therefore a lysate of a microorganism expressing the enzyme (in particular a bacterium expressing the enzyme). Such a lysate or extract can be obtained using standard microbial cell lysis methods. For example, the microorganism may be mechanically lysed (e.g., by French press), acoustically lysed (e.g., by sonication), chemically lysed using a suitable lysis buffer / reagent (e.g., BugBuster, Sigma Aldrich, USA), or lysed by freeze-thawing. The lysate or extract may be a raw lysate / extract, i.e., one that has not been subjected to additional processing after lysis. Alternatively, the lysate may be processed. For example, the insoluble fraction may be removed (e.g., by centrifugation) to provide only the soluble fraction of the lysate. The resulting soluble fraction may be frozen for later use as described below, or in a preferred embodiment, the frozen soluble fraction is lyophilized and the resulting lyophilisate is preferably sealed in a container, e.g., a vial, under vacuum. Thus, the lysate (or extract) generally encompasses a lysate / extract that is more enriched for an enzyme of the invention than the raw lysate / extract.

[0044] A further aspect of the invention provides the use of a cytochrome P450 enzyme comprising SEQ ID NO: 3, or a variant thereof having at least 95% identity to SEQ ID NO: 3 and having CYP450 activity, for oxidizing an organic compound. In such uses (and in other aspects of the invention), it is preferred that the enzyme is a preferred enzyme of the invention as described herein. Specifically, in a preferred embodiment, the present invention relates to a cytochrome P450 SeuC10 The present invention provides a use of an enzyme having the amino acid sequence shown in SEQ ID NO:3.

[0045] The enzyme of the invention, and the enzyme for the uses, methods and kits of the invention, is present in the Streptomyces urothermus strain deposited at the Mycotoxin Prevention and Applied Microbiology Research Unit, National Center for Agricultural Utilization Research, Peoria, Illinois, USA under the accession number NRRL2539. The strain is also deposited in various other culture collections under the respective accession numbers ATCC14975, ATCC19749, CBS488.68, DSM40014, ETH6677, IFO12764, IMET43078, ISP5014, JCM4206, JCM4575, RIA1030. This enzyme, or a variant thereof, when combined with a suitable reductase component, is capable of oxidizing organic compounds.

[0046] As will be appreciated by those skilled in the art, the cytochrome P450 SeuC10 The enzyme can be extracted, with or without purification, from the known strains of Streptomyces urothermus NRRL2539 or other species, or can be synthesized by the synthesis of cytochrome P450 SeuC10 can similarly be extracted, with or without purification, from a recombinant expression system by cloning into an expression system such as E. coli.

[0047] Actinomycetes, including Streptomyces urithermus NRRL2539, are prone to mutations from natural causes and also as a result of artificial treatments such as ultraviolet irradiation, radiotherapy and chemical treatment. The present invention encompasses all growth mutants of Streptomyces urithermus NRRL2539. These mutants also encompass any strains obtained by genetic manipulations such as recombination, transduction and transformation. It is also well known that the characteristics of actinomycetes change to some extent after continuous cultivation, even for the same strain. Thus, the strains do not necessarily have to be taxonomically distinguishable from each other, since there are slight differences in the characteristics of the cultures. The present invention encompasses all strains capable of producing said cytochrome P450 enzymes, and in particular those strains that are not clearly distinguishable from the NRRL2539 strain or its mutants.

[0048] It is clear to those skilled in the art that variants of the specific amino acid sequences exemplified herein may be included in the present invention. Variants having amino acid sequences similar to those of the amino acid sequences disclosed herein, in which one or more amino acid residues are substituted, deleted or added in any combination, are particularly preferred. Among them, silent substitutions, silent additions and silent deletions that do not change the properties and activity of the protein of the present invention are preferred. Although there are various amino acids with similar properties, one or more such amino acids of a substance can often be substituted with one or more other amino acids without eliminating the desired activity of the substance. That is, the amino acids glycine, alanine, valine, leucine and isoleucine are often substitutable for each other (amino acids with aliphatic side chains). Among these possible substitutions, it is preferred to substitute glycine and alanine for each other (because they have relatively short side chains), and it is also preferred to substitute valine, leucine and isoleucine for each other (because they have large hydrophobic aliphatic side chains). Other amino acids that can often be substituted for one another include phenylalanine, tyrosine and tryptophan (amino acids with aromatic side chains); lysine, arginine and histidine (amino acids with basic side chains); aspartic acid and glutamic acid (amino acids with acidic side chains); asparagine and glutamine (amino acids with amide side chains); and cysteine ​​and methionine (amino acids with sulfur-containing side chains). The above substitutions are considered conservative substitutions. Mutants include naturally occurring mutants and artificial mutants. Artificial mutants can be generated using mutagenesis methods, including those applied to nucleic acid molecules, cells or organisms. As mentioned above, the mutants preferably have substantial identity to the amino acid sequences exemplified herein.As used herein, the term "variant" or "variant thereof" refers to an amino acid sequence having "substantial identity" with SEQ ID NO: 3, with at least 95%, at least 96%, at least 97%, at least 98%, at least 98.1%, at least 98.2%, at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.1%, at least 99.8%, or at least 99.9% identity being preferred. The term "substantial identity" indicates that the sequence desirably has a greater degree of identity with any of the sequences described herein than with prior art amino acid sequences. To compare amino acid sequences, programs such as online tools using the CLUSTAL W algorithm (Thompson, JD, Higgins, DG and Gibson, TJ (1994). Nucleic Acids Research, 22:4673-4680.) can be used. This program compares amino acid sequences and finds the best alignment by inserting spaces into either sequence as necessary. For the best alignment, the identity or similarity of amino acids (identity and conservation of amino acid types) can be calculated. Programs such as BLASTx align the longest similar sequences and assign a value to the match. That is, comparisons can be made even when there are several similar regions, each with a different score. The above applies mutatis mutandis to all amino acid sequences disclosed in this application. Nucleic acid sequences can also be aligned in the same way using any suitable program, such as Emboss Needle, in connection with the embodiment of the invention related to nucleic acid sequences, and the identity of those sequences can be calculated.

