Measurement of anti-Treponema pallidum body fluid antibodies using a mixture of Treponema pallidum surface antigens

Abstract

To provide a means for detecting infection with Treponema pallidum with higher sensitivity. [Solution] The inventors have discovered that by measuring anti-Treponema pallidum antibodies in body fluid samples by immunological assay using a mixture of TpN47 antigen derived from the cocoon thread or silk gland of genetically modified silkworms, which are artificial surface antigens of Treponema pallidum, and the same genetically modified TpN15-TpN17 fusion antigen, the measurement sensitivity is clearly improved to a practical level, even exceeding that of native Treponema pallidum antigens.

Description

[Technical field]

[0001] The present invention relates to a method for measuring antibodies in body fluids using a raw material obtained from a genetically modified organism. More specifically, the present invention relates to a method for measuring antibodies in body fluids for syphilis using a mixture of Treponema pallidum surface antigens derived from genetically modified silkworms. [Background technology]

[0002] Syphilis is a typical sexually transmitted disease that has been around for a long time, and has been increasing rapidly in recent years. From 1999 to 2012, about 600-800 cases were reported per year, and it was a disease that did not receive much attention in daily medical practice, except among a very small number of medical professionals. However, after exceeding 1,000 cases with 1,228 cases in 2013, it continued to increase steadily, exceeding 7,000 cases in 2018. The preliminary number of cases as of the 46th week of 2019 was 5,817, and it cannot be said that the trend has yet begun to decrease.

[0003] Syphilis is a chronic infectious disease caused by Treponema pallidum (TP), which spreads from localized to the whole body. Primary syphilis rash appears at the site of infection, followed by secondary syphilis rash that spreads throughout the body. Both primary and secondary rashes disappear naturally without treatment and become asymptomatic (asymptomatic syphilis), and the disease progresses with repeated remission and exacerbation of symptoms. It is said that late symptoms (late syphilis) appear several years after infection. Even if infected with syphilis, not all patients will develop symptomatic syphilis, and even those who develop clinical symptoms but do not receive treatment may develop asymptomatic syphilis at some point. Currently, syphilis can be fully treated with antibiotics, but because of the coexistence of asymptomatic states, serological tests are becoming more common than specimen collection from the affected area.

[0004] One of such methods for diagnosing syphilis is a method for detecting antibodies produced in the patient's body fluids (body fluid antibodies). In this antibody detection method, Treponema pallidum bacteria have been cultured in rabbit testes, solubilized and extracted with a surfactant, etc., and then insoluble matter has been removed and necessary components have been purified using various methods, and the resulting antigen has been used. However, since this method uses rabbits to produce the antigen, it is difficult to obtain a large amount of the same quality stably. In addition, it has been considered problematic from the viewpoint of animal protection. In order to solve such problems, a method using Treponema pallidum surface antigen (TP antigen) produced in Escherichia coli by genetic recombination technology has been used in recent years (Patent Document 1, Non-Patent Document 1).

[0005] Recently, a technique has been established for producing useful proteins in silkworms (recombinant silkworms) using recombinant gene technology (Non-Patent Documents 2, 3, 4, 5). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 11-192089 [Non-patent literature]

[0007] [Non-Patent Document 1] V.Sambri,et al.,Western Immunoblotting with Five Treponema pallidum Recombinant Antigens for Serologic Diagnosis of Syphilis Clin.Diagno.Labo.Immuno.,8(3) p.534-539(2001) [Non-Patent Document 2] Molecular Entomology, pp.36-45, Kyoritsu Shuppan [Non-Patent Document 3] Dev. Growth Differ., 56, 14-25, 2011 [Non-Patent Document 4] J. Biotechnol. Biomater, S9, 004, 2012 [Non-Patent Document 5] Targeted Gene Expression Using the GAL4 / UAS System in the Silkworm Bombyx mori Morikazu Imamura, etal. Genetics, 165, 1329- 1340 (2003) DISCLOSURE OF THEINVENTION [Problem to be solved by the invention]

[0008] As mentioned above, currently, syphilis can be fully treated with antibiotics, but asymptomatic states also exist. Therefore, there is still a high need to diagnose the infection as accurately as possible and to decide on early treatment, and there is a demand for a means to detect infection with Treponema pallidum with higher sensitivity. In this regard, it is necessary to further improve the sensitivity of the measurement of anti-TP antibodies in body fluid samples using currently available recombinant TP antigens. [Means for solving the problem]

[0009] The present inventors have conducted research aimed at solving the above problems, and have found that by measuring anti-TP antibodies in body fluid samples by immunological measurement using a mixture of TpN47 antigen derived from the cocoon thread or silk gland of a genetically modified silkworm, which is an artificial surface antigen of TP, and the genetically modified TpN15-TpN17 fusion antigen, the measurement sensitivity is clearly improved to a practical level and exceeds that of the native TP antigen.

[0010] (1) Overview of the Invention That is, the present invention provides a method for measuring body fluid antibodies (hereinafter also referred to as the measurement method of the present invention), which comprises contacting a mixture of recombinant TpN47 antigen (hereinafter also referred to as 47 antigen) derived from the cocoon filaments or silk gland of a genetically modified silkworm (hereinafter also referred to as 47 recombinant silkworm) transformed with the TpN47 gene, which is an artificial surface antigen of Treponema pallidum (TP), and recombinant TpN15-TpN17 fusion antigen (hereinafter also referred to as 15-17 antigen) derived from the cocoon filaments or silk gland of a genetically modified silkworm (hereinafter also referred to as 15-17 recombinant silkworm) transformed with a fusion gene of the same TpN15 gene and TpN17 gene, with a body fluid sample, and measuring anti-Treponema pallidum antibodies in the body fluid sample by an immunological measurement method as a binding signal with the mixture of the above antigens (hereinafter also referred to as the measurement method of the present invention).

[0011] Silkworms transformed with TP genes can be produced using techniques already available. In this example, cocoons derived from 47 recombinant silkworms and 15-17 recombinant silkworms were purchased from a specialized company, and the cocoon filaments of the cocoons were used as the raw materials for the 47 antigen and the 15-17 antigen. However, as far as the inventors know, the recombinant TpN47 antigen and the TpN15-TpN17 antigen obtained from the cocoon filaments are not publicly known.

