Method for producing nucleic acid oligomer

Abstract

The objective of the present invention is to provide: a method for stabilizing a nucleic acid oligomer solution having a phosphorothioate bond; and a method for producing a purified nucleic acid oligomer. The present invention provides: a method for stabilizing a nucleic acid oligomer, the method being characterized in that an atmosphere in contact with an elution fraction obtained by subjecting a crude nucleic acid oligomer including a nucleic acid oligomer represented by formula (1) (in the formula, the symbols are as described in the specification) to reverse phase column chromatography is made into an inert gas atmosphere in which the oxygen concentration is 10% or less; and a method for producing a purified nucleic acid oligomer from the elution fraction.

Description

[Technical field]

[0001] This patent application claims priority and the benefit of Japanese Patent Application No. 2020-072233 (filed April 14, 2020) under the Paris Convention, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for producing a nucleic acid oligomer. More specifically, the present invention relates to a method for producing a nucleic acid oligomer containing a phosphorothioate. [Background technology]

[0003] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field. Examples include antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0004] Nucleic acid oligomers can be synthesized by solid phase synthesis, and the nucleic acid oligomers synthesized by extending nucleic acid on a solid phase carrier are cut off from the solid phase carrier, and then, for example, in the case of a nucleic acid oligomer containing ribose, the protecting group of the hydroxyl group at the 2'-position of ribose is removed by deprotection to produce the desired nucleic acid oligomer. Nucleic acid oligomers having phosphorothioate bonds are also known as useful compounds (Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2017 / 068377 Summary of the Invention [Problem to be solved by the invention]

[0006] The stability of a nucleic acid oligomer having phosphorothioate bonds may be a problem when compared with a nucleic acid oligomer consisting of only phosphodiester bonds. The present invention aims to provide a method for stabilizing a nucleic acid oligomer having phosphorothioate bonds, and an efficient method for producing the nucleic acid oligomer, which includes a step of isolating the nucleic acid oligomer stabilized by the method. [Means for solving the problem]

[0007] As a result of intensive research conducted by the present inventors to achieve the above object, they have found that the nucleic acid oligomer having phosphorothioate bonds can be stabilized by subjecting a crude product of the nucleic acid oligomer having phosphorothioate bonds produced by the phosphoramidite method to reverse-phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer, and then making the atmosphere in contact with the obtained elution fraction an inert gas atmosphere of a certain concentration or less. The present invention provides a method for stabilizing a nucleic acid oligomer having phosphorothioate bonds, and an efficient method for producing a nucleic acid oligomer having phosphorothioate bonds, which includes a step of isolating the nucleic acid oligomer stabilized by the method.

[0008] The present invention includes the following aspects, but is not limited to these. Item 1. A fraction eluted from reverse phase column chromatography, comprising a compound represented by formula (1): [ka]

[0009] (In the formula, B C each independently represents the same or different nucleobase, R are each independently the same or different and each represents a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each represent a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; X's are independently the same or different and each represents an oxygen atom or a sulfur atom; Y represents a hydrogen atom or a hydroxyl-protecting group; G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion; n is expressed by the formula (2): 60≦n (2) and up to 20% of the n X's are sulfur atoms. A method for stabilizing a nucleic acid oligomer, comprising: making an atmosphere in contact with a solution containing a nucleic acid oligomer represented by the formula: an inert gas atmosphere having an oxygen concentration of 10% or less. Item 2. A method for producing a stabilized purified nucleic acid oligomer solution, comprising the steps of: subjecting a crude product of the nucleic acid oligomer represented by formula (1) produced by the phosphoramidite method to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer of formula (1); and making the atmosphere in contact with the elution fraction described in Item 1 an inert gas atmosphere having an oxygen concentration of 10% or less. Item 3. A method for producing a purified nucleic acid oligomer, comprising the steps of producing a purified nucleic acid oligomer solution by the steps described in item 2 above, and further comprising the steps of isolating the purified nucleic acid oligomer from the purified nucleic acid oligomer solution. Item 4. The method according to any one of items 1 to 3 above, wherein the oxygen concentration is 5% or less. Item 5. The method according to any one of items 1 to 4 above, wherein the oxygen concentration is 2.5% or less. Item 6. The method according to any one of Items 2 to 5 above, wherein the reversed-phase column chromatography uses, as a mobile phase, at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts. Item 7. The method according to any one of items 2 to 6 above, wherein the reversed-phase column chromatography uses, as a mobile phase, a mobile phase containing at least one ammonium salt selected from the group consisting of dialkylammonium salts. Item 8. The method according to any one of Items 2 to 7 above, wherein the reversed-phase column chromatography uses, as a mobile phase, at least one water-soluble organic solvent selected from the group consisting of an alcohol-based water-soluble organic solvent and a nitrile-based water-soluble organic solvent. Item 9. The method according to item 3 above, comprising mixing the stabilized purified nucleic acid oligomer solution with a C1-C4 organic solvent having at least one oxygen atom, and isolating the precipitated nucleic acid oligomer. Item 10. The method according to any one of items 1 to 9 above, wherein in formula (1), R is each independently a hydroxy group or a methoxy group. Item 11. The method according to any one of items 2 to 9 above, wherein R is a hydroxy group.

