Biotin-modified dimers and uses thereof

Abstract

The present invention addresses the problem of providing a novel halogenated biotin-modified dimer to enable imaging diagnosis or treatment. The present invention provides a compound represented by formula (1) or a salt thereof. (In the formula, L1 represents a trivalent linking group, L2 represents a divalent linking group, Hal represents a halogen element, p represents an integer of 1-5, and q, r, s, and t each independently represent an integer of 1-8.)

Description

[Technical field]

[0001] The present invention relates to a biotin-modified dimer and its use. [Background technology]

[0002] The affinity between avidin and biotin or between streptavidin and biotin is very high (Kd=10 -15 From 10 -14 M), which is one of the strongest interactions between biomolecules. Currently, the avidin / streptavidin-biotin interaction is widely used in the fields of biochemistry, molecular biology, and medicine. A drug delivery method and pretargeting method have been devised that combines the high binding ability of avidin / streptavidin and biotin with antibody molecules.

[0003] Chicken-derived avidin and microbial-derived streptavidin are highly immunogenic in the human body, and therefore, after administration to the human body, anti-avidin / streptavidin antibodies are produced early on, which is one of the reasons preventing the practical application of the pretargeting method. A low-immunogenic streptavidin has been reported to solve this problem (International Publication WO2010 / 095455).

[0004] Low-immunogenic streptavidin is characterized by its reduced immunogenicity in the human body. However, because it has an affinity for biotin present in the human body, there is a concern that in diagnostic applications, it may cause problems such as high background levels, and in therapeutic applications, it may not be able to exert a disease-specific therapeutic effect.

[0005] Thus, a streptavidin mutant with reduced affinity for natural biotin and a biotin modified substance having high affinity for this streptavidin mutant with low affinity for natural biotin have been reported (International Publication WO2014 / 129446). In addition, a streptavidin mutant with reduced affinity for natural biotin and a biotin modified dimer having high affinity for this streptavidin mutant with low affinity for natural biotin have been reported (International Publication WO2015 / 125820). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication WO2010 / 095455 [Patent Document 2] International Publication WO2014 / 129446 [Patent Document 3] International Publication WO2015 / 125820 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to provide a novel halogenated biotin-modified dimer that enables imaging diagnosis or therapy. Another aim of the present invention is to provide a diagnostic kit or therapeutic kit using the above biotin-modified dimer in combination with a streptavidin mutant. [Means for solving the problem]

[0008] Colorectal cancer has a high incidence rate and is on the rise. Even in stage IV cases, resection of distant metastases is considered, and combination chemotherapy and molecular targeted drugs are used, but no adjuvant therapy that is effective in improving life prognosis has been established. Many colorectal cancers express carcinoembryonic antigen (CEA), and radioimmunotherapy is possible using a specific anti-CEA antibody labeled with radioisotope (RI). In the present invention, a drug delivery system (Cupid-Psyche system) and the α-particle-emitting nuclide astatine-211 ( 211 The present invention aims to provide a new radiopharmaceutical and companion diagnostic agent for the treatment of intractable cancers by combining the radiopharmaceutical and the radioisotope-specific agonist, β-At, with a radioisotope-specific agonist, β-At, and a radioisotope-specific agonist, β-At, for the treatment of intractable cancers.

[0009] The Cupid-Psyche system is a pretargeting radioimmunotherapy that utilizes modified biotin (Psyche) and tetrameric streptavidin (Cupid)-conjugated monoclonal antibodies, which was developed based on molecular dynamics simulations using a supercomputer.

[0010] In an embodiment of the present invention, 211 We developed a therapy that efficiently delivers At to colorectal cancer using the Cupid-Psyche system. 211 By using At-labeled Psyche, we confirmed the targeting of Cupid-binding scFv antibodies to colon cancer cells. 211 The stability of At-labeled Psyche and its binding to Cupid-binding scFv antibody were confirmed. 211 The present invention was completed based on the above findings.

[0011] That is, according to the present invention, the following inventions are provided. <1> A compound represented by the following formula (1) or a salt thereof: [ka] (In the formula, L 1 represents a trivalent linking group, L 2 represents a divalent linking group, Hal represents a halogen element. p represents an integer from 1 to 5; q, r, s and t each independently represent an integer of 1 to 8. <2> L 1 but, [ka] 2. The compound according to claim 1, or a salt thereof, <3> L2 is a divalent linking group consisting of a combination of groups selected from -CONH-, -NHCO-, -COO-, -OCO-, -CO-, -O-, and an alkylene group having 1 to 10 carbon atoms; <1> or <2> 2. The compound or a salt thereof according to claim 1 . <4> A compound represented by the following formula (2) or a salt thereof: <1> from <3> 1. The compound or salt thereof according to any one of the above. [ka] (The meaning of each symbol in the formula is the same as in claim 1.) <5> Hal, I, 125 I, or 211 At, <1> from <4> 1. The compound or salt thereof according to any one of the above. <6> p is 1, <1> from <5> 1. The compound or salt thereof according to any one of the above. <7> The following compounds: [ka] <8> (1) <1> from <7> and (b) a streptavidin mutant-molecular probe conjugate obtained by binding a molecular probe to a streptavidin mutant having the amino acid sequence set forth in SEQ ID NO: 1 (provided that the amino acid sequence consisting of six histidines at the C-terminus may be partially or completely deleted) Effect of the Invention

[0012] The biotin-modified dimer according to the present invention and a kit containing the same are useful in diagnostic and therapeutic methods based on the pretargeting method. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 shows a schematic of the domain structure. [Diagram 2] FIG. 2 shows an SDS-PAGE CBB stained image of CEA-V2122. [Diagram 3] FIG. 3 shows the evaluation of the binding ability of CEA-Cupid with an antigen (CEACAM5). [Figure 4] FIG. 4 shows the evaluation of the binding performance of CEA-Cupid with modified biotin. [Diagram 5] FIG. 5 shows the biodistribution (%ID / g) of 125I-Cupid-scFv antibody. [Figure 6] FIG. 6 shows the accumulation (%ID / g) of 125I-Cupid-scFv antibody in tumor tissues. [Figure 7] FIG. 7 shows the accumulation amount (%ID) of 125I-Cupid-scFv antibody in the thyroid gland, the tumor-to-blood ratio, and the tumor-to-muscle ratio. [Figure 8] FIG. 8 shows the biodistribution (%ID / g) of Cupid-scFv antibody (24 h prior) + 211At-psyche-B. [Figure 9] FIG. 9 shows the accumulation (%ID) of Cupid-scFv antibody (24 hours before) + 211At-psyche-B in the thyroid gland, tumor-to-blood ratio, and tumor-to-muscle ratio. [Figure 10] FIG. 10 shows the biodistribution (%ID / g) of Cupid-scFv antibody (48 h before) + 211At-psyche-B. [Figure 11] FIG. 11 shows the accumulation (%ID) of Cupid-scFv (48 hours before)+211At-psyche-B in the thyroid gland, the tumor-to-blood ratio, and the tumor-to-muscle ratio. [Figure 12]FIG. 12 shows the biodistribution (%ID / g) of 211At-psyche-B. [Figure 13] FIG. 13 shows the accumulation (%ID) of 211At-psyche-B in the thyroid gland. [Figure 14] FIG. 14 shows the biodistribution (% ID / g) of Cupid-scFv (24 h before)+211At-psyche-BR. [Figure 15] FIG. 15 shows the accumulation (%ID) of Cupid-scFv (24 hours before)+211At-psyche-BR in the thyroid gland, the tumor-to-blood ratio, and the tumor-to-muscle ratio. [Figure 16] FIG. 16 shows the biodistribution (% ID / g) of Cupid-scFv (48 h before)+211At-psyche-BR. [Figure 17] FIG. 17 shows the accumulation (%ID) of Cupid-scFv (48 hours ago)+211At-psyche-BR in the thyroid gland, the tumor-to-blood ratio, and the tumor-to-muscle ratio. [Figure 18] FIG. 18 shows the biodistribution (%ID / g) of 211At-psycheBR. [Figure 19] FIG. 19 shows the accumulation (%ID) of 211At-psyche-BR in the thyroid gland. [Figure 20] FIG. 20 shows the change over time in mouse body weight (g) after Cupid-scFv-antibody+211At-psyche-BR treatment. [Figure 21] FIG. 21 shows the change in tumor volume (mm3) over time after Cupid-scFv-antibody+211At-psyche-BR treatment. [Figure 22] FIG. 22 shows the pharmacokinetics (%ID / g, 6h) of Cupid-scFv antibody (24h before) + 211At-psycheBR. [Figure 23] FIG. 23 shows the change in mouse body weight (g) over time. [Figure 24] FIG. 24 shows the change in tumor volume (mm3) over time. [Diagram 25]FIG. 25 shows the pharmacokinetics (%ID / g, 6h) of Cupid-scFv antibody (24h before) + 211At-psycheB. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The present invention will now be described in further detail. (1) Halogenated biotin-modified dimer The present invention relates to a compound represented by the following formula (1) or a salt thereof, and preferably to a compound represented by the following formula (2) or a salt thereof. The compound of the present invention is also called a "halogenated biotin modified dimer". [ka]

[0015] [ka]

[0016] L 1 represents a trivalent linking group, preferably [ka] and more preferably [ka] It is.

[0017] L 2 represents a divalent linking group. L 2 is preferably a divalent linking group consisting of a combination of groups selected from -CONH-, -NHCO-, -COO-, -OCO-, -CO-, -O-, and an alkylene group having 1 to 10 carbon atoms. L 2 is more preferably a divalent linking group consisting of a combination of groups selected from -CONH-, -NHCO-, -O-, and alkylene groups having 1 to 10 carbon atoms.

[0018] Hal represents a halogen element. Examples of the halogen element represented by Hal include fluorine (F), chlorine (Cl), bromine (Br), iodine (I), astatine (At), tennessine (Ts), and isotopes thereof, and preferably iodine, astatine, and isotopes thereof. The halogen element is preferably 123 I, 124 I, 125 I, 131 I, 210 At, 211 Among the above, I, At, etc. 123 I, 124 I, 125 I, 131 I, 211 At is preferred. Hal is particularly preferably I, 125 I, or 211 At.

[0019] p represents an integer of 1 to 5, preferably an integer of 1 to 3, and particularly preferably 1.

[0020] q, r, s and t each independently represent an integer of 1 to 8, preferably independently represent an integer of 1 to 6, more preferably independently represent an integer of 3 to 6, and particularly preferably represent 4 or 5.

[0021] Specific examples of the compound of the present invention include the following compounds. [ka]

[0022] (2) Method for producing halogenated biotin modified dimer The halogenated biotin modified dimer of the present invention can be prepared by adding sodium halide (sodium iodide, Na ) dissolved in methanol to a mixed solution of N-bromo-succinimide in methanol and acetic acid, as described in the Examples below. 125 I, etc.) or halogen ( 211At) is added and stirred, and then a compound represented by the following formula (A) dissolved in methanol is added and reacted to produce the compound.