[0049] In a preferred embodiment, the term "variant" generally refers to a sequence having at least 95% identity to SEQ ID NO:3 and having CYP450 activity, more preferably at least 96% identity to SEQ ID NO:3 or at least 97% identity to SEQ ID NO:3, even more preferably 98% identity to SEQ ID NO:3, even more preferably 99% identity to SEQ ID NO:3, and most preferably 100% identity to SEQ ID NO:3.

[0050] The claimed cytochrome P450 enzymes can be used to oxidize (e.g., hydroxylate, dealkylate, epoxidize, etc.) a variety of compounds. In a preferred embodiment, using the same conditions as those described in Example 4 herein, the organic compounds being oxidized have at least 3% conversion to the resulting derivative, more preferably at least 5%, more preferably at least 10%, more preferably at least 25%, more preferably at least 50%, even more preferably at least 70%, and most preferably 100% conversion to the resulting derivative.

[0051] The compound oxidized by the cytochrome P450 enzyme may have a linear or branched alkyl group, which may be substituted or unsubstituted (such as methyl, isopropyl, or tert-butyl), an aromatic group, which may be substituted (such as aryl or heteroaryl), an olefinic group or a substituted aryl or heteroaryl, or an alkyl heteromolecule; the linear or branched alkyl group, which may be substituted or unsubstituted, may be hydroxylated, the aromatic group may be hydroxylated, the olefinic group or a substituted aryl or heteroaryl may be epoxidized, and the alkyl heteromolecule may be dealkylated.

[0052] Conversion rates for these reactants are particularly high when the claimed cytochrome P450 enzymes are used.

[0053] The compound to be oxidized is preferably a compound of formula (I). [ka] where R represents the remainder of the compound. 1 , R 2 and R 3 are independently H or C 1-12 Alkyl or C 6-10 aryl; or R 1 , R 2 and R 3 any two of may be bonded together to form an optionally substituted cycloalkyl or heterocycloalkyl, or R 1 , R 2 and R 3 may be bonded to each other's bridging carbons to form an olefin, aryl, or heteroaryl.

[0054] Preferably, R is an optionally substituted alkyl, an optionally substituted olefin, an optionally substituted aryl, an optionally substituted heteroaryl, or an optionally substituted heterocycloalkyl.

[0055] As used herein, "alkyl" refers to any alkyl group having a C1 to C 10 It means an alkyl group of the formula C3-C4, which may be linear, branched or cyclic. Examples include propyl, butyl, pentyl, hexyl, cyclopentyl and cyclohexyl. 10 It is preferably an alkyl moiety of the formula: C5-C6 alkyl moiety. The alkyl is preferably an optionally substituted cyclohexyl.

[0056] For clarity, the term cycloalkyl refers to a cyclic alkyl group.

[0057] As used herein, "aryl" refers to an optionally substituted monocyclic, bicyclic or tricyclic aromatic radical, such as phenyl, biphenyl, naphthyl, anthracenyl, etc. The aryl is preferably an optionally substituted C6 aryl.

[0058] As used herein, "heteroaryl" means an optionally substituted monocyclic, bicyclic or tricyclic aromatic radical containing one to four heteroatoms selected from oxygen, nitrogen and sulfur, such as furanyl, pyrrolyl, thiazolyl, isothiazolyl, tetrazolyl, imidazolyl, oxazolyl, isoxazolyl, thienyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, indolyl, azaindolyl, isoindolyl, quinolyl, isoquinolyl, triazolyl, thiadiazolyl, oxadiazolyl.

[0059] As used herein, heterocycloalkyl refers to an optionally substituted cycloalkyl in which one to four carbon atoms are replaced by a heteroatom, preferably selected from nitrogen, oxygen, sulfur or phosphorous.

[0060] As used herein, the term "optionally substituted" means that an H has been removed from the compound and replaced with an organic fragment such as any combination of carbon, halogen, hydrogen, nitrogen, oxygen, and sulfur.

[0061] The compound of the formula (I) preferably has a molecular weight of 50 to 1,000, for example, 100 to 700, and more preferably 200 to 500.

[0062] Preferably, R 1 , R 2 and R 3 are independently H, C 1-6 Alkyl or C 6-10 aryl, where R1 , R 2 and R 3 It is preferred that one or more of R 1 , R 2 and R 3 is independently selected from H, methyl, ethyl, propyl, butyl, t-butyl, pentyl, and hexyl, with the proviso that R 1 , R 2 and R 3 It is preferred that one or more of

[0063] In a particularly preferred embodiment, the cytochrome P450 enzyme is reacted with a compound such as carbamazepine, bosentan, diclofenac, meloxicam, tivantinib or ambroxide. Other preferred compounds used as substrates are as shown in the examples, in particular ambroxide, diclofenac, tivantinib, carbamazepine, palmitic acid, BIRB796, vanoxerine, ruxolitinib and perindopril.

[0064] The preferred compounds to be oxidized are generally compounds of the following structural formula: [ka]

[0065] The cytochrome P450 enzyme may be used in combination with a reductase component that activates the cytochrome P450. In a preferred embodiment, a ferredoxin and a ferredoxin reductase component are used. Any component that activates the cytochrome P450 may be used, such as a component fused directly or via a peptide bond, or a chemical-based alternative that provides oxygen, such as peroxide, iodane, or chemicals with similar resultant properties. In a particularly preferred embodiment, the cytochrome P450 having SEQ ID NO:3 is activated by a ferredoxin reductase component. SeuC10Combining an enzyme, or a variant thereof having at least 95% identity to SEQ ID NO:3 and having CYP450 activity, with suitable ferredoxin and ferredoxin reductase components provides an effective system for converting substrate compounds to the resulting oxidized derivatives.

[0066] In a preferred embodiment, the cytochrome P450 enzyme or variant thereof is present in a Streptomyces urothermus NRRL2539 cell.

[0067] In another preferred embodiment, said cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid encoding said enzyme, derived from Streptomyces urothermus NRRL2539. As used herein, the term "comprises" is intended to mean containing at least the sequences described in the claims, but may also include other sequences. In one embodiment, said recombinant microorganism comprises a heterologous nucleic acid encoding said enzyme or variant thereof. In another embodiment, said recombinant microorganism also comprises a heterologous nucleic acid encoding a reductase agent. "Heterologous" has the meaning given above, i.e. said microorganism does not naturally comprise the nucleotide sequence of the nucleic acid of the invention.