[0012] (2) Treponema pallidum (TP) TP is a type of spirochete, and several proteins have been reported as TP antigen proteins (The Journal of Immunology, Vol.129, p.833-838, 1982; The Journal of Immunology, Vol.129, p.1287-1291, 1982; Journal of Clinical Microbiology, Vol.21, p.82-87, 1985; Journal of Clinical Microbiology, Vol.30, p.115-122, 1992). Representative surface antigen proteins are known to be TpN47 with molecular weights of 47 kd, TpN15 with molecular weights of 15 kd, and TpN17 with molecular weights of 17 kd, and the base and amino acid sequences of their genes have been determined (Microbiological Reviews, Vol. 57, p. 750-779; Infection and Immunity, Vol. 61, p. 1202-1210, 1993; Journal of Bacteriology, Vol. 162, p. 1227-1237, 1992; Infection and Immunity, Vol. 57, p. 3708-3714, 1989).

[0013] (3) Recombinant TP antigen <Gene cloning> The recombinant TpN47 antigen and the recombinant TpN15-TpN17 fusion antigen obtained using recombinant E. coli are already known (Patent Document 1, etc.), and their production can be performed by a conventional method in genetic engineering. That is, the desired TpN47 gene or TpN15-TpN17 fusion gene is cloned, and the DNA sequence encoding the obtained Tp antigen is incorporated into a vector, and then the vector is introduced into the host E. coli. Then, the E. coli transformed with the vector is cultured, and the DNA sequence encoding the Tp antigen of the vector is expressed, whereby the desired two types of TP antigens can be obtained in large quantities. Furthermore, these recombinant TP antigens derived from E. coli are also commercially available. However, as described above, the recombinant TP antigens derived from silkworms are not publicly known to the best of the present inventor's knowledge.

[0014] The above genes can be suitably cloned by gene amplification methods such as PCR and recombinant PCR, regardless of the host into which the gene is to be introduced, such as E. coli, silkworm (described later), etc. Furthermore, chemical gene synthesis can be used as necessary.

[0015] When the PCR method is used, the desired TP antigen gene fragment can be obtained as a gene amplification product by specifically amplifying the TP antigen region of the native TP antigen gene using a forward primer and a reverse primer that sandwich both ends of the coding region of the TpN47 gene. The native TP antigen gene can be obtained by extracting genomic DNA from Treponema pallidum, Nicols strain, cultured in rabbit testis.

[0016] The recombinant PCR method can be suitably used for obtaining a TpN15-TpN17 fusion gene. That is, the TpN15 gene and the TpN17 gene are obtained separately by gene amplification methods such as the above-mentioned PCR method, and a sequence complementary to the vicinity of the end of one DNA fragment to which the other DNA fragment is to be bound is added to the end of the other DNA fragment to which the other DNA fragment is to be bound, and the one gene fragment to which the end is added and the other gene fragment to which the other DNA fragment is to be bound are mixed, and gene amplification is performed by PCR using primers complementary to both ends of the intended fusion gene to obtain the desired TpN15-TpN17 fusion gene fragment.

[0017] Here, at least for silkworms, examples of gene amplification primers used in cloning the TpN47 gene using PCR and cloning the TpN15-TpN17 fusion gene using recombinant PCR are given. These examples are matters that can be easily derived by fitting each sequence of the TP antigen to the knowledge of known PCR or recombinant PCR. For the gene amplification primers given as examples here, the underlined parts of the base sequence are each terminal sequence of the gene. As in each example, it is preferable that a stop codon is added to the additional sequence at the 3' end. In addition, it is preferable that a predetermined restriction enzyme recognition site is provided in the 5' end sequence and the 3' end sequence. For example, the addition of a BamHI recognition sequence to the 5' end and the addition of a NotI recognition sequence to the 3' end sequence are exemplified, but are not limited to these. They can be freely selected depending on the vector to be incorporated, for example, the restriction enzyme site in the binary expression system described below.

[0018] (a) When the TpN47 gene is cloned using a PCR method, the following primers for TpN47 are used for the above-mentioned TP genomic DNA: 47K Primer 1: 5' end GATCC GGATCC GGCTCGTCTCATCATGAG (SEQ ID NO: 1), 47K Primer 2: 3' end TAGCC GCGGCCGC CTA AGACACACGGGATAGGAC (SEQ ID NO:2), These can be used to clone the TpN47 gene.

[0019] (b) When cloning the TpN15-TpN17 fusion gene using recombinant PCR, first, a primer for TpN17, for example, is used for the above-mentioned TP genomic DNA; 17K Primer 1: 5' end GATCC GGATCC TGTGTCTCGTGCACAACC (SEQ ID NO:3), 17K Primer 2: 3' end TAGCCGCGGCCGCCTA TTTCTTTGTTTTTTTGAGCAC (SEQ ID NO: 4), These can be used to clone the TpN17 gene.

[0020] Next, as a primer for TpN15, for example: 15K Primer 1: 5' end GATCC GGATCC TGTTCATTTAGTTCTAT (SEQ ID NO:5) 15K Primer 2: 3' end TAGCC GCGGCCGCCTA CCTGCTAATAATGGCTT (SEQ ID NO:6) These can be used to clone the TpN15 gene.

[0021] Then, the TpN15-TpN17 fusion gene can be cloned using the TpN17 gene and the TpN15 gene obtained as described above.

[0022] That is, the desired TpN15-TpN17 fusion gene can be cloned by carrying out a PCR reaction in the presence of these gene fragments and appropriate primers used for fragment fusion amplification. First, as a primer for 15K fragment 1, SEQ ID NO:5 and the following SEQ ID NO:7 Primer pair for amplification of: SEQ ID NO:5 and 15K primer 1 at the 5' end of As the 17K-5' end + 15K-3' end primer, TGTGCACGAGACACACCTGCTAATAATGGCTTCCT (SEQ ID NO:7) Prepare the above, perform PCR using the TpN15 gene obtained above as a template, and clone the 15K-linked fragment; Second, the following primers were used for 17K fragment 2: SEQ ID NO:8 and SEQ ID NO:4 Primer pair for amplification of: 5' end TGTGTCTCGTGCACAACCGT (SEQ ID NO: 8), SEQ ID NO:4 17K primer 2 at the 3' end of Prepare the above, perform PCR using the TpN17 gene obtained above as a template, and clone the 17K-linked fragment; Third, the above primers for 15K-17K amplification were used. SEQ ID NO:4 and SEQ ID NO:5 A pair of amplification primers was prepared to amplify the above-mentioned 1 and 2. 15K connection fragments and 17K connection fragments Perform PCR reaction using as a template; This allows cloning of the desired TpN15-TpN17 fusion gene.

