Adeno-associated virus (AAV) producing cell lines and related methods

Abstract

The present disclosure relates to mammalian cell lines for producing adeno-associated viruses (AAV), preferably comprising nucleic acids encoding helper genes and AAV genes under the control of a derepressible promoter. The disclosure also relates to isolated nucleic acid molecules encoding such genes and methods of using mammalian cells for the production of AAV.

Description

[Technical Field]

[0001] The present disclosure relates to a mammalian cell line for producing adeno-associated virus (AAV). The cells preferably contain nucleic acids encoding helper genes and AAV genes under the control of a derepressible promoter. The present disclosure also relates to isolated nucleic acid molecules encoding such genes and methods for using the mammalian cells for the production of AAV.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The above ASCII copy, created on December 17, 2019, is named 0132-0049WO1_SL.txt and is 364,567 bytes in size. [Background technology]

[0003] The safety profile and long-term expression capability of adeno-associated virus (AAV) make it an excellent viral vector for gene therapy in humans. The wild-type AAV genome consists of a 4.7 kb single-stranded DNA containing regulatory genes for replication (Rep) and structural genes for capsid (Cap), flanked by inverted terminal repeats (ITRs) for viral replication and packaging. As a virus-dependent virus, AAV replication in host cells requires co-infection with a helper virus such as adenovirus (Ad) and herpes simplex virus (HSV). Alternatively, expression of cloned helper genes can also support AAV replication. For example, recombinant AAV can be produced in HEK293 cells by co-transfection of three plasmids: the pHelper plasmid expressing adenovirus-derived E2A, E4, Orf6, and VA; the pRep-Cap plasmid for the Rep and Cap proteins; and an AAV transfer plasmid carrying the desired gene of interest (GOI).

[0004] Currently, AAV production relies on several bridge platforms. In addition to the triple transfection in HEK293 cells described above, AAV can be produced by co-infecting insect cells with two baculoviruses, each expressing a Rep-Cap and a GOI. However, these baculoviruses are unstable at higher passages and require time for preparation (see, for example, Urabe et al., "Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors," Human Gene Therapy 13:1935-1943 (2002)). HeLa packaging cells with stably integrated Rep-Cap and a GOI have also been developed. These systems nevertheless still require wild-type adenovirus as a helper virus, which poses the risk of replicating adenovirus contamination in AAV products (see, e.g., Robert et al., “Manufacturing of recombinant adeno-associated viruses using mammalian expression platforms,” Biotechnology Journal 12:1600193(1-16)(2017)).

[0005] There is a need for cell lines and associated methods for producing AAV that are easily scalable to large-scale production to provide reproducible and consistent results while limiting contamination and reducing costs. Summary of the Invention

[0006] In some embodiments, provided herein is a mammalian cell for producing adeno-associated virus (AAV), comprising a nucleic acid molecule encoding a viral helper gene under the control of a first repressible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second repressible promoter, and a nucleic acid molecule encoding a repression element of the first and second repressible promoters.

[0007] In a further embodiment, the adenovirus helper genes include the E2A and E4Orf6 genes under the control of a first repressible promoter, the AAV genes include the Rep and Cap genes under the control of a second repressible promoter, and the AAV genes include the E2A and E4Orf6 genes under the control of a third repressible promoter. De-suppression A virus-associated non-coding RNA under the control of a possible promoter and two inverted terminal repeat (ITR) sequences and the first, second, and third De-suppression Provided herein are mammalian cells for producing adeno-associated virus (AAV) comprising a nucleic acid molecule encoding a repression element of a possible promoter.

[0008] In a further embodiment, the adenovirus helper genes include the E2A and E4Orf6 genes under the control of a first repressible promoter, the AAV genes include the Rep and Cap genes under the control of a second repressible promoter, and the AAV genes include the E2A and E4Orf6 genes under the control of a third repressible promoter. De-suppression Provided herein is an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters.

[0009] In yet a further embodiment, there is provided a method of producing adeno-associated virus (AAV) in mammalian cells, comprising: introducing into the mammalian cells adenoviral helper genes comprising E2A and E4Orf6 genes under the control of a first repressible promoter; AAV genes comprising Rep and Cap genes under the control of a second repressible promoter; and a third repressible promoter. De-suppressionProvided herein are methods comprising transfecting a mammalian cell with an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a first, second, and third derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of a first, second, and third derepressible promoter, treating the mammalian cell with a binding partner of the repression elements, activating the first, second, and third derepressible promoters, producing AAV, and recovering the AAV.

[0010] In a further embodiment, a method of treating a mammalian cell with adeno-associated virus (AAV) comprises transfecting a mammalian cell with adenovirus helper genes comprising E2A and E4Orf6 genes under the control of a first repressible promoter, AAV genes comprising Rep and Cap genes under the control of a second repressible promoter, and a third repressible promoter. De-suppression Provided herein are methods comprising transfecting a mammalian cell with an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a first, second, and third derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of a first, second, and third derepressible promoter, treating a mammalian cell with a binding partner of the repression elements, activating the first, second, and third derepressible promoters, producing AAV, recovering the AAV, and administering the AAV to a mammalian patient.

[0011] In still further embodiments, provided herein are methods for producing adeno-associated virus (AAV), the method comprising transfecting a mammalian cell stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB with a first nucleic acid encoding adenoviral helper genes including the E2A gene, the E4Orf gene, and virus-associated non-coding RNA under the control of a first repressible promoter, a second nucleic acid encoding AAV genes including the Rep gene and the Cap gene under the control of a second repressible promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third repressible promoter, treating the mammalian cell with a binding partner of TetR and / or TetR-KRAB, activating the first, second, and third repressible promoters, producing AAV, and recovering the AAV.

[0012] In yet a further embodiment, a method of producing adeno-associated virus (AAV) comprises stably transfecting mammalian cells with a nucleic acid encoding a TetR and / or a TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence flanking the TetR and / or TetR-KRAB repressor, and a selection gene; transfecting the stably transfected mammalian cells with a first nucleic acid encoding adenoviral helper genes including the E2A gene, the E4Orf gene, and a virus-associated non-coding RNA under the control of a first repressible promoter; a second nucleic acid encoding AAV genes including the Rep gene and the Cap gene under the control of a second repressible promoter; and optionally a third nucleic acid encoding a gene of interest under the control of a third repressible promoter; treating the mammalian cells with a binding partner of TetR; and activating the first, second, and third repressible promoters; Provided herein are methods that include producing AAV and recovering AAV. [Brief explanation of the drawings]

[0013] [Figure 1] FIG. 1 shows a schematic diagram of the use of repressible promoters to control expression of helper genes and the VA gene according to embodiments herein. [Figure 2A] 1 shows exemplary nucleic acid molecules for production of helper genes and VA genes according to embodiments herein. [Figure 2B] 1 shows exemplary nucleic acid molecules for production of helper genes and VA genes according to embodiments herein. [Figure 3] 1 shows the results of induction of helper genes and AAV genes according to embodiments herein. [Figure 4] 4A-4C show schematic diagrams of derepressible constructs for expression of AAV genes according to embodiments herein. [Figure 5] 1 shows an exemplary derepressible p5 promoter according to embodiments herein. [Figure 6] 1 shows an exemplary derepressible p19 promoter according to embodiments herein. [Figure 7A] 1 shows an exemplary derepressible p19 promoter containing an artificial intron according to embodiments herein. [Figure 7B] 1 shows an exemplary derepressible p19 promoter containing an artificial intron according to embodiments herein. [Figure 8A] 1 shows the results of Rep-Cap expression and AAV titer using Rep-Cap vectors according to embodiments herein. [Figure 8B] 1 shows the results of Rep-Cap expression and AAV titer using Rep-Cap vectors according to embodiments herein. [Figure 9A] 1 shows the results of Rep-Cap expression and AAV titer boost using helper and Rep-Cap vectors according to embodiments herein. [Figure 9B]1 shows the results of Rep-Cap expression and AAV titer boost using helper and Rep-Cap vectors according to embodiments herein. [Figure 10A] 1 shows an exemplary nucleic acid construct encoding helper genes, AAV genes, and VA genes according to embodiments herein. [Figure 10B] 1 shows an exemplary nucleic acid construct encoding helper genes, AAV genes, and VA genes according to embodiments herein. [Figure 10C] 1 shows an exemplary nucleic acid construct encoding helper genes, AAV genes, and VA genes according to embodiments herein. [Figure 10D] 1 shows an exemplary nucleic acid construct encoding helper genes, AAV genes, and VA genes according to embodiments herein. [Figure 11A] 1 shows an exemplary nucleic acid construct encoding a helper, an AAV, a gene of interest, and a Rep-Cap vector according to embodiments herein. [Figure 11B] 1 shows an exemplary nucleic acid construct encoding a helper, an AAV, a gene of interest, and a Rep-Cap vector according to embodiments herein. [Figure 11C] 1 shows an exemplary nucleic acid construct encoding a helper, an AAV, a gene of interest, and a Rep-Cap vector according to embodiments herein. [Figure 11D] 1 shows an exemplary nucleic acid construct encoding a helper, an AAV, a gene of interest, and a Rep-Cap vector according to embodiments herein. [Figure 11E] 1 shows an exemplary nucleic acid construct encoding a helper, an AAV, a gene of interest, and a Rep-Cap vector according to embodiments herein. [Figure 12A] 1 shows an exemplary nucleic acid construct encoding TetR and TetR-KRAB according to embodiments herein. [Figure 12B] 1 shows an exemplary nucleic acid construct encoding TetR and TetR-KRAB according to embodiments herein. DETAILED DESCRIPTION OF THE INVENTION

[0014] The use of the word "a" or "an," when used in conjunction with the word "comprising" in the claims and / or specification, may mean "one," but may also be consistent with the meaning of "one or more," "at least one," and "more than one."

[0015] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the method / device being used to determine the value. Typically, the term is meant to encompass a variation of less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, depending on the context.

[0016] Although the use of the term "or" in the claims is used to mean "and / or" unless expressly stated to refer to alternatives only or the alternatives are not mutually exclusive, the present disclosure supports a definition that refers to alternatives only and "and / or."

[0017] As used in the specification and claims, the terms "comprising" (and any form of "comprising," e.g., comprise and comprise), "having" (and any form of having, e.g., have and has), "including" (and any form of "including," e.g., includes and include), or "containing" (and any form of containing, e.g., contains and contain) are inclusive or open-ended and do not exclude additional, unrecited, elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the invention. Furthermore, the compositions, systems, cells, and / or nucleic acids of the invention can be used to achieve any of the methods described herein.

[0018] Adeno-associated virus (AAV) is used as the vector of choice for gene therapy in over 120 clinical trials worldwide. The rapidly growing demand for recombinant AAV requires a highly efficient and robust manufacturing platform. However, current methods for producing AAV, including transient transfection and helper virus systems, are very costly and labor-intensive. Provided herein are plasmid- and helper virus-free AAV producer cell lines and methods for their use that offer efficient AAV production for long-term solutions at significantly reduced costs. The AAV producer cell lines described herein represent a next-generation platform for both clinical and commercial AAV production.

[0019] Thus, in embodiments, provided herein are mammalian cells for producing adeno-associated virus (AAV).

[0020] As used herein, the term "mammalian cell" includes cells derived from any member of the mammalian order, such as, for example, human cells, mouse cells, rat cells, monkey cells, hamster cells, etc. In some embodiments, the cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHOK1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, a CHOK1SV cell including all variants (e.g., POTELLIGENT®, Lonza, Slough, UK), or a CHOK1SV GS-KO (glutamine synthetase knockout) cell including all variants (e.g., XCEED™, Lonza, Slough, UK). Exemplary human cells include human embryonic kidney (HEK) cells, such as HEK293, HeLa, or HT1080 cells.

[0021] Mammalian cells include mammalian cell cultures, which can be either adherent or suspension cultures. Adherent cultures refer to cells that grow on a substrate surface, such as a plastic plate, dish, or other suitable cell culture growth platform, and may be attachment-dependent. Suspension cultures refer to cells that can be maintained, for example, in culture flasks or large suspension vessels, which allow for a large surface area for gas and nutrient exchange. Suspension cell cultures often utilize stirring or agitation mechanisms to provide adequate mixing. Media and conditions for maintaining cells in suspension are generally known in the art. Exemplary suspension cell cultures include human HEK293 clonal cells.