[0068] In another aspect of the invention, there is provided a method for producing an oxidized organic compound comprising reacting an organic compound with a cytochrome P450 enzyme comprising SEQ ID NO:3, or a variant thereof having at least 95% identity to SEQ ID NO:3 and having CYP450 activity.

[0069] The selection of the compound to be oxidized is as described above.

[0070] In a preferred embodiment, the enzyme is used to catalyze the oxidation of an alkyl or aryl group.

[0071] In particularly preferred embodiments, the compound to be oxidized is carbamazepine, bosentan, diclofenac, meloxicam, tivantinib, ambroxide, or derivatives thereof, or other compounds as described in the examples and above. One or more additional components may be used to activate the cytochrome P450 enzyme. In an embodiment according to the invention, the cytochrome P450 enzyme of the invention is used in combination with a reductase component, preferably in combination with a ferredoxin and a ferredoxin reductase component.

[0072] In one embodiment of the invention, the enzyme is present in a host cell, i.e., a host cell is used for the biotransformation of a substrate compound. In a preferred embodiment of the invention, the cytochrome P450 enzyme or variant thereof is present in a Streptomyces urothermus NRRL2539 cell (i.e., the host cell is a Streptomyces urothermus NRRL2539 cell). In another preferred embodiment, the host cell is a microorganism of the invention (as described above). The cell may be administered an organic compound to be oxidized. The method may include an additional step of subsequently harvesting and purifying (or isolating) the cells to obtain the oxidized compound. In particular, the cells are subsequently harvested and the oxidized compound is isolated. That is, the method may include an additional step of purifying (or isolating) the oxidized compound. In this step, first, the cells are harvested (e.g., by centrifugation). If the oxidized compound is secreted by the cells and is present in the cell supernatant, the oxidized compound is extracted from the supernatant. Such extraction may be performed using standard methods in the art, as described below.

[0073] If the oxidized compound is present in the cells, the cells can be lysed (or extracted) using methods such as those described above, and the oxidized compound can be isolated from the lysate. Such isolation can be performed by standard methods in the art, as described below.

[0074] Cultivation of Streptomyces urythermus NRRL2539 for the production of P450 enzyme extracts is suitably carried out by inoculation into a conventional medium containing nutrients well known to be used with such microorganisms. That is, the medium contains a source of assimilable carbon and a source of assimilable nitrogen. The medium may contain inorganic salts. Examples of sources of assimilable carbon include glucose, sucrose, starch, glycerin, starch syrup, molasses and soybean oil. Examples of sources of assimilable nitrogen include soybean solids (such as soybean meal or soybean flour), wheat germ, meat extract, peptone, corn steep liquor, dry yeast and ammonium salts such as ammonium sulfate. If necessary, inorganic salts such as sodium chloride, potassium chloride, calcium carbonate and various phosphates may be included. The medium is preferably sterilized and has a pH adjusted to 5-8. Cultivation of other strains or species may similarly be carried out in any suitable medium as known in the art.

[0075] As will be appreciated by those skilled in the art, the use of a particular culture method is not critical to the present invention, and any method commonly used for culturing actinomycetes (or other types of bacteria, if desired) may equally be employed in the present invention. The method employed will usually be selected with consideration of industrial efficiency in mind; that is, from an industrial point of view, liquid culture is usually preferred, with submerged culture being the most convenient. Cultivation is preferably carried out under aerobic conditions.

[0076] The enzyme of the present invention may be produced in the presence of an inducer. The inducer is preferably selected so as to be the same as the target substrate of the isolated enzyme, but is not limited thereto. After 4 hours to 3 days have passed after seeding, preferably 0.05 to 5 mM of the inducer, more preferably 0.2 mM of the inducer, is added, and then the culture is continued for 2 hours to 1 week, preferably about 1 day. The culture temperature is usually 20°C to 45°C, preferably 25°C to 30°C, and optimally about 27°C. Shaking culture or aeration method can be used.

[0077] The cells obtained by the above culture may be disrupted by a cell disruption method such as high-pressure homogenization in a buffer solution. A crude enzyme solution is obtained from the supernatant obtained by centrifugation. For example, the enzyme of the present invention can be obtained in the supernatant generated by centrifugation at 38,000×g for 20 minutes.

[0078] In another embodiment, the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid encoding the enzyme (i.e., a heterologous nucleic acid derived from Streptomyces urothermus NRRL2539).

[0079] Said at least one recombinant microorganism can then be administered the organic compound to be oxidized, which may include an isolation and / or purification step, as described above, to obtain the oxidized compound.

[0080] In a preferred embodiment, this is a functional cytochrome P450 with an intact heme. SeuC10 This can be achieved by recombinant expression of either of the cofactor enzymes. This can be expressed with any or all of the cofactor enzymes. In a particularly preferred embodiment, ferredoxin and ferredoxin reductase can be expressed. This can be achieved by the use of polycistronic plasmids or by fusion, via a linker or directly, into a single protein product.

[0081] Alternatively, the functional cytochrome P450 SeuC10 The protein may be expressed alone, without being mixed with a cofactor enzyme. In a preferred embodiment, the cofactor enzyme may be dosed to provide an active enzymatic reaction after production of the substance. The cofactor may be obtained by extraction from wild-type or recombinant plant-derived or microbial fermentation-derived substances. Exemplary cloning methods that may be used are described in Hussain & Ward,. Appl Environ Microbiol. 2003; 69(1):373-382.

[0082] The native organism, host strain expressing the recombinant or extracted enzyme is preferably in direct contact with the substrate in a monophasic or biphasic aqueous medium. The reaction conditions, including the choice of pH and temperature, are clear to the skilled artisan and are based on the prior art. For example, the reaction may be carried out at a pH value in the range of 5 to 11, more preferably in the range of 6.5 to 9.0, and most preferably about 8. To achieve this pH, a microbial growth medium or a phosphate buffer solution having the above pH may be selected and used. The reaction temperature is preferably in the range of 20°C to 45°C, more preferably in the range of 25°C to 30°C. The concentration of the substrate in the reaction medium is preferably in the range of 0.01% by weight to 5.0% by weight. The time allowed for the reaction may vary depending on the substrate concentration in the reaction mixture, the reaction temperature, and other factors, but is usually between 1 minute and 5 days, and more often between 1 day and 5 days. The extracted enzyme material may be used as is after extraction, or after storage in a frozen solution. In particularly preferred embodiments, the extracted enzyme material may be dried, preferably by lyophilization, in sealed or unsealed containers under vacuum, with or without the addition of other components required for the reaction, such as other enzyme cofactor components, for later use.