[0010] The present invention further includes the following aspects, but is not limited to these. Item 1A. Formula (1) produced by the phosphoramidite method: [ka]

[0011] (In the formula, B C each independently represents the same or different nucleobase, R are each independently the same or different and each represents a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each represent a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; X's are independently the same or different and each represents an oxygen atom or a sulfur atom; Y represents a hydrogen atom or a hydroxyl-protecting group; G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion; n is expressed by the formula (2): 60≦n (2) and up to 20% of the n X's are sulfur atoms. subjecting the crude product of the nucleic acid oligomer represented by formula (1) to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer of formula (1); The atmosphere in contact with the eluted fraction is an inert gas atmosphere having an oxygen concentration of 10% or less to obtain a stabilized purified nucleic acid oligomer solution. A method for producing a nucleic acid oligomer. Item 2A. The method for producing a nucleic acid oligomer according to Item 1A, further comprising a step of isolating a purified nucleic acid oligomer from the stabilized purified nucleic acid oligomer solution. Item 3A. The method for producing a nucleic acid oligomer according to either Item 1A or Item 2A, wherein the oxygen concentration is 5% or less. Item 4A. The method for producing a nucleic acid oligomer according to either Item 1A or Item 2A, wherein the oxygen concentration is 2.5% or less. Item 5A. The method according to any one of items 1A to 4A, wherein the mobile phase of the reversed-phase column chromatography contains at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts. Item 6A. The method according to any one of items 1A to 4A, wherein the mobile phase for the reversed-phase column chromatography contains at least one ammonium salt selected from the group consisting of dialkylammonium salts. Item 7A. The method according to any one of items 1A to 6A, wherein the reversed-phase column chromatography uses, as a mobile phase, at least one water-soluble organic solvent selected from the group consisting of an alcohol-based water-soluble organic solvent and a nitrile-based water-soluble organic solvent. Item 8A. The method according to item 2A, comprising mixing the stabilized purified nucleic acid oligomer solution with a C1-C4 organic solvent having at least one oxygen atom, and isolating the precipitated nucleic acid oligomer. Item 9A. The method according to any one of items 1A to 8A, wherein, in formula (1), R is each independently a hydroxy group or a methoxy group. Item 10A. The method according to any one of items 1A to 8A, wherein R is a hydroxy group. Item 11A. A fraction eluted from reverse phase column chromatography, comprising a compound represented by formula (1): [ka]

[0012] (In the formula, The definition of each group is as defined in item [1A]. A method for stabilizing a nucleic acid oligomer, comprising: making an atmosphere in contact with a solution containing a nucleic acid oligomer represented by the formula: an inert gas atmosphere having an oxygen concentration of 10% or less. Effect of the Invention

[0013] INDUSTRIAL APPLICABILITY The present invention stabilizes nucleic acid oligomers having phosphorothioate bonds and provides an efficient method for producing the same. [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 is a diagram showing an example of synthesis of a nucleic acid oligomer by the phosphoramidite method. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention describes a method for stabilizing a nucleic acid oligomer, which is characterized in that the atmosphere in contact with a solution containing a nucleic acid oligomer represented by formula (1), which is a fraction eluted from reverse phase column chromatography, is an inert gas atmosphere having an oxygen concentration of 10% or less. In the formula (1), B C The nucleic acid base represented by the formula (hereinafter, sometimes referred to as "base") may be a natural or unnatural nucleic acid base. Examples of such unnatural nucleic acid bases include modified analogs of natural or unnatural nucleic acid bases. Typical examples of nucleic acid bases include purine compounds and pyrimidine compounds, such as the nucleic acid bases disclosed in U.S. Pat. No. 3,687,808, "Concise Encyclopedia Of Polymer Science And Engineering", pp. 858-859, edited by Kroschwitz JI, John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613.

[0016] Specific examples include purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine.