[0023] The resulting TP antigen gene fragment can be incorporated into a plasmid vector by a standard method such as ligation or linker ligation.

[0024] <Genetically modified silkworms> Transgenic silkworms can be obtained by transforming silkworms with the TP antigen gene. Silkworms (Bombyx mori) are a species that has been cultivated for approximately 5,000 years, and are considered to be the most widely cultivated species in the world. Silkworms are domesticated species derived from the silkworm (Bombys mandarina) and are domesticated insects that have been continuously bred. Transformation methods for silkworms have already been provided, and the entire genome information has also been released (Goldsmith, MR et al., Annu. Rev. Entomol., 50:71-100, 2005).

[0025] Representative examples of the above transformation method include methods using transposon-based vectors, binary expression systems, etc., but transformation can also be performed by knocking in the TP antigen gene using TALEN, CRISPR / CAS9, etc.

[0026] A well-known method of using a vector utilizing a transposon is a plasmid vector using the transposon piggy Bac. This plasmid vector contains two inverted repeat sequences present at both ends of the transposon piggy Bac, and the TP antigen gene to be incorporated into the silkworm chromosome is inserted between the repeat sequences. When this is microinjected into silkworm eggs together with a transposase-expressing helper plasmid, the TP antigen gene region between the repeat sequences is transferred by the action of the transposase, and silkworms having the TP antigen gene incorporated into the chromosome can be obtained. However, piggy Bac is a plasmid vector that contains two inverted repeat sequences present at both ends of the transposon piggy Bac, and the TP antigen gene to be incorporated into the silkworm chromosome is inserted between the repeat sequences. When this is microinjected into silkworm eggs together with a transposase-expressing helper plasmid, the TP antigen gene region between the repeat sequences is transferred by the action of the transposase, and silkworms having the TP antigen gene incorporated into the chromosome can be obtained. When Bac is used, there are limitations such as the fact that the TP antigen gene is inserted almost randomly into the base sequence TTAA in the silkworm genome and that the size of the DNA fragment that can be inserted is limited to approximately 20 kb or less.

[0027] Examples of binary expression systems include the GAL4 / UAS system, the IE1 / hr3 system, the Tet-On / Off system, etc. Of these, the GAL4 / UAS system has already been used in silkworms (M. Imamura et al., Genetics 165:1329-1340, 2003: Non-Patent Document 5).

[0028] In the GAL4 / UAS system, constructs (trap constructs) in which the GAL4 gene is placed under a basal promoter are created and integrated into various genomic regions. When the integrated trap construct is under the control of a certain enhancer, a basal promoter such as the sericin 1 promoter traps the enhancer, and GAL4, a yeast-derived transcription activation factor, is expressed. When the enhancer is active only in a specific group of silkworm cells, GAL4 is expressed only in that group of cells. The sericin 1 promoter functions in the expression of sericin 1 in the middle silk gland of silkworms. Of the three types of sericin, sericin 1-3, sericin 1 is the one that is secreted the most. Then, if the TP antigen gene, which is the subject of the present invention, is expressed in the middle silk gland of silkworms and the TP antigen is secreted into the sericin layer of the cocoon filament, sericin is water-soluble and can be dissolved in an aqueous solvent such as a phosphate buffer solution, making it easy to extract the TP antigen and less likely to lose its activity. For these reasons, the sericin 1 promoter is the basic promoter most preferably used when the GAL4 / UAS system is applied to the present invention. However, when the target gene, the TP antigen gene, is directly linked to the sericin 1 promoter, the expression level is insufficient, so it is preferable to use a binary expression system that enhances the expression. For example, when a construct in which the TP antigen gene is located downstream of UAS (upstream activator sequence), which is the recognition sequence of GAL4, is integrated into the genome, the expressed GAL4 is recognized and activated by UAS, and the TP antigen gene is efficiently expressed.

[0029] Ectopic gene expression using such a GAL4 / UAS system can be carried out in double transgenic silkworms obtained by crossing a GAL4 transgenic individual (driver) with a UAS transgenic individual (effector) of a transgenic silkworm.

[0030] The IE1 / hr3 system uses the property of the IE1 transactivator and hr3 enhancer of the baculovirus that infects insects to control gene expression in the host insect, increasing the expression level of the target gene, the TP antigen gene. IE1 expressed by the sericin 1 promoter activates hr3, thereby increasing the expression level of the target protein, the TP antigen protein.

[0031] In the Tet-On / Off system, the tetracycline-controlled activator of E. coli activates the expression of the TP antigen gene, which is an introduced gene connected downstream of a transcriptional regulatory response element sequence. When tetracycline or doxycycline is administered, it binds to and inhibits the activator, so that the expression of the TA antigen gene can be turned on and off by administering these drugs.

[0032] Whether or not a gene of interest, for example, a GAL4 gene or a TP antigen gene, has been introduced into a silkworm and is being expressed can be confirmed by introducing a marker gene downstream of the gene of interest, such as the GAL4 gene or the TP antigen gene, to be introduced. As the marker gene, a fluorescent protein gene is preferably used. As the fluorescent protein genes, genes of fluorescent proteins of two or more colors can be used as necessary. For example, if a red fluorescent protein gene is used as a marker for one silkworm (for example, a driver silkworm) and a green fluorescent protein gene is used as a marker for the other silkworm (effector silkworm), yellow fluorescence, a combination of red and green, can be observed from silkworms into which both genes have been introduced by crossing, and this yellow fluorescence can be used as an indicator to select silkworms into which both the driver gene and the effector gene have been introduced.

[0033] (4) TP antigen mixture of the present invention As described above, the TP antigen mixture of the present invention is a mixture of 47-antigen and 15-17 antigen. The mixing ratio of 47-antigen and 15-17 antigen is preferably 4:6-6:4 (mass ratio). The TP mixture of the present invention may be in the form of an aqueous composition dissolved in an aqueous solvent, or may be a lyophilized product or the like, or may be immobilized on a solid phase. The concentration of the TP antigen mixture of the present invention in the aqueous composition can be freely set depending on the purpose of use of the mixture.