[0083] After completion of the conversion reaction, the resulting oxidized compound can be isolated (or purified) using conventional methods, including, for example, filtration, solvent extraction, chromatography, crystallization, and other isolation methods. Such methods will be selected taking into account the identity of the product. The product may or may not be derivatized, as desired, before, during, or after isolation. Isolation and purification may be referred to interchangeably herein. Isolation may be considered as a form of purification or the first step of purification, for example, separating cells or oxidized compounds from a bulk reaction. Further purification steps can then be performed to improve purity. Thus, references to isolation herein may be considered as the first purification step. Purification may include only the first isolation step, but may also include additional steps to achieve a higher level of purity. It is preferred that a purity of at least 80% w / w (dry weight), at least 85% w / w (dry weight), at least 90% w / w (dry weight), or at least 95% w / w (dry weight) is achieved for the oxidized compound.

[0084] The starting materials as substrates for the enzymes may be derived from synthetic routes, may be natural, may be derived from natural biomass such as plant material, may be produced by fermentation, or may be derived from a mixture of both. Enzymatic reactions may be carried out with pure or unpurified materials, and the resulting reaction products may be used to facilitate subsequent purification of reactants or unreacted components.

[0085] Of the substrate compounds used as starting materials, organic or inorganic free bases, alkali metal salts, for example sodium salts or potassium salts, or acid salts, such as tosylates or hydrochlorides, are suitable for use.

[0086] After completion of the conversion reaction, the desired compound is produced, collected, isolated from the reaction system and purified by conventional methods if necessary, or can be used directly in unpurified form in subsequent steps. For example, the reaction product can be centrifuged or filtered, and the supernatant or filtrate can be extracted with a hydrophobic resin, an ion exchange resin, or a water-immiscible organic solvent such as ethyl acetate. After evaporation of the solvent of the extract, the remaining crude material, e.g., the remaining crude oxidized compound, can be purified by column chromatography using silica gel or alumina or a reversed phase stationary phase and eluting with a suitable eluent. If the starting material is a mixture, the product is isolated as a mixture of oxidized compounds and can be separated using chromatography or other suitable methods, if desired.

[0087] Typically the resulting oxidized compounds may have improved pharmaceutical or agrochemical properties such as bioactivity potency, improved solubility, reduced non-specific interactions, or may simply be more useful, e.g., for further synthesis, or may be useful as analytical standards.

[0088] The cytochrome P450 enzyme preparations of the present invention were incubated with substrate compounds (a) ferredoxin, (b) ferredoxin-NADP at pH 8.0 for 5 minutes. + -When reacted with reductase, (c) an NADPH regenerating system, and (d) dissolved oxygen, the reaction temperature is at least in the range of 4°C to 60°C. The optimum pH for each cytochrome is in the range of 6.5 to 8.0. Each cytochrome is stable when kept at 4°C and in the range of pH 6.0 to 9.0 for 24 hours. Stored lyophilized enzymes are stable for 10 days at 20°C to 27°C compared to controls stored below -18°C.

[0089] Ferredoxin, Ferredoxin-NADP + -The use of reductase, oxygen and NADPH is not essential. Any component capable of activating cytochrome P450 may be used.

[0090] Measurement of enzyme activity is usually performed using one of two methods. (i) Cytochrome P450 measurements The measurement is carried out according to the method of Omura and Sato et al. (J Biol Chem, 239. 1964, 2370). That is, cytochrome P450 is quantitatively analyzed based on the absorbance difference of reduced CO relative to the decrease in the difference spectrum at 450 nm and 490 nm using the following formula:

number

[0091] For the measurement of enzyme activity, the components in the table above are mixed and the solution is shaken at 27°C for 16-20 hours, after which the reaction is stopped by adding, for example, 100-500 μl of ACN. The amount of oxidized substrate formed by the enzyme system is confirmed by HPLC or UPLC. This reaction can also be used on a preparative scale by increasing the volume accordingly.

[0092] In a further aspect, the present invention provides a method for producing a method for the treatment of a cancer i) a cytochrome P450 enzyme comprising SEQ ID NO:3, or a variant enzyme having at least 95% identity to SEQ ID NO:3 and having CYP450 activity; ii) a microorganism expressing a cytochrome P450 enzyme comprising SEQ ID NO: 3 or a variant enzyme having at least 95% identity to SEQ ID NO: 3 and having CYP450 activity; and / or iii) comprising the nucleic acid molecule, recombinant construct, or vector of the present invention as described above; Provide a kit.

[0093] Most preferably, the kit comprises a CYP450 enzyme of the present invention.

[0094] If the kit comprises a microorganism or a lysate thereof (fresh, frozen and / or lysate dried), the microorganism is preferably a microorganism of the invention as described above or a lysate of a microorganism of the invention. Components of the kit, such as the cytochrome P450 enzyme, the microorganism or lysate, or the nucleic acid molecule, recombinant construct or vector, may be lyophilized and / or vacuum sealed.

[0095] The kit may further include instructions for use in oxidizing an organic compound. The kit allows a user to screen for the oxidation of a compound of interest.

[0096] In a preferred embodiment, the kit further comprises an electron donor. This is particularly advantageous when the kit comprises the enzyme of the present invention. The kit preferably comprises ferredoxin reductase and ferredoxin as electron donors, together with a cofactor regenerating system, such as cofactors NADH or NADPH, or NAD+ or NADP+, glucose or glucose-6-phosphate, and glucose dehydrogenase or glucose-6-phosphate dehydrogenase. However, any suitable electron donor may be used.

[0097] Optionally, the kit may further comprise, either separately or contained in other components, a buffer, which is particularly advantageous when the kit comprises an enzyme of the invention.