[0017] In addition, B CExamples of nucleic acid bases represented by the formula (I) include amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6-azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, and 5-aminoallyluracil; 8-halo-, aminated, thiolated, thioalkylated, hydroxylated, and other 8-substituted purines; and 5-trifluoromethyluracil. aryl and other 5-substituted pyrimidines;6-azapyrimidines;N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine);dihydrouracil;3-deaza-5-azacytosine;7-deazaadenine;N6-methyladenine, N6,N6-dimethyladenine;5-amino-allyl-uracil;N3-methyluracil;substituted 1,2,4-triazoles;2-pyridinones;5-nitroindoles;3-nitropyrroles;5-methoxyuracil;uracil-5-oxyacetic acid;5-methoxycarbonylmethyluracil;2-thiouracil, 5-methyl-2-thiouracil;5-methoxycarbonylmethyl-2-thiouracil;5-methylaminomethyl-2- Examples include thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, and the like.

[0018] When R represents an OQ group and Q represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, the structure is represented by the structures of LNA-1, LNA-2, and LNA-3 shown in the following formula (3).

[0019] [ka]

[0020] (In the formula, B c represents a nucleobase as defined above.

[0021] The hydroxyl-protecting group represented by Y can be any group that can function as a protecting group in the amidite method, and can be any of the known protecting groups used for amidite compounds. The hydroxyl-protecting group represented by Y is preferably the following group:

[0022] [ka]

[0023] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. The alkoxy group is, for example, a methoxy group.

[0024] The chain length of the nucleic acid oligomer of formula (1) is, for example, n≧60, n≧80, or n≧100. The upper limit of the chain length is, for example, n≦200. In the nucleic acid oligomer, up to 20% (inclusive) of the n X's are sulfur atoms. Preferably, the nucleic acid oligomer of formula (1) has one or more phosphorothioate bonds, more preferably three or more phosphorothioate bonds.

[0025] The nucleic acid oligomer of formula (1) may be, for example, a DNA or RNA oligomer, or these oligomers may contain a non-natural nucleic acid base. The nucleic acid oligomer is typically a single-stranded DNA or RNA oligomer. In the nucleic acid oligomer of formula (1), the substituents R are preferably each independently a hydroxyl group or a methoxyl group. The method of the present invention is suitable for RNA, which is a nucleic acid oligomer of formula (1) in which the substituents R are each independently a hydroxyl group or a methoxyl group. More specifically, it is suitable for producing a nucleic acid oligomer containing both a nucleotide in which the substituent R is a hydroxyl group and a nucleotide in which the substituent R is a methoxyl group.

[0026] <Method for purifying nucleic acid oligomers by reversed-phase column chromatography> Separation by reverse phase column chromatography is carried out by passing a mobile phase containing an alkylammonium salt through a column containing a packing material, then passing a solution in which a reaction product containing a nucleic acid oligomer synthesized using the phosphoramidite method is dissolved through the same mobile phase, adsorbing and binding the nucleic acid oligomer within the column, and separating and eluting the impurities contained in the nucleic acid oligomer and the target nucleic acid molecule using a gradient that gradually increases the concentration of the organic solvent in the mobile phase.

[0027] The eluted fractions obtained by reversed-phase column chromatography are selected and collected by analyzing the composition by UV absorption at a wavelength of 260 nm under chromatographic conditions generally used for separating and analyzing nucleic acids. The purified target nucleic acid oligomers having a predetermined amount of phosphorothioate bonds are obtained from the collected fractions. As the analysis method, for example, the method described in the non-patent document (Handbook of Analysis of Oligonucleotides and Related Products, CRC Press) can be used.

[0028] Examples of the packing material for the reversed-phase column chromatography include silica or polymers that serve as a hydrophobic stationary phase, such as silica or polymers to which one or more groups selected from a phenyl group, an alkyl group having 1 to 20 carbon atoms, and a cyanopropyl group are fixed. For example, silica or polymers that serve as such packing materials have a particle size of 2 μm or more, or 5 μm or more.

[0029] In reversed-phase column chromatography, the eluted fraction is obtained as a water-soluble mobile phase, and examples of the solvent system that serves as the mobile phase include alcohol-based organic solvents (e.g., methanol, ethanol, 2-propanol, or n-propanol), nitrile-based organic solvents (e.g., acetonitrile), and water. As the alcohol-based organic solvent, C1-C3 alcohols are preferred, and among these, methanol is more preferred. As the nitrile-based organic solvent, acetonitrile is preferred. Each organic solvent may be used alone or in combination of two or more.

[0030] The mobile phase of the reversed phase column chromatography usually contains an alkylammonium salt, and the eluent also contains these alkylammonium salts. As the alkylammonium salt, usually, monoalkylammonium salts, dialkylammonium salts and trialkylammonium salts are used, preferably monoalkylammonium salts and dialkylammonium salts, more preferably dialkylammonium salts. The carbon number of the monoalkylamine forming the monoalkylammonium salt is preferably 3 to 10, more preferably 4 to 6, and even more preferably hexylamine. The carbon number of the dialkylamine forming the dialkylammonium salt is preferably 4 to 10, more preferably 5 to 9. A preferred dialkylamine is dibutylamine. The trialkylamine forming the trialkylammonium salt is preferably 6 to 12, more preferably 6 to 9, and specifically, triethylamine is exemplified.