[0023] The amount of N-bromo-succinimide added is preferably 0.1 to 1.0 equivalent, more preferably 0.1 to 0.5 equivalent, and further preferably 0.1 to 0.3 equivalent. The amount of N-bromo-succinimide added is preferably greater than the amount (equivalent) of sodium halide or halogen added, but if the amount of N-bromo-succinimide added is too large, there is a concern that the compound represented by formula (A) may decompose, so it is preferable to adjust the amount to an appropriate amount.

[0024] [ka]

[0025] (The meaning of each symbol in the formula is the same as that in formula (1).)

[0026] (3) Use of biotin-modified dimers According to the present invention, there is provided a therapeutic or diagnostic agent which combines the modified biotin dimer of the present invention with a streptavidin mutant-molecular probe conjugate.

[0027] As the streptavidin mutant, the streptavidin mutants described in International Publication WO2014 / 129446 and International Publication WO2015 / 125820 can be used. Particularly preferably, the streptavidin mutant V2122 described in Example 3 of International Publication WO2015 / 125820 (SEQ ID NO: 4 of International Publication WO2015 / 125820) can be used.

[0028] Examples of molecular probes include antibodies, peptides, nucleic acids, aptamers, etc., and specifically, antibodies, peptides, nucleic acids, aptamers, etc. that target the following antigens that are specifically expressed in cancer can be used.

[0029] Epiregulin, ROBO1,2,3,4, 1-40-β-amyloid, 4-1BB, 5AC, 5T4, ACVR2B, adenocarcinoma antigen, α-fetoprotein, angiopoietin 2, anthrax toxin, AOC3 (VAP-1), B-lymphoma cells, B7-H3, BAFF, β-amyloid, C242 antigen, C5, CA-125, carbonic anhydrase 9 (CA-IX), cardiac myosin, CCL11 (eotaxin-1), CCR4, CCR5, CD11, CD18, CD125, CD140a, CD147 (basigin), CD147 (basigin), CD15, CD152, CD154 (CD40L), CD154, CD19, CD2, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD25 (α chain of IL-2 receptor), CD28, CD3, CD30 (TNFRSF8), CD33, CD37, CD38 (cyclic ADP-ribose hydrolase), CD4, CD40, CD41 (integrin α-IIb), CD44 v6, CD5, CD51, CD52, CD56, CD6, CD70, CD74, CD79B, CD80, CEA, CFD, ch4D5, CLDN18.2, Clostridium difficile, clumping factor A, CSF2, CTLA-4, cytomegalovirus, cytomegalovirus glycoprotein B, DLL4, DR5, E. coli Shiga toxin type 1, E. coli Shiga toxin type 2, EGFL7, EGFR, endotoxin, EpCAM, episialin, ERBB3, Escherichia coli, F protein of respiratory syncytial virus, FAP, fibrin II beta chain, fibronectin extra domain-B, folate receptor 1, Frizzled receptor, GD2, GD3 ganglioside, GMCSF receptor alpha chain, GPNMB, hepatitis B surface antigen, hepatitis B virus, HER1, HER2 / neu, HER3, HGF, HIV-1, HLA-DR beta, HNGF,Hsp90, human beta amyloid, human scatter factor receptor kinase, human TNF, ICAM-1 (CD54), IFN-α, IFN-γ, IgE, IgE Fc domain, IGF-1 receptor, IGF-I, IgG4, IGHE, IL-1β, IL-12, IL-13, IL-17, IL-17A, IL-22, IL-23, IL-4, IL-5, IL-6, IL-6 receptor, IL-9, ILGF2, influenza A hemagglutinin, insulin-like growth factor I receptor, integrin α4, integrin α4β7, integrin α5β1, integrin α7 β7, integrin αIIbβ3, integrin αvβ3, integrin γ-inducing protein, interferon receptor, interferon α / β receptor, ITGA2, ITGB2 (CD18), KIR2D, L-selectin (CD62L), Lewis-Y antigen, LFA-1 (CD11a), lipoteichoic acid, LOXL2, LTA, MCP-1, mesothelin, MS4A1, MUC1, mucin CanAg, myostatin, N-glycolylneuraminic acid, NARP-1, NCA-90 (granulocyte antigen), NGF, NOGO-A, NRP1, Oryctolagus cuniculus, OX-40, oxLDL, PCSK9, PD-1, PDCD1, PDGF-R α, phosphatidylserine, prostate cancer cells, Pseudomonas aeruginosa, rabies virus glycoprotein, RANKL, respiratory syncytial virus, RHD, Rh (Rhesus) factor, RON, RTN4, sclerostin, SDC1, Selectin P, SLAMF7, SOST, sphingosine-1-phosphate, TAG-72, TEM1, tenascin-C, TFPI, TGFβ1, TGFβ2, TGF-β, TNF-α, TRAIL-R1, TRAIL-R2, tumor antigen CTAA16.88, tumor-specific glycosylation of MUC1, TWEAK receptor, TYRP1 (glycoprotein 75), VEGF-A, VEGFR-1, VEGFR2, vimentin, VWF,

[0030] A fusion of a molecular probe such as a cancer antigen-specific antibody molecule with a streptavidin mutant is prepared and administered to a patient, thereby allowing the streptavidin mutant to accumulate specifically in cancer cells. Next, the halogenated biotin modified dimer of the present invention having affinity for the streptavidin mutant is administered to a patient, allowing halogen to accumulate precisely in cancer cells. In the present invention, antibody production is suppressed by reducing immunogenicity, and early clearance from the body due to antibodies and shock such as anaphylactic shock can be prevented. In addition, in the present invention, by using tissues, serum, etc. collected from a patient as an in vitro diagnostic agent or clinical test agent, noise derived from biotin or biotin-binding proteins present in tissues, serum, etc. is reduced, enabling diagnosis and testing with a higher S / N ratio.

[0031] Alternatively, in the present invention, a conjugate can be prepared by binding a fusion of a molecular probe, such as a cancer antigen-specific antibody molecule, with a streptavidin mutant to the halogenated biotin-modified dimer of the present invention, and the conjugate can be administered to a patient.

[0032] Various molecules can be used as the antibody to be bound to the streptavidin mutant. Either polyclonal or monoclonal antibodies can be used. The subclass of the antibody is not particularly limited, but IgG, particularly IgG, is preferred. 1 The term "antibody" includes all modified antibodies and antibody fragments, including humanized antibodies, human-type antibodies, human antibodies, antibodies derived from various animals such as mice, rabbits, rats, guinea pigs, and monkeys, chimeric antibodies of human antibodies and antibodies derived from various animals, diabodies, scFv, Fd, Fab, Fab', and F(ab)'. 2 These include, but are not limited to:

[0033] A conjugate of a streptavidin mutant and an antibody can be obtained by a method known to those skilled in the art. For example, it can be obtained by a chemical binding method (US Pat. No. 5,608,060), or it can be obtained as a fusion protein by linking a DNA encoding a streptavidin mutant with a DNA encoding an antibody and expressing it in a host cell using an expression vector or the like. The link between the DNA encoding a streptavidin mutant and the DNA encoding an antibody may be mediated by a DNA encoding a suitable peptide called a linker. It is desirable that a streptavidin mutant-antibody conjugate is prepared while retaining the specific binding ability between the antibody and the target molecule.

[0034] The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples. EXAMPLES

[0035] <Synthesis of modified biotin dimer compounds> <General method> Nuclear magnetic resonance (NMR) spectra were recorded using a JEOL ECX500 ( 1 H NMR: 500MHz), or JEOL ECS400( 1 H NMR: 400 MHz) spectrometer. Chemical shifts are reported in ppm relative to the residual solvent peak in a deuterated solvent as an internal reference (CDCl 3 : δ = 7.26 ppm, CD 3 OD: δ = 3.31 ppm. Low-resolution mass spectra (LRMS) were measured using ESI-MS on a Shimadzu LCMS-2020 system. Reactions were monitored by thin-layer chromatography (TLC) or low-resolution mass spectrometry (LRMS).

[0036] Reverse-phase high-performance liquid chromatography (HPLC) was performed using a JASCO-HPLC system. Detection was performed using 254 nm UV light, and a gradient solvent system (acetonitrile / 0.1% trifluoroacetic acid MQ solution or 0.1% formic acid MQ solution) was used as the mobile phase. For analysis, a YMC-Triart-C18 (150 mm×4.6 mm ID) column was used at a flow rate of 1 mL / min. For preparative analysis, a YMC-Triart-C18 (250 mm×10 mm ID or 150 mm×4.6 mm ID) column was used at a flow rate of 6.3 mL / min for the former and 1 mL / min for the latter.

[0037] Methyl 5-((2S,3S,4R)-3,4-diaminotetrahydrothiophen-2-yl)pentanoate hydrobromide (2) [ka]

[0038] Biotin 1 (5 g, 20.4 mmol) was added to 47% aqueous hydrogen bromide solution (24 ml), and the mixture was stirred under reflux at 150 °C for 90 h under an argon atmosphere, after which the solvent was removed under reduced pressure, and the resulting crude product 2 was used in the next reaction without further purification.

[0039] 5-((2S,3S,4R)-3,4-Bis((tert-butoxycarbonyl)amino)tetrahydrothiophen-2-yl)pentanoic acid (3) [ka]

[0040] Di-tert-butyl dicarbonate (12.8 g, 61.3 mmol) was added to a mixture of crude product 2 (20.4 mmol) in 1,4-dioxane (100 ml) and 1 M aqueous NaOH solution (100 ml) at room temperature. The mixture was stirred at room temperature for 22 hours under an argon atmosphere. After removing the solvent under reduced pressure, 1 M aqueous HCl was added, extracted with chloroform, and the organic layer was washed with saturated saline. After drying over sodium sulfate, the solvent was removed under reduced pressure. The obtained crude product 3 was used in the next reaction without further purification.