[0022] As used herein, the term "adeno-associated virus (AAV)" refers to a small, replication-deficient, non-enveloped virus containing single-stranded DNA of the Parvoviridae and Dependoparvovirus genera. More than 10 adeno-associated virus serotypes have been identified to date, with serotype AAV2 being the most well-characterized. Other non-limiting examples of AAV serotypes include ANC80, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11. In addition to these serotypes, AAV pseudotypes have been developed. AAV pseudotypes contain the capsid of one serotype and the genome of a second serotype (e.g., pseudotype AAV2 / 5 corresponds to an AAV with the genome of serotype AAV2 and the capsid of AAV5).

[0023] As used herein, the term "adenovirus" refers to a non-enveloped virus of the Adenoviridae family, which has an icosahedral nucleocapsid containing double-stranded DNA. More than 50 adenovirus subtypes have been isolated from humans, and many additional subtypes have been isolated from other mammals and birds. For birds, see, for example, Ishibashi et al., "Adenoviruses of Animals," The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, pp. 497-562 (1984); Strauss, "Adenovirus Infections in Humans," The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, pp. 451-596 (1984). These subtypes belong to the Adenoviridae family, which is currently divided into two genera: mastadenovirus and aviadenovirus. All adenoviruses are morphologically and structurally similar. However, in humans, adenoviruses exhibit different immunological properties and are therefore classified into serotypes. Two human serotypes of adenovirus, AV2 and AV5, have been extensively studied and provide most of the general information about adenoviruses.

[0024] In embodiments, the mammalian cells provided herein suitably comprise a nucleic acid molecule encoding a viral helper gene under the control of a first repressible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second repressible promoter, and a nucleic acid molecule encoding the repression elements of the first and second repressible promoters.

[0025] In exemplary embodiments, nucleic acid molecules encoding various components for producing AAV are contained within a mammalian cell in separate nucleic acid molecules, for example, separate plasmids or vectors. In other embodiments, nucleic acid molecules encoding various components for producing AAV are contained within the same plasmid or vector. In further embodiments, certain components are contained within the same nucleic acid molecule (e.g., helper genes and AAV genes), while other genes are contained within separate nucleic acid molecules (e.g., genes encoding inhibitory elements).

[0026] "Nucleic acid," "nucleic acid molecule," or "oligonucleotide" refers to a polymeric compound containing covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or miRNA.

[0027] In various embodiments described herein, the nucleic acid molecules can encode various genes, i.e., when transcribed, the nucleic acid molecules produce mRNA for the genes described herein, which is then translated into the desired or required protein.

[0028] As described herein, the mammalian cell preferably contains a nucleic acid molecule encoding a viral helper gene. Viral helper genes include various adenovirus genes, herpesvirus genes, and bocavirus genes (e.g., Guido et al., "Human bocavirus: Current knowledge and future challenges," World J. Gateroenterol 22:8684-8697, the disclosure of which is incorporated herein by reference in its entirety). In an exemplary embodiment, the viral helper gene is an adenovirus helper gene. As referred to herein, the term "adenovirus helper gene" or "AV helper gene" refers to a gene composed of one or more nucleic acid sequences derived from one or more adenovirus subtypes or serotypes that contributes to the replication and packaging of adeno-associated viruses. In some embodiments, the adenovirus helper gene is E1A, E1B, E2A, E4 (including E4Orf6), VA, or a combination thereof, or any other adenovirus helper gene. In an exemplary embodiment, the adenovirus helper gene comprises both the E2A gene and the E4Orf6 gene. Preferably, an internal ribosome entry site (IRES) element is included between the E2A gene and the E4Orf6 gene. The IRES element initiates the translation of the E4Orf6 gene after the E2A gene in the single expression cassette, providing stability to the construct.

[0029] The various nucleic acid molecules encoding the various genes described herein are preferably under the control of a derepressible promoter. As used herein, "under control" refers to the regulation of a gene by a "promoter," "promoter sequence," or "promoter region," which refers to a DNA regulatory region / sequence capable of binding RNA polymerase and initiating transcription of a downstream coding or non-coding gene sequence. In other words, the promoter and gene are in an operable combination or operably linked. As used herein, the terms "in operable combination," "in operable order," and "operably linked" refer to the linkage of nucleic acid sequences in such a manner as to produce a promoter capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule. This term also refers to the linkage of amino acid sequences in such a manner as to produce a functional protein.

[0030] In some examples of the present disclosure, the promoter sequence includes a transcription initiation site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background. In some embodiments, the promoter sequence includes a transcription initiation site and a protein binding domain involved in the binding of RNA polymerase. Eukaryotic promoters often, but do not necessarily, include "TATA" and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive gene expression in, for example, the host cells or vectors of the present disclosure. In some embodiments, the promoter is not a leaky promoter, i.e., the promoter does not constitutively express any of the gene products described herein. In other embodiments described herein, the promoter is a constitutive promoter that initiates mRNA synthesis independently of external regulatory influences.

[0031] Preferably, the promoters used to control the transcription of various genes for producing the AAVs described herein are derepressible promoters. As used herein, a "derepressible promoter" refers to a structure comprising a functional promoter and additional elements or sequences that can bind to a repression element to cause repression of the functional promoter. "Repression" refers to the reduction or inhibition of initiation of transcription of a downstream coding or non-coding gene sequence by the promoter. A "repression element" refers to a protein or polypeptide that can bind to a promoter (or near a promoter) to reduce or inhibit the promoter's activity. The repression element can interact with the substrate or binding partner of the repression element such that the repression element undergoes a conformational change. This conformational change of the repression element eliminates the ability of the repression element to reduce or inhibit the promoter, resulting in "derepression" of the promoter, thereby allowing the promoter to proceed with transcription initiation. A "functional promoter" refers to a promoter that is capable of initiating transcription in the absence of the action of a repression element. Various functional promoters that can be used in the practice of the present invention are known in the art, and include, for example, P CMV , P H1 , P19, P5, P40, and promoters of adenoviral helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).

[0032] Exemplary repression elements and their corresponding binding partners that can be used as derepressible promoters are known in the art and include systems such as the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, e.g., Mullick et al., "The cumate gene-switch: a system for regulated expression in mammalian cells," BMC Biotechnology 6:43(1-18) (2006), the disclosure of which is incorporated herein by reference in its entirety, including the disclosure of the derepressible promoter system described therein), and the TetO / TetR system described herein (e.g., Yao et al., "Tetracycline Repressor, TetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells," Human Gene Therapy 9:1939-1950 (1998), the disclosure of which is incorporated herein by reference in its entirety).

[0033] In an exemplary embodiment, the derepressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). A schematic diagram showing an exemplary repressible promoter system is provided in Figure 1. CMV Derepressible promoters, including promoters, and P H1 Derepressible promoters containing the promoter are shown, both of which contain two TetO sequences (TetO2). As shown, when two tetracycline repressor proteins (the repression elements of the TetR-TetO2 sequences) bind to the TetO2 sequences, P CMV Promoter and P H1Both promoters are repressed; that is, little or no transcription occurs from these promoters. Upon binding of a binding partner of TetR, preferably doxycycline (Dox), the TetR protein changes conformation and is released from the TetO2 sequence, and the functional promoters begin their normal transcription process as they would naturally. This results in an "off" position (preferably P CMV Promoter and P H1 This results in a system-wide change from the promoter (no transcription) to the "on" position upon addition of Dox, resulting in P CMV Promoter and P H1 The promoters are allowed to revert to their natural state of transcribing the genes under their control.

[0034] For example, as shown in Figure 1, CMV When a promoter (preferably the pcDNA4 / TO promoter; INVITROGEN®) is bound by TetR, it is in the "off" position. When Dox is added, TetR changes conformation and is released from the TetO2 sequence of the repressible promoter, resulting in the P CMV The promoter drives transcription of the adenoviral helper genes (eg, E2A and E4).

[0035] As described herein and illustrated in Figure 1, the mammalian cell can further include a nucleic acid encoding a virus-associated (VA) non-coding RNA under the control of a fourth repressible promoter. As shown in Figure 1, this repressible promoter is a functional promoter P H1, and a TetO2 sequence that controls the expression of a non-coding RNA (see, e.g., Wiederschain et al., "Single-vector inducible lentiviral RNAi system for oncology target validation," Cell Cycle 8:498-504 (2009) (the disclosure of which is incorporated herein by reference in its entirety, including the disclosure of promoter systems and sequences)). As shown in FIG. 1, a P H1 When the promoter is bound by TetR, it is in the "off" position. When Dox is added, TetR changes conformation and is released from the TetO2 sequence of the repressible promoter, resulting in P H1 The promoter proceeds to transcribe the VA1 non-coding RNA.

[0036] Figure 2A shows exemplary nucleic acid molecules that can be utilized in various mammalian cells and methods described herein. As shown, a CMV promoter is used upstream of both the E2A gene and the E4Orf6 gene, linked via an IRES element. The CMV promoter includes a CMV enhancer and a tet operator (TetO2) for control by derepression. An exemplary location of the H1 promoter, which also includes a TetO2 sequence that controls expression of the VA non-coding RNA, is also shown in Figure 2A.

[0037] 1 and 2A also illustrate that, in embodiments, a mammalian cell can include a repression element under the control of a constitutive promoter. As described herein, preferably, the encoded repression element is the tetracycline repressor protein (TetR). As illustrated in FIGS. 1 and 2A, a preferred promoter for expression of the repression element is the hPGK promoter. By placing the repression element under the control of a constitutive promoter, production of the repression element, preferably TetR, is always active. That is, TetR is produced when the nucleic acid molecule is introduced into a mammalian cell. This provides for tight control of various derepressible promoters that are repressed by TetR binding to the TetO2 sequence.

[0038] As shown in Figure 2A, in an exemplary embodiment, a nucleic acid encoding a transcriptional repression domain in-frame with a nucleic acid encoding a tetracycline repressor protein can be introduced. In Figure 2A, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, e.g., Szulc et al., "A versatile tool for conditional gene expression and knockdown," Nature Methods 3:109-116 (2006)). The use of a KRAB sequence or other transcriptional repression domain improves the repression activity of TetR when bound to TetO2, thereby minimizing the amount of leakage or basal gene expression before derepression (i.e., before the addition of Dox). Figure 2B and Figure 12A show exemplary nucleic acid molecules lacking the KRAB sequence.

[0039] As shown in Figure 12A, in an exemplary embodiment, a nucleic acid encoding a tetracycline-repressor protein can be contained in or stably expressed in a mammalian cell. In Figures 2A and 12B, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, e.g., Szulc et al., "A versatile tool for conditional gene expression and knockdown," Nature Methods 3:109-116 (2006)). The use of a KRAB sequence or other transcriptional repression domain improves the repression activity of TetR when bound to TetO2, thereby minimizing the amount of readthrough or basal gene expression before derepression (i.e., before the addition of Dox). Figures 2B and 12A show exemplary nucleic acid molecules lacking the KRAB sequence.

[0040] In some embodiments, the AAV genes encoded by the nucleic acid molecule include the Rep gene and the Cap gene. Other AAV genes that can be encoded by the nucleic acid molecule include any gene from any AAV serotype. In some embodiments, the AAV genes are Rep78, Rep68, Rep52, Rep40, VP1, VP2, VP3, or a combination thereof. In some embodiments, the AAV genes are derived from adeno-associated virus type 2. In some embodiments, the AAV genes are derived from adeno-associated virus Anc80.

[0041] As referred to herein, the term "Rep" gene refers to the art-recognized AAV genome region encoding viral replication proteins required together to replicate the viral genome, or functional homologs thereof, such as the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV-2 DNA replication. Thus, the rep coding region can include genes encoding AAV Rep78 and Rep68 ("long forms of Rep") and Rep52 and Rep40 ("short forms of Rep"), or functional homologs thereof. The rep coding region, as used herein, can be derived from any viral serotype, such as the AAV serotypes described herein. The region need not contain all of the wild-type genes but may be modified (e.g., by nucleotide insertion, deletion, or substitution) so long as the present rep gene provides sufficient integration function when expressed in a suitable target cell. See, e.g., Muzyczka, N., Current Topics in Microbiol. and Immunol. 158:97-129 (1992) and Kotin, RM, Human Gene Therapy 5:793-801 (1994).