[0031] Examples of the acid that forms the monoalkylammonium salt, dialkylammonium salt, and trialkylammonium salt include carbonic acid, acetic acid, formic acid, trifluoroacetic acid, and propionic acid.

[0032] The concentration of the ammonium salt is usually 1 to 200 mM, preferably 5 to 150 mM, and more preferably 20 to 100 mM.

[0033] The pH range of the mobile phase is usually 6 to 8, and preferably 6.5 to 7.5.

[0034] The temperature for reverse phase column chromatography is usually 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C.

[0035] The eluate fraction obtained by reverse phase column chromatography usually contains water, an alcohol-based organic solvent, a nitrile-based organic solvent, the alkylammonium salt, and the nucleic acid oligomer of formula (1). The amount of water in the eluate is usually 90% to 30%, preferably 80% to 40%, and more preferably 70% to 40%. The amount of the alcohol-based organic solvent in the eluate is usually 0 to 20%, preferably 0 to 15%, and more preferably 0 to 10%. The amount of the nitrile-based organic solvent in the eluate is usually 10 to 70%, preferably 20 to 60%, and more preferably 30 to 50% (all % above represent mass %).

[0036] The molar concentration of the alkylammonium salt in the eluted fraction is usually 1 mM to 200 mM, and preferably 10 mM to 100 mM.

[0037] The concentration of the nucleic acid oligomer in the eluted fraction is usually 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0038] <Step for stabilizing the elution fraction containing nucleic acid oligomers obtained by reversed phase chromatography> The inert gas atmosphere with an oxygen concentration of 10% or less may be adjusted, for example, by supplying an inert gas with a predetermined oxygen concentration or less to a container containing a nucleic acid oligomer, and measuring and confirming that the oxygen concentration in the atmosphere in the container is within the set concentration range. Specifically, the atmosphere in the container can be adjusted by flowing a high-purity inert gas such as argon or nitrogen, or an inert gas with an oxygen concentration adjusted to a predetermined concentration, or by replacing the atmosphere in the container with the inert gas or an inert gas with an adjusted concentration.

[0039] The preparation of an inert gas atmosphere having an oxygen concentration of 10% or less may be carried out at any stage of before, during, or after the eluted fraction is supplied to the container, or may be carried out in combination thereof.

[0040] The inert gas includes, but is not limited to, nitrogen gas, argon gas, and helium gas.

[0041] The atmosphere in the container can be replaced by vacuum replacement, pressure replacement, flow replacement, bubbling replacement, or freeze degassing, and may be subjected to ultrasonic waves or heating. The more preferred method is flow replacement.

[0042] The oxygen concentration in the inert gas atmosphere is preferably 10% or less, more preferably 5.0% or less, even more preferably 2.5% or less, and even more preferably 0.1% or less.

[0043] Under the inert gas atmosphere, the obtained eluted fraction may be stored usually at 0°C to 80°C, preferably 10°C to 70°C, and more preferably 20°C to 60°C.

[0044] The elution fraction containing the nucleic acid oligomer obtained by reverse phase chromatography may be subjected to, for example, after storage, a single or multiple post-treatment steps selected from a reprecipitation step, a separation step, an ultrafiltration step, a deprotection step, and a freeze-drying step in order to isolate the nucleic acid oligomer.

[0045] In the reprecipitation step, the stabilized solution is brought into contact with a poor solvent to precipitate and isolate the nucleic acid oligomer. If necessary, the liquid portion may be removed from the solid-liquid separation state, and the precipitated nucleic acid oligomer may then be collected and isolated by filtration or the like. Examples of poor solvents for the reprecipitation step include C1-C4 organic solvents having at least one oxygen atom (e.g., C1-C4 alcohol, tetrahydrofuran, dioxane). As such a solvent, ethanol or isopropanol is preferred.

[0046] In the separation process, the stabilized solution is mixed with at least one of an acidic aqueous solution such as an aqueous sodium acetate solution, water, and saline, and then a water-immiscible organic solvent is added to separate the solution into an aqueous layer and an organic layer, and the aqueous layer containing the desired nucleic acid oligomer can be obtained.

[0047] In the ultrafiltration step, the nucleic acid oligomers present in the solution after the storage step can be separated from low molecular weight components having a desired molecular weight or less using an ultrafiltration membrane.