[0041] Di-tert-butyl ((2S,3S,4R)-2-(4-aminobutyl)tetrahydrothiophene-3,4-diyl)dicarbamate (4) [ka]

[0042] To a solution of crude product 3 (471 mg, 1.13 mmol) in toluene (6 ml) was added N,N-diisopropylethylamine (293 μl, 1.70 mmol) and diphenylphosphoryl azide (367 μl, 1.70 mmol) at room temperature, and the mixture was stirred at 85 °C for 3 hours and 40 minutes under an argon atmosphere. N,N-diisopropylethylamine (98 μl, 0.73 mmol) and diphenylphosphoryl azide (122 μl, 0.73 mmol) were further added, and the mixture was stirred at 85 °C for 1 hour. The mixture was cooled to room temperature, and THF (7 ml) and 2 M NaOH aqueous solution (4 ml) were added, and the mixture was stirred at room temperature for 13 hours, and the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel chromatography (chloroform / methanol=95:5 → 75:25 → 65:35) to obtain the target compound 4 (151 mg, yield 34%, 3 steps). 1 H NMR (500 MHz, CDCl 3) δ:1.28-1.72 (m, 24H), 2.47 (t, J = 10.3 Hz, 1H), 2.66 (t, J = 7.4 Hz, 2H), 3.16-3.28 (m, 1H), 3.44-3.60 (m, 1H), 4.16-4.40 (m, 2H), 4.72-4.88 (m, 1H), 4.90-5.08 (m, 1H). LRMS (ESI): m / z 390.95 [M+H] + .

[0043] Benzyl 7-((4-((2S,3S,4R)-3,4-bis((tert-butoxycarbonyl)amino)tetrahydrothiophen-2-yl)butyl)amino)-7-oxoheptanoate(5) [ka]

[0044] Compound 4 (129.4 mg, 0.33 mmol) and 7-(benzyloxy)-7-oxoheptanoic acid (Reference 1) (150 mg, 0.599 mmol) were dissolved in dichloromethane (5 ml) and triethylamine (115 μl, 0.825 mmol) and EDCI (157 mg, 0.825 mmol) were added at room temperature. The mixture was stirred at room temperature for 18 hours under an argon atmosphere. After removing the solvent under reduced pressure, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate water, saturated ammonium chloride aqueous solution, and saturated saline, respectively. After drying with sodium sulfate, the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel chromatography (chloroform / methanol = 100:0 → 95:5) to obtain the target compound 5 (126 mg, 61% yield). 1 H NMR (500 MHz, CDCl 3) δ:1.26-1.70 (m, 30H), 2.15 (t, J = 6.9 Hz, 2H), 2.36 (t, J = 7.4 Hz, 2H),2.46 (t, J = 9.7 Hz, 1H), 3.11-3.29 (m, 3H), 3.41-3.53 (m, 1H), 4.16-4.27 (m, 1H), 4.28-4.36 (m, 1H), 4.72-4.81 (m, 1H),4.89-4.98 (m, 1H), 5.11 (s, 2H), 5.55-5.65 (m, 1H), 7.28-7.40 (m, 5H). LRMS (ESI): m / z 644.10 [M+Na] + .

[0045] Benzyl 7-((4-((2S,3S,4R)-3,4-diaminotetrahydrothiophen-2-yl)butyl)amino)-7-oxoheptanoate trifluoroacetate(6) [ka]

[0046] To a solution of compound 5 (126 mg, 0.203 mmol) in dichloromethane (4 ml) was added trifluoroacetic acid (1 ml) at room temperature. The mixture was stirred at room temperature for 2 hours under an argon atmosphere. After removing the solvent under reduced pressure, azeotropic distillation with toluene was performed three times, and trifluoroacetic acid was removed under reduced pressure. The crude product 6 was used in the next reaction without further purification.

[0047] Benzyl 7-((4-((3aS,4S,6aR,E)-2-((tert-butoxycarbonyl)imino)hexahydro-1H-thieno[3,4-d]imidazol-4-yl)butyl)amino)-7-oxoheptanoate(7) [ka]

[0048] To a mixture of compound 6 (0.203 mmol) in 1,4-dioxane (2 ml) and triethylamine (141 μl, 1.02 mmol), Goodman's reagent (83.4 mg, 0.213 mmol) dissolved in 1,4-dioxane (1.5 ml) was added at room temperature. The mixture was stirred at 50 °C for 2 hours under an argon atmosphere, and the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel chromatography (chloroform / methanol = 100:0 → 93:7) to obtain the target compound 7 (yield quant., 2 steps). 1 H NMR (500 MHz, CDCl 3 ) δ:1.22-1.78 (m, 21H), 2.15 (t, J = 7.4 Hz, 2H), 2.35 (t, J = 7.4 Hz, 2H), 2.88 (d, J = 13.2 Hz, 1H), 3.01 (dd, J = 4.6 Hz, 13,2 Hz, 1H), 3.10-3.20 (m, 1H), 3.21-3.28 (m, 1H), 3.29-3.38 (m, 1H), 4.60 (dd, J = 4.6 Hz, 8.6 Hz, 1H), 4.79 (dd, J = 4.6 Hz, 8.0 Hz, 1H), 5.10 (s, 2H), 7.30-7.40 (m, 5H). LRMS (ESI): m / z 547.25 [M+H] + .

[0049] 7-((4-((3aS,4S,6aR,E)-2-((tert-Butoxycarbonyl)imino)hexahydro-1H-thieno[3,4-d]imidazol-4-yl)butyl)amino)-7-oxoheptanoic acid(8) [ka]

[0050] Lithium hydroxide hydrate (21.3 mg, 0.51 mmol) was added to a mixture of compound 7 (0.203 mmol) in methanol (3 ml) and water (1.5 ml) at room temperature. The mixture was stirred at 50 °C for 1 hour and 20 minutes under an argon atmosphere, and the solvent was removed under reduced pressure. A saturated aqueous solution of ammonium chloride was added, and the mixture was extracted with chloroform. After drying with sodium sulfate, the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel chromatography (chloroform / methanol = 99:1 → 85:15 → 80:20 → 75:25) to obtain the target compound 8 (83.2 mg, yield 89%, white solid). 1 H NMR (500 MHz, CD 3 OD) δ:1.26-1.87 (m, 21H), 2.19 (t, J = 6.8 Hz, 2H), 2.22 (t, J = 7.4 Hz, 2H), 2.89 (d, J = 13.2 Hz, 1H),3.02 (dd, J = 4.6 Hz, 13.2 Hz, 1H), 3.10-3.29 (m, 3H), 4.53 (dd, J = 4.6 Hz, 8.0 Hz, 1H), 4.76 (dd, J = 4.6 Hz, 8.6 Hz, 1H). LRMS (ESI): m / z 457.85 [M+H] + .

[0051] Di-tert-butyl (5-((3-oxo-1-phenyl-2,7,10-trioxa-4-azadodecan-12-yl)carbamoyl)-1,3-phenylene)dicarbamate(10) [ka]

[0052] Compound 9 (reference 2) (450 mg, 1.28 mmol) in methanol (5 ml) was added to benzyl (2-(2-(2-aminoethoxy)ethoxy)ethyl)carbamate (reference 3) (646 mg, 2.29 mmol) and 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM, 530 mg, 1.92 mmol) at room temperature. The mixture was stirred at room temperature for 115 hours under an argon atmosphere, and the solvent was removed under reduced pressure. After that, 1 M HCl aqueous solution was added, extracted with ethyl acetate, and the organic layer was washed with saturated sodium bicarbonate water and saturated saline, respectively. After drying with sodium sulfate, the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel chromatography (chloroform / methanol = 96:4) to obtain the target compound 10 (273 mg, yield 35%, yellow solid). 1 H NMR (400 MHz, CDCl 3 ) δ:1.49 (s, 18H), 3.32-3.47 (m, 2H), 3.54-3.70 (m, 10H), 5.07 (s, 2H), 5.36-5.47 (m, 1H), 6.68-6.86 (m, 2H), 6.88-6.98 (m, 1H), 7.28-7.40 (m, 5H), 7.42-7.51(m, 2H), 7.67-7.77 (m, 1H). LRMS (ESI): m / z 617.05 [M+H] + .

[0053] Benzyl (2-(2-(2-(3,5-diaminobenzamido)ethoxy)ethoxy)ethyl)carbamate trifluoroacetate(11) [ka]

[0054] To a solution of compound 10 (86.8 mg, 0.14 mmol) in dichloromethane (4.5 ml) was added trifluoroacetic acid (0.5 ml) at room temperature. The mixture was stirred at room temperature for 4 hours under an argon atmosphere, and the solvent was removed under reduced pressure. Toluene azeotropy was performed twice, and trifluoroacetic acid was removed under reduced pressure. The crude product 11 was used in the next reaction without further purification.

[0055] tert-butyl ((3aS,4S,6aR,E)-4-(4-(7-((3-(7-((4-((3aS,4S,6aR,Z)-2-((tert-butoxycarbonyl)imino)hexahydro-1H-thieno[3,4-d]imidazol-4-yl)butyl)amino)-7-oxoheptanamido)-5-((3 -oxo-1-phenyl-2,7,10-trioxa-4-azadodecan-12-yl)carbamoyl)phenyl)amino)-7-oxoheptanamido)butyl)tetrahydro-1H-thieno[3,4-d]imidazol-2(3H)-ylidene)carbamate(12) [ka]

[0056] To a mixture of compound 11 (37.9 mg, 58.8 μmol) and compound 8 (67.3 mg, 147 μmol) in DMF (1 ml) and triethylamine (65.6 μl, 470 μmol), 1-Hydroxy-7-azabenzotriazole (HOAt, 32 mg, 235 μmol) and 1-[Bis(dimethylamino)methyliumyl]-1H-1,2,3-triazolo[4,5-b]pyridine-3-oxidehexafluorophosphate (HATU, 89.4 mg, 235 μmol) were added at room temperature. The mixture was stirred at room temperature for 16 hours under an argon atmosphere. After removing the solvent under reduced pressure, water was added and the mixture was extracted with chloroform. After drying over sodium sulfate, the solvent was removed under reduced pressure. The resulting residue was roughly purified by silica gel chromatography (chloroform / methanol = 97:3 → 75:25 → 40:60) to give a crude product containing the target compound 12 (20.5 mg). 1 H NMR (400 MHz, CD 3 OD) δ1.21-1.90 (m, 42H), 2.19 (t, J = 7.2 Hz, 4H), 2.37 (t, J = 7.2 Hz, 4H), 2.92 (d, J = 13.0 Hz, 2H), 3.01 (dd, J = 4.5 Hz, 13.1 Hz, 2H), 3.05-3.67 (m, 18H), 4.51-4.60 (m, 2H), 4.75-85 (m, 2H), 5.03 (s, 2H), 7.23-7.36 (m, 5H), 7.67-7.73 (m, 2H), 7.98-8.05(m, 1H). LRMS (ESI): m / z 647.90 [M+2H] 2+ .