[0098] Preferably, the kit may further comprise one or more other cytochrome P450 enzymes. This is particularly advantageous when the kit comprises the enzyme of the present invention. When the kit comprises a microorganism expressing the enzyme of the present invention, the microorganism may further express one or more additional CYP450 enzymes, or the kit may comprise one or more additional microorganisms or their lysates, each of which expresses a further CYP450 enzyme (i.e., a CYP450 enzyme other than the CYP450 enzyme of the present invention). When the kit comprises a nucleic acid molecule, recombinant construct, or vector encoding the enzyme of the present invention, the nucleic acid molecule, recombinant construct, or vector may further encode one or more additional CYP450 enzymes, or the kit may further comprise one or more additional nucleic acid molecules, recombinant constructs, or vectors, each of which encodes a further CYP450 enzyme (i.e., a CYP450 enzyme other than the CYP450 enzyme of the present invention).

[0099] Preferably, the cytochrome P450 enzyme or microorganism or its lysate is lyophilized or immobilized or tethered to other polymers or supports such as alginate beads, iron affinity beads, nickel columns and electrochemical electrodes.

[0100] In a further aspect, the present invention provides a method for producing a cytochrome P450 enzyme of the invention, the method comprising introducing a nucleic acid molecule, recombinant construct or vector of the invention into a microorganism, expressing the cytochrome P450 enzyme in said microorganism, and optionally purifying (or isolating) said cytochrome P450 enzyme.

[0101] The techniques for carrying out the method are well known in the art. The nucleic acid molecule, recombinant construct or vector can be produced using standard techniques as described above. The microorganism into which the nucleic acid molecule, construct or vector is introduced is preferably as described above for the microorganism of the present invention. That is, the microorganism is preferably a bacterium, for example E. coli. The enzyme is expressed in the microorganism using standard techniques in the art, for example as shown in the examples below.

[0102] To obtain active enzyme, the microorganism may be lysed to obtain an enzyme-containing lysate. Lysis may be performed using standard methods in the art, for example, using a French press. The enzyme may then be purified (or isolated) if necessary. Purification may be performed using standard methods in the art. For example, the enzyme may be expressed with an affinity tag (e.g., His tag or Strep tag) and then purified by affinity chromatography, as described above.

[0103] The following examples illustrate the methods of the present invention, but are provided by way of illustration only and should not be construed as limiting the invention. EXAMPLES

[0104] Example 1: P450 from Streptomyces urothermus NRRL2539 SeuC10 Cloning Extraction of genomic DNA from Streptomyces urothermus NRRL2539 Genomic DNA (gDNA) was isolated from cell pellets of fermented material of Streptomyces urithermus NRRL2539. The medium contained 4 g / L yeast extract, 10 g / L malt extract, and 4 g / L glucose and was adjusted to pH 7.0. Two 250-mL Erlenmeyer flasks were filled with 50 mL of this medium and sterilized at 115°C for 20 min. Streptomyces urithermus NRRL2539 was inoculated into two flasks containing 50 mL of growth medium from cryovial stocks stored in liquid nitrogen. After 2 days of growth at 27°C and 200 rpm, 50 mL of culture was transferred to a 50-mL centrifuge tube and centrifuged to collect pelleted cells. The pellet was washed once with isotonic buffer to remove residual medium components and then frozen at -80°C for subsequent genomic DNA extraction as described below. The cell pellet was thawed and resuspended in 7.5 ml of TE buffer (10 mM Tris-HCl (pH 7.5), 1 mM Na2EDTA). 75 μl of 20 mg / ml lysozyme solution was added and the solution was incubated at 37°C for 1 h, after which 750 μl of 10% (w / v) SDS was added and mixed by inversion. 20 μl of 20 mg / ml pronase was added and incubated at 37°C for 1.5 h, after which 16 μl of 10 mg / ml RNase solution was added to the solution, followed by another incubation step at 37°C for 1 h and at 50°C for 1 h. After adding 900 μl of 0.5 M NaCl solution, the solution was extracted twice with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1; Sigma-Aldrich). The aqueous layer was collected and the genomic DNA was precipitated with one volume of isopropanol and centrifugation (10,000×g, 30 min, 20°C). The genomic DNA pellet was washed once with 100% ethanol and twice with 70% ethanol (approximately 30 ml for each wash step). The genomic DNA pellet was air-dried and resuspended in 5 ml of TE buffer. The concentration and purity of the genomic DNA were measured using a NanoDrop instrument (Thermo Scientific), and the integrity of the genomic DNA was assessed by agarose gel electrophoresis.

[0105] PCR reaction P450 SeuC10 Ferredoxin SeuF08 The gene operon (SEQ ID NO: 1) was cloned from Streptomyces urothermus NRRL2539 using SeuC10-SeuF08_f primer (5'-primer sequence-3': ATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAGATCGGCACGACGCACCTC) (SEQ ID NO: 5) and SeuC10-SeuF08_r primer (5'-primer sequence-3': CTACCCGCAGAGGGCGGGGCATAAGCTTCCTATTAGGCGGAGCGCTCCCGTACGGTGATG) (SEQ ID NO: 6) in a total reaction volume of 50 μl. The PCR reaction contained 10 μl 5x GC Green buffer (Thermo Scientific), 2.5 μl DMSO (Sigma), 10 μl 5 M betaine (Sigma), 1 μl formamide (Sigma), 1 μl 10 mM dNTPs (Thermo Scientific), 1 unit HotStart II Phusion® High-Fidelity DNA Polymerase (Thermo Scientific), ∼90 ng genomic DNA, 0.5 μM each of forward and reverse primers, and the reaction was filled up to a total volume of 50 μl with MilliQ® HO. PCR reactions were performed in an Eppendorf Mastercycler ep Gradient system using the following cycle conditions: 98°C for 2 min, 35 cycles (98°C for 45 sec, 72°C for 30 sec, 72°C for 3 min), 72°C for 15 min. PCR reactions were analyzed by agarose gel electrophoresis and products were extracted from the agarose gel using Qiagen's QIAquick 96 PCR Purification Kit. The concentration of the amplicon with the expected length of 1558 bp was measured using a Biochrome Genequant 1300 instrument and a Molecular Devices Spectramax 384 plus plate reader.