[0042] As referred to herein, the term "Cap" gene refers to the art-recognized region of the AAV genome that encodes the viral capsid proteins. Illustrative (non-limiting) examples of these capsid proteins are AAV capsid proteins VP1, VP2, and VP3. The Cap genes used in this disclosure can be from any AAV serotype or combination of AAV serotypes.

[0043] Figure 4A shows the natural location and promoter-driven Rep and Cap genes. As is known in the art, for successful AAV production, the ratio of Rep78 and Rep52 genes must be maintained at an optimal level. As discussed in, for example, "Role for Highly Regulated rep Gene Expression in Adeno-Associated Virus Vector Production," Journal of Virology 71:5236-5243 (1997) (the disclosure of which is incorporated herein by reference in its entirety), controlling the amount of Rep78 produced can interfere with DNA replication. Furthermore, Rep78 can be toxic when overproduced in mammalian cells. See, for example, Clark et al., "Cell Lines for the Production of Recombinant Adeno-Associated Virus," Human Gene Therapy 6:1329-1341 (1995) (the disclosure of which is incorporated herein by reference in its entirety), which discusses that high rep protein levels can be associated with cytotoxicity. The location of the promoter (p19) for Rep52 expression is also located within the coding region for Rep78. As described herein, various modifications are made to the native location of the Rep gene and promoter to overcome these challenges.

[0044] In an exemplary embodiment, a mammalian cell can contain a nucleic acid encoding a Rep78 gene under the control of a second derepressible promoter and a Rep52 gene under the control of a third derepressible promoter. As shown in Figure 4B, one way to achieve this arrangement is to remove the Rep52 gene from within the Rep78 gene and place it downstream of the Rep78 gene and the Cap gene. The Rep78 gene can be under the control of a derepressible promoter (p5) containing a TetO2 sequence. In such an embodiment, the native p19 promoter within Rep78 is modified or mutated to be silenced. The removed Rep52 gene is also placed under the control of a derepressible promoter (p19) containing a TetO2 sequence.

[0045] Figure 5 shows three potential positions for each TetO sequence relative to the TATA box, rep binding element (RBE), and initiation element (INR) for modifying the p5 promoter of Rep78. The wild-type P5 promoter is also shown schematically. Figure 6 shows three potential positions for each TetO sequence relative to the TATA box and Sp1 transcription factor of the p19 promoter of Rep52. The wild-type P19 promoter is also shown. Additional positions for TetO sequences are encompassed herein and can be readily envisioned by those skilled in the art.

[0046] In yet a further embodiment, the Rep78 gene can be under the control of a derepressible promoter, and the Rep52 gene can be under the control of a derepressible promoter contained within an artificial intron. Such an embodiment is illustrated in Figure 4C. As illustrated, a derepressible p5 promoter (e.g., containing a TetO2 sequence described herein) is placed upstream of the Rep78 gene. A derepressible p19 promoter (e.g., containing a TetO2 sequence) contained within an intron (referred to as In-i-p19) controls Rep52 expression. A schematic diagram of this embodiment is provided in Figure 7A, where two Tet operator sequences are illustrated within the chimeric intron. This chimeric intron can be inserted at various positions relative to the p19 promoter components. For example, as shown in Figure 7B, the intron sequence is preferably placed downstream of the TATA-2 sequence of the p19 promoter. The spacing can be, for example, about 1 to 25 base pairs downstream from the TATA-2 sequence.

[0047] As described herein, in exemplary embodiments, the Cap gene encoded by the nucleic acid molecule is preferably under the control of its native promoter. That is, the Cap gene does not need to be under the control of a derepressible promoter, although a derepressible promoter can be used if desired. In a preferred embodiment, the Cap gene is under the control of the p40 promoter.

[0048] In an exemplary embodiment, the nucleic acid molecule comprises two inverted terminal repeat (ITR) sequences. As known in the art, these ITR sequences (i.e., AAV2 ITRs) comprise a single-stranded sequence of nucleotides followed by its reverse complement downstream. The ITR sequences represent the minimum sequences required for replication, rescue, packaging, and integration of the AAV genome. Preferably, these ITR sequences flank a gene of interest. Thus, in an embodiment, the nucleic acid molecule further encodes a gene of interest. This gene of interest can be, for example, a reporter gene, a selection gene, or a gene of therapeutic interest.

[0049] For example, as illustrated in Figure 10C, a gene of interest, such as the gene encoding enhanced green fluorescent protein (EGFP), is flanked by two ITR sequences.

[0050] "Gene" refers to an assembly of nucleotides that encodes a polypeptide, and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can function as a regulatory sequence before (5' non-coding sequences) and after (3' non-coding sequences) the coding sequence. In some embodiments, the gene is integrated in multiple copies. In some embodiments, the gene is integrated in a predetermined number of copies.

[0051] As referred to herein, the term "gene of interest" or "GOI" is used to describe a heterologous gene. As referred to herein, the term "heterologous gene" or "HG," when referring to a nucleic acid sequence such as a coding sequence or control sequence, refers to a nucleic acid sequence, e.g., a gene, that is not normally linked together and / or is not normally associated with a particular cell. In some embodiments, a heterologous gene is a construct in which the coding sequence itself is not found in nature (e.g., a synthetic sequence with codons different from the native gene). Allelic variations or naturally occurring mutational events do not give rise to heterologous DNA as used herein.

[0052] As referred to herein, a "reporter gene" is a gene whose expression confers a phenotype on a cell that can be easily identified and measured. In some embodiments, the reporter gene comprises a fluorescent protein gene. In some embodiments, the reporter gene comprises a selection gene.

[0053] As referred to herein, the term "selection gene" refers to the use of a gene that encodes an enzymatic activity that confers the ability to grow in a medium lacking what would be an essential nutrient; in addition, a selection gene can confer antibiotic or drug resistance to cells in which the selection gene is expressed. A selection gene may also be used to confer a particular phenotype to a host cell. If a host cell must express a selection gene to grow in a selective medium, the gene is said to be a positive selection gene. A selection gene can also be used to select against host cells that contain a particular gene. A selection gene used in this manner is called a negative selection gene.

[0054] As referred to herein, the term "therapeutic gene" refers to any functionally related nucleotide sequence. Thus, therapeutic genes of the present disclosure can include any desired gene encoding a protein that is missing or missing from the target cell genome or encoding a non-native protein with a desired biological or therapeutic effect (e.g., antiviral function), or the sequence can correspond to a molecule with antisense or ribozyme function. Representative (non-limiting) examples of suitable therapeutic genes include those used to treat inflammatory, autoimmune, chronic, and infectious diseases, including disorders such as AIDS, cancer, neurological disorders, cardiovascular disease, and hypercholesterolemia; various blood disorders, including various anemias, thalassemias, and hemophilias; and genetic defects such as cystic fibrosis, Gaucher disease, adenosine deaminase (ADA) deficiency, and emphysema. Several antisense oligonucleotides (e.g., short oligonucleotides complementary to sequences surrounding the translation start site (AUG codon) of mRNA) useful for antisense therapy of cancer and viral diseases have been described in the art and are examples of suitable therapeutic genes.

[0055] In some embodiments, the mammalian cells provided herein are substantially free of helper virus. As referred to herein, a "helper virus" refers to any non-AAV virus that is added to enable replication and packaging of an adeno-associated virus. Representative (non-limiting) examples of helper viruses are adenovirus and herpesvirus. In some embodiments, the term "substantially free of helper virus" refers to cells having less than 100, less than 10, or less than 1 helper virus per cell. In some embodiments, the term "substantially free of helper virus" refers to cells or cell populations that are free of helper virus using detection methods known to those skilled in the art. In some embodiments, wild-type helper virus is not present in the cells. In some embodiments, the term "wild-type virus" refers to any completely non-AAV virus that can replicate in cells independently of any other virus.

[0056] The AAV production cells described herein provide a long-term, cost-effective solution for large-scale AAV production. Because constitutive expression of either the helper or Rep proteins can be cytotoxic, the strategy described herein allows for control of their expression by engineered, repressible promoters.

[0057] In yet a further embodiment, a mammalian cell for producing adeno-associated virus (AAV) is provided, comprising: adenovirus helper genes comprising E2A and E4Orf6 genes under the control of a first repressible promoter; AAV genes comprising Rep and Cap genes under the control of a second repressible promoter; and a third repressible promoter in a single nucleic acid molecule. De-suppressionProvided herein are mammalian cells comprising a sequence encoding a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters. In such embodiments, the single nucleic acid molecule contains all the various sequences, along with other necessary elements, to enable AAV production within the cell.

[0058] Figures 10A and 10B show exemplary nucleic acid molecules containing these various sequences that can be utilized in mammalian cells to produce AAV.

[0059] As described herein, the mammalian cells are preferably mammalian cell cultures, which in embodiments may be suspension cultures. As described herein, the use of suspension cell cultures allows for scale-up and increased production of AAV.

[0060] As described herein and shown in Figures 1, 2A-2B, and 10A-10B, preferably, the single nucleic acid molecule comprises an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0061] Various constructs for encoding Rep and Cap genes, including the Rep78 and Rep52 genes, are described herein. In embodiments, the Rep78 gene is under the control of a second derepressible promoter, and the Rep52 gene is under the control of a fourth derepressible promoter (e.g., as shown in Figure 4B, the Rep52 gene is separate from the Rep78 gene). In further embodiments, the Rep78 gene can be under the control of a second derepressible promoter, and the Rep52 gene can be under the control of a fourth derepressible promoter contained within an artificial intron, as described herein, for example, with reference to Figures 4C and 7A-7B. Preferably, the Cap gene is under the control of its native promoter.

[0062] Various derepressible promoters are described herein, and in embodiments, the derepressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). In embodiments, the functional promoter of the first derepressible promoter (i.e., controlling expression of adenovirus helper genes including E2A and E4Orf6 genes) is a cytomegalovirus (CMV) promoter.

[0063] In embodiments, as described herein and illustrated in Figures 1, 2A-2B, and 10A-10D, preferably, the repression element of the repressible promoter is under the control of the repressible promoter such that it is constantly produced and limits expression of other genes under the control of the constitutive promoter. Preferably, the encoded repression element is a tetracycline repressor protein that binds to the TetO2 sequence and functions as a repressible promoter. In embodiments, for example, as shown in Figures 2A, 10A, and 10C, a nucleic acid encoding a transcriptional repression domain (e.g., a KRAB sequence) is included in frame with the nucleic acid encoding the tetracycline repressor protein. This transcriptional repression domain provides improved repression activity of TetR when bound to TetO2, thereby minimizing the amount of readthrough or basal gene expression prior to derepression.

[0064] Exemplary mammalian cells that can be used in the embodiments and methods described herein are described throughout and include, for example, Chinese hamster ovary (CHO) cells, and human cells, including human embryonic kidney (HEK, e.g., HEK293) cells.

[0065] As described herein, preferably, the mammalian cell further comprises a nucleic acid molecule encoding a gene of interest (GOI). As shown in Figures 10C-10D, preferably, the GOI is contained between two ITR sequences.

[0066] adenovirus helper genes including E2A and E4Orf6 genes under the control of a first repressible promoter, AAV genes including Rep and Cap genes under the control of a second repressible promoter, and a third De-suppression Also provided herein is an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters.

[0067] As used herein, "isolated nucleic acid molecule" includes vectors and plasmids that can contain the isolated nucleic acid molecule, as well as similar structures that allow the isolated nucleic acid molecule to be manipulated, stored, shipped, and ultimately utilized in various cell transfection systems. The isolated nucleic acid molecules described herein can be used to produce the AAVs described herein, but can also be utilized in various non-AAV-producing cell lines (including transient transfection systems). The isolated nucleic acid molecules described herein preferably further comprise various additional elements and sequences necessary to enable their use in cell systems, including mammalian cells, as described herein.