[0057] N1,N1'-(5-((2-(2-(2-Aminoethoxy)ethoxy)ethyl)carbamoyl)-1,3-phenylene)bis(N7-(4-((3aS,4S,6aR)-2-iminohexahydro-1H-thieno[3,4-d]imidazol-4-yl)butyl)heptanediamide) 2,2,2-trifluoroacetate(13) [ka]

[0058] To a solution (150 μl) of compound 12 (20.5 mg, 15.8 μmol), trifluoroacetic acid (3 ml) was added at room temperature. The mixture was stirred at room temperature for 14 hours and 30 minutes under an argon atmosphere, and the solvent was removed under reduced pressure. The resulting crude product was purified by reversed-phase HPLC (gradient: 0% for 5 min; 2-100% for 90 min CH 3 CN in 0.1% CF 3 The product was purified using a COOH aqueous solution (retention time: 35.2 min, YMC-Triart C18, flow rate = 3.5 ml / min) to give the target compound 13 (8.3 mg, 11% yield, 2 steps). 1 H NMR (400 MHz, CD 3OD) δ:1.35-1.81 (m, 24H), 2.20 (t, J = 7.6 Hz, 4H), 2.39 (t, J = 7.2 Hz, 4H), 2.81 (d, J = 13.5 Hz, 2H), 2.98 (dd, J = 4.9 Hz, 13.0 Hz, 2H), 3.07-3.17 (m, 4H), 3.18-3.28 (m, 4H), 3.57 (t, J = 6.3 Hz, 2H), 3.64-3.72 (m, 8H), 4.50 (dd, J = 4.5 Hz, 8.1 Hz, 2H), 4.71 (dd, J = 4.5 Hz, 8.1 Hz, 2H), 7.76 (d, J = 2.2 Hz, 2H), 7.90 (t, J = 1.8 Hz, 1H). LRMS (ESI): m / z 320.65 [M+3H] 3+ .

[0059] N1,N1'-(5-((2-(2-(2-(3-(Trimethylstannyl)benzamido)ethoxy)ethoxy)ethyl)carbamoyl)-1,3-phenylene e)bis(N7-(4-((3aS,4S,6aR)-2-iminohexahydro-1H-thieno[3,4-d]imidazol-4-yl)butyl)heptanediamide) formate(15) [ka]

[0060] Compound 14 (Reference 4) (1.9 mg, 5.0 μmol) and triethylamine (9.5 μl, 68 μmol) were added to a solution of compound 13 (5.9 mg, 4.5 μmol) in DMF (400 μl) at room temperature. The mixture was stirred at room temperature for 3 hours and 30 minutes under an argon atmosphere, and the solvent was removed under reduced pressure. The resulting crude product was purified by reverse phase HPLC (gradient: 0% for 5 min; 2-100% for 90 min CH 3Purification was performed using CN in 0.1% HCOOH aqueous solution, retention time: 40.5 min, YMC-Triart C18, flow rate = 3.5 ml / min) to obtain target compound 15 (3.4 mg, yield 57%). LRMS (ESI): m / z 614.10 [M+2H] 2+ .

[0061] References 1.Su, Z.; Yeagley, AA; Su, R.; Peng, L.; Melander, C. ChemMedCmem 2012, 7, 2030-2039 2.Roy, BC; Malik, SJ Org. Chem. 199, 64, 2969-2974. 3.Thoma, G.; Streiff, MB; Katapodis, AG; Duthaler, RO; Voelcker, NH; Ehrhardt, C.; Masson, C. Chem.-Eur. J. 2006, 12, 99-117. 4.GE HEALTHCARE LIMITED, Michelle, A.;Jane, B.; Peter, BI WO2010 / 86398, 2010, A1.

[0062] < 211 At sign > N-Bromosuccinimide (0.00271 mg, 0.152 μmol) was dissolved in methanol (100 μl) and acetic acid (1 μl). 211 After adding At (10-150 MBq) and stirring at room temperature for 1 min, bis-iminobiotin (compound 15) (0.1 mg, 0.076 μmol) dissolved in methanol (100 μl) was added and stirred at room temperature for 10 min. The reaction solution was diluted with 800 μl of water and analyzed by reverse phase HPLC (20% for 2 min; 20-70% for 20 min CH 3 CN in 0.1% CF 3COOH aqueous solution, retention time = 9.7 min, YMC-Triart C18, flow rate = 4.7 ml / min) 211 Compound 23 ( 211 We obtained the following results:

[0063] 211 Compound 23 ( 211 Structure of At-psycheBR: [ka]

[0064] 211 About At-psycheB Compound 24, having the structure below, was synthesized as described in Example 1 of International Publication WO2019 / 230905. Structure of compound 24 (Bisiminobiotin 24 (Psyche-B-ATE)): [ka]

[0065] < 211 At sign > N-Bromosuccinimide (0.00271 mg, 0.152 μmol) was dissolved in methanol (100 μl) and acetic acid (1 μl). 211 After adding At (10-150 MBq) and stirring at room temperature for 1 min, bis-iminobiotin (compound 24) (0.1 mg, 0.076 μmol) dissolved in methanol (100 μl) was added and stirred at room temperature for 10 min. The reaction solution was diluted with 800 μl of water and analyzed by reverse phase HPLC (20% for 2 min; 20-70% for 20 min CH 3 CN in 0.1% CF 3 COOH aqueous solution, retention time = 9.7 min, YMC-Triart C18, flow rate = 4.7 ml / min)211 Compound 25 labeled with At ( 211 also denoted as At-psyche-B) was obtained.

[0066] 211 Compound 25 labeled with At ( 211 At-Psyche-B) structure:

Chemical formula

[0067] To the recovered solutions of Compounds 23 and 25 recovered by reverse-phase HPLC, a 0.1% TFA solution was added and diluted 2-fold, and then passed through a Sep-Pak solid-phase extraction column (Sep-pak C18 light, manufactured by Waters). 6 mL of a 0.5% sodium ascorbate solution was passed through to wash away unnecessary solvents and contaminants from the Sep-Pak column, and the compounds were recovered with 1 mL of a PBS solution containing 50% ethanol, 0.5% acetic acid, and 0.5% sodium ascorbate.

[0068] <Preparation of Cupid-scFv antibody> (1) Expression and purification of CEA-V2122 protein (also referred to as Cupid-scFv antibody) V2122 is a streptavidin mutant described in Example 3 of International Publication WO2015 / 125820 (SEQ ID NO: 4 of International Publication WO2015 / 125820). The amino acid sequence of V2122 (the sequence having a 6×His tag at the C-terminus) is described in SEQ ID NO: 1 in the Sequence Listing.

[0069] scFv-V2122 is a product obtained by binding a single-chain antibody (scFv) against CEACAM5 to the above-mentioned V2122. This scFv-type anti-CEACAM5 antibody has the scFv sequence described in Patent Document US7626011B2. The amino acid sequence of the scFv-type anti-CEACAM5 antibody is described in SEQ ID NO: 2 in the Sequence Listing. Also, the amino acid sequence of CEA-V2122 in which the scFv-type anti-CEACAM5 antibody and V2122 are linked by an amino acid linker (GGGGSGGGG) (SEQ ID NO: 7) is described in SEQ ID NO: 3 in the Sequence Listing.

[0070] To express the CEA-V2122 fusion protein, a pelB signal for secretion expression in E. coli was inserted at the N-terminus, and a 6xHis-Tag sequence was inserted at the C-terminus. The DNA codons of the CEA-V2122 gene sequence were optimized for E. coli, and an artificial gene was synthesized. The amino acid sequence is shown in SEQ ID NO: 4, and the DNA sequence is shown in SEQ ID NO: 5. The domain structure is shown in FIG. 1.

[0071] A specific protein expression vector used was a vector in which the chaperone skp gene was incorporated into MCS2 of the pETDuet1 vector. The skp gene was synthesized by artificial gene synthesis of DNA with codons optimized for E. coli based on the amino acid sequence described in SEQ ID NO:6 in the sequence listing. The synthesized skp gene was amplified by PCR using primers (AAGGAGATATACATATGGATAAAATTGCCATTGTTAATAT (SEQ ID NO:8), TTGAGATCTGCCATATGTTATTTCACTTGTTTCAGAACG (SEQ ID NO:9)), and cloned into MCS2 of the pETDue1 vector linearized with the restriction enzyme NdeI using the In-Fusion HD Cloning Kit to create pETDuet_skp. Next, the CEA-V2122 gene was incorporated into MCS1 of pETDuet_skp. Specifically, the artificially synthesized CEA-V2122 gene was amplified by PCR using primers (AGAAGGAGATATACCATGAAATATCTGCTGCCGAC (SEQ ID NO: 10), CGCCGAGCTCGAATTTTAATGATGGTGATGATGATG (SEQ ID NO: 11)). In addition, pETDuet_skp was linearized by PCR using primers (GGTATATCTCCTTCTTAAAGTTAAAC (SEQ ID NO: 12), AATTCGAGCTCGCGCCTGCAG (SEQ ID NO: 13)). The PCR-amplified CEA-V2122 and the linearized pETDuet_skp were cloned using the In-Fusion HD Cloning Kit. The cloned vector was sequenced to confirm the incorporated gene sequence, and named pETDuet_CEA-V2122_skp.

[0072] For protein expression, pETDuet_CEA-V2122_skp was transformed into BL21(DE3) (Nippon Gene) and pre-cultured in 2xYT medium (SIGMA-ADLRICH) at 37℃ overnight. The pre-cultured medium was added to fresh medium at a 100-fold dilution, and cultured at 37℃ until OD(600nm) = 0.5-2.0. IPTG was then added to a final concentration of 0.5mM, and cultured at 37℃ for 4 hours. The culture supernatant was collected and stored at 4℃.

[0073] CEA-V2122 protein was crudely purified by batch method using 6xHis-Tag added to the C-terminus. Specifically, cOmplete His-Tag Purification Resin equilibrated with Buffer A (50mM TrisHCl, 0.2M NaCl, 1mM EDTA, 5mM imidazole, pH8.0) was added to the culture supernatant stored at 4℃, and the protein was bound to the resin by stirring at 4℃ for 2 hours to overnight. The resin was then collected in a column and washed with 20 column volumes of Buffer A. The crude CEA-V2122 was then eluted with Buffer B (50mM TrisHCl, 0.2M NaCl, 1mM EDTA, 400mM imidazole, pH8.0) and collected.

[0074] Next, the crude product was purified using a Protein L column. Specifically, 1 mL of Capto L (GE Healthcare Life Sciences) was packed into a PD-10 column, equilibrated with 10 column volumes of PBS, and the crude product was applied. After washing with 10 column volumes of PBS, the crude product was eluted with 10 mM glycine hydrochloride pH 2.0 and centrifuged using a Vivaspin Turbo 15 (MWCO 100,000). The buffer was then replaced with PBS using a PD-10 (GE Healthcare Life Sciences), and centrifuged using a Vivaspin Turbo 4 (MWCO 100,000) to obtain the final purified product. After SDS-PAGE electrophoresis, the purity of the tetramer CEA-V2122 was examined by CBB staining, and the results are shown in Figure 2. The SDS-PAGE gel used was Mini-PROTEAN TGX 4-15% (Bio-Rad), and the CBB staining solution used was Bullet CBB Stain One (Ready To Use) (Nacalai Tesque). As shown in FIG. 2, it was confirmed that the purified CEA-V2122 was mainly composed of a tetramer of approximately 150 kDa.