[0048] If the nucleic acid oligomer has a protecting group at the 5'-end, the protecting group of the nucleic acid oligomer can be deprotected by mixing an acidic aqueous solution such as an acetic acid solution or a solution in which an acidic substance such as acetic acid is dissolved in an organic solvent with the solution after the storage step.

[0049] In the freeze-drying process, the aqueous solution of frozen nucleic acid oligomers is depressurized to sublimate the water, thereby separating the nucleic acid oligomers from the water.

[0050] Synthesis of nucleic acid oligomers by phosphoramidite method can be performed by nucleic acid extension reaction according to known methods (for example, the methods described in the above-mentioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Regarding the production of nucleic acid oligomers by phosphoramidite method, the synthesis of RNA according to the scheme shown in Figure 1 will be taken as an example, and the production method of nucleic acid oligomers will be described with reference to the reaction pathway (condensation reaction, oxidation, deprotection) shown below.

[0051] In the above chemical formula showing the reaction pathway, Ba is an optionally protected nucleic acid base; Tr is a protecting group; X is as defined above, and SP represents the portion of the inorganic porous carrier other than the nucleoside structure.

[0052] The inorganic porous carrier having a nucleoside structure (Sp-Nu) and the nucleic acid base constituting the nucleoside of the amidite monomer (Am-1) are the above-mentioned nucleic acid bases or nucleic acid bases protected with a protecting group.

[0053] Examples of suitable amidite monomers (Am-1) include compounds represented by the following chemical formula (Am-1'), in which R represents a protected hydroxyl group. Specific protecting groups include TBDMS amidites (TBDMS RNA Amidites, trade name, ChemGenes Corporation), ACE amidites, TOM amidites, CEE amidites, CEM amidites, and TEM amidites (see Chakhmakhcheva's review: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Rus Examples of such an amide include amides such as amides described in the International Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21. and EMM amidites (described in International Publication No. 2013 / 027843).

[0054] [ka]

[0055] (In the formula, R represents a group as defined above, and B a represents an optionally protected nucleobase.

[0056] [Solid-phase synthesis of RNA] The Tr group of the inorganic porous carrier (Sp-Nu) is deprotected to obtain a solid phase carrier (Am-2). Then, the amidite monomer (Am-1) and the solid phase carrier (Am-2) are subjected to a condensation reaction to obtain a reaction product (Am-3). Then, the reaction product (Am-3) is oxidized to obtain a product (Am-4). Then, the product (Am-4) is deprotected (-Tr) to obtain a product (Am-5). Next, the amidite monomer (Am-1) and the product (Am-5) are further subjected to a condensation reaction to extend the phosphodiester bond. In this way, a series of cycles of deprotection, condensation reaction, and oxidation are repeated as many times as necessary so that the hydroxyl group at the 5' position of the extended oligonucleotide chain end becomes the desired sequence, and then the nucleic acid molecule of the desired sequence can be produced by cutting it out from the solid phase carrier. Such synthesis may be performed using an automatic nucleic acid synthesizer that employs the phosphoramidite method. Here, RNA will be taken as an example for explanation, but the present invention can also be applied to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0057] In the step of deprotecting the Tr group, the protecting group of the hydroxyl group at the 5' position of the RNA chain end supported on the solid phase carrier is deprotected. As the protecting group, a trityl-based protecting group (typically, a DMTr group) is used. The deprotection can be carried out using an acid. Examples of the acid for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0058] In the condensation step, a nucleoside phosphoramidite is bound to the 5' hydroxyl group of the RNA chain end deprotected in the deprotection step to generate a phosphite. The nucleoside phosphoramidite used has the 5' hydroxyl group protected with a protecting group (e.g., DMTr group).

[0059] The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1 H-tetrazole (Activator-42).

[0060] After the condensation step, the unreacted hydroxyl group at the 5'-position may be capped, if necessary, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0061] The oxidation step is a step of oxidizing the phosphite formed in the condensation step. The oxidation step can be carried out using an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl) peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide.

[0062] When converting a phosphite triester group into a thiophosphate triester group, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used as the "oxidizing agent". The oxidizing agent can be used by diluting it with a suitable solvent to a concentration of 0.001 to 2M. The solvent used in the reaction is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio.

[0063] The oxidation step may be carried out after the capping step, or conversely, the capping step may be carried out after the oxidation step, and this order is not limited.

[0064] After the oxidation step, the process returns to the deprotection step, and the above-mentioned series of steps of condensation reaction, oxidation, and deprotection are repeated depending on the nucleotide sequence of the nucleic acid oligomer to be synthesized, thereby synthesizing RNA having the desired sequence.

[0065] After the synthesis of a nucleic acid oligomer having a desired sequence is completed, the RNA strand is cleaved from the solid support using ammonia or an amine compound and recovered.