[0068] For example, as shown in Figures 10A-10B, two plasmid constructs are shown. As shown, in embodiments, an internal ribosome entry site (IRES) element can be included between the E2A gene and the E4Orf6 gene. As described herein with reference to Figure 4B, in embodiments, the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of (i.e., separated from) a fourth derepressible promoter.

[0069] In a further embodiment, as shown with reference to Figures 10A-10B, the Rep78 gene is under the control of a derepressible promoter (the ip5 promoter shown in Figure 5 and various repeats described in Figure 5), and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron, illustrated as ip19 and described with reference to Figures 7A-7B. The isolated nucleic acid preferably further comprises the Cap gene under the control of its native promoter (i.e., p40).

[0070] As described herein, various derepressible promoters can be included in the isolated nucleic acid molecule, preferably comprising a functional promoter and two tetracycline operator sequences (TetO2). As shown in Figures 10A and 10B, for the helper genes E2 and E4, preferably this functional promoter is a CMV promoter comprising a TetO2 sequence. Derepressible promoters for use with virus-associated non-coding RNA preferably comprise an H1 promoter and a TetO2 sequence.

[0071] As described herein and shown in Figures 10A and 10B, the repression element (e.g., tetracycline repressor protein) is preferably under the control of a constitutive promoter, e.g., the hPGK promoter. As shown in Figures 10A and 12B, the isolated nucleic acid molecule can further comprise a nucleic acid encoding a transcriptional repression domain (e.g., a KRAB sequence) in frame with the nucleic acid encoding the tetracycline repressor protein. As shown in Figures 10C-10D and 11B, the isolated nucleic acid molecule can further comprise a gene of interest (GOI, e.g., GFP) between the two ITR sequences.

[0072] As described herein and shown in Figures 12A-12B, the repression element is preferably flanked by insulators, such as chicken hypersensitive site-4 (cHS4) sequences.

[0073] In embodiments, a nucleic acid encoding a transcriptional repression domain (such as KRAB) is included in frame with a nucleic acid encoding a tetracycline repressor protein (eg, TetR-KRAB).

[0074] Additional genetic and sequence elements for inclusion in the isolated nucleic acid molecules described herein are known in the art and can be illustrated in Figures 10A-10D and 11A-11E.

[0075] The term "sequence identity" or "% identity" in the context of nucleic acid sequences described herein refers to the percentage of residues in a comparison sequence that are the same when the sequences are aligned over a specified comparison window. The comparison window can be a segment of at least 10 to over 1000 residues over which sequences can be aligned and compared. Alignment methods for determining sequence identity are well known and can be performed using publicly available databases such as BLAST (blast.ncbi.nlm.nih.gov / Blast.CGI).

[0076] In some embodiments, the nucleic acid molecules have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity with a reference nucleic acid molecule (or a fragment of a reference polypeptide or reference nucleic acid molecule), respectively. In specific embodiments of the present disclosure, the polypeptide or nucleic acid molecule has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%, or 100% sequence identity with a reference nucleic acid molecule (or a fragment of a reference nucleic acid molecule), respectively. In some embodiments, the nucleic acid molecules have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity with a reference nucleic acid molecule, respectively.

[0077] A "vector" or "expression vector" is a replicon, such as a plasmid, phage, virus, or cosmid, to which a nucleic acid molecule described herein can be attached to bring about the replication and / or expression of the attached nucleic acid molecule in a cell. "Vector" includes episomal (e.g., plasmid) and non-episomal vectors. The term "vector" includes both viral and non-viral means for introducing nucleic acid molecules into cells in vitro, in vivo, or ex vivo. The term vector may also include synthetic vectors. Vectors may be introduced into desired host cells by well-known methods, including, but not limited to, transfection, transduction, cell fusion, and lipofection. Vectors can include various regulatory elements, including promoters.

[0078] Also provided herein are methods for producing adeno-associated virus (AAV) in mammalian cells. Preferably, the methods described herein involve transfecting mammalian cells with adenovirus helper genes, including E2A and E4Orf6 genes, under the control of a first repressible promoter, AAV genes, including Rep and Cap genes, under the control of a second repressible promoter, and a third repressible promoter. De-suppression The method comprises transfecting an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of the first, second, and third derepressible promoters.

[0079] As used herein, "transfection" refers to the introduction of an exogenous nucleic acid molecule, including a vector, into a cell. A "transfected" cell contains an exogenous nucleic acid molecule within the cell, and a "transformed" cell is one in which the exogenous nucleic acid molecule within the cell induces a phenotypic change within the cell. The transfected nucleic acid molecule may be integrated into the genomic DNA of the host cell and / or may be maintained by the cell transiently or extrachromosomally long-term. A host cell or organism that expresses an exogenous nucleic acid molecule or fragment is referred to as a "recombinant," "transformed," or "transgenic" organism. Many transfection techniques are commonly known in the art. See, for example, Graham et al., Virology, 52:456 (1973), Sambrook et al., Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York (1989), Davis et al., Basic Methods in Molecular Biology, Elsevier (1986), and Chu et al., Gene 13:197 (1981). Such techniques can be used to introduce one or more exogenous DNA moieties, such as AAV vector cassettes, AAV helper constructs, and other nucleic acid molecules, into a suitable host cell.

[0080] Various methods for transfecting mammalian cells with the isolated nucleic acid molecules (i.e., vectors) described herein are known in the art and include various chemical and physical methods, such as electroporation, cell injection, calcium phosphate exposure, liposome or polymer-based carrier systems, etc.

[0081] In an exemplary embodiment, vectors such as the PIGGYBAC™ transposon can be used for stable integration of these nucleic acid molecules, allowing for the single-step insertion of large nucleic acid sequences randomly in multiple copies in a cell's genome. This system consists of the PIGGYBAC™ vector and Super PIGGYBAC™ transposase, which recognizes transposon-specific inverted terminal repeats (ITRs) and efficiently integrates the ITRs and intervening DNA into the genome at TTAA sites. The Super PIGGYBAC™ transposase is delivered to cells via a Super PIGGYBAC™ transposase expression vector that is co-transfected with one or more PIGGYBAC™ vectors.

[0082] The method further includes treating the mammalian cell with a binding partner of the repression element. As described herein, in the presence of the repression element, the functional promoter of the repressible promoter that controls the transcription of the various genes encoded by the nucleic acid molecule is repressed. That is, the gene is not actively transcribed but instead awaits derepression. As described herein, the repression element of the repressible promoter is preferably under the control of a constitutive promoter so that the repression element is produced immediately after transfection of the nucleic acid molecule into the mammalian cell. Upon treatment with the binding partner of the repression element, the repression element binds to the binding partner, changes conformation, and no longer represses the repressible promoter. This activates the first, second, and third (optionally additional) repressible promoters (i.e., functional promoters of the repressible promoters) in the mammalian cell.

[0083] After activation, the various elements are transcribed and translated within the mammalian cell, resulting in the production of AAV, which is then recovered using methods known in the art.

[0084] The methods described herein can be utilized in any mammalian cell, including mammalian cell cultures, but preferably the mammalian cell culture is a suspension culture comprising human cells, such as a HEK suspension cell culture.

[0085] As described throughout, the nucleic acid molecule can further comprise an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.Exemplary constructs relating to the Rep78 and Rep52 genes are described herein, including those in which the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.In another embodiment of the method, the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained in an artificial intron.

[0086] As described herein, the use of an artificial intron allows the removal of the fourth derepressible promoter after the activation of the derepressible promoter and before the production of AAV. As described herein, the derepressible promoter in the intron ensures the suppression of Rep52 gene expression before activation, and also allows the expression of Rep78 protein after the removal of the intron during mRNA splicing. In an exemplary embodiment of the method, the Cap gene is under the control of a natural promoter such as p40.

[0087] In embodiments, the functional promoter of the derepressible promoter controlling expression of the helper genes is a cytomegalovirus (CMV) promoter. Preferably, in the methods described herein, the encoded repression element is a tetracycline repressor protein, and preferably, the derepressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). In embodiments, the repression element is under the control of a constitutive promoter such as hPGK, for example, when the encoded repression element is a tetracycline repressor protein.

[0088] As described herein, in embodiments utilizing TetR and / or TetR-KRAB repression elements, treatment of cells with doxycycline alters the conformation of TetR and activates transcription of various genes.

[0089] The methods described herein can utilize a variety of mammalian cells, including human cells such as human embryonic kidney (HEK) cells, or other mammalian cells, including Chinese hamster ovary (CHO) cells.

[0090] As described throughout, in embodiments, the AAV comprises a nucleic acid molecule encoding a gene of interest, which may be a reporter gene, a selection gene, or any other gene of interest, including a gene of therapeutic interest.

[0091] The AAV production method can be used in a continuous production system. In an exemplary embodiment, the use of suspension cell cultures allows for large-scale production of AAV under high productivity and long-term culture conditions, allowing for multiple harvests of AAV for each batch of starting cells.

[0092] The production methods can utilize any suitable reactor, including, but not limited to, stirred tank, air-lift pump, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and / or spouted bed bioreactors. As used herein, a "reactor" can include a fermentor or fermentation unit, or any other reaction vessel, and the term "reactor" is used synonymously with "fermentor." The terms fermentor or fermentation refer to both microbial and mammalian cultures. For example, in some embodiments, an exemplary bioreactor unit can perform one or more or all of the following: feeding nutrients and / or carbon sources, injecting a suitable gas (e.g., oxygen), inflow and outflow of fermentation or cell culture medium, separating gas and liquid phases, maintaining temperature, maintaining oxygen and CO2 levels, maintaining pH levels, agitation (e.g., stirring), and / or cleaning / sterilization. An exemplary reactor unit, such as a fermentation unit, may include multiple reactors within the unit; for example, a unit may have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more bioreactors within each unit, and / or a facility may include multiple units with single or multiple reactors within the facility. In various embodiments, the bioreactors may be suitable for batch, semi-fed-batch, fed-batch, perfusion, and / or continuous fermentation processes. Any suitable reactor diameter may be used. In embodiments, the bioreactors may have a volume of from about 100 mL to about 50,000 L.Non-limiting examples include 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, and 550 liters. 1, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. Furthermore, suitable reactors can be multi-use, single-use, disposable, or non-disposable and can be formed from any suitable material, including stainless steel (e.g., 316L or any other suitable stainless steel) and metal alloys such as Inconel, plastic, and / or glass.

[0093] In embodiments, and unless otherwise specified herein, the devices, facilities, and methods described herein can also include any suitable unit operations and / or equipment not specifically mentioned, e.g., operations and / or equipment for the separation, purification, and isolation of such products. Any suitable facilities and environments can be used, such as traditional stick-built facilities, modular, mobile, and temporary facilities, or any other suitable construction, equipment, and / or layout. For example, in some embodiments, modular clean rooms can be used. Furthermore, unless otherwise specified, the devices, systems, and methods described herein can be housed and / or performed in a single location or facility, or can be housed and / or performed in separate or multiple locations and / or facilities.

[0094] In a further embodiment, a method of treating a mammalian cell with adeno-associated virus (AAV) comprises transfecting a mammalian cell with adenovirus helper genes comprising E2A and E4Orf6 genes under the control of a first repressible promoter, AAV genes comprising Rep and Cap genes under the control of a second repressible promoter, and a third repressible promoter. De-suppression Provided herein are methods comprising transfecting a mammalian cell with a virus-associated non-coding RNA under the control of a first, second, and third derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of a first, second, and third derepressible promoter, treating a mammalian cell with a binding partner of the repression elements, activating the first, second, and third derepressible promoters, producing AAV, recovering the AAV, and administering the AAV to a mammalian patient.

[0095] Preferably, the method is used to treat a human patient with a gene of interest, including a therapeutic gene. Administration to a human patient can include, for example, inhalation, injection, or intravenous administration, as well as other methods of administration known in the art.

[0096] Methods for producing AAV and the use of various derepressible promoters are described herein.

[0097] In a further embodiment, provided herein is a method of producing adeno-associated virus (AAV), the method comprising transfecting a mammalian cell stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB with a first nucleic acid encoding adenoviral helper genes comprising the E2A gene, the E4Orf gene, and a virus-associated non-coding RNA under the control of a first derepressible promoter, a second nucleic acid encoding AAV genes comprising the Rep gene and the Cap gene under the control of a second derepressible promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter, treating the mammalian cell with a binding partner of TetR, activating the first, second, and third derepressible promoters, producing AAV, and recovering the AAV.