[0075] (2) Performance evaluation of CEA-V2122 in SPR The affinity between CEA-V2122 and the antigen CEACAM5 was measured using a surface plasmon resonance (SPR) measurement device: Biacore T200 (GE Healthcare Life Sciences). Specifically, Recombinant Human CEACAM-5 / CD66e Protein, CF (R&D SYSTEMS) was immobilized on Sensor Chip CM5 (GE Healthcare Life Sciences) using an amine coupling kit (GE Healthcare Life Sciences), and the final immobilized amount of ligand was 279 RU. In addition, purified CEA-V2122 was adjusted as an analyte in a 2-fold dilution series from 1E-08 M to 6.25E-10 M. Data was obtained by Single-Cycle Kinetics analysis for interaction analysis. The obtained data was subjected to curve fitting using the Biacore T200 Evaluation Software, version 2.0 in the Bivalent Analyze mode, and the values ​​of ka1 = 3.208E+5 and kd1 = 3.461E-7 were obtained. D =kd1 / ka1, so K D The evaluation value obtained was = kd1 / ka1 = 3.461E-7 / 3.208E+5 = 1.078E-12. The results are shown in Figure 3. The sensorgrams shown in Fig. 3, K D The values ​​confirmed that CEA-V2122 strongly bound to CEACAM5.

[0076] In addition, the interaction analysis between CEA-V2122 and biotin modified products was also carried out using Biacore T200. The specific biotin modified product is the title compound 14 described in Example 1 of International Publication WO2018 / 07239. The specific analysis method is as follows. The purified CEA-V2122 was immobilized on Sensor Chip CM5 using an amine coupling kit with a target value of 5000RU. Five types of 2-fold dilution series of analyte concentrations from 1E-08 M to 6.25E-10 M were used. Data was acquired by Single-Cycle Kinetics analysis for the interaction analysis. Curve fitting was performed on the obtained data using the Bivalent Analyze mode in Biacore T200 Evaluation Software, version 2.0, and values ​​of ka1=3.792E+4 and kd1=4.424E-6 were obtained. In addition, in Bivalent Analyze, K D =kd1 / ka1, so K D The evaluation value obtained was = kd1 / ka1 = 3.792E+4 / 4.424E-6 = 1.167E-10. The results are shown in Figure 4. The sensorgram shown in FIG. D From these values, it was confirmed that CEA-V2122 strongly binds to the modified biotin.

[0077] < 125 Cupid labeled with I 125 I-labeled Cupid was prepared as follows. In a reaction vessel containing 38.2 μg of N-succinimidyl 3-trimethylstannyl-benzoate (ATE, Toronto Research Chemicals, North York, Canada), 11 μL of a methanol solution of N-chlorosuccinimide (1 mg / mL), 12 μL of Na 125 Solution I (23.2 MBq) and 41 μL of 1% acetic acid / methanol were added and stirred at room temperature for 45 minutes.

[0078] The reaction solution was mixed with 40 μL of ultrapure water and then purified by reversed-phase HPLC (mobile phase A: 1% CF 3 COOH / water, mobile phase B: 1%CF 3 COOH / MeCN; Mobile phase B 40-60% (20 min), retention time 8.7 min, column Cosmosil 5C 18 The mixture was purified using a 1.0 mL / min AR-II column (4.6 × 150 mm, Nacalai Tesque, Kyoto, Japan), with a flow rate of 1.0 mL / min. 125 Fractions containing I]SIB were collected and purified by N-Succinimidyl 3-[ 125 I]iodobenzoate ([ 125 I]SIB) was obtained. 125 The I]SIB collected solution was evaporated to dryness using an evaporator and redissolved in 25 μL of ultrapure water.

[0079] [ 125 25uL of the I]SIB aqueous solution was added to 50uL of scFv-CEA-Cupid solution [4.1mg / mL] and 25uL of 0.1M borate buffer (pH 8.5) and reacted for 2 hours under ice-cooled conditions. The reaction solution was then passed through a PD-10 column (GE Healthcare, Uppsala, Sweden) and eluted with PBS to obtain the title compound X. The purity of the separated sample was examined by thin-layer chromatography using a Tec-control Chromatography 150-771 strip (BIODEX, Shirley, NY, USA) and size-exclusion HPLC.

[0080] Labeling rate during SIB synthesis 75.6% (SIB recovered by fraction from HPLC) * 92.6% by HPLC · 125 I-Cupid labeling rate 49.4% (PD-10) 125 I-Cupid *66.1% on SE-HPLC ·Radiochemical purity SE-HPLC: 98.0% iTLC: 99.7%

[0081] References: Zalutsky MR, Narula AS. Astatination of proteins using an N-succinimidyl tri-n-butylstannyl benzoate intermediate. Int J Rad Appl Instrum A. 1988;39(3):227-32.

[0082] [Experiment 1: In MKN-45 tumor-bearing mouse model transplanted with gastric cancer cells (MKN-45) that highly express carcinoembryonic antigen (CEA), 125 Pharmacokinetic study of I-Cupid-scFv antibody] <Purpose> Cupid-scFv antibody binding to CEA expressed on cancer cells 211 Before evaluating the pharmacokinetics of At-psyche, it is necessary to understand the rate at which Cupid-scFv antibody binds to cancer cells, its clearance from the blood, and its accumulation in normal tissues. Therefore, in this study, we investigated the pharmacokinetics of Cupid-scFv antibody in MKN-5 tumor-bearing model mice.

[0083] <Method> In this experiment, human gastric cancer cells (MKN-45) with high CEA expression were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 MKN-45 tumor-bearing model mice were created by transplanting 0.1 ml of 1000 mg ... 125 I-labeled anti-Cupid-scFv antibody ( 125To evaluate the amount of CEA binding depending on the dose of Cupid-scFv antibody, one group was administered 50 pmol. 125 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, 12 h, 24 h (100 pmol), 24 h (50 pmol), 48 h, and 72 h after administration of I-Cupid-scFv antibody, and tumor tissues and normal tissues and organs were extracted. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (top of right testis), testis (right side), stomach (contents free), small intestine (contents included), large intestine (contents included), liver, brown fat (interscapular), submandibular gland, thyroid (with trachea), bone (right femur), cerebrum, eyeball (both sides), and bladder (urine free); the remaining remains were divided into 3 equal parts, namely remainder-1, remainder-2, and remainder-3. The weights of the blood, plasma, tumor, and normal tissues and organs were then measured, and their radioactivity was measured using a gamma counter. 125 The amount of accumulated I-Cupid-scFv antibody (radioactivity) was calculated. 125 The percentage of I-Cupid-scFv antibody accumulated per unit weight (g) in blood, plasma, tumor, and normal tissues and organs (%ID / g). 125 Regarding the accumulation of I-Cupid-scFv antibody, the weight of the thyroid gland could not be accurately measured, so 125 The percentage of I-Cupid-scFv antibody that accumulated in the thyroid gland (%ID) was shown.

[0084] <Result> Figure 5 shows 125 The biodistribution (%ID / g) of I-Cupid-scFv antibody is shown. Figure 6 shows the effect of immunization with tumor tissue. 125 The accumulation amount (%ID / g) of I-Cupid-scFv antibody is shown. Figure 7 shows the effect of thyroid 125 The accumulation amount (%ID) of I-Cupid-scFv antibody, tumor-to-blood ratio, and tumor-to-muscle ratio are shown.

[0085] From the blood 125 The clearance of I-Cupid-scFv antibody was 50.0±1.6% at 1 min, 40.1±2.8% at 1 h, 25.1±1.4%ID / g at 6 h, 15.5±1.4%ID / g at 12 h, 6.4±0.8%ID / g (50 pmol: 6.6±0.5%ID / g) at 24 h, 1.9±0.2%ID / g at 48 h, and 0.4±0.1%ID / g at 72 h. 125 The excretion of I-Cupid-scFv antibody decreased over time, reaching approximately 94% of the administered dose at 24 hours, approximately 98% at 48 hours, and approximately 99.6% at 72 hours. To the tumor 125 The accumulation of I-Cupid-scFv antibody was 0.6±0.2%ID / g at 1 min, 3.2±0.6%ID / g at 1 h, 10.4±1.7%ID / g at 6 h, 14.0±3.1%ID / g at 12 h, 13.5±0.6% (50 pmol: 12.6±1.3%ID / g) at 24 h, 9.9±1.6%ID / g at 48 h, and 5.9±0.7%ID / g at 72 h. 125 The accumulation of I-Cupid-scFv antibody increased over time, reaching a peak at 12 hours. High accumulation was maintained even after 24 and 48 hours. It had decreased to about half of the peak at 72 hours. 125 The accumulation of I-Cupid-scFv antibody was at approximately the same level between 100 pmol and 50 pmol 24 hours after administration. Tumor-to-blood ratios were 0.01 ± 0.00 at 1 min, 0.06 ± 0.03 at 1 h, 0.33 ± 0.16 at 6 h, 0.79 ± 0.28 at 12 h, 1.79 ± 0.71 (50 pmol: 1.94 ± 0.33) at 24 h, 4.43 ± 1.75 at 48 h, and 12.74 ± 6.24 at 72 h. The tumor-to-muscle ratio was 1.5 ± 0.3 at 1 min, 4.0 ± 2.2 at 1 h, 12.7 ± 5.0 at 6 h, 19.7 ± 4.4 at 12 h, 32.1 ± 6.5 (34.6 ± 8.5) at 24 h, 57.7 ± 14.4 at 48 h, and 159.8 ± 72.0 at 72 h. Thyroid accumulation was fairly low (<0.05% ID) and did not show an increasing trend over time.

[0086] [Experiment 2: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-B <Purpose> In MKN-45 tumor-bearing mouse model, the effect of Cupid-scFv antibody administered in advance (24 h before) was 211 The pharmacokinetics of At-psyche-B was investigated.

[0087] <Method> In this experiment, human gastric cancer cells (MKN-45) with high CEA expression were used. Male, 9-week-old immunodeficient mice (BALB / cScl nu / nu) were used. MKN-45 cells (1x10 7 MKN-45 tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein. After the tumor volume reached a certain size (13 days after transplantation), the mice were divided into 4 groups and Cupid-scFv antibody was administered at 100 pmol / 0.1 ml each through the tail vein. 24 hours after administration of Cupid-scFv antibody, the mice were injected with 100 pmol / 0.1 ml of Cupid-scFv antibody through the tail vein. 211 At-psyche-B (approximately 0.25MBq / 100ml) was administered. 211 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-B, and tumor tissues and normal tissues and organs were removed. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (top of right testis), testis (right side), stomach (no contents), small intestine, large intestine, liver, brown fat, submandibular gland, thyroid (with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, and urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. Blood, plasma, urine, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs 211The amount of At-psyche-B accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-B accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-B, the weight of the thyroid gland could not be measured accurately, so 211 The percentage of At-psyche-B that accumulated in the thyroid gland (%ID) was shown.