[0034] (5) Body fluid samples The body fluid sample to be subjected to the measurement method of the present invention is not limited as long as it is a body fluid sample that may contain anti-TP antibodies due to syphilis infection. Examples include blood samples, saliva samples, and urine samples. Among these, blood samples are particularly preferred. Examples of blood samples include whole blood samples, serum samples, and plasma samples, and serum samples and plasma samples are more preferred. If necessary, anticoagulants and the like may be added, and serum obtained by absorbing nonspecific antibodies with the heated culture supernatant of the TP Reiter strain is also acceptable. Dilution with physiological saline or a buffer solution is also performed as appropriate.

[0035] (6) Immunological measurement method The immunological measurement method used in the measurement method of the present invention is not limited as long as it is a means capable of measuring anti-TP antibodies in a body fluid sample by an antigen-antibody reaction between the anti-TP antibodies in the body fluid sample and the TP antigen mixture of the present invention. To that extent, enzyme immunoassay, immunoturbidimetry, radioimmunoassay, latex agglutination or turbidimetry (hereinafter referred to as latex agglutination or turbidimetry), hemocyte or particle agglutination (hereinafter referred to as hemocyte or particle agglutination), immunochromatography, etc. can be used.

[0036] Examples of enzyme immunoassays include EIA (Enzyme Immunoassay). , ELISA (Enzyme-Linked Immunosorbent Assay), FEIA ( Fluorescence Enzyme Immunoassay (CLEIA) (Chemiluminescent Enzyme Immunoassay), CLIA( Examples include chemiluminescent immunoassay (CLIA). The abbreviation CLIA is often used to mean CLEIA.

[0037] Examples of the immunoturbidimetric method include nephelometry and IA (Turbidimetric Immunoassay).

[0038] Examples of radioimmunoassays include RIA (Radio Immunoassay) and CPBA (Competitive Protein Binding Assay).

[0039] Examples of latex agglutination and turbidimetric methods include LA (latex agglutination), LA (latex agglutination turbidimetric immunoassay), LPIA (latex photometric immunoassay), KIMS (kinetic interaction of microparticles), and colloidal gold immunoassay.

[0040] Examples of blood cell / particle agglutination methods include PA (Particle Agglutination Reaction) ), PHA (Passive Hemagglutination), etc.

[0041] In the measurement method of the present invention, specifically, the TP antigen mixture of the present invention is applied as a TP antigen for capturing anti-TP antibodies in a body fluid sample in each of the above immunological measurement methods. The specific form of application can be freely selected depending on the measurement method to be applied.

[0042] In the measurement method of the present invention, when enzyme immunoassay is performed, for example, in ELISA, a TP antigen mixture is fixed to the well of a 96-well plate used as a solid phase, and a body fluid sample is brought into contact with the mixture to bind the anti-TP antibody in the body fluid sample to the TP antigen mixture fixed to the well, and then an anti-human antibody with a specific enzyme label is brought into contact with the TP antigen mixture in the body fluid sample on the well to which the anti-TP antibody in the body fluid sample has bound, and the anti-TP antibody in the body fluid sample can be measured by the color signal obtained from the enzyme label. In other enzyme immunoassays, the TP antigen mixture of the present invention is fixed to a solid phase according to each measurement method, for example, a specific particle, etc., and the anti-TP antibody in the body fluid sample is brought into contact with the TP antigen mixture to which the anti-TP antibody fixed to the solid phase has bound, and the anti-human antibody labeled according to the type of measurement method is bound to the TP antigen mixture to which the anti-TP antibody fixed to the solid phase has bound, and the anti-TP antibody in the body fluid sample can be measured by the signal from the specific label, for example, a fluorescent substrate (FEIA), a chemiluminescent substrate (CLEIA or CLIA), etc.

[0043] When using the immunoturbidimetric method, the body fluid sample is contacted with the TP antigen mixture of the present invention in the liquid phase, and the light scattering intensity (nephelometry) or transmittance (IA) of the liquid phase is measured to detect the anti-TP antigen in the body fluid sample. antibody can be measured.

[0044] When a radioimmunoassay is used, for example, in RIA, a competitive antigen-antibody reaction is carried out between an RI-labeled antibody and an anti-TP antibody in a body fluid sample against a certain amount of the TP antigen mixture of the present invention, and the labeled antibody bound to the antigen (bound type) and the labeled antibody not bound to the antigen are separated. The free form is separated, and its ratio can be measured as the concentration of anti-TP antibodies from its radioactivity. Methods include the double antibody method, in which the antigen-antibody complex is precipitated with a second antibody, the ammonium sulfate salting-out method, in which precipitation is performed with ammonium sulfate, and PEG precipitation. In the CPBA method, the reaction between the RI-labeled antibody and the TP antigen mixture of the present invention fixed to the solid phase is competitively reacted with the anti-TP antibody in the body fluid sample that is not labeled with RI, and then the bound antibody and free antibody are separated and their radioactivity can be measured.

[0045] When using the latex agglutination method and turbidimetry, for example, the latex agglutination reaction is a method in which the TP antigen mixture of the present invention is sensitized to latex particles, which are a solid phase, and an antigen-antibody reaction is carried out between the sensitized latex particles and the anti-TP antibodies in the body fluid sample, and the presence of anti-TP antibodies in the body fluid sample is determined based on the presence or absence of agglutination due to the antigen-antibody reaction. The reaction is mainly carried out on a slide glass, and the cloudy state is observed. The latex agglutination turbidimetry method is a method in which the presence or absence of anti-TP antibodies in the body fluid sample is determined based on the change in turbidity of the reaction solution accompanying the agglutination of the sensitized latex in the above-mentioned latex agglutination reaction. antibody The latex near-infrared turbidimetry is a method for measuring the amount of anti-TP in a body fluid sample based on the transmittance of the turbidity of the reaction solution caused by the agglutination of sensitized latex in the latex agglutination reaction described above, which is automated. antibody The microparticle turbidimetric method uses the microparticles to which the TP antigen mixture of the present invention is bound as a solid phase to carry out an antigen-antibody reaction with anti-TP antibodies in a body fluid sample, and measures the turbidity of agglutination caused by the antigen-antibody reaction from the transmittance to measure the anti-TP concentration in the body fluid sample. antibody The gold colloid immunoassay is a method for measuring anti-TP antibodies in a body fluid sample captured by an antigen-antibody reaction with the TP antigen mixture of the present invention, and then reacts with a gold colloid-labeled TP antigen, and the anti-TP antibodies in the body fluid sample are detected by the coloring of the gold colloid. antibody This is a method for determining the presence of. This principle is also used in immunochromatography.