[0098] As described herein, preferably the mammalian cells are mammalian cell cultures, including suspension cultures.

[0099] As described herein, preferably the mammalian cells are Chinese hamster ovary (CHO) cells or human cells, including human embryonic kidney (HEK) cells.

[0100] As described herein, the use of two or three different nucleic acids or transposons to transfect mammalian cells offers advantages over combining nucleic acids in one plasmid, including the ability to optimize the ratio of separate AAV production and packaging components and to exert temporal control over the expression of each transposon.

[0101] As described herein, preferably, the nucleic acid encoding the E2A and E4Orf genes further comprises an internal ribosome entry site (IRES) element between the E2A and E4Orf genes.

[0102] As described herein, preferably the derepressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0103] As described herein, preferably the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0104] In some embodiments, mammalian cells used to produce adeno-associated virus (AAV) stably express one or more nucleic acids encoding TetR and / or TetR-KRAB under the control of a constitutive promoter.

[0105] As described herein, stable expression of TetR and / or TetR-KRAB in mammalian cells (preferably via a transposon prior to insertion of nucleic acids carrying viral components) maximizes repression of potential cytotoxic AAV genes introduced by transfection and provides increased temporal control over derepressible promoter elements.

[0106] In some embodiments, the KRAB repression domain is fused in-frame with TetR.

[0107] As described herein, fusing the KRAB repression domain in-frame with TetR ensures that "leaky" expression of potentially cytotoxic AAV-packaged nucleic acids is unlikely to occur. The KRAB repression domain fused in-frame with the TetR repression domain provides an additional mechanism for achieving high levels of repression of derepressible promoters.

[0108] In some embodiments, the mammalian cell produces a sufficient amount of TetR, where "sufficient" of TetR, as used herein, is defined as the amount and / or level of repression (e.g., TetR) and / or activity (i.e., before addition of doxycycline) to stop the expression and / or activity of the repressible and / or derepressible element.

[0109] As described herein, producing sufficient amounts of TetR is necessary for repression of derepressible promoters under normal conditions (e.g., before the addition of doxycycline). If sufficient amounts of TetR are not produced by mammalian cells, the cells may prematurely transcribe and translate AAV packaging nucleic acids, which are potentially cytotoxic.

[0110] In a further embodiment, the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) flanked by TetR and / or TetR-KRAB repressor sequences. As described herein, expression of the cHS4 sequences flanked by TetR and / or TetR-KRAB repressor sequences prevents silencing of TetR expression and further improves the stability of the integrated repressor in the mammalian cell genome.

[0111] In a further embodiment, the treatment comprises treating with doxycycline to remove repression of the derepressible promoter.

[0112] In further embodiments, each of the first, second, and third nucleic acids is flanked by transposon-specific inverted terminal repeats (ITRs).

[0113] In a further embodiment, a method for producing adeno-associated virus (AAV) comprises stably transfecting a mammalian cell with a nucleic acid encoding a TetR and / or a TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence flanking the TetR and / or TetR-KRAB repressor, and a selection gene; transfecting the stably transfected mammalian cell with a first nucleic acid encoding adenovirus helper genes including an E2A gene, an E4Orf gene, and a virus-associated non-coding RNA under the control of a first repressible promoter; a second nucleic acid encoding AAV genes including a Rep gene and a Cap gene under the control of a second repressible promoter; and, optionally, a third nucleic acid encoding a gene of interest under the control of a third repressible promoter; treating the mammalian cell with a binding partner of TetR; activating the first, second, and third repressible promoters; producing AAV; and recovering the AAV.

[0114] In some embodiments, the mammalian cell further comprises a selection gene, such as a zeocin resistance gene. Additional selection genes include other antibiotic resistance genes, such as kanamycin and geneticin resistance genes. As described herein, expression of the zeocin resistance gene allows for efficient selection of correctly integrated suppression elements in the mammalian cell genome.

[0115] Additional Exemplary Embodiments Embodiment 1 is a mammalian cell for producing adeno-associated virus (AAV), comprising a nucleic acid molecule encoding a viral helper gene under the control of a first repressible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second repressible promoter, and a repression element of the first and second repressible promoters.

[0116] Embodiment 2 includes the mammalian cell of embodiment 1, wherein the mammalian cell is a mammalian cell culture.

[0117] Embodiment 3 includes the mammalian cell of embodiment 2, wherein the mammalian cell culture is a suspension culture.

[0118] Embodiment 4 includes the mammalian cell of any one of embodiments 1 to 3, wherein the viral helper genes are adenoviral helper genes.

[0119] Embodiment 5 includes the mammalian cell of embodiment 4, wherein the adenoviral helper genes include the E2A gene and the E4Orf6 gene.

[0120] Embodiment 6 includes the mammalian cell of embodiment 5, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0121] Embodiment 7 includes the mammalian cell of any one of embodiments 1 to 6, wherein the AAV genes include a Rep gene and a Cap gene.

[0122] Embodiment 8 includes the mammalian cell of embodiment 7, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a third derepressible promoter.

[0123] Embodiment 9 comprises the mammalian cell of embodiment 7, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a third derepressible promoter contained within an artificial intron.

[0124] Embodiment 10 includes the mammalian cell of embodiment 8 or 9, wherein the Cap gene is under the control of its native promoter.

[0125] Embodiment 11 comprises the mammalian cell of any one of embodiments 1 to 10, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0126] Embodiment 12 comprises the mammalian cell of embodiment 11, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0127] Embodiment 13 comprises the mammalian cell of any one of embodiments 1 to 12, wherein the repression element is under the control of a constitutive promoter.

[0128] Embodiment 14 comprises the mammalian cell of any one of embodiments 1 to 13, wherein the repression element is a tetracycline repressor protein.

[0129] Embodiment 15 includes the mammalian cell of embodiment 14, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding a tetracycline repressor protein.

[0130] Embodiment 16 comprises the mammalian cell of any one of embodiments 1 to 15, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

[0131] Embodiment 17 includes the mammalian cell of any one of embodiments 1 to 15, wherein the mammalian cell is a human cell.

[0132] Embodiment 18 includes the mammalian cell of embodiment 17, wherein the human cell is a human embryonic kidney (HEK) cell.

[0133] Embodiment 19 comprises the mammalian cell of any one of embodiments 1 to 18, further comprising a nucleic acid molecule comprising two inverted terminal repeat (ITR) sequences.

[0134] Embodiment 20 comprises a mammalian cell according to any one of embodiments 1 to 19, further comprising a nucleic acid molecule encoding a gene of interest.

[0135] Embodiment 21 comprises the mammalian cell of any one of embodiments 1 to 20, further comprising a nucleic acid encoding a virus-associated non-coding RNA under the control of a fourth derepressible promoter.

[0136] Embodiment 22 is a mammalian cell for producing adeno-associated virus (AAV), comprising adenovirus helper genes including E2A and E4Orf6 genes under the control of a first repressible promoter, AAV genes including Rep and Cap genes under the control of a second repressible promoter, and a third repressible promoter. De-suppression The mammalian cell comprises a nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters.

[0137] Embodiment 23 includes the mammalian cell of embodiment 22, wherein the mammalian cell is a mammalian cell culture.

[0138] Embodiment 24 includes the mammalian cell of embodiment 23, wherein the mammalian cell culture is a suspension culture.

[0139] Embodiment 25 comprises the mammalian cell of any one of embodiments 22 to 24, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0140] Embodiment 26 comprises the mammalian cell of any one of embodiments 22 to 25, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.

[0141] Embodiment 27 comprises a mammalian cell according to any one of embodiments 22 to 25, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.

[0142] Embodiment 28 includes the mammalian cell of embodiment 26 or 27, wherein the Cap gene is under the control of its native promoter.

[0143] Embodiment 29 comprises the mammalian cell of any one of embodiments 22 to 28, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0144] Embodiment 30 comprises the mammalian cell of embodiment 29, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0145] Embodiment 31 comprises the mammalian cell of any one of embodiments 22 to 30, wherein the repression element is under the control of a constitutive promoter.

[0146] Embodiment 32 comprises the mammalian cell of any one of embodiments 22 to 31, wherein the repression element is a tetracycline repressor protein.

[0147] Embodiment 33 includes the mammalian cell of embodiment 25, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding a tetracycline repressor protein.

[0148] Embodiment 34 comprises the mammalian cell of any one of embodiments 22 to 33, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

[0149] Embodiment 35 comprises the mammalian cell of any one of embodiments 22 to 33, wherein the mammalian cell is a human cell.

[0150] Embodiment 36 includes the mammalian cell of embodiment 35, wherein the human cell is a human embryonic kidney (HEK) cell.

[0151] Embodiment 37 comprises the mammalian cell of any one of embodiments 22 to 36, further comprising a nucleic acid molecule encoding a gene of interest.

[0152] Embodiment 38 is a vector comprising adenovirus helper genes, including E2A and E4Orf6 genes, under the control of a first repressible promoter, AAV genes, including Rep and Cap genes, under the control of a second repressible promoter, and a third repressible promoter. De-suppression An isolated nucleic acid molecule comprising a virus-associated non-coding RNA under the control of a derepressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters.

[0153] Embodiment 39 comprises the isolated nucleic acid of embodiment 38, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0154] Embodiment 40 comprises the isolated nucleic acid of embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.

[0155] Embodiment 41 comprises the isolated nucleic acid of embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.

[0156] Embodiment 42 comprises the isolated nucleic acid of embodiment 40 or 41, wherein the Cap gene is under the control of its native promoter.

[0157] Embodiment 43 comprises the isolated nucleic acid of any of embodiments 38 to 42, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0158] Embodiment 44 comprises the isolated nucleic acid of embodiment 43, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0159] Embodiment 45 comprises the isolated nucleic acid of any of embodiments 38 to 44, wherein the repression element is under the control of a constitutive promoter.

[0160] Embodiment 46 comprises the isolated nucleic acid of any of embodiments 38 to 45, wherein the repressive element is a tetracycline repressor protein.

[0161] Embodiment 47 comprises the isolated nucleic acid of embodiment 46, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding a tetracycline repressor protein.

[0162] Embodiment 48 comprises the isolated nucleic acid of any of embodiments 38 to 47, further comprising a gene of interest.

[0163] Embodiment 49 is a method of producing adeno-associated virus (AAV) in mammalian cells, comprising: transfecting the mammalian cells with adenovirus helper genes comprising E2A and E4Orf6 genes under the control of a first repressible promoter; AAV genes comprising Rep and Cap genes under the control of a second repressible promoter; and a third repressible promoter. De-suppressiona method for producing AAV comprising transfecting a mammalian cell with an isolated nucleic acid molecule encoding a virus-associated non-coding RNA under the control of a first repressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of a first, second, and third repressible promoter; treating the mammalian cell with a binding partner of the repression elements; activating the first, second, and third repressible promoters; producing AAV; and recovering the AAV.

[0164] Embodiment 50 includes the method of embodiment 49, wherein the mammalian cells are mammalian cell cultures.

[0165] Embodiment 51 includes the method of embodiment 50, wherein the mammalian cell culture is a suspension culture.

[0166] Embodiment 52 includes the method of any one of embodiments 49 to 51, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0167] Embodiment 53 includes the method of any of embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.

[0168] Embodiment 54 includes the method of any of embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.

[0169] Embodiment 55 includes the method of embodiment 54, wherein the fourth derepressible promoter is removed after activation of the derepressible promoter and before production of AAV.

[0170] Embodiment 56 includes the method of embodiment 53 or 54, wherein the Cap gene is under the control of its native promoter.

[0171] Embodiment 57 comprises the method of any of embodiments 49 to 56, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0172] Embodiment 58 includes the method of embodiment 57, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0173] Embodiment 59 comprises the method of any one of embodiments 49 to 58, wherein the repression element is under the control of a constitutive promoter.

[0174] Embodiment 60 is the method of any one of embodiments 49 to 59, wherein the repression element is a tetracycline repressor protein.

[0175] Embodiment 61 includes the method of embodiment 60, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.