[0088] <Result> Figure 8 shows Cupid-scFv antibody (24 hours before) + 211 The distribution of At-psyche-B in the body (%ID / g) is shown. Figure 9 shows the effect of Cupid-scFv antibody (24 hours before) on the thyroid gland. 211 At-psyche-B accumulation (%ID), tumor-to-blood ratio, and tumor-to-muscle ratio are shown.

[0089] From the blood 211 The clearance of At-psyche-B was 46.4±1.4% ID / g at 1 minute, 40.6±3.2% ID / g at 1 hour, 29.4±0.9% ID / g at 6 hours, and 6.2±1.3% ID / g at 24 hours. 211 Accumulation of At-psyche-B decreased over time, and approximately 94% of the administered dose was excreted within 24 hours. To the tumor 211 The accumulation of At-psyche-B was 0.6±0.1%ID / g at 1 minute, 3.2±0.4%ID / g at 1 hour, 11.8±1.5%ID / g at 6 hours, and 16.3±4.1% at 24 hours. 211 At-psyche-B accumulation increased over time. The tumor-to-blood ratio was 0.01 ± 0.00 at 1 min, 0.08 ± 0.01 at 1 h, 0.40 ± 0.05 at 6 h, and 2.63 ± 0.10 at 24 h. The tumor-to-muscle ratio was 1.5 ± 0.3 at 1 min, 5.2 ± 1.0 at 1 h, 14.0 ± 0.9 at 6 h, and 26.5 ± 4.6 at 24 h. Although accumulation in the thyroid gland was low (0.16±0.06% ID at 24 h), a tendency for it to increase over time was observed. To the liver 211 At-psyche-B was 17.4±2.3%ID / g at 1 min, 13.6±1.4%ID / g at 1 h, 16.0±1.4%ID / g at 6 h, and 15.5±0.1% at 24 h. 211 Accumulation of At-psyche-B was high immediately after administration and remained high for up to 24 hours. To the spleen 211 At-psyche-B was 4.9±1.7%ID / g at 1 min, 7.9±1.1%ID / g at 1 h, 10.1±0.3%ID / g at 6 h, and 9.6±2.4% at 24 h. 211 Accumulation of At-psyche-B increased over time, peaked at 6 hours, and remained high even after 24 hours. To the kidneys 211 At-psyche-B was 29.3±1.5%ID / g at 1 min, 14.2±1.3%ID / g at 1 h, 9.8±0.7%ID / g at 6 h, and 4.7±0.8% at 24 h. 211 Accumulation of At-psyche-B decreased over time, reaching 5% of the administered dose at 24 hours. To the lungs 211 At-psyche-B was 15.9±1.7%ID / g at 1 min, 14.7±3.6%ID / g at 1 h, 11.2±0.9%ID / g at 6 h, and 4.2±0.5% at 24 h. 211 Accumulation of At-psyche-B was high by 6 hours but decreased to 4% of the administered dose by 24 hours.

[0090] [Experiment 3: Cupid-scFv antibody (48 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-B Experiment 1 125 From the results of the pharmacokinetics experiment of I-Cupid-scFv antibody, 125 48 hours after administration of I-Cupid-scFv antibody, blood 125The accumulation of I-Cupid-scFv antibody was low, whereas the tumor 125 The accumulation of I-Cupid-scFv antibody was high. <Purpose> In MKN-45 tumor-bearing model mice, the effect of Cupid-scFv antibody administered in advance (48 h before) was 211 The pharmacokinetics of At-psyche-B was investigated.

[0091] <Method> In this experiment, human gastric cancer cells (MKN-45) with high CEA expression were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 Tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein. After the tumor volume reached a certain size (12 days after transplantation), the mice were divided into 4 groups and Cupid-scFv antibody was administered at 100 pmol / 0.1 ml each through the mouse tail vein. 211 At-psyche-B (approximately 0.25MBq / 100ml) was administered. 211 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-B, and tumor tissues and normal tissues and organs were removed. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (upper part of right testis), testis (both sides), stomach, stomach contents, small intestine (including contents), large intestine (including contents), liver, brown fat (between the scapula), submandibular gland, thyroid gland (with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. Blood, plasma, urine, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs 211 The amount of At-psyche-B accumulated (radioactivity) was calculated. 211The percentage of At-psyche-B accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-B, the weight of the thyroid gland could not be measured accurately, so 211 The percentage of At-psyche-B that accumulated in the thyroid gland (%ID) was shown.

[0092] <Result> Figure 10 shows Cupid-scFv antibody (48 hours before) + 211 The distribution of At-psyche-B in the body (%ID / g) is shown. Figure 11 shows the effect of Cupid-scFv antibody (48 hours before) on the thyroid gland. 211 The amount of At-psyche-B accumulated (%ID), tumor-to-blood ratio, and tumor-to-muscle ratio are shown.

[0093] From the blood 211 The clearance of At-psyche-B was 30.7±2.2% ID / g at 1 minute, 30.8±5.5% ID / g at 1 hour, 19.0±2.6% ID / g at 6 hours, and 2.6±0.5% ID / g at 24 hours. 211 Accumulation of At-psyche-B was similar at 1 minute and 1 hour, and decreased to approximately 2.6% of the administered dose at 24 hours. To the tumor 211 The accumulation of At-psyche-B was 0.5±0.1%ID / g at 1 minute, 3.2±0.7%ID / g at 1 hour, 9.9±2.9%ID / g at 6 hours, and 11.3±3.3% at 24 hours. 211 At-psyche-B accumulation increased over time. The tumor-to-blood ratio was 0.02 ± 0.00 at 1 min, 0.11 ± 0.02 at 1 h, 0.51 ± 0.09 at 6 h, and 4.38 ± 0.85 at 24 h. The tumor-to-muscle ratio was 1.0 ± 0.3 at 1 min, 4.7 ± 0.4 at 1 h, 13.1 ± 3.5 at 6 h, and 23.2 ± 7.2 at 24 h. To the thyroid 211Although the accumulation of At-psyche-B was low (0.16±0.02% ID at 24 h), it tended to increase over time. To the liver 211 At-psyche-B was 41.4±6.2%ID / g at 1 min, 25.6±2.5%ID / g at 1 h, 23.6±2.3%ID / g at 6 h, and 19.3±0.6% at 24 h. 211 Accumulation of At-psyche-B was high immediately after administration and decreased over time, but remained high at 24 hours. To the spleen 211 At-psyche-B was 3.5±0.1%ID / g at 1 minute, 8.5±0.6%ID / g at 1 hour, 11.1±0.7%ID / g at 6 hours, and 10.2±1.6% at 24 hours. 211 Accumulation of At-psyche-B increased over time, peaked at 6 hours, and remained high even after 24 hours. To the kidneys 211 At-psyche-B was 62.3±9.8%ID / g at 1 min, 38.0±4.5%ID / g at 1 h, 14.9±0.8%ID / g at 6 h, and 6.6±0.2% at 24 h. 211 At-psyche-B was excreted immediately after administration via the kidney, decreasing to 6.6% of the administered dose within 24 hours. To the lungs 211 At-psyche-B was 10.2±1.6%ID / g at 1 min, 12.2±0.9%ID / g at 1 h, 8.5±0.9%ID / g at 6 h, and 3.5±0.2% at 24 h. 211 Accumulation of At-psyche-B peaked at 1 hour and then decreased over time, reaching 3.5% of the administered dose at 24 hours.

[0094] [Experiment 4: MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psycheB <Purpose> In MKN-45 tumor-bearing mouse model, in the absence of Cupid-scFv antibody 211 The pharmacokinetics of At-psyche-B was investigated.

[0095] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cScl nu / nu) were used. MKN-45 cells (1x10 7 When the tumor volume reached a certain level (14 days after transplantation), the mice were divided into four groups and injected with 0.1 ml of 0.1% ethanol into the tail vein of the mice. 211 At-psyche-B (approximately 0.25MBq / 00ml) was administered. 211 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-B, and tumor tissues and normal tissues and organs were extracted. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (upper part of right testis), testis (both sides), stomach, stomach contents, small intestine (including contents), large intestine (including contents), liver, brown fat (between the shoulder blades), submandibular gland, thyroid gland (with trachea), bone (right femur), brain, eyeball, bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. Blood, plasma, urine, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs 211 The amount of At-psyche-B accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-B accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-B, the weight of the thyroid gland could not be measured accurately, so 211 The percentage of At-psyche-B that accumulated in the thyroid gland (%ID) was shown.

[0096] <Result> Figure 12 shows 211 The distribution of At-psyche-B in the body (%ID / g) is shown. Figure 13 shows the effect of thyroid211 The accumulation amount (%ID) of At-psyche-B is shown.

[0097] In the blood 211 The accumulation of At-psyche-B was 10.4±1.1% ID / g at 1 minute, 3.8±0.3% ID / g at 1 hour, 0.4±0.1% ID / g at 6 hours, and 0.2±0.04% ID / g at 24 hours. 211 Accumulation of At-psyche-B was already low at 1 min and decreased to approximately 0.2% of the administered dose at 24 h, and clearance from the blood was fairly rapid. To the tumor 211 The accumulation of At-psyche-B was 0.3±0.05%ID / g at 1 minute, 1.0±0.1%ID / g at 1 hour, 1.0±0.1%ID / g at 6 hours, and 0.3±0.02% at 24 hours. 211 There was almost no accumulation of At-psyche-B. Thyroid accumulation was low, at 0.16±0.06% ID at 6 h. To the kidneys 211 At-psyche-B was 61.4±6.5%ID / g at 1 min, 57.2±3.1%ID / g at 1 h, 17.7±1.9%ID / g at 6 h, and 5.1±0.9% at 24 h. 211 At-psyche-B accumulated in the kidney immediately after administration, but decreased to 5.1% of the administered dose within 24 hours. To the liver 211 At-psyche-B was 49.1±6.2%ID / g at 1 min, 35.3±3.3%ID / g at 1 h, 16.8±0.7%ID / g at 6 h, and 9.0±1.4% at 24 h. 211 Accumulation of At-psyche-B was high immediately after administration and decreased over time, but remained high at 24 hours.

[0098] [Experiment 5: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-BR] <Purpose> In MKN-45 tumor-bearing mouse model, the effect of Cupid-scFv antibody administered in advance (24 h before) was 211 The pharmacokinetics of At-psyche-BR was investigated.