[0046] When using the blood cell / particle agglutination method, for example, the particle agglutination reaction is carried out by using gelatin particles or the like to which the TP antigen mixture of the present invention is adsorbed (bound) as a solid phase to detect anti-TP antigens in a body fluid sample. antibody In the passive hemagglutination reaction, sensitized red blood cells having the TP antigen mixture of the present invention fixed on their surfaces are reacted with anti-TP antibodies in a body fluid sample, and the presence of anti-TP antibodies in the body fluid sample is determined based on the presence or absence of agglutination due to the antigen-antibody reaction.

[0047] Immunochromatography is an immunological measurement method that utilizes the property that when a liquid is dropped onto a nitrocellulose membrane or the like, it moves on the membrane due to capillary action. First, a body fluid sample is contacted with the labeled TP antigen mixture of the present invention to form a labeled antigen-antibody complex, and as the antigen-antibody complex moves across the membrane, the antigen-antibody complex is captured by the TP antigen immobilized downstream, and the presence or absence of the label determines the presence or absence of anti-TP in the body fluid sample. antibody It can determine the presence or absence of the disease. It is also used as a tool for point-of-care testing (POCT). More details will be provided later.

[0048] The present invention provides the above-mentioned measurement method in an embodiment in which a solid phase fixation of the TP antigen mixture is used. The solid phase fixation includes tubes, columns, etc. on which the above-mentioned TP antigen mixture is fixed; multi-well plates such as 96-well plates; particles such as latex particles, gelatin particles, microparticles; etc. The present invention also provides these fixations (hereinafter also referred to as the solid phase of the present invention).

[0049] Furthermore, the present invention provides a solid-phase region for a TP antigen mixture, a detection region for detecting a complex of the mixture of antigens and the anti-TP antibody in the body fluid sample, the complex being formed by contact between the solid-phase region and the body fluid sample and moving in the continuous phase by capillary action mediated by the aqueous phase, is provided downstream of the solid-phase region; The present invention provides an immunochromatographic device for measuring Treponema pallidum (hereinafter also referred to as the device of the present invention).

[0050] (7) Method of providing data, etc. The measurement method of the present invention can also be expressed as a data acquisition method in which, for example, a body fluid sample is contacted with the TP antigen mixture of the present invention, anti-TP antibodies in the body fluid sample are measured as a signal representing binding with the TP antigen mixture, and the signal is acquired as data on syphilis infection of the sample donor. This is what we have in mind.

[0051] The present invention also provides a kit for carrying out the measurement method of the present invention, which contains the solid phase of the present invention as an element (hereinafter, also referred to as the kit of the present invention). The kit of the present invention can also contain other kit elements, such as a diluent, a labeled second antibody, and a label revealing reagent, which are used in the measurement depending on the specific immunological measurement method. Effect of the Invention

[0052] INDUSTRIAL APPLICABILITY The present invention provides a means for measuring anti-TP antibodies in body fluid samples, which has a measurement sensitivity at a practical level clearly improved over conventional products. [Brief description of the drawings]

[0053] [Figure 1] 1 is a diagram showing an example of a device when the measurement method of the present invention is carried out by immunochromatography. [Diagram 2] 1 is a diagram showing an example of the measurement principle when the measurement method of the present invention is carried out by immunochromatography. [Diagram 3] 1 is a diagram illustrating the measurement principle when the measurement method of the present invention is carried out by an enzyme immunoassay such as an ELISA method. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0054] An embodiment of the present invention will be described with reference to the drawings.

[0055] FIG. 1 is a diagram showing an example of a device when the measurement method of the present invention is performed by immunochromatography. The immunochromatography device 10 (hereinafter, device 10) is configured by fixing a moisture absorption phase 1, a mobile phase 2, and a specimen dropping / reaction phase 3 on a packing sheet 5, and the moisture absorption phase 1, the mobile phase 2, and the specimen dropping / reaction phase 3 are in contact with each other in a form that allows moisture to flow between them. The mobile phase 2 is provided with a color development area 21. When a body fluid specimen is dropped onto the specimen dropping / reaction phase 3, the anti-TP antibody in the specimen reacts with the TP antigen mixture contained in the specimen dropping / reaction phase 3 to form a bond of an anti-TP antibody-TP antigen complex. This bond moves by capillary action in the direction of 3 → 2 → 1, and is captured in the color development area 21 in which a capture means for the anti-TP antibody-TP antigen complex and a signal color development means are provided, and a predetermined color is generated. In order to promote the migration due to the capillary phenomenon, a separate developing solution may be added directly to the sample dropping / reaction phase 3 or from its upstream. Free TP antigen and developing solution are trapped in the water absorption phase 1. The water absorption phase 1 has a function of rectifying the capillary phenomenon in addition to the trapping function, and is preferably made of a material with high water absorption power such as cotton or filter paper. The above-mentioned specific color development signals the presence of anti-TP antibodies in the body fluid sample. If color is developed, it is determined that anti-TP antibodies are present in the body fluid sample (positive), and if no color is developed, it is determined that the anti-TP antibodies are not present (negative).

[0056] FIG. 2 is a diagram showing an example of the measurement principle using the device 10. The basic reaction principle in the device 10 is an antigen-antibody reaction between the anti-TP antibody in the body fluid sample and the TP antigen mixture of the present invention. In the sample dropping / reaction phase 3 shown in FIG. 2, sensitized particles 41, which are particles 61 sensitized with "TP antigen mixture 50, which is a mixture of 15-17 antigen 52 and 47 antigen 53", are attached in a state in which they can move due to capillary action mediated by moisture. Examples of the particles 61 include colored latex particles, fluorescent particles, and metal colloid particles such as gold colloid. In addition, it is also possible to use a TP antigen mixture 50 directly carrying a label such as a color-developing enzyme without using the particles 61. As the above-mentioned metal colloid, it is also possible to use colloids of different metals such as silver colloid and selenium colloid in addition to gold colloid. In addition, the label such as the color-developing enzyme generates a predetermined signal by reacting with a label revealing reagent such as a substrate for the color-developing enzyme in the color-developing area 21. The label revealing reagent can be dropped separately onto the color-developing area 21. However, it is preferable to attach the revealing reagent to the color-developing area 21 in advance and provide a mechanism in the color-developing area 21 in which a signal is automatically generated by the presence of moisture that has moved due to capillary action.