[0176] Embodiment 62 includes the method of embodiment 60 or 61, wherein the treating comprises treating with doxycycline.

[0177] Embodiment 63 includes the method of any of embodiments 49 to 62, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

[0178] Embodiment 64 includes the method of any of embodiments 49 to 63, wherein the mammalian cell is a human cell.

[0179] Embodiment 65 includes the method of embodiment 64, wherein the human cells are human embryonic kidney (HEK) cells.

[0180] Embodiment 66 includes the method of any one of embodiments 49 to 65, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.

[0181] Embodiment 67 includes the method of embodiment 66, wherein the AAV comprises a gene of therapeutic interest.

[0182] Embodiment 68 is a method of treating a mammalian cell with adeno-associated virus (AAV), comprising transfecting a mammalian cell with adenovirus helper genes comprising E2A and E4Orf6 genes under the control of a first derepressible promoter, AAV genes comprising Rep and Cap genes under the control of a second derepressible promoter, and a third derepressible promoter. De-suppression and administering the AAV to a mammalian patient.

[0183] Embodiment 69 includes the method of embodiment 68, wherein the mammalian cells are mammalian cell cultures.

[0184] Embodiment 70 includes the method of embodiment 69, wherein the mammalian cell culture is a suspension culture.

[0185] Embodiment 71 includes the method of any of embodiments 68 to 70, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0186] Embodiment 72 includes the method of any of embodiments 68 to 71, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.

[0187] Embodiment 73 includes the method of any of embodiments 68 to 72, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.

[0188] Embodiment 74 includes the method of embodiment 73, wherein the fourth derepressible promoter is removed after activation of the derepressible promoter and before production of AAV.

[0189] Embodiment 75 includes the method of embodiment 73 or 74, wherein the Cap gene is under the control of its native promoter.

[0190] Embodiment 76 includes the method of any of embodiments 68 to 75, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0191] Embodiment 77 includes the method of embodiment 76, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0192] Embodiment 78 comprises the method of any one of embodiments 68 to 77, wherein the repression element is under the control of a constitutive promoter.

[0193] Embodiment 79 is the method of any one of embodiments 68 to 78, wherein the repression element is a tetracycline repressor protein.

[0194] Embodiment 80 includes the method of embodiment 79, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.

[0195] Embodiment 81 includes the method of embodiment 79 or 80, wherein the treating comprises treating with doxycycline.

[0196] Embodiment 82 includes the method of any of embodiments 68-81, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

[0197] Embodiment 83 includes the method of any of embodiments 68 to 82, wherein the mammalian cells are human cells.

[0198] Embodiment 84 includes the method of embodiment 83, wherein the human cells are human embryonic kidney (HEK) cells.

[0199] Embodiment 85 includes the method of any of embodiments 68 to 84, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.

[0200] Embodiment 86 includes the method of embodiment 87, wherein the AAV comprises a gene of therapeutic interest.

[0201] Embodiment 87 includes the method of any of embodiments 68-86, wherein administering comprises inhalation, injection, or intravenous administration.

[0202] Embodiment 88 is a method of producing adeno-associated (AAV) virus, comprising transfecting a mammalian cell stably expressing TetR and / or one or more nucleic acids encoding TetR with a first nucleic acid encoding adenoviral helper genes including the E2A gene, the E4Orf gene, and a virus-associated non-coding RNA under the control of a first derepressible promoter, a second nucleic acid encoding AAV genes including the Rep gene and the Cap gene under the control of a second derepressible promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter, treating the mammalian cell with a binding partner of TetR and / or TetR-KRAB, activating the first, second, and third derepressible promoters, producing AAV, and recovering the AAV.

[0203] Embodiment 89 includes the method of embodiment 88, wherein the mammalian cells are mammalian cell cultures.

[0204] Embodiment 90 includes the method of any of embodiments 88-89, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.

[0205] Embodiment 91 includes the method of any of embodiments 88 to 90, wherein the mammalian cells are human cells.

[0206] Embodiment 92 includes the method of embodiment 91, wherein the human cells are human embryonic kidney (HEK) cells.

[0207] Embodiment 93 includes the method of embodiment 89, wherein the mammalian cell culture is a suspension culture.

[0208] Embodiment 94 includes the method of any of embodiments 88-90, wherein the mammalian cell further comprises an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

[0209] Embodiment 95 comprises the method of any of embodiments 88 to 91, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).

[0210] Embodiment 96 includes the method of embodiment 92, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

[0211] Embodiment 97 includes the method of any of embodiments 88 to 96, wherein the stably expressed TetR and / or TetR-KRAB is under the control of a constitutive promoter.

[0212] Embodiment 98 includes the method of embodiment 97, wherein the nucleic acid encoding TetR-KRAB comprises KRAB fused in-frame with TetR.

[0213] Embodiment 99 includes the method of any one of embodiments 88-98, wherein the treating comprises treating with doxycycline.

[0214] Embodiment 100 includes the method of any one of embodiments 88 to 99, wherein each of the first, second, and third nucleic acids is flanked by transposon-specific inverted terminal repeats (ITRs).

[0215] Embodiment 101 includes the method of any of embodiments 88-100, wherein the mammalian cell expresses a sufficient amount of TetR and / or TetR-KRAB.

[0216] Embodiment 102 includes the method of any of embodiments 88 to 101, wherein the AAV comprises a gene of therapeutic interest.

[0217] Embodiment 103 includes the method of any of embodiments 88-102, wherein the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) flanked by TetR and / or TetR-KRAB repressor sequences.

[0218] Embodiment 104 comprises the method of any of embodiments 88 to 103, wherein the mammalian cells further comprise a zeocin resistance gene.

[0219] Embodiment 105 is a method for producing an adeno-associated virus (AAV), comprising stably transfecting a mammalian cell with a nucleic acid encoding a TetR and / or a TetR-KRAB repressor, chicken hypersensitive site-4 (cHS4) sequences flanking the TetR and / or TetR-KRAB repressor, and a selection gene; and transfecting the stably transfected mammalian cell with an adenovirus helper gene comprising an E2A gene, an E4Orf gene, and a virus-associated non-coding RNA under the control of a first derepressible promoter. a second nucleic acid encoding AAV genes comprising Rep and Cap genes under the control of a second repressible promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third repressible promoter; treating the stably transfected mammalian cells with a binding partner of TetR; activating the first, second, and third repressible promoters; producing AAV; and recovering the AAV.

[0220] Embodiment 106 includes the method of embodiment 105, wherein the stably transfected mammalian cells produce sufficient amounts of TetR.

[0221] Embodiment 107 includes the method of any of embodiments 106 and 107, wherein the KRAB repression domain is fused in-frame with TetR. [Example]

[0222] Example 1: Design and validation of derepressible helper genes To drive the expression of the E2A and E4Orf6 genes, we utilized a derepressible promoter derived from the pcDNA4 / TO vector (INVITROGEN). This promoter contains the complete CMV promoter with two tetracycline operator sequences (TetO2) inserted between the TATA box and the transcription start site (TSS). In the presence of the tetracycline repressor protein (TetR), transcription initiation was blocked by binding of TetR to the TetO2 site. When tetracycline or doxycycline was added to the medium, it bound to TetR and changed its conformation. This resulted in the release of TetR and the derepressible / activation of the CMV promoter, leading to the induction of gene expression (Figure 1 shows the off and on conformations of the TETR / TetO2 derepressible promoter system).

[0223] To simplify the design and improve stability, an internal ribosome entry site (IRES) element was used to initiate translation of E4Orf6 after E2A in a single expression cassette driven by a single inducible CMV promoter (Fig. 1 ).

[0224] To induce VA I non-coding RNA, we used the H1 promoter with TetO2 inserted (see, e.g., Wiederschain et al., "Single-vector inducible lentiviral RNAi system for oncology target validation," Cell Cycle 8:498-504 (2009)). Similarly, addition of doxycycline releases TetR and turns on VA I expression (Figure 1).

[0225] As described above, a TetR gene expression cassette is included for control of a derepressible promoter (see Figure 1). The constitutive human PGK promoter is used to drive expression of TetR, followed by an IRES that directs expression of puromycin N-acetyltransferase, which is used to select for cells that have integrated the transposon (see Figure 2A).

[0226] To reduce potential leaky expression from derepressible promoters, we also included an enhanced form of TetR (see, e.g., Szulc et al., "A versatile tool for conditional gene expression and knockdown," Nature Methods 3:109-116 (2006)). Briefly, the potent repression domain of KRAB was fused in frame to the C-terminus of native TetR, which improves its repression activity and minimizes basal gene expression before induction. To facilitate nuclear entry of the larger TetR-KRAB fusion protein, we also inserted an SV40 nuclear localization signal (NLS) (Figure 2A, Figures S12A-S12B).

[0227] The sequence of the pcDNA3.1-E2A-E4-VA-TetR vector shown in Figure 2A is provided below.

[0228] iHelper1 / pcDNA3.1-E2A-E4-VA-TetR(11,986bp)

[0229]

[0230] The sequence of the pcDNA3.1-E2A-E4-VA-TetR-V2 vector shown in Figure 2B is provided below.

[0231] iHelper2 / pcDNA3.1-E2A-E4-VA-TetR-V2(11,641bp)

[0232]

[0233] We tested all transfer plasmids containing the repressible helper (piHelper1) and TetR expression cassettes for use in AAV production by transient transfection. As shown in Figure 3, when the plasmids were cotransfected with the control pRep-Cap and pAAV-GOI plasmids, the addition of Dox activated AAV production to approximately 30% of the level of the control helper vector, which supports constitutive helper gene expression. Thus, the repressible helper constructs were functional for AAV production upon induction.

[0234] Example 2: Design and validation of a non-repressible Rep-Cap gene The challenge for producing Rep proteins is twofold. First, the ratio of Rep78 to Rep52 needs to be maintained during induction for high-titer AAV production. Second, the p19 promoter required for Rep52 expression is located within the coding region of Rep78, which creates a challenge for including a derepressible promoter. To overcome these challenges, we developed two strategies (Figures 4A-C).

[0235] First, to preserve the natural regulation of Rep gene expression (see Figure 4A), the original viral promoter was retained but modified by inserting two TetO sites around the TATA box and TSS. Two copies of the TetO sites were inserted upstream of a truncated p5 promoter with core elements including a TATA box, a Rep binding element (RBE), and a YY1 site. Additionally, a wild-type copy of the p5 promoter, which functions as an enhancer, was placed downstream of the Cap gene to support both Rep and Cap expression (Figure 5) (see, e.g., U.S. Patent No. 5,622,856).

[0236] The sequence of the derepressible p5 promoter shown in Figure 5 is as follows:

[0237] min-p5-i1 TATTTAATCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 3)

[0238] min-p5-i2 TATTTAAtcTCCCTATCAGTGATAGAGAtcGCCCGAGTGAGCACGCAGGGTCTCCATTTTGATCCCTATCAGTGATAGAGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 4)

[0239] min-p5-i3 TCCCTATCAGTGATAGAGAtcTATTTAAGCCCGAGTGAGCACGCAGTCCCTATCAGTGATAGAGAGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 5)

[0240] Similarly, two copies of the TetO site were also inserted into the p19 promoter next to the TSS site (Figure 6). To minimize the interference of such insertions and maximize the original activity of these viral promoters, three TetO site insertion methods were designed for each promoter for best performance. Therefore, a total of nine variations were examined (iRepCap1 to iRepCap9).

[0241] The sequences of the derepressible promoters, including p19, illustrated in Figure 6, are provided below.

[0242] p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 6)

[0243] p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagTCCCTATCAGTGATAGAGActccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 7)

[0244] p19-i3 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaaTCCCTATCAGTGATAGAGAcagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 8)

[0245] Two methods were developed for the placement of the repressible p19 promoter. In the first method, a separate expression cassette for Rep52 was generated, driven by the repressible p19 promoter. In the first method, shown in Figure 4B, the original p19 promoter in the Rep78 ORF was silenced by changing six nucleotides in three core regulatory elements (SP1, TATA-1, and TATA-2 sites) required for p19 activity. These changes did not alter the Rep78 protein sequence. Rep78 was controlled by the repressible p5 promoter.