[0099] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 Tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein. After the tumor volume reached a certain size (13 days after transplantation), the mice were divided into 4 groups and Cupid-scFv antibody was administered at 100 pmol / 0.1 ml each through the mouse tail vein. 24 hours after administration of Cupid-scFv antibody, 211 At-psyche-BR (approximately 0.25MBq / 100ml) was administered. 211 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-BR, and tumor tissues and normal tissues and organs were extracted. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (upper part of right testis), testis (both sides), stomach, stomach contents, small intestine (including contents), large intestine (including contents), liver, brown fat (between the scapula), submandibular gland, thyroid gland (with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. Blood, plasma, urine, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs 211 The amount of At-psyche-B accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-BR accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-BR, the weight of the thyroid gland could not be accurately measured, so 211The percentage of At-psyche-BR that accumulated in the thyroid gland (%ID) was shown.

[0100] <Result> FIG. 14 shows Cupid-scFv antibody (24 hours before) + 211 The distribution of At-psyche-BR in vivo (%ID / g) is shown. Figure 15 shows the effect of Cupid-scFv antibody (24 hours before) on the thyroid gland. 211 The amount of At-psyche-BR accumulation (%ID), tumor-to-blood ratio, and tumor-to-muscle ratio are shown.

[0101] From the blood 211 The clearance of At-psyche-BR was 46.9±1.1% ID / g at 1 minute, 39.5±5.2% ID / g at 1 hour, 25.3±1.0% ID / g at 6 hours, and 8.3±0.5% ID / g at 24 hours. 211 Accumulation of At-psyche-B decreased over time, and approximately 92% of the administered dose was excreted within 24 hours. To the tumor 211 The accumulation of At-psyche-BR was 0.6±0.1%ID / g at 1 minute, 3.1±0.7%ID / g at 1 hour, 9.3±0.6%ID / g at 6 hours, and 18.4±2.5% at 24 hours. 211 At-psyche-BR accumulation increased over time. The tumor-to-blood ratio was 0.01 ± 0.00 at 1 min, 0.08 ± 0.02 at 1 h, 0.7 ± 0.02 at 6 h, and 2.23 ± 0.41 at 24 h. The tumor-to-muscle ratio was 1.22 ± 0.05 at 1 min, 5.11 ± 1.81 at 1 h, 12.80 ± 1.86 at 6 h, and 25.07 ± 3.68 at 24 h. To the thyroid 211 Although the accumulation of At-psyche-BR was low (0.15±0.05% ID at 24 h), it tended to increase over time. To the liver 211At-psyche-BR was 13.3±2.2%ID / g at 1 min, 11.4±0.7%ID / g at 1 h, 12.8±0.2%ID / g at 6 h, and 7.8±0.9% at 24 h. 211 Accumulation of At-psyche-BR was high immediately after administration, maintained a constant level for up to 6 hours, and decreased to approximately half the level at 24 hours. To the spleen 211 At-psyche-BR was 4.7±0.4%ID / g at 1 minute, 7.1±0.2%ID / g at 1 hour, 8.4±1.0%ID / g at 6 hours, and 5.5±1.1% at 24 hours. 211 At-psyche-BR accumulation increased over time, peaked at 6 hours, and declined to 1 min levels after 24 hours. To the kidneys 211 At-psyche-BR was 28.6±1.3%ID / g at 1 min, 17.1±1.4%ID / g at 1 h, 9.5±0.2%ID / g at 6 h, and 5.4±0.5% at 24 h. To the lungs 211 At-psyche-BR was 14.4±1.6%ID / g at 1 min, 13.2±2.2%ID / g at 1 h, 9.1±1.0%ID / g at 6 h, and 5.3±0.1% at 24 h. 211 At-psyche-BR accumulation decreased over time.

[0102] [Experiment 6: Cupid-scFv antibody (48 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-BR] <Purpose> In MKN-45 tumor-bearing model mice, the effect of Cupid-scFv antibody administered in advance (48 h before) was 211 The pharmacokinetics of At-psyche-BR was investigated.

[0103] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 Tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein. After the tumor volume reached a certain size (12 days after transplantation), the mice were divided into 4 groups and Cupid-scFv antibody was administered at 100 pmol / 0.1 ml each through the mouse tail vein. 211 At-psyche-BR (approximately 0.25MBq / 100ml) was administered. 211 Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-BR, and tumor tissues and normal tissues and organs were extracted. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (top of right testis), testis (both sides), stomach, gastric contents, small intestine (contents free), large intestine (contents free), liver, brown fat (interscapular), submandibular gland, thyroid gland (with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. Blood, plasma, urine, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs 211 The amount of At-psyche-BR accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-BR accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-BR, the weight of the thyroid gland could not be accurately measured, so 211 The percentage of At-psyche-BR that accumulated in the thyroid gland (%ID) was shown.

[0104] <Result> Figure 16 shows Cupid-scFv antibody (48 hours before) + 211The distribution of At-psyche-BR in vivo (%ID / g) is shown. Figure 17 shows the effect of Cupid-scFv antibody (48 hours before) on the thyroid gland. 211 At-psyche-BR accumulation (%ID), tumor-to-blood ratio, and tumor-to-muscle ratio are shown.

[0105] From the blood 211 The clearance of At-psyche-BR was 26.4±2.7% ID / g at 1 minute, 30.6±3.2% ID / g at 1 hour, 22.7±2.7% ID / g at 6 hours, and 1.6±1.0% ID / g at 24 hours. 211 Accumulation of At-psyche-BR was maintained at a certain level for up to 6 hours, but approximately 98% of the administered dose was excreted within 24 hours. To the tumor 211 The accumulation of At-psyche-BR was 0.5±0.0%ID / g at 1 minute, 3.2±0.5%ID / g at 1 hour, 9.3±1.4%ID / g at 6 hours, and 7.4±2.3% at 24 hours. 211 At-psyche-BR accumulation peaked at 6 hours. The tumor-to-blood ratio was 0.02 ± 0.00 at 1 min, 0.10 ± 0.01 at 1 h, 0.42 ± 0.11 at 6 h, and 5.39 ± 1.56 at 24 h. The tumor-to-muscle ratio was 1.30 ± 0.06 at 1 min, 5.13 ± 0.67 at 1 h, 11.42 ± 1.05 at 6 h, and 27.98 ± 2.34 at 24 h. To the thyroid 211 Although the accumulation of At-psyche-BR was low (0.19±0.03% ID at 24 h), it tended to increase over time. To the liver 211 The accumulation of At-psyche-BR was 31.5±4.3%ID / g at 1 minute, 19.8±1.3%ID / g at 1 hour, 18.7±2.7%ID / g at 6 hours, and 8.9±1.7% at 24 hours. 211 At-psyche-BR accumulation was high immediately after administration and then decreased over time. To the spleen 211Accumulation of At-psyche-BR was 3.4±0.2%ID / g at 1 minute, 6.8±0.3%ID / g at 1 hour, 9.7±1.0%ID / g at 6 hours, and 4.6±1.6% at 24 hours. 211 At-psyche-BR accumulation increased over time, peaked at 6 hours, and declined to 1 min levels after 24 hours. To the kidneys 211 Accumulation of At-psyche-BR was 81.7±11.8%ID / g at 1 min, 54.5±4.0%ID / g at 1 h, 15.0±2.3%ID / g at 6 h, and 5.6±1.0% at 24 h. To the lungs 211 Accumulation of At-psyche-BR was 9.5±0.4%ID / g at 1 min, 12.7±0.6%ID / g at 1 h, 7.5±3.3%ID / g at 6 h, and 2.9±0.3% at 24 h.

[0106] [Experiment 7: MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psycheBR] <Purpose> In MKN-45 tumor-bearing mouse model, in the absence of Cupid-scFv antibody 211 The pharmacokinetics of At-psyche-BR was investigated.

[0107] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 When the tumor volume reached a certain level (19 days after transplantation), the mice were divided into four groups and injected with 0.1 ml of 0.1% ethanol into the tail vein of the mice. 211 At-psyche-BR was administered. 211Mice were euthanized by exsanguination from the heart under isoflurane anesthesia 1 min, 1 h, 6 h, and 24 h after administration of At-psyche-BR, and tumor tissues and normal tissues and organs were extracted. Normal tissues and organs: muscle (right gastrocnemius), heart, lung, spleen, pancreas, testis (both sides), stomach, gastric contents, small intestine (contents free), large intestine (contents free), liver, kidney, submandibular gland, thyroid (with trachea), bone (right femur), and cerebrum. Blood, plasma, tumor, and normal tissues and organs were then weighed and their radioactivity was measured using a gamma counter. Blood, plasma, urine, tumor, and normal tissues and organs were weighed and their radioactivity was measured using a gamma counter. 211 The amount of At-psyche-BR accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-BR accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-BR, the weight of the thyroid gland could not be accurately measured, so 211 The percentage of At-psyche-BR that accumulated in the thyroid gland (%ID) was shown.

[0108] <Result> Figure 18 shows 211 The biodistribution (%ID / g) of At-psycheBR is shown. Figure 19 shows the effect of thyroid 211 At-psyche-BR accumulation (%ID) is shown.

[0109] In the blood 211 The accumulation of At-psyche-BR was 13.5±1.1% ID / g at 1 minute, 2.1±0.2% ID / g at 1 hour, 1.0±0.2% ID / g at 6 hours, and 0.2±0.04% ID / g at 24 hours. 211 Accumulation of At-psyche-B was already low at 1 min, was approximately 0.2% of the administered dose at 24 h, and clearance from the blood was fairly rapid. To the tumor 211The accumulation of At-psyche-BR was 0.3±0.04%ID / g at 1 minute, 0.4±0.02%ID / g at 1 hour, 0.8±0.09%ID / g at 6 hours, and 0.4±0.02% at 24 hours. 211 There was almost no accumulation of At-psyche-BR. To the thyroid 211 Accumulation of At-psyche-BR was low, at 0.29±0.05% ID at 6 h. To the kidneys 211 The accumulation of At-psyche-BR was 72.7±5.6%ID / g at 1 min, 77.9±2.1%ID / g at 1 h, 32.1±8.2%ID / g at 6 h, and 3.0±0.1% at 24 h. 211 At-psyche-B was excreted via the kidney immediately after administration, decreasing to 3.0% of the administered dose within 24 hours. To the liver 211 The accumulation of At-psyche-BR was 51.1±5.9%ID / g at 1 minute, 30.8±3.3%ID / g at 1 hour, 19.6±0.5%ID / g at 6 hours, and 5.0±0.2% at 24 hours. 211 Accumulation of At-psyche-B was high immediately after administration and decreased over time.

[0110] [Experiment 8: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Therapeutic efficacy and toxicity evaluation of At-psycheBR] <Purpose> Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 To evaluate the therapeutic efficacy and toxicity of At-psyche-BR over time.