[0057] As described above, a blood sample is preferable as a body fluid sample that may contain the anti-TP antibody 51. Examples of blood samples include whole blood samples, serum samples, plasma samples, etc., and a serum sample or plasma sample is preferable. Since the anti-TP antibody 51 in the body fluid sample is an antibody produced as a humoral immune response when a subject is infected with TP, the presence of the anti-TP antibody 51 in the body fluid sample is a signal regarding the subject's syphilis infection, i.e., a signal that the subject is infected with syphilis or at least has been infected with syphilis.

[0058] The material of the specimen dropping / reaction phase 3 is not limited as long as it is a material to which the sensitized antigen 41, etc. can be attached when dried, and in the liquid phase of the body fluid specimen, developing solution, etc., the TP antigen in the TP antigen mixture or the anti-TP antibody-TP antigen complex can be dissociated. Examples of the material include glass fiber, cotton, and filter paper. Also, the specimen dropping phase (not shown) and the reaction phase may be provided separately. In this case, the specimen dropping phase is placed upstream of the reaction phase to which the sensitized particles 41, etc. are attached. As described above, the developing solution that may be added is not limited as long as it does not inhibit the antigen-antibody reaction and allows the progression of 3→2→1 by capillary action in the device 10, and various aqueous solvents, such as water, buffer solution, and physiological saline, are exemplified.

[0059] In the device 10, first, the anti-TP antibody 51 in the body fluid sample comes into contact with the TP antigen mixture 50 (consisting of a number of 15-17 antigens 52 and a number of 47 antigens 53) sensitized to the surface of the sensitized particle 41 attached to the sample dropping / reaction phase 3 (Figure 2(1)), and a particle 42 carrying the anti-TP antibody-TP antigen complex (complex-carrying particle 42) is formed by the antigen-antibody reaction (Figure 2(2)).

[0060] The mobile phase 2 is a material through which the TP antigens in the TP antigen mixture or the complex-carrying particles 42 can move by the capillary phenomenon mediated by moisture, and is not particularly limited as long as it is a material that can be provided with the color-developing area 21, and examples thereof include nitrocellulose membranes, cellulose nanofibers, glass fibers, silica gel, and the like. The complex-carrying particles 42 that reach the color-developing area 21 by the capillary phenomenon are captured in the color-developing area 21. The capturing means is integrated with the color-developing means. Specifically, the TP antigens are immobilized in a line shape in the color-developing area 21. The immobilization must be strong enough not to move or diffuse due to moisture. In addition, the TP antigens immobilized in the color-developing area 21 are preferably the TP antigen mixture 50, but may be other TP antigens, such as native TP antigens or TP antigens transformed in a different host. In addition, the shape may be any design other than a line shape, such as a dot shape or a circle shape, and is not limited at all. The complex-carrying particles 42 that have been moved by capillary action react with the TP antigen immobilized in the color-developing area 21 and the anti-TP antigen on the complex-carrying particles 42. antibody The TP antigen is captured by binding with 51 through an antigen-antibody reaction, forming a sandwich complex 43 called "immobilized TP antigen-anti-TP antibody-TP antigen" (Figure 2 (3)).

[0061] The sandwich complex 43 is revealed by coloring in the color-developing area 21 due to the intended action, thereby measuring the presence of anti-TP antibodies in the body fluid sample. For example, in the case of colored particles such as colored latex or gold colloid, the above-mentioned sandwich complex 43 is formed in the color-developing area 21, and the color of the latex or the red color of the gold colloid is visually revealed. In the case of a color-developing enzyme such as alkaline phosphatase (ALP) or peroxidase, contact with a color-developing substrate such as 5-bromo-4-chloro-3-indolyl-phosphate disodium salt or DAB (3,3'-diaminobenzidine tetrahydrochloride) will result in As described above, if the anti-TP antibody is positive using the method of the device 10, it is highly likely that the sample provider is or was previously infected with syphilis, and if it is negative, it indicates that the subject is not infected with syphilis or is in a wait-and-see state. Since syphilis requires long-term follow-up, it is possible to obtain reliable data for a definitive diagnosis of syphilis by monitoring over time using the highly sensitive and easily usable device 10.

[0062] Fig. 3 is a diagram showing the measurement principle when the measurement method of the present invention is performed by an enzyme immunoassay such as ELISA. In Fig. 3, the solid phase 62 has a structure in which the antigen-antibody reaction related to the measurement method of the present invention occurs on its inner wall. For example, a well of a multi-hole plate such as a 96-well plate is typical, but this is not limited thereto and is merely an example, and other embodiments such as a column surface, particles, tubes, etc. may also be used. In any case, the first step is to bring the anti-TP antibody 51 in the body fluid sample into contact with the TP antigen mixture 50 fixed on the solid phase 62 to cause an antigen-antibody reaction (Fig. 3(1)).

[0063] The second step is to contact the solid-phase-fixed TP mixture 50-anti-TP antibody 51 complex 501 formed in the first step with a second antibody 54 carrying a labeling substance such as a color-developing enzyme, which is an anti-human antibody against the anti-TP antibody 51 (Figure 3(2)).

[0064] The third step is a color development process in which a label revealing reagent 55 such as a reaction substrate is allowed to react with the sandwich complex 502 consisting of the solid-phase fixed TP mixture 50-anti-TP antibody 51 complex 501-second antibody formed in the second step to develop color (Figure 3(3)).

[0065] By measuring the signal 56 such as color development in the third step, the anti-TP antibody 51 in the body fluid sample can be measured. As shown in Figure 3(4), by using a calibration curve relating the signal intensity to the amount of anti-TP antibody, not only qualitative but also quantitative measurement is possible. EXAMPLES

[0066] Test examples and working examples of the present invention will be disclosed below.