[0246] In the second method, an artificial intron was created for the insertion of a TetO site in the Rep78 ORF (Figure 4C). A chimeric intron between an intron from human β-globin and an immunoglobulin heavy chain gene was adapted by replacing non-essential internal sequences with a TetO site (Figure 7A). The new artificial intron was inserted in situ 1 bp or 25 bp downstream of the TATA-2 site of the p19 promoter (iRepCap-10 and iRepCap11) (Figure 4B and Figure 7B). The new p19 promoter with an adjacent TetO-containing intron ensured the suppression of Rep52 gene expression before induction while also allowing the expression of Rep78 protein after intron removal during mRNA splicing. Splicing efficiency was assessed by PCR analysis of cDNA.

[0247] The nucleic acid sequence of the intron-based p19 promoter illustrated in Figures 7A-7B is provided below.

[0248] In-p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagt atttaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacagcgcctgtttgaatctcacggag (SEQ ID NO: 9)

[0249] In-p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagta tttaagcgcctgtttgaatctcacggaaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacag (SEQ ID NO: 10)

[0250] To test the activity of 11 inducible Rep-Cap designs, HEK293 cells were transfected with one of the vectors as well as standard pHelper and pAAV-GFP for AAV production. Three days after transfection, cells were harvested for Rep-Cap protein expression and AAV titer analysis. Western blot analysis revealed variable expression levels of Rep and Cap proteins, with many maintaining a similar Rep78 to Rep52 ratio as the control RepCap vector (Figure 8A). qPCR analysis of AAV titer indicated that the designs performed similarly to or had higher titers than the control triple transfection (Figure 8B).

[0251] To test the performance of both the inducible helper and inducible Rep-Cap designs together, HEK293 cells were transfected with selected iRepCap vectors, iHelper1 / 2, and pAAV-GFP and either untreated or treated with doxycycline for 3 days. As shown in Figure 9A, Rep and Cap protein expression was induced only by the addition of Dox and derepression of the derepressible promoter. Accordingly, AAV titers significantly increased by more than 10- to 25-fold upon derepression (Figure 9B).

[0252] To stably integrate iHelper and iRepCap, iHelper1 / 2 and iRepCap10 were selected along with AAV-GFP, and functional cassettes were assembled into a single PIGGYBAC™ transposon transfer vector PB007 (Transposagen, Inc., Lexington, KY). Figures 10A-10D show the plasmid constructs used for integration into mammalian cells, preferably HEK293 cells. To facilitate the future addition of specific AAV genes of interest, some of the transfer vectors did not contain AAV-GFP (Figures 10A and 10B). HEK293 cells were transfected with both the transfer vector and transposase mRNA, and the pool of integrated cells was enriched by puromycin selection. Single-cell clones were isolated and screened for AAV production with or without Dox treatment to activate derepression.

[0253] The nucleic acid sequence of the vector shown in Figure 10A is provided below.

[0254] PB007-iHelper1-iRepCap10 / PBBG7(18,281bp)

[0255] The sequence of the vector depicted in Figure 10B is provided below.

[0256] PB007-iHelper2-iRepCap10 / PBBG8(17,936bp)

[0257] The sequence of the vector depicted in Figure 10C is provided below.

[0258] PB007-iHelper1-iRepCap10-AAV-GFP / PBBG9(21,391bp) AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT (SEQ ID NO: 13)

[0259] The sequence of the vector depicted in Figure 10D is provided below.

[0260] PB007-iHelper2-iRepCap10-AAV-GFP / PBBG10(21,046bp) (SEQ ID NO: 14)

[0261] Additional vector sequences for use in practicing the present invention:

[0262] iRepCap1 / pKan-Anc80-RepCap-p5i1-p19i1(10,497bp)

[0263] agtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 15)

[0264] iRepCap2 / pKan - Anc80 - RepCap - p5i2 - p19i1 (10,495bp)

[0265] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 16)

[0266] iRepCap3 / pKan - Anc80 - RepCap - p5i3 - p19i1(10,493bp)

[0267] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 17)

[0268] iRepCap4 / pKan - Anc80 - RepCap - p5i1 - p19i2 (10,495bp)

[0269] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 18)

[0270] iRepCap5 / pKan - Anc80 - RepCap - p5i2 - p19i2 (10,493bp)

[0271] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 19)

[0272] iRepCap6 / pKan - Anc80 - RepCap - p5i3 - p19i2 (10,491bp)

[0273] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 20)

[0274] iRepCap7 / pKan - Anc80 - RepCap - p5i1 - p19i3 (10,495bp)

[0275] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 21)

[0276] iRepCap8 / pKan - Anc80 - RepCap - p5i2 - p19i3 (10,493bp)

[0277] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 22)

[0278] iRepCap9 / pKan - Anc80 - RepCap - p5i3 - p19i3 (10,491bp)

[0279] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 23)

[0280] iRepCap10 / pKan - Anc80 - Intron - induced RepCap (7,567 bp)

[0281]

[0282] iRepCap11 / pKan-Anc80-intron-inducible RepCap-d2 (7,567 bp)

[0283]

[0284] The sequence of the PBBG-iHelper-Puro construct shown in Figure 11A is shown below:

[0285] PBBG-iHelper-Puro (11,801bp)

[0286]

[0287] The sequence of the PBBG-ITRGFP construct shown in Figure 11B is shown below:

[0288] PBBG-ITRGFP (7,798 bp)

[0289]

[0290] The sequence of the PBBG-iRC8 construct shown in Figure 11C is shown below:

[0291] PBBG-iRC8 (9,399 bp)

[0292]

[0293] The sequence of the PBBG-iRC9 construct shown in Figure 11D is shown below:

[0294] PBBG-iRC9 (9,393 bp)

[0295]

[0296] The sequence of the PBBG-Anc80iRC construct shown in Figure 11E is shown below:

[0297] PBBG-Anc80iRC (9,393 bp)

[0298]

[0299] The sequence of the pcDNA-TetR-In construct shown in Figure 12A is shown below:

[0300] pcDNA-TetR-In(7147bp)

[0301]

[0302] The sequence of the pcDNA-TetR-KRAB-Ins construct shown in Figure 12B is shown below:

[0303] pcDNA-TetR-KRAB-Ins(7493bp)

[0304]

[0305] It will be readily apparent to those skilled in the relevant art that other suitable modifications and adaptations to the methods and applications described herein can be made without departing from the scope of any of the embodiments.

[0306] Although particular embodiments have been illustrated and described herein, it is to be understood that the claims should not be limited to the specific forms or arrangements of parts described and shown. Although exemplary embodiments are disclosed and specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation. Modifications and variations of the embodiments are possible in light of the above teachings. It is therefore to be understood that the embodiments may be practiced otherwise than as specifically described.