[0066] Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0067] The chain length of the thus obtained nucleic acid oligomer is, for example, n≧60, n≧80, or n≧100, and also n≦200.

[0068] In the step of deprotecting the phosphate protecting group, after the synthesis of a nucleic acid having a desired sequence is completed, an amine compound is used to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, etc.

[0069] If there is a protecting group at the 2'- or 3'-hydroxyl group of ribose, it can be removed according to the methods described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571. EXAMPLES

[0070] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0071] Measurement method The measurement methods used in the following tests are shown below. (Measurement method 1: RNA purity measurement method) The purity of RNA in the fraction solution eluted by reverse phase chromatography was measured by HPLC. The fractionated RNA was separated into each component by HPLC (wavelength 260 nm, column DNAPacTM PA 200, 4.0 mm x 250 mm, 8.0 μm), and the purity of RNA was calculated from the area value of the main product in the total area value of the obtained chromatogram. The HPLC measurement conditions are shown in Table 1 below.

[0072] [Table 1]

[0073] (Measurement method 2: Oxygen concentration measurement) The oxygen concentration of the atmosphere in contact with the fractionated solution eluted by reverse phase chromatography was measured using PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentration in air and pure nitrogen, and then the needle attached to the device was inserted into a container such as a flask capped with a septum to measure the oxygen concentration in the gas phase of the system. The measured oxygen concentration was displayed in real time, and the point where the measured value stabilized was regarded as the oxygen concentration of the atmosphere.

[0074] [Reference example 1] Solid-phase synthesis of RNA using the amidite method An RNA having the nucleic acid sequence I shown below was synthesized. The strand was 103 bases long.

[0075] Strand I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*U*U*U (5'-3') (SEQ ID NO: 1) In the above sequence notation, U represents uridine, C represents cytidine, A represents adenosine, or G represents guanosine in the sequence description. The symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The RNA was synthesized from the 3' to 5' side using a nucleic acid synthesizer (AKTA oligopi lot plus100 GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 63 μmol scale. The RNA amidites used in the synthesis were uridine EMM amidite (described in Example 2 of International Publication WO 2013 / 0278 43), cytidine EMM amidite (described in Example 3 of the same publication), adenosine EMM amidite (described in Example 4 of the same publication), and guanosine EMM amidite (described in Example 5 of the same publication), each of which has the following formula: porous glass was used as the solid phase support, a dichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as the sulfurizing agent, and anhydrous phenoxyacetic acid solution and N-methylimidazole solution were used as the capping solution. After completion of the nucleic acid elongation, the nucleic acid on the carrier was treated with a diethylamine solution to selectively deprotect the cyanoethyl protecting group of the phosphoric acid moiety. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0076] [ka]

[0077] The excision and deprotection from the solid phase support after solid phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol were added, and the solid phase support was filtered after standing for a while, and the solvent was distilled off. Then, the hydroxyl group was deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to a desired concentration.

[0078] Preparative purification of RNA The synthesized RNA was purified by column chromatography under the conditions in Table 2 below. However, before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The fraction with a retention time of 94.2 minutes to 95.8 minutes was collected, and the obtained solution was analyzed by HPLC. The purity was calculated by the method described in Measurement Method 1 above. As a result, the purity of RNA in the collected fraction was 94%.

[0079] [Table 2]

[0080] Check the storage stability of the solution [Example 1] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 1 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). Furthermore, a needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 0.0%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial taken out of the incubator was cooled to room temperature, and the purity of RNA was calculated using the method described in the measurement method 1, which was 83%.

[0081] [Example 2] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 1 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). Furthermore, a needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 2.1%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial was taken out of the incubator and cooled to room temperature, and the purity of RNA was calculated using the method described in the measurement method 1, which was 77%.

[0082] [Example 3] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 1 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). A needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 7.3%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial was taken out of the incubator and cooled to room temperature, and the purity of RNA was calculated using the method described in the measurement method 1, which was 73%.

[0083] [Comparative Example 1] 0.5 mL of the solution of the fraction containing the RNA separated and purified in Reference Example 1 was placed in a 10 mL glass headspace vial (GL Sciences), and sealed with a septum and crimp cap (GL Sciences) without replacing the atmosphere with nitrogen. The glass headspace vial containing the separated solution was then placed in an incubator (Kenis) whose temperature was adjusted to 60° C., and allowed to stand for 8 hours. After standing, the headspace vial was taken out of the incubator and cooled to room temperature, and the purity of the RNA in the fraction was calculated by the method described in Measurement Method 1 above, and was found to be 60%.