[0106] Construction of pHD05 vector The pHD05 vector is a derivative of pHD02 (see WO2018 / 091885) that contains a cer sequence, which was amplified by PCR from the pKS450 plasmid (Summers and Sherratt., EMBO J. 1988;7(3):851-858.) using the ser_f primer (5'-primer sequence-3': GGGTCCTCAACGACAGGAGCACGATCATGCCGGAAATACAGGAACGCACGCTG) (SEQ ID NO: 7) and the ser_r primer (5'-primer sequence-3': TTATCGCCGGCATGGCGGCCCCACGGGTGCCGGGGCACAACTCAATTTGCGGGTAC) (SEQ ID NO: 8). The amplicon with the expected length of 439 bp was extracted from agarose gel using the GeneJet Gel Extraction Kit (Thermofisher) and cloned into the FspAI site of pHD02 by Gibson assembly. The plasmid containing this cer sequence was analyzed by PCR screening, and the DNA sequence was confirmed by Sanger sequencing at LGC Genomics (Germany). The plasmid containing this cer sequence was designated pHD05.

[0107] P450 SeuC10 Ferredoxin SeuF08 Cloning of gene operons into pHD05 plasmid Purified P450 SeuC10 Ferredoxin SeuF08The amplicon was assembled into pHD05 vector digested with NdeI and EcoRI, thereby introducing the cytochrome P450·ferredoxin gene operon into a polycistronic operon containing ferredoxin reductase (scf15a). The vector was digested with restriction endonucleases (New England Biolabs). Restriction digests were performed for 16 h at 37°C in a total volume of 200 μl containing 20 μl 10x CutSmart buffer®, 4 μl each restriction endonuclease (40 units; New England Biolabs), and ∼10.4 μg of plasmid DNA. The reaction was stopped by inactivating the restriction endonucleases at 65°C for 20 min. The expected digestion products were purified using the GeneJET Gel Extraction Kit from Thermo Scientific. The purified digested vector and purified P450 amplicon were assembled together using Gibson assembly in a total volume of 20 μL containing ~50 ng of digested vector, a 1:3 (vector:insert) molar concentration of insert, 6.65% PEG8000, 133 mM Tris-HCl (Fisher) (pH 7.5), 13.3 mM MgCl2 (Sigma), 13.3 mM DTT (Sigma), 0.266 mM dNTPs (New England BioLabs), 1.33 mM NAD (New England BioLabs), 0.495 units of Phusion DNA polymerase (New England BioLabs), 79.5 units of Taq DNA ligase (New England BioLabs), and 0.075 units of T5 exonuclease (New England BioLabs). The reaction mixture was incubated at 50° C. for 1 h and 1 μL was introduced into 25 μL of E. coli DH5α chemically competent cells (Invitrogen) by chemical transformation. After incubation at 37° C. for 16 h, clones were selected on Miller's Luria Broth (LB) plates containing 50 μg / mL kanamycin.Clones were picked and cultured in 5 mL LB containing the same antibiotics, and recombinant plasmids were isolated from these cultures using QIAGEN's QIAprep 96 Plus Kit. The DNA sequences of P450, ferredoxin, and ferredoxin reductase were analyzed by PCR screening, and the DNA sequences were confirmed by Sanger sequencing at LGC genomics (Germany). The constructed plasmid was designated pHD05-SeuC10-SeuF08 (Figure 2).

[0108] Construction of recombinant expression strains P450 SeuC10 , ferredoxin SeuF08 , and ferredoxin reductase SCF15A E. coli Tuner (DE3) strain (Merck) was used as a host for recombinant expression of. To construct this expression strain, E. coli Tuner (DE3) cells were transformed with the expression plasmid using chemical transformation. 25 μl of chemically competent cells were mixed with 1 μl (~100 ng) of pHD05-SeuC10-SeuF08 plasmid and then incubated on ice for 30 min. After a 30 s heat shock in a 42°C water bath, the cells were cooled on ice for 2 min. 1 ml of LB was added to the cells and then incubated at 37°C with shaking at 250 rpm for 1 h. The transformation mixture was plated on LB plates containing 50 μg / ml kanamycin. The plates were incubated at 37°C for 16 h. To make glycerol stocks of this expression strain, several colonies were picked with a sterile loop and inoculated into 5 ml of LB medium containing the same antibiotics and grown at 250 rpm at 37°C for 16 h. 500 ml of this culture was mixed with 500 μl of 50% (w / v) glycerol in a cryovial and stored at -80°C.

[0109] Example 2: Recombinant P450 SeuC10 Expression of Preculture: 5 ml of LB Miller medium (Sigma) supplemented with 50 μg / ml kanamycin was inoculated with a loop scraped from a cryovial containing E. coli Tuner (DE3) carrying the pHD05-SeuC10-SeuF08 expression plasmid. Cells were grown overnight at 37°C and 250 rpm in a New Brunswick Scientific Innova 4230 shaking incubator. Inoculation: A baffled 250 ml flask was inoculated with 50 ml of PCM8.1 medium supplemented with 50 μg / ml kanamycin with the overnight preculture until an OD600 of 0.1 was reached and incubated at 37° C., 200 rpm until the end of the day. The composition of PCM8.1 was as follows: MgSO4 (0.49 gL -1 ), Na2HPO4 * 7H2O(6.7gL -1 ), KH2PO4(3.4gL -1 ), NH4Cl(2.68gL -1 ), Na2SO4(0.71gL -1 ), arginine (0.2gL -1 ), histidine (0.15gL -1 ), Lysine (0.2gL -1 ), phenylalanine (0.2gL -1 ), serine (0.2gL -1 ), threonine (0.2gL -1 ), tryptophan (0.2gL -1 ), methionine (0.2gL -1 ), monosodium glutamate (8gL -1 ), glucose (0.5gL -1 ), glycerol (10gL -1 ), and FeCl3 (81.1 gL -1 ), CaCl2 * 6H2O(4.38gL -1 ), MnCl2 * 4H2O(1.98gL -1 ), ZnSO4 * 7H2O(2.88gL -1 ), CoCl2* 6H2O(0.48gL -1 ), CuCl2 * 2H2O(0.34gL -1 ), NiCl2 * 6H2O(0.48gL -1 ), Na2MoO4 * 2H2O(0.48gL -1 ), Na2SeO3(0.35gL -1 ), and H3BO3 (0.12 gL -1 ) 1000x diluted trace element solution. Production: 50 μg / ml kanamycin, 23.8 μg / ml IPTG, 320 μg / ml 5'-aminolevulinic acid, and 55 μg / ml FeSO4 * The seed culture was inoculated into a baffled 1 L flask containing 200 mL of PCM8.1 medium supplemented with 7H2O until an OD of 0.6 was reached. The induced production culture was incubated at 27°C and 200 rpm until stationary phase was reached (approximately 16-20 hours). The culture was harvested by centrifugation at 3,000 rpm for 15 minutes. The pellet was washed with 30 mL of wash buffer (isotonic 0.85% NaCl with 5% glycerol) and transferred to a new 50 mL centrifuge tube. The cells were further centrifuged at 4,000 rpm for 25-35 minutes and the pellet was stored at -20°C for processing.