[0307] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. The present invention may have the following aspects. Item 1 A mammalian cell for producing adeno-associated virus (AAV), comprising: a. a nucleic acid molecule encoding a viral helper gene under the control of a first repressible promoter; b. a nucleic acid molecule encoding an AAV gene under the control of a second repressible promoter; and c. a nucleic acid molecule encoding the repression elements of said first and second derepressible promoters. Item 2 2. The mammalian cell of item 1, wherein the mammalian cell is a mammalian cell culture. Item 3 3. The mammalian cell according to item 2, wherein the mammalian cell culture is a suspension culture. Item 4 4. The mammalian cell according to any one of items 1 to 3, wherein the viral helper gene is an adenoviral helper gene. Item 5 5. The mammalian cell according to item 4, wherein the adenovirus helper genes include the E2A gene and the E4Orf6 gene. Item 6 6. The mammalian cell of item 5, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 7 7. The mammalian cell of any one of items 1 to 6, wherein the AAV genes comprise a Rep gene and a Cap gene. Item 8 8. The mammalian cell of item 7, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a third derepressible promoter. Item 9 8. The mammalian cell according to item 7, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a third derepressible promoter contained within an artificial intron. Item 10 10. The mammalian cell according to item 8 or 9, wherein the Cap gene is under the control of its native promoter. Item 11 Each of the derepressible promoters contains a functional promoter and two tetracycline operator sequences (TetO 2 11. The mammalian cell according to any one of items 1 to 10, comprising: Item 12 12. The mammalian cell of item 11, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 13 13. The mammalian cell according to any one of items 1 to 12, wherein the repression element is under the control of a constitutive promoter. Item 14 14. The mammalian cell according to any one of items 1 to 13, wherein the repression element is a tetracycline repressor protein. Item 15 15. The mammalian cell of item 14, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein. Item 16 16. The mammalian cell according to any one of items 1 to 15, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell. Item 17 16. The mammalian cell according to any one of items 1 to 15, wherein the mammalian cell is a human cell. Item 18 18. The mammalian cell of item 17, wherein the human cell is a human embryonic kidney (HEK) cell. Item 19 19. The mammalian cell of any one of items 1 to 18, further comprising a nucleic acid molecule comprising two inverted terminal repeat (ITR) sequences. Item 20 20. The mammalian cell of any one of items 1 to 19, further comprising a nucleic acid molecule encoding a gene of interest. Item 21 21. The mammalian cell of any one of items 1 to 20, further comprising a nucleic acid encoding a virus-associated non-coding RNA under the control of a fourth derepressible promoter. Item 22 A mammalian cell for producing adeno-associated virus (AAV), comprising: a. i. adenoviral helper genes including the E2A gene and the E4Orf6 gene under the control of a first repressible promoter; ii. AAV genes, including the Rep and Cap genes, under the control of a second derepressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; and iv. two inverted terminal repeat (ITR) sequences; v. A mammalian cell comprising a nucleic acid molecule encoding repression elements of said first, second, and third derepressible promoters. Item 23 23. The mammalian cell according to item 22, wherein the mammalian cell is a mammalian cell culture. Item 24 24. The mammalian cell according to item 23, wherein the mammalian cell culture is a suspension culture. Item 25 25. The mammalian cell of any one of items 22 to 24, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 26 26. The mammalian cell of any one of items 22 to 25, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter. Item 27 26. The mammalian cell according to any one of items 22 to 25, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron. Item 28 28. The mammalian cell according to item 26 or 27, wherein the Cap gene is under the control of its native promoter. Item 29 Each of the derepressible promoters contains a functional promoter and two tetracycline operator sequences (TetO 2 29. The mammalian cell according to any one of items 22 to 28, comprising: Item 30 30. The mammalian cell of item 29, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 31 31. The mammalian cell according to any one of items 22 to 30, wherein the repression element is under the control of a constitutive promoter. Item 32 32. The mammalian cell according to any one of items 22 to 31, wherein the repression element is a tetracycline repressor protein. Item 33 26. The mammalian cell of item 25, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein. Item 34 34. The mammalian cell according to any one of items 22 to 33, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell. Item 35 34. The mammalian cell according to any one of items 22 to 33, wherein the mammalian cell is a human cell. Item 36 36. The mammalian cell of item 35, wherein the human cell is a human embryonic kidney (HEK) cell. Item 37 37. The mammalian cell of any one of items 22 to 36, further comprising a nucleic acid molecule encoding a gene of interest. Item 38 a. adenoviral helper genes including the E2A gene and the E4Orf6 gene under the control of a first repressible promoter; b. AAV genes, including the Rep and Cap genes, under the control of a second repressible promoter; c. a virus-associated non-coding RNA under the control of a third repressible promoter; and d. two inverted terminal repeat (ITR) sequences; e. An isolated nucleic acid molecule encoding the repression elements of said first, second, and third derepressible promoters. Item 39 39. The isolated nucleic acid of item 38, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 40 40. The isolated nucleic acid of item 38 or 39, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter. Item 41 40. The isolated nucleic acid of item 38 or 39, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron. Item 42 42. The isolated nucleic acid of item 40 or 41, wherein the Cap gene is under the control of its native promoter. Item 43 43. The isolated nucleic acid of any one of items 38 to 42, wherein each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2). Item 44 44. The isolated nucleic acid of item 43, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 45 45. The isolated nucleic acid of any one of items 38 to 44, wherein the repression element is under the control of a constitutive promoter. Item 46 46. ​​The isolated nucleic acid of any one of items 38 to 45, wherein the repression element is a tetracycline repressor protein. Item 47 47. The isolated nucleic acid of claim 46, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein. Item 48 48. The isolated nucleic acid of any one of items 38 to 47, further comprising a gene of interest. Item 49 1. A method for producing adeno-associated virus (AAV) in mammalian cells, comprising: a. The mammalian cell i. adenoviral helper genes including the E2A gene and the E4Orf6 gene under the control of a first repressible promoter; ii. AAV genes, including the Rep and Cap genes, under the control of a second derepressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; and iv. two inverted terminal repeat (ITR) sequences; v. transfecting with an isolated nucleic acid molecule encoding the repression elements of the first, second, and third derepressible promoters; b. treating the mammalian cells with a binding partner of the inhibitory element; c. activating the first, second, and third derepressible promoters; d. Producing the AAV; e. Recovering the AAV. Item 50 50. The method of claim 49, wherein the mammalian cells are mammalian cell cultures. Item 51 51. The method of claim 50, wherein the mammalian cell culture is a suspension culture. Item 52 52. The method of any one of items 49 to 51, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 53 53. The method according to any one of items 49 to 52, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter. Item 54 53. The method according to any one of items 49 to 52, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron. Item 55 55. The method of claim 54, wherein the fourth derepressible promoter is removed after the activation of the derepressible promoter and before the production of the AAV. Item 56 55. The method of claim 53 or 54, wherein the Cap gene is under the control of its native promoter. Item 57 Each of the derepressible promoters contains a functional promoter and two tetracycline operator sequences (TetO 2 57. The method according to any one of items 49 to 56, comprising: Item 58 58. The method of claim 57, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 59 59. The method of any one of items 49 to 58, wherein the repression element is under the control of a constitutive promoter. Item 60 60. The method of any one of items 49 to 59, wherein the repression element is a tetracycline repressor protein. Item 61 61. The method of claim 60, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein. Item 62 62. The method of item 60 or 61, wherein the treatment comprises treating with doxycycline. Item 63 63. The method according to any one of items 49 to 62, wherein the mammalian cells are Chinese hamster ovary (CHO) cells. Item 64 64. The method according to any one of items 49 to 63, wherein the mammalian cells are human cells. Item 65 65. The method of claim 64, wherein the human cells are human embryonic kidney (HEK) cells. Item 66 66. The method of any one of items 49 to 65, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest. Item 67 67. The method of item 66, wherein the AAV comprises a gene of therapeutic interest. Item 68 A method of treatment with adeno-associated virus (AAV), comprising: a. The mammalian cell i. adenoviral helper genes including the E2A gene and the E4Orf6 gene under the control of a first repressible promoter; ii. AAV genes, including the Rep and Cap genes, under the control of a second derepressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; and iv. two inverted terminal repeat (ITR) sequences; v. transfecting with an isolated nucleic acid molecule encoding the repression elements of the first, second, and third derepressible promoters; b. treating the mammalian cells with a binding partner of the inhibitory element; c. activating the first, second, and third derepressible promoters; d. Producing the AAV; e. recovering the AAV; f. Administering the AAV to a mammalian patient. Item 69 69. The method of claim 68, wherein the mammalian cells are mammalian cell cultures. Item 70 70. The method of claim 69, wherein the mammalian cell culture is a suspension culture. Item 71 71. The method of any one of items 68 to 70, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 72 72. The method of any one of items 68 to 71, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter. Item 73 73. The method according to any one of items 68 to 72, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron. Item 74 74. The method of claim 73, wherein the fourth derepressible promoter is removed after the activation of the derepressible promoter and before the production of the AAV. Item 75 75. The method of item 73 or 74, wherein the Cap gene is under the control of its native promoter. Item 76 Each of the derepressible promoters contains a functional promoter and two tetracycline operator sequences (TetO 2 76. The method according to any one of items 68 to 75, comprising: Item 77 77. The method of claim 76, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 78 78. The method of any one of items 68 to 77, wherein the repression element is under the control of a constitutive promoter. Item 79 79. The method of any one of items 68 to 78, wherein the repression element is a tetracycline repressor protein. Item 80 80. The method of claim 79, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein. Item 81 81. The method of item 79 or 80, wherein the treatment comprises treating with doxycycline. Item 82 82. The method according to any one of items 68 to 81, wherein the mammalian cells are Chinese hamster ovary (CHO) cells. Item 83 83. The method according to any one of items 68 to 82, wherein the mammalian cells are human cells. Item 84 84. The method of claim 83, wherein the human cells are human embryonic kidney (HEK) cells. Item 85 85. The method of any one of items 68 to 84, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest. Item 86 86. The method of item 85, wherein the AAV comprises a gene of therapeutic interest. Item 87 87. The method of any one of items 68 to 86, wherein the administering comprises inhalation, injection, or intravenous administration. Item 88 1. A method for producing adeno-associated virus (AAV), comprising: a. A mammalian cell stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB, i. a first nucleic acid encoding adenoviral helper genes, including the E2A gene, the E4Orf gene, and a virus-associated non-coding RNA, under the control of a first repressible promoter; ii. a second nucleic acid encoding AAV genes, including the Rep and Cap genes, under the control of a second derepressible promoter; iii. a third nucleic acid encoding a gene of interest, optionally under the control of a third derepressible promoter; b. treating the mammalian cells with a binding partner of the TetR; c. activating the first, second, and third derepressible promoters; d. Producing the AAV; e. Recovering the AAV. Item 89 89. The method of claim 88, wherein the mammalian cells are mammalian cell cultures. Item 90 90. The method of claim 88 or 89, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell. Item 91 91. The method according to any one of items 88 to 90, wherein the mammalian cells are human cells. Item 92 92. The method of claim 91, wherein the human cells are human embryonic kidney (HEK) cells. Item 93 90. The method of claim 89, wherein the mammalian cell culture is a suspension culture. Item 94 91. The method of any one of items 88 to 90, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Item 95 Each of the derepressible promoters contains a functional promoter and two tetracycline operator sequences (TetO 2 92. The method according to any one of items 88 to 91, comprising: Item 96 Item 96. The method of item 95, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter. Item 97 97. The method of any one of items 88 to 96, wherein the TetR and / or TetR-KRAB is under the control of a constitutive promoter. Item 98 98. The method of item 97, wherein the nucleic acid encoding the TetR-KRAB comprises KRAB fused in-frame with the TetR. Item 99 99. The method of any one of items 88 to 98, wherein the treatment comprises treating with doxycycline. Item 100 99. The method of any one of items 88 to 99, wherein each of the first, second, and third nucleic acids is flanked by transposon-specific inverted terminal repeats (ITRs). Item 101 101. The method of any one of items 88 to 100, wherein the mammalian cell expresses a sufficient amount of TetR and / or TetR-KRAB. Item 102 102. The method of any one of items 88 to 101, wherein the AAV comprises a gene of therapeutic interest. Item 103 103. The method of any one of items 88-102, wherein the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) flanked by the TetR and / or TetR-KRAB repressor sequences. Item 104 104. The method of any one of items 88 to 103, wherein the mammalian cell further comprises a selection gene. Item 105 1. A method for producing an adeno-associated virus (AAV), comprising: a. mammalian cells a nucleic acid encoding a TetR and / or TetR-KRAB repressor; chicken hypersensitive site-4 (cHS4) sequences flanking the TetR and / or TetR-KRAB repressor; stably transfecting the cells with a selection gene; b. The stably transfected mammalian cells i. a first nucleic acid encoding adenoviral helper genes, including the E2A gene, the E4Orf gene, and a virus-associated non-coding RNA, under the control of a first repressible promoter; ii. a second nucleic acid encoding AAV genes, including the Rep and Cap genes, under the control of a second derepressible promoter; iii. optionally, a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter; c. treating the stably transfected mammalian cells with a binding partner of the TetR; d. activating the first, second, and third derepressible promoters; e. Producing the AAV; f. Recovering the AAV. Item 106 106. The method of claim 105, wherein the stably transfected mammalian cells produce sufficient amounts of TetR. Item 107 107. The method of claim 105 or 106, wherein the KRAB repression domain is fused in-frame with the TetR.

Claims

1. A mammalian cell for producing adeno-associated virus (AAV), comprising: a. i. adenoviral helper genes, including E2A and E4Orf6 genes, under the control of a first repressible promoter; ii. AAV genes including Rep and Cap genes under the control of a second repressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; and iv. two inverted terminal repeat (ITR) sequences; v. A mammalian cell comprising a nucleic acid molecule encoding repression elements of said first, second, and third derepressible promoters.

2. The mammalian cell of claim 1 , wherein the mammalian cell is a mammalian cell culture.

3. The mammalian cell of claim 2 , wherein the mammalian cell culture is a suspension culture.

4. The mammalian cell according to any one of claims 1 to 3, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

5. 5. The mammalian cell according to claim 1, wherein the Rep78 gene is under the control of the second repressible promoter and the Rep52 gene is under the control of a fourth repressible promoter.

6. 5. The mammalian cell according to any one of claims 1 to 4, wherein the Rep78 gene is under the control of the second repressible promoter and the Rep52 gene is under the control of a fourth repressible promoter contained within an artificial intron.

7. The mammalian cell of claim 5 or 6, wherein the Cap gene is under the control of a native promoter.

8. Each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO ２ The mammalian cell according to any one of claims 1 to 7, comprising:

9. 9. The mammalian cell of claim 8, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

10. The mammalian cell according to any one of claims 1 to 9, wherein the repression element is under the control of a constitutive promoter.

11. The mammalian cell according to any one of claims 1 to 10, wherein the repression element is a tetracycline repressor protein.

12. The mammalian cell of claim 11, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.

13. The mammalian cell according to any one of claims 1 to 12, wherein the mammalian cell is a Chinese Hamster Ovary (CHO) cell.

14. The mammalian cell according to any one of claims 1 to 12, wherein the mammalian cell is a human cell.

15. 15. The mammalian cell of claim 14, wherein the human cell is a human embryonic kidney (HEK) cell.

16. The mammalian cell according to any one of claims 1 to 15, further comprising a nucleic acid molecule encoding a gene of interest.

17. 1. An in vitro method for producing adeno-associated virus (AAV) in mammalian cells, comprising: a. the mammalian cell, i. adenoviral helper genes, including E2A and E4Orf6 genes, under the control of a first repressible promoter; ii. AAV genes including Rep and Cap genes under the control of a second repressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; and iv. two inverted terminal repeat (ITR) sequences; v. transfecting with an isolated nucleic acid molecule encoding a repression element of said first, second, and third derepressible promoters; b. treating the mammalian cell with a binding partner of the inhibitory element; c. activating the first, second, and third derepressible promoters; d. Producing the AAV; e. recovering the AAV.

18. 20. The method of claim 17, wherein the mammalian cells are in mammalian cell culture.

19. 20. The method of claim 18, wherein the mammalian cell culture is a suspension culture.

20. The method of any one of claims 17 to 19, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.

21. The method according to any one of claims 17 to 20, wherein the Rep78 gene is under the control of said second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.

22. 21. The method according to any one of claims 17 to 20, wherein the Rep78 gene is under the control of said second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.

23. 23. The method of claim 22, wherein said fourth derepressible promoter is removed after said activation of said derepressible promoter and prior to said production of said AAV.

24. 23. The method of claim 21 or 22, wherein the Cap gene is under the control of its native promoter.

25. Each of the derepressible promoters comprises a functional promoter and two tetracycline operator sequences (TetO ２ 25. The method of claim 17, comprising:

26. 26. The method of claim 25, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.

27. The method according to any one of claims 17 to 26, wherein the repression element is under the control of a constitutive promoter.

28. The method of any one of claims 17 to 27, wherein the repression element is a tetracycline repressor protein.

29. 30. The method of claim 28, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.

30. 30. The method of claim 28 or 29, wherein the treatment comprises treating with doxycycline.

31. The method of any one of claims 17 to 30, wherein the mammalian cell is a Chinese Hamster Ovary (CHO) cell.

32. The method according to any one of claims 17 to 31, wherein the mammalian cell is a human cell.

33. 33. The method of claim 32, wherein the human cell is a human embryonic kidney (HEK) cell.

34. The method of any one of claims 17 to 33, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.

35. 35. The method of claim 34, wherein the AAV comprises a gene of therapeutic interest.

Images