[0084] [Table 3] 1) The nucleic acid (RNA) fractionated and purified in Reference Example 1 was stored at 60°C for 8 hours under a specified oxygen concentration, and then the purity (%) of the nucleic acid was measured by HPLC. 2) Retention rate of nucleic acid (%) = HPLC purity of nucleic acid after storage / Purity of nucleic acid during separation and purification in Reference Example 2

[0085] Recovery of RNA from stored fractions [Example 4] In Example 1, the oxygen concentration of the atmosphere was set to 0.0%, and 0.4 mL of the solution that had been left for 8 hours was placed in a 15 mL polypropylene conical tube (Corning), and 0.2 mL of sodium acetate aqueous solution (3 M, pH = 5.2) and 1.2 mL of ethanol were added. The resulting slurry solution was centrifuged for 10 minutes at 3000 g and 25 ° C., and the supernatant was removed. Subsequently, 1 mL of 70% ethanol aqueous solution was added, and the operation of centrifuging for 10 minutes at 3000 g and 25 ° C. and removing the supernatant was repeated twice to obtain RNA as a precipitate. The obtained RNA was dissolved in 0.4 mL of water, and the purity of the RNA in the fraction was calculated using the method described in the measurement method 1, and the purity was 77%.

[0086] [Comparative Example 2] 0.4 mL of the fractionated solution left for 8 hours in Comparative Example 1 was placed in a 15 mL polypropylene conical tube (Corning), and 0.2 mL of sodium acetate aqueous solution (3 M, pH = 5.2) and 1.2 mL of ethanol were added. The resulting slurry solution was centrifuged for 10 minutes at 3000 g and 25 ° C., and the supernatant was removed. Subsequently, 1 mL of 70% ethanol aqueous solution was added, and the procedure of centrifuging for 10 minutes at 3000 g and 25 ° C. and removing the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 0.4 mL of water, and the purity of RNA in the fraction was calculated by the method described in the measurement method 1, and the purity was 64%.

[0087] [Reference example 2] Solid-phase synthesis of RNA using the amidite method An RNA having the nucleic acid sequence II shown below was synthesized. The strand was 67 bases long.

[0088] Strand II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U (5'-3') (SEQ ID NO: 2) In the above sequence notation, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The letters Am, Um, Cm, and Gm indicate nucleotides in which the 2' hydroxyl group is replaced with a methoxy group. The RNA was synthesized from the 3' to the 5' side using a nucleic acid synthesizer (AKTA oligopi lot plus100 GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 53 μmol scale. The synthesis was carried out using uridine EMM amidite (described in Example 2 of WO 2013 / 027843), cytidine EMM amidite (described in Example 3 of the same), adenosine EMM amidite (described in Example 4 of the same), and guanosine EMM amidite (described in Example 5 of the same) as RNA amidites, as well as uridine 2'OMe amidite, cytidine 2'OMe amidite, adenosine 2'OMe amidite, and guanosine 2'OMe amidite of the following formulae, respectively, porous glass as the solid phase support, a dichloroacetic acid toluene solution as the deblocking solution, 5-benzylthio-1H-tetrazole as the condensing agent, an iodine solution as the oxidizing agent, and 3-amino-1,2,4-dithiazole-5-thione as the sulfurizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution as the capping solutions. After completion of the nucleic acid elongation, the nucleic acid on the carrier was treated with a diethylamine solution to selectively deprotect the cyanoethyl protecting group of the phosphoric acid moiety. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0089] [ka]

[0090] The excision and deprotection from the solid phase support after solid phase synthesis were performed according to the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol were added, and the solid phase support was filtered after standing for a while, and the solvent was distilled off. Then, the hydroxyl group was deprotected using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to a desired concentration.

[0091] Preparative purification of RNA Column chromatography purification was performed under the conditions in Table 4 below. However, before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The solution with retention times of 66.7 minutes to 70.9 minutes was collected, and the obtained solution was analyzed by HPLC. The purity was calculated by the method described in Measurement Method 1 above. As a result, the purity was 94%. This collected and purified RNA solution was used to carry out the experiments in the following Examples and Comparative Examples.

[0092] [Table 4]

[0093] Check the storage stability of the solution [Example 5] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 2 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). Furthermore, a needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the atmosphere in the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 0.0%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial taken out of the incubator was cooled to room temperature, and the purity of RNA was calculated by the method described in the measurement method 1, which was 87%.

[0094] [Example 6] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 2 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). Furthermore, a needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 2.1%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial was taken out of the incubator and cooled to room temperature, and the purity of RNA was calculated using the method described in the measurement method 1, which was 84%.