[0111] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (5x10 6Mice were then transplanted with 100 pmol / 0.1 ml of Cupid-scFv antibody into the tail vein of each mouse. The mice were then divided into 7 groups for evaluating the therapeutic effect when the tumor volume reached a certain size (8 days after transplantation) and into a group for evaluating the internal distribution of the tumor in the tumor-bearing model (6 hours). The mice were then administered 100 pmol / 0.1 ml of Cupid-scFv antibody via the tail vein of each mouse. 24 hours after administration of Cupid-scFv antibody, the mice in the treatment group were administered 100 pmol / 0.1 ml of Cupid-scFv antibody via the tail vein of each mouse. 211 At-psyche-BR was administered at doses of 5.55MBq, 3.70MBq, 1.85MBq, 1.11MBq, and 0.37MBq, respectively. 211 The At-psyche-BR solvent was administered to the subjects (vehicle group). The Cupid group was administered only to the subjects. 211 The general condition of the mice was observed and recorded immediately after and 3 hours after administration of At-psyche-BR. 211 Until the 14th day after administration of At-psyche-BR, the general condition of the rats was observed and their body weights were measured every day. 211 From 14 days after administration of At-psyche-BR, the general condition was observed and the body weight was measured every other day. 211 Measurements were taken every other day after At-psyche-BR treatment. 211 Thirty-six days after At-psyche-BR treatment, the general condition was observed, body weight was measured, and tumor size was measured. The mice were then euthanized after exsanguination via the heart under isoflurane anesthesia, and the tumor tissue and major tissues and organs were removed, weighed, and fixed in formalin.

[0112] <Result> FIG. 20 shows the change in mouse body weight (g) over time. FIG. 21 shows the tumor volume (mm 3 ) over time.

[0113] In the 5.55MBq and 3.70MBq groups, body weight decreased over time after administration, and on the fifth day, due to severe general condition and weight loss, the animals were euthanized and the treatment was terminated. In the 1.85 MBq group, general condition and weight loss were also significant on day 5, but the animals were not euthanized and observation continued. From day 6 onwards, general condition and weight were restored, and by day 19, they had fully recovered. In the 1.11MBq and 0.37MBq groups, changes in general condition and body weight were similar to those in the control group. Compared to the control group, 1.85MBq, 1.11MBq, and 0.37MBq treatments suppressed tumor growth up to day 10 of treatment. Although tumor volume increased over time thereafter, tumor growth was suppressed in a dose-dependent manner compared to the control group.

[0114] [Experiment 9: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-BR (6h)] <Purpose> In MKN-45 tumor-bearing mouse model, the effect of Cupid-scFv antibody administered in advance (24 h before) was 211 The pharmacokinetics (6 h) of At-psyche-BR was investigated.

[0115] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7 Tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein when the tumor volume reached a certain level (8 days after transplantation). 24 hours after administration of Cupid-scFv antibody, 100 pmol / 0.1 ml of Cupid-scFv antibody was administered into the mouse tail vein. 211 At-psyche-BR (approximately 0.30MBq / 100ml) was administered. 211Six hours after administration of At-psyche-BR, mice were euthanized by exsanguination from the heart under isoflurane anesthesia, and tumor tissues and normal tissues and organs were removed. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (top of right testis), testis (both sides), stomach, gastric contents, small intestine (contents free), large intestine (contents free), liver, brown fat (interscapular), submandibular gland, thyroid gland (together with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. The weights of blood, plasma, urine, tumor, and normal tissues and organs were then measured, and their radioactivity was measured using a gamma counter. The effects of the blood, plasma, urine, tumor, and normal tissues and organs on the radioactivity of the normal tissues and organs were measured. 211 The amount of At-psyche-BR accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-BR accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-BR, the weight of the thyroid gland could not be accurately measured, so 211 The percentage of At-psyche-BR that accumulated in the thyroid gland (%ID) was shown. <Result> FIG. 22 shows Cupid-scFv antibody (24 hours before) + 211 The pharmacokinetics of At-psycheBR (%ID / g, 6h) is shown. To the tumor 211 Accumulation of At-psyche-BR was high, 31.0±3.4%ID / g.

[0116] [Experiment 10: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Therapeutic efficacy and toxicity evaluation of At-psycheB] <Purpose> Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 To evaluate the therapeutic efficacy and toxicity of At-psyche-BR over time.

[0117] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (5x10 6 Mice were then transplanted with 100 pmol / 0.1 ml of Cupid-scFv antibody into the tail vein of each mouse. The mice were then divided into six groups for evaluating the therapeutic effect when the tumor volume reached a certain size (8 days after transplantation) and into a group for evaluating the internal distribution of the tumor in the tumor-bearing model (6 hours). The mice were then administered 100 pmol / 0.1 ml of Cupid-scFv antibody via the tail vein of each mouse. 24 hours after administration of Cupid-scFv antibody, the mice in the treatment group were administered 100 pmol / 0.1 ml of Cupid-scFv antibody via the tail vein of each mouse. 211 At-psyche-B was administered at 3.70MBq, 1.85MBq, 1.11MBq and 0.37MBq, respectively. There was no 5.55MBq administration group in this experiment. 211 The group administered the solvent for At-psyche-B (vehicle group), and the group administered only Cupid (Cupid group). 211 The general condition of the mice was observed and recorded immediately after and 3 hours after administration of At-psyche-B. 211 Until the 14th day after administration of At-psyche-B, the general condition of the animals was observed and their body weight was measured every day. 211 From 14 days after administration of At-psyche-B, the general condition was observed and the body weight was measured every other day. 211 Measurements were taken every other day after At-psyche-B treatment. 211 Thirty-six days after At-psyche-B treatment, the general condition was observed, body weight was measured, and tumor size was measured. The mice were then euthanized by cardiac exsanguination under isoflurane anesthesia, and tumor tissue and major tissues and organs were removed, weighed, and fixed in formalin.

[0118] <Result> FIG. 23 shows the change in mouse body weight (g) over time. FIG. 24 shows the tumor volume (mm 3 ) over time.

[0119] In the 3.70MBq administration group, body weight decreased over time after administration, and on the fifth day, due to severe general condition and weight loss, the animals were euthanized and the administration was terminated. In the 1.85 MBq group, the general condition and weight loss were also significant on the 5th day, but the animals were not euthanized and observation continued. From the 6th day onwards, red spots were scattered on the skin, and one animal died on the 10th. The red spots on the skin persisted until the 12th day. The general condition of two animals improved from the 12th day onwards, and they had fully recovered by the 26th day. In the 1.11 MBq group, body weight was slightly reduced until the 5th day, after which it recovered slightly, but not to the same extent as in the control group. In the 0.37MBq group, the weight loss was not as great as in the 1.11MBq group, but after the 10th day, it was similar to that in the 1.11MBq group. Compared to the control group, 1.85MBq, 1.11MBq, and 0.37MBq treatments suppressed tumor growth up to day 10 of treatment. Although tumor volume increased over time thereafter, tumor growth was suppressed in a dose-dependent manner compared to the control group.

[0120] [Experiment 11: Cupid-scFv antibody (24 hours before) in MKN-45 tumor-bearing mouse model 211 Pharmacokinetic study of At-psyche-B (6h)] <Purpose> In MKN-45 tumor-bearing mouse model, the effect of Cupid-scFv antibody administered in advance (24 h before) was 211 The pharmacokinetics (6 h) of At-psyche-B was investigated.

[0121] <Method> In this experiment, human gastric cancer cells (MKN-45) with high expression of carcinoembryonic antigen (CEA) were used. Male, 9-week-old immunodeficient mice (BALB / cSlc nu / nu) were used. MKN-45 cells (1x10 7Tumor-bearing model mice were created by transplanting 100 pmol / 0.1 ml of Cupid-scFv antibody into the mouse tail vein when the tumor volume reached a certain level (8 days after transplantation). 24 hours after administration of Cupid-scFv antibody, 100 pmol / 0.1 ml of Cupid-scFv antibody was administered into the mouse tail vein. 211 At-psyche-B (approximately 0.30MBq / 100ml) was administered. 211 Six hours after administration of At-psyche-B, mice were euthanized by exsanguination from the heart under isoflurane anesthesia, and tumor tissues and normal tissues and organs were removed. Normal tissues and organs: skin (right lower leg), muscle (right gastrocnemius), heart, lung, spleen, pancreas, white fat (top of right testis), testis (both sides), stomach, gastric contents, small intestine (contents free), large intestine (contents free), liver, brown fat (interscapular), submandibular gland, thyroid gland (together with trachea), bone (right femur), cerebrum, eyeball (both sides), bladder, urine; the remaining remains were divided into three equal parts, remainder-1, remainder-2, and remainder-3. The weights of blood, plasma, urine, tumor, and normal tissues and organs were then measured, and their radioactivity was measured using a gamma counter. The effects of the administration of At-psyche-B on blood, plasma, urine, tumor, and normal tissues and organs were measured. 211 The amount of At-psyche-B accumulated (radioactivity) was calculated. 211 The percentage of At-psyche-B accumulated per unit weight (g) in blood, plasma, urine, tumor, and normal tissues and organs (%ID / g). 211 Regarding the accumulation of At-psyche-B, the weight of the thyroid gland could not be measured accurately, so 211 The percentage of At-psyche-B that accumulated in the thyroid gland (%ID) was shown.

[0122] <Result> FIG. 25 shows Cupid-scFv antibody (24 hours before) + 211 The pharmacokinetics of At-psycheB (%ID / g, 6h) is shown. To the tumor 211 Accumulation of At-psyche-B was high, 25.8±1.5%ID / g.

Claims

1. A compound represented by the following formula (1) or a salt thereof: 【Chemistry 1】 (In the formula, L １ but 【Chemistry 2】 indicates, L 2 represents -CONH-L 3 -NHCO-, L 3 represents a combination of an alkylene group having 1 to 10 carbon atoms and -O-; Hal represents a halogen element; p represents an integer of 1 to 5; q, r, s and t each independently represent an integer of 1 to 8.

2. The compound or salt thereof according to claim 1 , which is a compound or salt thereof represented by the following formula (2): 【Chemistry 3】 (The meaning of each symbol in the formula is the same as in claim 1.)

3. Hal, I, １２５ I, or ２１１ 3. The compound or salt thereof according to claim 1 or 2, wherein At is

4. The compound or salt thereof according to any one of claims 1 to 3, wherein p is 1.

5. The following compounds: 【Chemistry 4】

6. A kit for treatment or diagnosis comprising: (1) a compound according to any one of claims 1 to 5; and (b) a streptavidin mutant-molecular probe conjugate obtained by binding a molecular probe to a streptavidin mutant comprising the amino acid sequence set forth in SEQ ID NO:1 (with the proviso that the amino acid sequence consisting of six histidines at the C-terminus may be deleted in part or in whole).

Images