[0110] Example 3: Extraction and processing of enzyme material A cell pellet suspension was obtained as described in Example 2. The cell pellet suspension contained recombinant P450, ferredoxin, and ferredoxin reductase in 100 mM potassium phosphate buffer (pH 8.0), 5 mM MgCl2, 5 mM TCEP, and 1 mM PMSF in a ratio of 3.0 ml of buffer per gram of cells. Lysed cells were obtained by three cycles of high pressure disruption at 30 kpsi. The lysed material was centrifuged at 38,000×g for 40 minutes (4° C.), and the supernatant was sterilized by passing it through a 0.2 micron filter to obtain a cell-free enzyme preparation containing recombinant P450, ferredoxin, and ferredoxin reductase. This crude extract was then either used immediately in the desired reaction or aliquoted into glass vials (usually 0.5 ml per 2 ml vial or 10 ml per 20 ml vial), frozen and lyophilized using an Edwards Supermodulyo freeze dryer, and then stored at -20°C in a standard laboratory freezer until required for use. The concentration of cytochrome P450 was measured according to the method of Omura and Sato et al. (J. Biol. Chem., 239. 1964, 2370). The concentration of cytochrome P450 in the cell-free extract of induced E. coli Tuner (DE3) cells carrying pHD05-SeuC10-SeuF08 was 17 μM. SeuC10 The carbon monoxide difference spectrum is shown in Figure 3.

[0111] Example 4A: Oxidase activity / spectrum assay Lyophilized materials of recombinant P450, ferredoxin, and ferredoxin reductase proteins were made and reconstituted to the original volume in high purity water as described in Example 3. Biocatalysis was carried out under the following conditions with shaking at 27°C: 100 mM potassium phosphate (pH 8.0), 5 mM MgCl2 (both present in the reconstituted enzyme preparation), and 0.1 mg / ml substrate compound such as carbamazepine, bosentan, diclofenac, meloxicam, tivantinib, or ambroxide. The concentrations of P450, ferredoxin, and ferredoxin reductase were as extracted (Example 3). Reactions were initiated by adding a 10x stock of cofactor mixture (50 mM G6P, 10 mM NADP, 10 UN / ml G6PDH) to a final volume of, for example, 10 μL to 90 μL for a total reaction volume of 100 μL. After 16–20 h, the reaction was extracted with an equal volume of acetonitrile, centrifuged to remove precipitated proteins, and conversion was assessed by UPLC-MS analysis.

[0112] UPLC data was obtained as follows. Column: Acquity UPLC BEH Shield RP18, 1.7 μm, inner diameter 2.1 mm, length 50 mm Solvent: H2O, B: Acetonitrile, both containing 0.1% formic acid Flow rate: 1.0ml / min Detector: Waters Acquity UPLC PDA (UV-Vis detection) and Waters Acquity UPLC QDA (MS)

[0113] To confirm the identity of reaction products, when known, their chromatographic retention times, masses, and UV spectra were compared with those of metabolite standards. Representative results of overall % conversion to oxidation products are shown in Table 1 below. [Table 1]

[0114] Example 4B: Hydroxylase activity / spectrum assay with whole cell biotransformation in E. coli A cell pellet was obtained as in Example 2. The cell pellet was thawed, washed with 0.85% NaCl buffer, and centrifuged at 4,000 RCF for 30 minutes at 4°C. The supernatant was discarded, and the pellet was flash frozen in liquid nitrogen. The pellet was thawed again and resuspended in 40 mL of buffer containing 50 mM potassium phosphate (pH 7.4), 5 mM MgCl2, and 100 mM glucose.

[0115] Biocatalysis was carried out with shaking at 27° C. using 0.1 mg / ml substrate compounds such as carbamazepine, bosentan, diclofenac, meloxicam, tivantinib, ambroxide or other compounds shown in Table 2. Reactions were stopped and analyzed as in Example 4. Results of broader substrate testing are shown in Table 2 below. [Table 2]

[0116] Example 5: P450 SeuC10 Comparison of activity with other cytochromes P450 Other cytochrome P450 enzymes are expressed as described above and their activities are assayed using the methods described in Example 4. SeuC10 The other P450 tested in this study was P450 from Amycolatopsis lurida NRRL2430. AluC09(SEQ ID NO: 13, see WO2018 / 091885); SriC12 from Streptomyces rimosus NRRL2234 (SEQ ID NO: 14, see WO2020 / 109776); SriC20 from Streptomyces rimosus NRRL2234 (SEQ ID NO: 15, see WO2020 / 109776); SriC22 from Streptomyces rimosus NRRL2234 (SEQ ID NO: 16, see WO2020 / 109776); and CYP107L from Streptomyces platensis DSM40041 (SEQ ID NO: 17, see Worsch et al., Biotechnology and Bioengineering 115:2156-2166, 2018).

[0117] The results are shown in Tables 3 and 4 below, which show the overall percent conversion of substrates to oxidation products. The results reported in Tables 3 and 4 were generated using the methods described in Examples 4A and 4B, respectively, with the substrates shown in each table below. The first column of each table corresponds to the results obtained in Tables 1 and 2 above. [Table 3] [Table 4]

[0118] As shown in the above tables, the enzyme of the present invention (SeuC10) exhibits higher conversion levels for almost all substrates than any other cytochrome P450 tested.