[0095] [Example 7] 0.5 mL of the solution of the fraction containing RNA separated and purified in Reference Example 2 was placed in a glass headspace vial (GL Science) with a capacity of 10 mL, and sealed with a septum and a crimp cap (GL Science). Furthermore, a needle for blowing nitrogen from a nitrogen cylinder, a needle for removing the blown nitrogen, and a measuring needle of an Oxygen Meter were pierced into the septum in the sealed system, and the system was replaced with nitrogen by flowing nitrogen, and the oxygen concentration in the atmosphere was set to 4.5%. Here, the oxygen concentration was measured using the method described in the measurement method 2. Furthermore, the glass headspace vial containing the separated solution was placed in an incubator (Kenis) whose temperature was adjusted to 60°C, and left to stand for 8 hours. After standing, the headspace vial taken out of the incubator was cooled to room temperature, and the purity of RNA was calculated using the method described in the measurement method 1, which was 83%.

[0096] [Comparative Example 3] 0.5 mL of the solution of the fraction containing the RNA separated and purified in Reference Example 2 was placed in a 10 mL glass headspace vial (GL Sciences), and sealed with a septum and crimp cap (GL Sciences) without replacing the atmosphere with nitrogen. The glass headspace vial containing the separated solution was then placed in an incubator (Kenis) whose temperature was adjusted to 60° C., and allowed to stand for 8 hours. After standing, the headspace vial was taken out of the incubator and cooled to room temperature, and the purity of the RNA in the fraction was calculated by the method described in Measurement Method 1, and was found to be 79%.

[0097] [Table 5] 1) The nucleic acid (RNA) fractionated and purified in Reference Example 2 was stored at 60°C for 8 hours under a specified oxygen concentration, and then the purity (%) of the nucleic acid was measured by HPLC. 2) Retention rate of nucleic acid (%) = HPLC purity of nucleic acid after storage / Purity of nucleic acid during separation and purification in Reference Example 2 [Industrial Applicability]

[0098] Nucleic acid oligomers having phosphorothioate bonds in the elution fraction of reverse phase chromatography can be stabilized, and purified nucleic acid oligomers (e.g., RNA) having phosphorothioate bonds can be efficiently produced. [Sequence List Free Text]

[0099] SEQ ID NOs: 1 and 2 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. A fraction eluted from reverse phase column chromatography, the fraction comprising a compound of formula (1): 【Chemistry 1】 (In the formula, B Ｃ each independently represents the same or different nucleobase, R are each independently the same or different and each represents a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and each represent a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; X's are independently the same or different and each represents an oxygen atom or a sulfur atom; Y represents a hydrogen atom or a protecting group for a hydroxyl group; G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion; n is represented by formula (2): 60≦n (2) and up to 20% of the n X's are sulfur atoms. The atmosphere in contact with the solution containing the nucleic acid oligomer represented by the formula (1) is an inert gas atmosphere having an oxygen concentration of 10% or less, The method for stabilizing a nucleic acid oligomer comprises supplying an inert gas to an elution fraction as a solution containing the nucleic acid oligomer.

2. A method for producing a stabilized purified nucleic acid oligomer solution, comprising the steps of: subjecting a crude product of the nucleic acid oligomer represented by formula (1) produced by the phosphoramidite method to reverse phase column chromatography to obtain a purified elution fraction containing the nucleic acid oligomer of formula (1); and making the atmosphere in contact with the elution fraction described in claim 1 an inert gas atmosphere having an oxygen concentration of 10% or less.

3. 3. A method for producing a purified nucleic acid oligomer, comprising the steps of producing a purified nucleic acid oligomer solution by the steps of claim 2, and further comprising the steps of isolating the purified nucleic acid oligomer from the purified nucleic acid oligomer solution.

4. The method according to any one of claims 1 to 3, wherein the oxygen concentration is 5% or less.

5. The method according to any one of claims 1 to 4, wherein the oxygen concentration is 2.5% or less.

6. The method according to any one of claims 2 to 5, wherein the reversed-phase column chromatography is reversed-phase column chromatography using, as a mobile phase, a mobile phase containing at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts.

7. The method according to any one of claims 2 to 6, wherein the reversed-phase column chromatography is reversed-phase column chromatography using, as a mobile phase, a mobile phase containing at least one ammonium salt selected from the group consisting of dialkylammonium salts.

8. The method according to any one of claims 2 to 7, wherein the reversed-phase column chromatography is reversed-phase column chromatography using, as a mobile phase, a mobile phase containing at least one water-soluble organic solvent selected from the group consisting of an alcohol-based water-soluble organic solvent and a nitrile-based water-soluble organic solvent.

9. The method according to claim 3, comprising mixing the stabilized purified nucleic acid oligomer solution with a C1-C4 organic solvent having at least one oxygen atom, and isolating the precipitated nucleic acid oligomer.

10. The method according to any one of claims 1 to 9, wherein, in formula (1), R is each independently a hydroxy group or a methoxy group.

11. 10. The method according to claim 1, wherein R is a hydroxy group.

Images