[0067] [Production Example 1] Purification of recombinant TP antigen Approximately 100 cocoons produced by the 47 recombinant silkworm and the 15-17 recombinant silkworm, which were purchased by on-demand order from Rimco Co., Ltd. (Uruma City, Okinawa Prefecture), were used to extract and purify the silkworm recombinant TP antigen. These cocoons were cut into pieces of approximately 5 mm in size with scissors, soaked in PBS-1% Tritonx-100, and stirred overnight at 4°C with a stirrer. Next, insoluble matter was filtered off with filter paper (Whatman) to obtain an extract. The extract was concentrated with a centrifugal concentrator (Sartorius Vivaspin 20) and gel-filtered with a Sephacryl S-200HR XK50 / 60 (GE) column and Tris-HCl buffer. The antigen fraction was concentrated with a centrifugal concentrator to obtain a purified recombinant antigen. The purification results are shown in Table 1.

[0068] [Table 1]

[0069] [Reference Example 1] Reactivity comparison by ELISA Native antigens and recombinant silkworm antigens (TpN47, TpN15-17) were each diluted with 10 mM phosphate buffer and dispensed at 100 μL / well at a concentration of 5 μg / mL into each well of a 96-well ELISA plate (BECTON DICKINSON), and the well walls were sensitized by leaving the plate overnight at 4° C. After sensitization, the plate was blocked with 10 mM phosphate buffer containing 1% bovine serum albumin at 37° C. for 2 hours, washed and dried to prepare sensitized ELISA plates for each antigen.

[0070] 50 μL of anti-TP antibody standard solution (Sekisui Medical) of various concentrations was dispensed into each well and incubated at room temperature for 60 minutes. After washing with 0.05% Triton X100-10 mM phosphate buffer, 50 μL of peroxidase-labeled anti-human IgG (DAKO) was added and incubated at room temperature for 1.5 hours. After washing with 0.05% Triton X100-10 mM phosphate buffer, 50 μL of a mixed solution of hydrogen peroxide and TMB (3,3',5,5'-tetramethylbenzidine) was added and color developed for 3 minutes. After stopping the reaction, the absorbance at 450 nm was measured with a spectrophotometer. The results are shown in Table 2.

[0071] [Table 2]

[0072] [Example 1] Test using an immunochromatographic test device (1) Preparation of test devices An immunochromatographic device as shown in Figure 1 was fabricated.

[0073] The recombinant silkworm TpN47 antigen and the recombinant silkworm TpN15-17 antigen were each dissolved in 1 mg / ml phosphate buffer and mixed in equal volumes to prepare a mixed antigen stock solution. The concentration of each antigen in the mixed antigen stock solution was 0.5 mg / ml. One volume of this mixed antigen stock solution was added to 9 volumes of a latex suspension in which red latex particles (Bangs Laboratory) were similarly suspended in phosphate buffer, and the mixture was mixed by inversion at 4°C for 5 hours. A 1% BSA-containing lysate was added to the mixture and mixed. The mixture was subjected to blocking treatment with a phosphate buffer solution to obtain a solution containing mixed antigen-sensitized latex particles.

[0074] The above antigen-sensitized latex particle suspension was uniformly applied to a glass fiber sheet (Millipor) cut into small pieces, and the sheet was placed in a vacuum drying apparatus and dried under reduced pressure for 20 hours to prepare a conjugate pad corresponding to the sample drop / reaction phase 3 in the device 10 in FIG. 1 (hereinafter referred to as the conjugate pad). The above recombinant antigen mixture solution was applied to a nitrocellulose membrane for immunochromatography (IMMUNOPORE), which corresponds to the mobile phase 2 in FIG. 1, using a spotting machine (BIODOT XYZ3050), to provide a linear coloring line corresponding to the coloring area 21 (hereinafter referred to as the line-applied membrane). Filter paper (manufactured by Whatman) was used as the moisture absorption phase in FIG. 1. The conjugate pad, applied membrane, and filter paper cut to the appropriate width and length were combined as shown in FIG. 1 to prepare a test device for measurement (hereinafter referred to as this product).

[0075] When a body fluid sample is dropped onto the conjugate pad, the anti-TP antibody in the body fluid sample reacts with the TP antigen-sensitized red latex beads contained in the conjugate pad to form a complex of anti-TP antibody-TP antigen-sensitized latex beads. This complex moves on the line-coated membrane, which is the mobile phase, and binds to the TP antigen immobilized on the downstream side as a linear colored line, forming a sandwich-type complex of immobilized TP antigen-anti-TP antibody-TP antigen-sensitized red latex beads. Note that the movement on the membrane may or may not involve a developing solution. Depending on the presence or absence of a red line of the latex beads that is thus revealed, it is possible to determine whether or not the signal related to syphilis of the sample donor is positive. If a red line appears, the syphilis signal is positive.

[0076] (2) Comparison of the test device using recombinant silkworm antigens with commercially available test reagents In this test, human serum was used as the body fluid sample. No developing solution was used for the membrane migration of the complex. A 2-fold dilution series was prepared with anti-TP antibody-negative healthy human serum, with an anti-TP antibody concentration of 18.75mIU / mL. This diluted serum was measured with Serodia TPPA (Fujirebio) and the above test device (this product) using recombinant silkworm antigen sensitized to red latex beads as described above. Serodia TPPA was used according to the prescription in the attached document, and 100μL of serum was dropped onto the conjugate pad and developed on the membrane, and after 15 minutes, the positive or negative was judged based on the appearance of a red line. The results are shown in Table 3. In Table 3, "+" indicates positive, "-" indicates negative, and "±" indicates pending judgment.

[0077] [Table 3]

[0078] Serodia TPPA gave a negative result at a 32-fold dilution (9.38mIU / mL), but this product gave a positive result up to a 128-fold dilution (2.34mIU / mL). This clearly demonstrated the high sensitivity of this product. Although Serodia TPPA, the standard method for measuring anti-TP antibodies, uses native antigens, the superiority of the recombinant silkworm-derived TP antigen mixture was nevertheless observed.