Claims

1. A cytochrome P450 enzyme comprising the amino acid sequence shown in SEQ ID NO:3, or a mutant enzyme thereof having an amino acid sequence having at least 95% identity with SEQ ID NO:3 and having CYP450 activity.

2. i) a sequence having at least 96% identity to the amino acid sequence shown in SEQ ID NO:3; ii) a sequence having at least 97% identity with the amino acid sequence shown in SEQ ID NO:3; iii) a sequence having at least 98% identity with the amino acid sequence shown in SEQ ID NO:3; iv) a sequence having at least 99% identity to the amino acid sequence shown in SEQ ID NO:3, or v) comprising the amino acid sequence shown in SEQ ID NO:3; The enzyme described in claim 1.

3. A nucleic acid molecule comprising a nucleotide sequence encoding the enzyme of claim 1 or claim 2.

4. A recombinant construct comprising the nucleic acid molecule of claim 3 operably linked to a heterologous expression control sequence.

5. A vector comprising the nucleic acid molecule of claim 3 or the recombinant construct of claim 4.

6. A microorganism or a lysate of said microorganism comprising a nucleic acid molecule according to claim 3, a recombinant construct according to claim 4, or a vector according to claim 5, A microorganism or a lysate of said microorganism, wherein said microorganism does not naturally contain the nucleic acid molecule described in claim 3.

7. i) is not Streptomyces eurythermus, and / or ii) Escherichia coli; The microorganism described in claim 6.

8. 3. Use of a cytochrome P450 enzyme according to claim 1 or claim 2 for oxidizing an organic compound, said use being ex vivo.

9. The use according to claim 8, wherein the oxidation is hydroxylation, epoxidation, or dealkylation.

10. 10. The use according to claim 8 or claim 9, wherein the organic compound to be oxidized comprises alkyl, aryl or olefinic groups and / or alkyl or aryl substituents.

11. The compound to be oxidized is a compound of formula (I), 【Chemistry 1】 where R represents the remainder of the compound and R 1 , R 2 and R 3 are independently H or C 1-12 Alkyl or C 6-10 aryl; or R 1 , R 2 and R 3 any two of may be bonded together to form an optionally substituted cycloalkyl or heterocycloalkyl, or R 1 , R 2 and R 3 may be bonded to each other's bridging carbons to form an olefin, aryl or heteroaryl.

12. 12. The use according to any one of claims 8 to 11, wherein the compound to be oxidized is carbamazepine, bosentan, diclofenac, meloxicam, tivantinib, or ambroxide.

13. i) the cytochrome P450 enzyme is used in combination with a reductase component or other reducing agent; ii) the cytochrome P450 enzyme is used in combination with a ferredoxin and a ferredoxin reductase component; iii) the cytochrome P450 enzyme is in a purified form, a partially purified form, a crude enzyme extract, a recombinant host cell form, or a native host cell form; iv) the cytochrome P450 enzyme or variant thereof is present in Streptomyces urothermus NRRL2539 cells; v) said cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid encoding said enzyme; and / or vi) the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid as defined in claim 6 or claim 7; Use according to any one of claims 8 to 12.

14. 3. A method for producing an oxidized organic compound, comprising reacting the organic compound with a cytochrome P450 enzyme according to claim 1 or claim 2.

15. i) the organic compound is oxidized by hydroxylation, epoxidation, or dealkylation; ii) the organic compound to be oxidized is an organic compound as defined in any one of claims 10 to 12; iii) the cytochrome P450 enzyme is used in combination with a reductase component; iv) the cytochrome P450 enzyme is used in combination with a ferredoxin and a ferredoxin reductase component; and / or v) the cytochrome P450 enzyme is in a purified form, a partially purified form, a crude enzyme extract, a recombinant host cell form, or a native host cell form; The method of claim 14.

16. i) the cytochrome P450 enzyme or a variant thereof is present in Streptomyces urothermus NRRL2539 cells, and the cells are administered an organic compound which is oxidized; ii) the cytochrome P450 enzyme or variant thereof is present in Streptomyces urothermus NRRL2539 cells, and the cells are administered an organic compound to be oxidized, thereafter the cells are harvested and the oxidized compound is isolated; iii) the cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid encoding said enzyme; iv) said cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid as defined in claim 6 or claim 7, said at least one recombinant microorganism being administered an organic compound to be oxidized, v) said cytochrome P450 enzyme or variant thereof is expressed by at least one recombinant microorganism comprising a heterologous nucleic acid as defined in claim 6 or claim 7, said at least one recombinant microorganism being administered an organic compound to be oxidized and then subjected to a purification step to obtain said oxidized compound, vi) the oxidized organic compound is recovered, isolated and / or purified; and / or vii) the oxidized organic compound is recovered, isolated and / or purified, and derivatized; The method according to claim 14 or claim 15.

17. i) a cytochrome P450 enzyme according to claim 1 or 2, ii) a microorganism expressing a cytochrome P450 enzyme according to claim 1 or claim 2, or a lysate thereof, and / or iii) a nucleic acid molecule according to claim 3, a recombinant construct according to claim 4, or a vector according to claim 5; Kit including:

18. i) the kit further comprises a reducing agent; ii) the kit further comprises a ferredoxin reductase and a ferredoxin; iii) the kit further comprises a buffer; iv) the kit further comprises one or more other cytochrome P450 enzymes and / or instructions for using the kit to oxidize an organic compound; v) the cytochrome P450 enzyme, microorganism or lysate, or nucleic acid molecule, recombinant construct, or vector is freeze-dried and / or vacuum-sealed; and / or (vi) The microorganism expressing a cytochrome P450 enzyme is a microorganism according to claim 6 or claim 7; The kit of claim 17.

19. 10. A method for producing a cytochrome P450 enzyme according to claim 1 or claim 2, comprising introducing a nucleic acid molecule according to claim 3, a recombinant construct according to claim 4, or a vector according to claim 5 into a microorganism and expressing the cytochrome P450 enzyme in the microorganism.

20. The method of claim 19, further comprising purifying the cytochrome P450 enzyme.

21. A method for preparing a lysate of a microorganism as defined in claim 6 or 7, comprising lysing said microorganism.

22. The method of claim 21, further comprising processing the lysate.

Images