[0079] (3) Comparison of syphilis seroconversion panel assays with commercially available test reagents As mentioned above, syphilis is latent, so to confirm the performance of a test reagent at a practical level, it is necessary to examine the effect over time, and testing using a seroconversion panel is suitable for this purpose. After TP infection, the production of humoral antibodies does not occur all at once, but increases gradually from a small amount. Therefore, a highly sensitive reagent can measure from a smaller amount of humoral antibodies, making it possible to contribute to the diagnosis of TP infection from an earlier stage after TP infection. The performance of a reagent from this perspective can be examined by using a seroconversion panel. In other words, this is positioned as an examination of the performance of a reagent at a practical level.

[0080] A commercially available seroconversion panel (PSS901 / SeraCare) was measured using Espline TPAb (Fujirebio), a reagent containing an immunochromatographic device, the above-mentioned Serodia TPPA, and this product. Espline TPAb is a reagent containing a measurement device that uses E. coli recombinant antigens and can individually determine TpN15-17 and TpN47, and measurements were performed according to the instructions in the package insert. This product was used in the same manner as in (2) above. The results are shown in Table 4. The meanings of "+", "-", and "±" in Table 4 are the same as in Table 3.

[0081] [Table 4]

[0082] Tp15-17 of Espaline TPAb was judged as pending on the 45th day, positive on the 48th day, and TpN47 was judged as positive on the 52nd day. In addition, Serodia TPPA was judged as positive on the 45th day. On the other hand, this product was judged as positive on the 31st day, and was clearly able to capture anti-TP antibodies earlier than the other two methods. It is generally said that IgM appears in the blood about 30 days after infection, and IgG appears about 45 days after infection, but this product is thought to have reacted with IgM as well. Although it is said that it is difficult to capture IgM using recombinant silkworm antigens in anti-TP antibody measurement, it was shown that this product using the TP antigen mixture of the present invention is possible.

[0083] [Example 2] Test by ELISA method Native antigen (Tokiwa Chemical) and the mixture (TP antigen mixture) of recombinant antigens (TpN47, TpN15-17) derived from silkworms prepared in Example 1 (1) above were diluted with 10 mM phosphate buffer, and 100 μL of each solution was dispensed into each well of a 96-well ELISA plate (Becton Dickinson) at a concentration of 5 μg / mL, and the plate was left overnight at 4° C. for sensitization. After sensitization, the plate was blocked with 10 mM phosphate buffer containing 1% bovine serum albumin at 37° C. for 2 hours, washed, and dried to prepare sensitized ELISA plates for each antigen.

[0084] 50 μL of anti-TP antibody standard solution (Sekisui Medical) of various concentrations was dispensed into each well and incubated at room temperature for 60 minutes. After washing, 50 μL of peroxidase-labeled anti-human IgG (DAKO) was added and incubated at room temperature for 1.5 hours. After washing, 50 μL of a mixed solution of hydrogen peroxide and TMB (3,3',5,5'-Tetramethylbenzidine) was added and color developed for 3 minutes. After stopping the reaction with sulfuric acid solution, the absorbance at 450 nm was measured with a spectrophotometer. The results are shown in Table 5.

[0085] [Table 5]

[0086] These results demonstrated that when the TP antigen mixture of the present invention is used, anti-TP antibodies in body fluid samples can be measured with extremely high sensitivity even in ELISA, as compared with the use of native antigens.

[0087] The results of Examples 1 and 2 demonstrated that the use of immunological measurement methods, such as immunochromatography and ELISA, in measuring anti-TP antibodies in body fluid samples can contribute to earlier diagnosis of syphilis. [Explanation of symbols]

[0088] 1: Water absorption phase 2: Mobile phase 21: Coloring area 3: Sample instillation and reaction phase 10: Immunochromatography device 41: Sensitizing particles 42: Complex-supported particles 43,502: Sandwich complex 50:TP antigen mixture 501: Solid-phase-fixed TP mixture-anti-TP antibody complex 51: Anti-TP antibody 52:15-17 antigen 53:47antigen 54:Second antibody 55: Label revealing reagent 56: Signal 61: Particle 62: Solid phase

Claims

1. A method for measuring antibodies in body fluids, comprising contacting a blood sample (excluding serum samples) with a mixture of recombinant TpN47 antigen derived from the cocoon filaments or silk gland of a genetically modified silkworm transformed with the TpN47 gene, which is an artificial surface antigen of Treponema pallidum, and recombinant TpN15-TpN17 fusion antigen derived from the cocoon filaments or silk gland of a genetically modified silkworm transformed with a fusion gene of the TpN15 gene and the TpN17 gene, and measuring anti-Treponema pallidum antibodies in the blood sample by an immunological measurement method as a binding signal with the mixture of antigens.

2. The method according to claim 1 , wherein the immunological measurement method is an enzyme immunoassay, an immunoturbidimetric method, a radioimmunoassay, a latex agglutination or turbidimetric method, a hemocyte or particle agglutination method, or an immunochromatography method.

3. The method according to claim 1 or 2, wherein a solid phase fixation of the mixture of the recombinant TpN47 antigen and the recombinant TPN15-TPN17 fusion antigen is used.

4. A solid phase on which an antigen is immobilized, the solid phase being used for measuring anti-Treponema pallidum antibodies in a blood sample (excluding serum samples), the solid phase having a mixture of recombinant TpN47 antigen derived from the cocoon filaments or silk gland of a genetically modified silkworm transformed with the TpN47 gene, which are artificial surface antigens of Treponema pallidum, and recombinant TpN15-TpN17 fusion antigen derived from the cocoon filaments or silk gland of a genetically modified silkworm transformed with a fusion gene of the TpN15 gene and the TpN17 gene.

5. The solid-phase region is provided with a mixture of a recombinant TpN47 antigen derived from the cocoon filaments or silk gland of a recombinant silkworm transformed with the TpN47 gene, which is an artificial surface antigen of Treponema pallidum, and a recombinant TpN15-TpN17 fusion antigen derived from the cocoon filaments or silk gland of a recombinant silkworm transformed with a fusion gene of the TpN15 gene and the TpN17 gene; a detection region for detecting a complex between the mixture of antigens and an anti-Treponema pallidum antibody in a blood sample, the complex being formed by contact between the solid-phase region and the blood sample (excluding a serum sample) and moving in a continuous phase by capillary action mediated by an aqueous phase, is provided downstream of the solid-phase region; Immunochromatographic device for measuring Treponema pallidum.

Images